RU2630669C1 - Method for determination of methylation of colorectal cancer tumor marker genes regulatory regions pucgpy sites by glad-pcr analysis, and set of oligonucleotide primers and fluorescence-labelled probes for implementation of this method - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: group of inventions is described including a set of oligonucleotide primers and fluorescence-labelled probes for identification of colon and rectum malignant lesions by analyzing RCGY sites methylation in the DNA samples in the specified positions of the regulatory regions of the tumor marker genes by the GLAD-PCR method and a method for identification of colon and rectum malignant lesion by RCGY sites methylation analysis in DNA samples of in the specified positions of regulatory regions of tumor marker genes by the GLAD-PCR method. This method involves formation of a colorectal cancer tumor marker gene panel: ADHFE1, ALX4, CNRIP1, EID3, ELMO1, ESR1, FBN1, HLTF, LAMA1, NEUROG1, NGFR, RARB, RXRG, RYR2, SDC2, SEPT9, SFRP2, SOCS3, SOX17, THBD , TMEFF2, UCHL1 and VIM.

EFFECT: invention expands the arsenal of oligonucleotide primers and fluorescence-labelled primers.

2 cl, 3 dwg, 4 tbl, 3 ex, 1 app

Description

The invention relates to the field of molecular biology, biotechnology and medicine, and can be used in molecular genetic diagnosis of cancer and to evaluate the effectiveness of anti-cancer therapy, namely for the analysis of methylation of tumor markers of colorectal cancer in samples of biological material.

A promising tool for molecular genetic diagnosis and monitoring of cancer is epigenetic diagnosis, that is, the identification of the disease by identifying epigenetic markers. Epigenetic markers are chemical groups that attach to human genomic DNA (methylation of cytosine bases to form 5-methylcytosine, 5mC) or to histone complexes associated with it and affect the functional activity of genes. The most common epigenetic disorder in carcinogenesis is local hypermethylation of individual DNA regions, the so-called CpG islands, in the regulatory regions of cancer suppressor genes, which are normally devoid of methyl groups. It has now been shown that such aberrant methylation is characteristic of the initial stages of most non-hereditary (sporadic) forms of cancer, which on average account for more than 90% of all cases of malignant neoplasms.

To carry out the epigenetic diagnosis of malignant neoplasms, two key issues need to be addressed:

a) what detection method should be used to determine the methylation status of genes;

b) methylation of regulatory regions of which genes is associated with a specific cancer?

To solve the first question, namely, to analyze the status of gene methylation, a number of methods are used that can be divided into four groups.

The first group of methods is based on bisulfite conversion of DNA, entailing changes in its nucleotide composition. Subsequently, the desired region of the converted genome can be amplified by PCR and sequenced to determine all methylated cytosine residues. If the researcher is interested in the methylation status of a particular CG dinucleotide, then simpler methods of analysis are used. So, it is possible to carry out methyl-sensitive PCR (another term used is “methyl-specific PCR”), in which two reactions are carried out using primers selected for cases of passage or failure of conversion in the studied dinucleotide. Another widely used method for determining methylation is the treatment of converted DNA with restriction endonucleases (COBRA method based on the appearance or disappearance of enzyme recognition sites in altered DNA). The disadvantages of the described methods include significant degradation and significant loss of nucleic acids during bisulfite conversion, which makes it difficult to analyze a small amount of material, the complexity, the cost of the study and the significant investment of time [Umer M, Herceg Z. Deciphering the epigenetic code: an overview of DNA methylation analysis methods // Antioxid Redox Signal. - 2013. - V. 18. - P. 1972-1986].

The second group of methods includes DNA hydrolysis procedures with methyl-sensitive endonucleases. Analysis of gene methylation status is based on the fact that these restriction enzymes are not able to recognize and cleave sequences containing methylated CG sites (for example, the HpaII enzyme that recognizes and hydrolyzes only unmethylated CCGG tetranucleotide). The results of the hydrolysis reaction can be analyzed by PCR with flanking primers. A significant limitation for the widespread use of these methods is the relatively small number of known restriction endonucleases that recognize sequences containing CG dinucleotides and are sensitive to methylation of cytosine residues in them [Shen L, Waterland RA. Methods of DNA methylation analysis // Curr Opin Clin Nutr Metab Care. - 2007. - V. 10. - P. 576-581]. This approach also does not allow the detection of partially methylated DNA, whereas just such a pattern of methylation of CpG islands is characteristic of the earliest stages of carcinogenesis. In addition, the use of these methods places higher demands on both the purity of the analyzed DNA and the quality of the study at all stages, since the conclusion about the presence of methylation in these methods is made in the absence of DNA hydrolysis by methyl-sensitive restriction endonucleases. However, underhydrolysis of DNA can occur in the presence of contamination or violation of the conditions of analysis. This leads to false conclusions about the presence of methylation and, as a consequence, to a false-positive diagnosis.

The third group of methods is based on the use of methyl binding domain containing proteins (MBD proteins) to isolate methylated DNA and its subsequent amplification. For example, MethylMeter technology developed by specialists of the American company RiboMed (Canadian patent No. 2724343, publ. May 15, 2008) is known, which allows achieving high sensitivity and specificity. This technology is used by manufacturers of some test systems, for example, G-CIMP DecisionDX of the American company Castle Biosciences. To protect this test system, US application No. 2014272986 was published, published September 18, 2014. However, such methods remain very time-consuming, and a clear and quantitative analysis of the results requires sophisticated and expensive equipment.

The fourth group of methods is based on the use of site-specific methyl-dependent DNA endonucleases. After their discovery and the start of commercial production of their preparations, it became possible to use this new class of enzymes in epigenetic studies. Unlike conventional restriction endonucleases, methyl-dependent enzymes recognize only methylated DNA sequences, which makes them another convenient tool for studying the methylation status of genes. The enzymes of this class include the endonucleases GlaI, BisI, BlsI, MteI and several others [http://russia.sibenzyme.com/products/m2_type], produced in Russia by SibEnzyme LLC.

Due to the coincidence of the DNA sequence, which is the product of de novo methylation, and the substrate specificity of the GlaI enzyme, the researchers of SibEnzyme LLC developed a method called GLAD-PCR (GlaI hydrolysis and Ligation Adapter Dependent PCR), which allows to determine the presence of R (5mC) GY sites in the studied DNA region [Kuznetsov V.V. et al. The method for determining the nucleotide sequence of Pu (5mC) GPy in a given position of extended DNA // RF Patent No. 2525710 C1, publ. 08/20/2014, Bull. No. 23]. The method involves hydrolysis of DNA with GlaI enzyme, attachment of a specific adapter to the ends of the hydrolyzed DNA, and subsequent real-time PCR reaction from the primers surrounding the target DNA region. The method makes it possible to determine the presence of one or several Pu (5mC) GPy sites inside the studied DNA fragment. Thus, the GLAD-PCR method can be used to determine the methylation status of regulatory regions of genes.

This method has a number of advantages, consisting in simplicity of execution, the ability to detect only methylated sites in complex mixtures of DNA, and the ability to quantify their number. It should also be noted that the method has considerable versatility and can be used to analyze any complex mixtures of DNA, for example, DNA from tumors containing nucleic acids not only from malignant, but also from normal cells (vascular cells, connective tissue, etc.). ) Testing of GLAD-PCR showed that the method is highly sensitive, allowing the detection of methylated sites in highly diluted solutions.

The indicated method is a universal method for detecting methylation of R (5mC) GY sites, which allows one to form and describe a specific gene panel specific for, for example, colorectal cancer. But in the description of the method itself, there are no gene panels specific for various types of oncology.

Colon and rectal cancer (colorectal cancer) is one of the most common types of malignant neoplasms. In the developed countries of the world, more than a million cases of this disease are diagnosed annually, and the mortality from cancer of this localization is more than 33% even in countries with a high level of cancer care [Walther A. et al. Genetic prognostic and predictive markers in colorectal cancer // Nat. Rev. Cancer - 2009. - V. 9. - P. 489-499]. As in the case of most other oncological diseases, the detection of this type of cancer in the early stages largely determines the success of treatment, which is why the development of sensitive molecular genetic, including epigenetic, methods for diagnosing colorectal cancer is undoubtedly an urgent task. However, the initial stages of the pathology of the internal organs are often not accompanied by anomalies determined by external examination or by patients who feel impaired body functions, which makes early diagnosis in these cases extremely difficult. Thus, the use of biochemical and genetic analyzes for the diagnosis of colorectal cancer is the preferred method for detecting the disease, especially since such diagnosis is possible at an asymptomatic stage [Gyparaki MT, Basdra EK, Papavassiliou AG. DNA methylation biomarkers as diagnostic and prognostic tools in colorectal cancer // J Mol Med (Berl). - 2013. - V. 91. - P. 1249-1256].

To develop an appropriate diagnostic system, it is necessary to find the answer to the second question: methylation of regulatory regions of which genes is associated with the development of colorectal cancer?

One of the first large-scale work on the search for marker genes for the epigenetic diagnosis of colorectal cancer was carried out in 2008 by Epigenomics AG (Germany) [Lofton-Day C et al. DNA methylation biomarkers for blood-based colorectal cancer screening // Clin Chem. - 2008. - V. 54. - P. 414-423]. At the first stage of the work, methyl-sensitive restriction enzymes were used to analyze more than 600 candidate fragments of genomic DNA isolated from tumors and normal tissue. 56 DNA sections were selected that significantly differed in the degree of methylation in healthy and malignant cells. Further, these sites were additionally tested on microarrays and in real-time PCR. This reduced the number of genes most suitable for use as epigenetic markers of colorectal cancer to seven (SEPT9, NGFR, TMEFF2, ALX4, EYA4, FOXL2, SIX6).

In the future, a large number of authors published the results of their studies on tumor marker genes for the epigenetic diagnosis of colorectal cancer, carried out by various methods, including such modern approaches as the use of DNA microarrays (for example, Infinium HumanMethylation, Illumina, USA), limited (RRBS, Reduced Representation Bisulfite Sequencing) and genome-wide bisulfite sequencing (WGBS, Whole Genome Bisulphite Sequencing) with next generation sequencing systems (Next Generation Sequencing, NGS) [Reinders J. et al. // Epigenomics. - 2010. - V. 2. - P. 209-220; Kaneda A., Yagi K. // Cancer Sci. - 2011. - V. 102. - P. 18-24; Kibriya M.G. et al. // BMC Med Genomics. - 2011 .-- 4:50; Kim Y.H. et al. // Ann Surg Oncol. - 2011. - V. 18. - P. 2338-2347; Gu H. et al. // Nat Protoc. - 2011. - V. 6. - P. 468-481; Yi J.M. et al. // Tumour Biol. - 2012. - V. 33. - P. 363-372; Hinoue T. et al. // Genome Res. - 2012. - V. 22. - P. 271-282; Lange C.P. et al. // PLoS One. - 2012 .-- 7: e50266; Li H. et al. // Oncol Rep. - 2012. - V. 28. - P. 99-104; Roperch J.P. et al. // BMC Cancer. - 2013 .-- P. 13-566; Naumov V.A. // Epigenetics. - 2013. - V. 8. - P. 921-934; Chen Y.A. et al. // Epigenetics. - 2013. - V. 8. - P. 203-209; Harper K.N. et al. // Cancer Epidemiol Biomarkers Prev. - 2013. - V. 22. - P. 1052-1060; Mitchell S.M. et al. // BMC Cancer. - 2014 .-- P. 14-54; Melson J. et al. // Int J Cancer. - 2014 .-- V. 134. - P. 2656-2662; Papadia C. et al. // Inflamm Bowel Dis. - 2014. - V. 20. - P. 271-277].

Some of the detected tumor markers are already used in commercial test systems for the diagnosis of colorectal cancer. In 2008-2012, Epigenomics AG (Germany) developed and patented the Epi proColon kit 2.0 test system for the diagnosis of colorectal cancer (international application No. WO2005001142, published on January 6, 2005; US application No. 2014179563, published 06/26/2014) based on the detection of a specific epigenetic marker SEPT9 in peripheral blood [Heichman KA. Blood-based testing for colorectal cancer screening // Mol Diagn Ther. 2014. - V. 18. - P. 127-135]. Methylation of another gene (VIM, vimentin) in malignant cells served as the basis for creating the ColoGuard assay test system from LabCorp (USA) [Lao VV, Grady WM. Epigenetics and colorectal cancer // Nat Rev Gastroenterol Hepatol. - 2011. - V. 8. - P. 686-700]. However, such mono-test systems are not intended to make a final diagnosis, and their indicators can serve only as additional indicators of the development or absence of a disease.

In total, the data obtained by the researchers indicate the unreliability of diagnostics based on the analysis of a single gene and, accordingly, the relevance of the development and implementation of test systems based on determining the status of DNA methylation in the regulatory regions of a number of tumor markers, allowing for more reliable and accurate diagnosis. Known work of Lind et al., Who created a diagnostic kit for the analysis of methylation of six genes: CNRIP1, FBN1, INA, MAL, SNCA and SPG20 [Lind G.E. et al. Identification of an epigenetic biomarker panel with high sensitivity and specificity for colorectal cancer and adenomas // Mol Cancer 2011. - V 10. - P. 85].

The closest analogue (prototype) is a method for determining the diagnosis of cancer in an individual with suspected colorectal cancer (International Application No. WO2014062218, IPC C12Q1 / 68, published on 04.24.2014), including: obtaining a sample from an individual suspected of having cancer; hydrolysis of highly purified genomic DNA from the studied biomaterial using bisulfite DNA conversion; determining the presence or absence of a high level of gene expression (determining the methylation level of the regulatory regions of tumor markers using digital PCR) in relation to the normal basic standard for one diagnostic panel, including the following biomarkers: TFPI2, THBD, C9ORF50, ADHFEl, FGF12, PTPRT, ZNF568 , KIAA1026, SFMBT2, and / or AUTS2; and diagnosing cancer with a high level of expression relative to the normal baseline standard of at least one biomarker.

A disadvantage of the known analogues and prototype is the use of bisulfite DNA conversion, which is characterized by laboriousness, high cost of research and significant time, as well as degradation and significant loss of nucleic acids, which leads to a decrease in accuracy and makes it difficult to analyze a small amount of material.

The technical result of the invention is to simplify and improve the accuracy of the method for determining methylation of RCGY sites of regulatory regions of tumor markers of colorectal cancer and the expansion of its functionality.

The indicated technical result is achieved by the developed set of oligonucleotide primers and fluorescently-labeled probes for identifying malignant lesions of the colon and rectum by analyzing RCGY sites in DNA methylation samples at specified positions of the regulatory regions of tumor markers by GLAD-PCR with the structure given in the appendix ( list of sequences) and table 1:

Table 1

- for specific primers and probe on sites of CpG islands of regulatory regions of the ADHFE1 tumor marker gene (5 '→ 3'):

- for specific primers and probe on sites of CpG islands of regulatory regions of the ALX4 tumor marker gene (5 '→ 3'):

- for specific primers and probe on sites of CpG islands of regulatory regions of the CNRIP1 tumor marker gene (5 '→ 3'):

- for specific primers and probe on the sites of CpG islands of regulatory regions of the tumor marker EID3 (5 '→ 3'):

- for specific primers and probe on the sites of CpG islands of regulatory regions of the ELMO1 tumor marker gene (5 '→ 3'):

- for specific primers and probe on the sites of CpG islands of regulatory regions of the tumor marker ESR1 (5 '→ 3'):

- for specific primers and probe on sites of CpG islands of regulatory regions of the tumor marker gene FBN1 (1) (5 '→ 3'):

- for specific primers and probe on sites of CpG islands of regulatory regions of the tumor marker gene FBN1 (2) (5 '→ 3'):

- for specific primers and probe on sites of CpG islands of regulatory regions of the tumor marker gene FBN1 (3.1) (5 '→ 3'):

- for specific primers and probe on sites of CpG islands of regulatory regions of the tumor marker gene FBN1 (3.3) (5 '→ 3'):

- for specific primers and probe on the sites of CpG islands of the regulatory regions of the HLTF tumor marker gene (5 '→ 3'):

- for specific primers and probe on the sites of CpG islands of regulatory regions of the tumor marker gene LAMA1 (5 '→ 3'):

- for specific primers and probe on the sites of CpG islands of regulatory regions of the gene tumor marker NEUROG1 (5 '→ 3'):

- for specific primers and probe on sites of CpG islands of regulatory regions of the tumor marker gene NGFR (5 '→ 3'):

- for specific primers and probe on sites of CpG islands of regulatory regions of the RARB tumor marker gene (5 '→ 3'):

- for specific primers and probe on the sites of CpG islands of regulatory regions of the tumor marker gene RXRG (5 '→ 3'):

- for specific primers and probe on sites of CpG islands of regulatory regions of the tumor marker RYR2 (5 '→ 3'):

- for specific primers and probe on the sites of CpG islands of regulatory regions of the tumor marker SDC2 (5 '→ 3'):

- for specific primers and probe on the sites of CpG islands of regulatory regions of the gene tumor marker SEPT9 (5 '→ 3'):

- for specific primers and probe on sites of CpG islands of regulatory regions of the tumor marker gene SFRP2 (5 '→ 3'):

- for specific primers and probe on sites of CpG islands of regulatory regions of the SOCS3 tumor marker gene (5 '→ 3'):

- for specific primers and probe on sites of CpG islands of regulatory regions of the tumor marker gene SOX17 (5 '→ 3'):

- for specific primers and probe on sites of CpG islands of regulatory regions of the THBD tumor marker gene (5 '→ 3'):

- for specific primers and probe on the sites of CpG islands of regulatory regions of the TMEFF2 tumor marker gene (5 '→ 3'):

- for specific primers and probe on sites of CpG islands of regulatory regions of the tumor marker UCHL1 (5 '→ 3'):

- for specific primers and probe on the sites of CpG islands of regulatory regions of the VIM tumor marker gene (5 '→ 3'):

where g is the genomic primer ( g enome); p - fluorescently-labeled probe ( z ond); h is a hybrid primer ( h ybrid); FAM - fluorescein; BHQ1 - fluorescence quencher (Black Hole Quencher 1).

The analysis results are taken into account by the method of hybridization-fluorescence detection of PCR amplification products in real time.

The indicated technical result is also achieved by creating a method for identifying malignant lesions of the colon and rectum by analyzing RCGY sites in DNA methylation samples at specified positions of the regulatory regions of tumor markers by GLAD-PCR, including the formation of a panel of tumor markers of colorectal cancer: ADHFE1, ALX4, CNRIP1 , EID3, ELMO1, ESR1, FBN1, HLTF, LAMA1, NEUROG1, NGFR, RARB, RXRG, RYR2, SDC2, SEPT9, SFRP2, SOCS3, SOX17, THBD, TMEFF2, UCHL1 and VIM by means of gene-based on-line cancer analysis and consideration I nucleotide sequences of putative regulatory regions of these genes, the identification of CpG islands located in them, the analysis of the primary structure of CpG islands and their compliance with certain selection criteria. In the regulatory region (promoter or first exon) of these genes, several RCGY sites are usually present, the methylation of which can suppress gene expression in colorectal cancer. Therefore, further on DNA samples from tumor material or cell lines, the most methylated sites are selected using GLAD-PCR analysis, which can be used to diagnose and / or predict the course of colorectal cancer.

, где р - фосфат с последующей амплификацией в реальном времени с использованием геномных праймеров и зондов, комплементарных последовательностям регуляторных областей указанных генов в исследуемой ДНК, и гибридных праймеров, 3'-концы которых комплементарны 5'-концам ДНК в заданных местах гидролиза GlaI, а оставшаяся часть комплементарнаадаптерной последовательности, и делают заключение о наличии последовательности R(5mC)GY, где 5mC - 5-метилцитозин, R-А или G, Y-Т или С в регуляторных областях указанных генов по появлению флуоресцентного сигнала для определения статуса метилирования сайтов в клинических образцах методом GLAD-ПЦР-анализа и на основе информации о статусе метилирования одного или нескольких сайтов делают вывод о наличии или отсутствия колоректального рака.Then hydrolysis of highly purified genomic DNA from the studied biomaterial by methyl-dependent site-specific DNA endonuclease GlaI is carried out, ligation of the universal oligonucleotide adapter

, where p is phosphate, followed by real-time amplification using genomic primers and probes complementary to the sequences of regulatory regions of these genes in the studied DNA, and hybrid primers whose 3'-ends are complementary to the 5'-ends of the DNA at specified GlaI hydrolysis sites, and the remaining part of the complementary adapter sequence, and conclude that the sequence R (5mC) GY is present, where 5mC is 5-methylcytosine, R-A or G, Y-T or C in the regulatory regions of these genes by the appearance of a fluorescent signal I determine the methylation status of sites in clinical samples by GLAD-PCR analysis, and based on the information about the methylation status of one or more sites come to the conclusion about the presence or absence of colorectal cancer.

The structure of the adapter is selected in such a way that its nucleotide sequence is unique to the human genome, optimal in GC composition and protected from the formation of self-complementary structures.

Moreover, when implementing the method using the above set of primers and probes presented in the Appendix (list of sequences).

.The invention is illustrated by the following graphic material presented in figures 1-3. In FIG. Figure 1 shows an example of a search for the most frequently methylated RCGY site in a selected region of the regulatory region of the FBN1 gene (3.3). As can be seen from FIG. 1, this was the third site in amplicon, which corresponds to a hybrid primer

.

Panel A shows a fragment of the nucleotide sequence; shows the binding sites of the genomic primer, probe and genome-specific 3'-tetranucleotides of hybrid primers. Panel B shows the fluorescence accumulation curves during PCR using various hybrid primers. Capital letters “GCGG” indicate the selected hybrid primer corresponding to the point of DNA hydrolysis at the most frequently methylated third RCGY site in the amplicon.

In FIG. 2: presents the result of GLAD-PCR analysis of the selected RCGY site in the regulatory region of the SEPT9 gene in clinical samples. The horizontal axis shows the numbers of clinical samples, where T - corresponds to the tumor sample, and N - healthy. The vertical axis shows the average value of Cq for each sample with an indication of the confidence interval.

In FIG. Figure 3 shows the ROC (Receiver Operating Characteristic) curve obtained as a result of the ROC analysis of the results of GLAD-PCR analysis of the methylation status of the RCGY site marker of colorectal cancer of the SEPT9 gene. The parameters of the ROC analysis are shown in table 4. ROC analysis is a standard method for assessing the diagnostic value of tests.

The invention is illustrated by the following examples 1-3, which implements a method for determining methylation of RCGY sites of regulatory regions of colorectal cancer tumor markers by GLAD-PCR analysis, as well as the composition of oligonucleotide primers and fluorescently-labeled probes for implementing this method.

Example 1. The development of specific primers and fluorescently-labeled probes on the sites of CpG islands of regulatory regions of tumor markers of colorectal cancer.

The study of published data on gene methylation in oncopathology of the lower intestine, RRBS sequencing data (Reduced Representation Bisulfite Sequencing, bisulfite sequencing of limited samples of loci) in the ENCODE / HudsonAlpha project and subsequent bioinformation analysis of the nucleotide sequences of the candidate gene sequences plots of CpG islands of regulatory regions of colorectal cancer tumor marker genes that meet the criteria for analysis by GLAD-PCR ( ablation. 2).

At the first stage of the work, the literature data of recent years on gene methylation in oncopathology of the lower intestine, RRBS sequencing (Reduced Representation Bisulfite Sequencing, bisulfite sequencing of limited locus samples) were analyzed in the ENCODE / HudsonAlpha project and a list of 57 genes was compiled. which methylation occurs with high frequency in the DNA of colorectal cancer cells. This list includes the following genes: SEPT9, SYNE1, FGF12, GAD2, HAND1, CACNA1G, CNRIP1, TLX2, LOX, LAMA1, GAS7, SLC6A15, BOLL, TFPI2, SOCS3, TRH, MDFI, C1orf70, RUNX3, TMPFF WNT5A, IGFBP7, TFPI2, FOXE1, NPY, WIF1, CIDEB, RIC3, KCNQ5, COL4A1, SPG20, SND1, PENK, CDO1, THBD, EDIL3, DUSP26, UCHL1, STOX2, ELMO1, SLC2AL, ESLAAL10 FLI1, RXRg, RYR2, PRKAR1B, BEND5, ITGA4, ADHFE1, NGFR, GATA4, NEYROG1, FBN1. When choosing genes for this list, the number of analyzed samples in the experiments described by the authors of the articles was also taken into account, since reliable data can be obtained only with a large number of DNA samples in the sample. Great importance was also attached to such a property described by the authors as the possibility of detecting gene methylation in the early stages of the disease, although, unfortunately, the number of publications that examined the dependence of gene methylation on the stage of oncopathology is very small.

At the second stage of the work, the nucleotide sequences of the putative regulatory regions of these 57 genes were examined and the CpG islands located in them were identified. The primary structures of CpG islands were analyzed for their compliance with the selection criteria:

1) The availability of data from published works showing a high frequency of methylation of the regulatory region of a gene in the studied samples of DNA samples from patients with colorectal cancer with a low frequency of methylation of this region in healthy donors or in adjacent normal tissues of the colon and rectum of cancer patients.

2) The presence of the CpG island in the region of the beginning of the gene (or in the region of the coding start point of the alternative protein isoform — the gene product), which in most cases is evidence of the regulation of the activity of this gene by methylation of this region.

3) The presence of a potential GlaI endonuclease recognition site (RCGY) in a nucleotide sequence at a selected site.

4) A sufficient distance (50 bp or more) between two potential GlaI endonuclease recognition sites for simultaneous annealing of a fluorescently labeled probe and a genomic primer in this region and the possibility of selecting a primer and a probe for this region that are not subject to theoretical cross-hybridization between by itself and with the adapter sequence.

5) The G + C value of the composition on the candidate site does not exceed 80%, which is caused by the limitations of the in vitro DNA amplification system, which uses HotStart Taq DNA polymerase.

6) The uniqueness of the nucleotide sequence of the candidate region of the analysis (its non-inclusion in the number of repetitive elements of the genome) in order to avoid nonspecific annealing of the selected genomic primer in other regions of the genome, which can lead to a significant decrease in the amplification efficiency and the difficulty of detecting the results during real-time PCR.

As a result of the bioinformation analysis of the regulatory regions of each of the listed genes, 26 regions from these regions (Table 2) that satisfy all the required analysis criteria using the GLAD-PCR method were selected and specific primers and probes for the selected areas of regulatory regions of tumor markers (Table 3).

Table 2.

Regulatory regions of tumor markers are promising for GLAD-PCR analysis.

Gene (region) Gene name Chromosome location The coordinates of the plot on the chromosome (version of the human genome GRCh38.p7) ADHFE1 alcohol dehydrogenase, iron containing 1 8q12.3 chr8: 66432540-66432621 Alx4 Alx homeobox 4 11p11.2 chr11: 44304627-44304798 CNRIP1 cannabinoid receptor interacting protein 1 2p13 chr2: 68319340-68319419 Eid3 EP300 interacting inhibitor of differentiation 3 12q23.3 chr12: 104303544-104303697 ELMO1 engulfment and cell motility 1 7p14.1 chr7: 37448622-37448735 ESR1 estrogen receptor 1 6q24-q27 chr6: 151807784-151807876 FBN1 (1) fibrillin 1 15q21.1 chr15: 48644977-48645057 FBN1 (2) chr15: 48645128-48645191 FBN1 (3.1) chr15: 48645489-48645638 FBN1 (3.3) chr15: 48645378-48645537 Hltf helicase-like transcription factor 3q25.1-q26.1 chr3: 149086693-149086780 LAMA1 laminin subunit alpha 1 18p11.3 chr18: 7117909-7118044 NEUROG1 neurogenin 1 5q23-q31 chr5: 135536157-135536283 NGFR nerve growth factor receptor 17q21-q22 chr17: 49495262-49495389 Rabar retinoic acid receptor beta 3p24 chr3: 25428290-25428491 Rxrg retinoid X receptor gamma 1q22-q23 chr1: 165445168-165445307 Ryr2 ryanodine receptor 2 1q43 chr1: 237043053-237043209 Sdc2 syndecan 2 8q22-q23 chr8: 96494024-96494159 Sept9 septin 9 17q25.3 chr17: 77372872-77372956 SFRP2 secreted frizzled-related protein 2 4q31.3 chr4: 153789082-153789314 SOCS3 suppressor of cytokine signaling 3 17q25.3 chr17: 78359402-78359490 SOX17 SRY-box 17 8q11.23 chr8: 54458606-54458751 Thbd thrombomodulin 20p11.21 chr20: 23049725-23049846 TMEFF2 transmembrane protein with EGF-like and two follistatin-like domains 2 2q32.3 chr2: 192195162-192195377 UCHL1 ubiquitin C-terminal hydrolase L1 4p13 chr4: 41256767-41256854 Vim vimentin 10p13 chr10: 17229414-17229552

The sequences of regulatory regions of genes used in the work according to the human genome GRCh37 / hg19 were obtained from the international GenBank database. To analyze and calculate primers and probes, to study their specificity, we used the Vector NTI 11.5 family of computer programs (Invitrogen, USA) and the US National Biotechnology Information Center database online resources (Blast NCBI, http://blast.ncbi.nlm.nih .gov / Blast.cgi).

Table 3.

Specific primers and probes on sites of regulatory regions of tumor markers.

Gene (region) The sequence of primers and probes * ADHFE1 g: GTGGGCACCCTGCGGTCC
p: FAM-CCCGCCGGCCCCGCACTC-BHQ1
r: GGTCGCGTACTTGCTGAGGCA Alx4 g: CGTCAACAACCTCTCATCC
p: FAM-TCCATTTCTTATTTCAGTTTTGCCACCA-BHQ1
r: GGACTCTGGTTTCTAAGATCAG CNRIP1 g: GCCAGACCCTCGCCCAGACA
p: FAM-CGAGGCCCGGCAGGTCCCCC-BHQ1
r: CGTCATTAGGCTGGATGCGCA Eid3 g: GCTCCGCGGGAAGACAGCC
p: FAM-CCCGGCCCAGCCACAAGC-BHQ1
r: TTTGAAAAAGAATAGCTGTCCCCTGA ELMO1 g: GGGTCGCCGGAGCTCTGA
p: FAM-AACCCTTGCCGCTGCTGTCCTGC-BHQ1
r: CGCCAGCCCAGGAAACTTTAC ESR1 g: CGCAGGGCAGAAGGCTCAGAA
p: FAM-TGCTCTTTTTCCAGGTGGCCCGCC-BHQ1
r: CGGGACATGCGCTGCGTC FBN1 (1) g: GCGGGGAGACTTTCAGGGCA
p: FAM-ATGCTGAAGCCTCGCGGTCCCC-BHQ1
r: CACGGGTTGGGCTTGGGA FBN1 (2) g: CAGCAGCCCCGGCCGATC
p: FAM-CCTCCCGGGCCCCGCCAGA-BHQ1
r: GGGTACTTTGCGCCGCGCTC FBN1 (3.1) g: GTAGCGGCCACGACTGGGA
p: FAM-CAGCCGCCGCCGCCTCCTC-BHQ1
r: CCGGCTGCACCCACTGGA FBN1 (3.3) g: GAGCCCGGCACCAAGAGC
p: FAM-CCCTCCCCTGCCTGACAGCTTCC-BHQ1
r: CACCGGGGCTGGAGCTGC Hltf g: AACAAAACACCGGCACCGCA
p: FAM-CAGTCGCACTCCTGGGGCCTCGT-BHQ1
r: GTTCTTCCCCGCCCCCAA LAMA1 g: ccaccttctctgcccacctccta
p: FAM-CTGACCGCGGCCGCCTCCC -BHQ1
r: CCGCCACCCAGACCCCTC NEUROG1 g: GTGCCTCGGCCGCTAATCG
p: FAM-CCGACCCCGCCTCTGTTTCACTGC-BHQ1
r: CCGTAATTACCGCCGGCCAATC

NGFR g: TGGCTTCACCCAGAGCCTCTC
p: FAM-CAGCCAGAGCGAGCCGAGCC-BHQ1
r: TCCAGCTCGGTCCGCTTTG Rabar g: TTCAGAGGCAGGAGGGTCTATTC
p: FAM-TCCCAGTCCTCAAACAGCTCGCATGG-BHQ1
r: GGTTCCCAGAAAGATCCCAAGTTC Rxrg g: GCCGCCGTCACCGCTACT
p: FAM-CCACCGCCGTCGCTGCTGC-BHQ1
r: GTGCCACCCGGTAGGGACC Ryr2 g: GGGGACCACGGAGGCGACT
p: FAM-TTTCCCCCAAGTCAAGGTGCTGCGAAA-BHQ1
r: CGGGGGTGATGGTGCAGGA Sdc2 g: GCGATTGCGGCTCAGGCT
p: FAM-PrivGAGCCCGAGTCCCCG-BHQ1
r: GGGAGTGCAGAAACCAACAAGTGA Sept9 g: GCAGGAGGCTGTATTTGGG
p: FAM-AGCCAAACAAAGTTCTCTGTCACCGCC-BHQ1
r: CGCTGCCGTTTAACCCTTG SFRP2 g: GCACAGCCAGAGTTTTCTTG
p: FAM-TACCCTTCATTGGCTCCTCCCTTGCT-BHQ1
r: AGGCTTCTCTGTTTGTTGTTTAAAG SOCS3 g: CAGTCCCGGGGGCCCTTCT
p: FAM-TGCTCCCCACCCGGCCACACTCC-BHQ1
r: CAAGGGCGCAGCGTGGGA SOX17 g: CGCCCTCCGACCCTCCAA
p: FAM-TCCCGGATTCCCCAGGTGGCC-BHQ1
r: CAGTTCAGGGCCAAGGGTGCT Thbd g: GTTCGGGAAAAGGAAGGAAGTGC
p: FAM-ATTGCTGGGTTCTCTGGCCGCC-BHQ1
r: TTACTCATCCCGGCGAGGTGA TMEFF2 g: GGTGGGCTACCCGCACACTCATA
p: FAM-CCATTCGCCTCACTCTCCGCTCCA-BHQ1
r: CGCCGACTCGCCCCTCTC UCHL1 g: GCAGAACCAAGCGAGGGGGAA
p: FAM-CGTACCCATCTGGCCGCGACCGTC-BHQ1
r: GGGGCCCGGCCGTACCAC Vim g: TCCGCAGCCATGTCCACCA
p: FAM-CCGTGTCCTCGTCCTCCTACCGCAG-BHQ1
r: GCTGCCCAGGCTGTAGGTGC

* Note: g - genomic primer; p - fluorescently-labeled probe; r is an additional genomic primer ( r everse), subsequently replaced by a hybrid primer in GLAD-PCR (example 2); FAM - fluorescein; BHQ1 - fluorescence quencher (Black Hole Quencher 1).

Real-time PCR was carried out in a volume of 20 μl in three repetitions on a CXF-96 detection amplifier (Bio-Rad, USA) according to a program universal for all amplified sections: 95 ° C for 3 min, then 5 cycles without detection: 95 ° C 10 s, 61 ° C 15 s, 72 ° C 20 s; then 50 cycles with detection through the FAM channel at the annealing stage: 95 ° C for 10 sec, 61 ° C for 15 sec, 72 ° C for 20 sec. The concentrations of the reaction components of PCR were similar to those indicated in Example 2. In the experiments, healthy donor leukocyte DNA was obtained and purified as described previously [M. Abdurashitov. et al. Restriction analysis of human DNA - new opportunities in DNA diagnostics. Medical genetics. 2007. - T. 6. - S. 29-36]. The amplification results were as expected. The sequences of the designed primers and probes are presented in table 3. Subsequently, when conducting GLAD-PCR, one of the primers, indicated in the table as “r” (reverse), was replaced with a selected hybrid primer (example 2).

Example 2. Search methylated sites RCGY for GLAD-PCR analysis

The methylation status of RCGY sites within the selected DNA regions was studied in order to select the optimal sites for further GLAD-PCR analysis of clinical samples. To search for promising R (5mC) GY sites within the selected regions of the regulatory regions of tumor markers for analysis, we used a DNA preparation from colorectal cancer cells of the SW837 line (colon adenocarcinoma cell line), isolated by the known method [Sambrook J., Russel D. Molecular cloning : a laboratory manual. 3rd ed. - New York: Cold Spring Harbor Laboratory Press, 2001. - 2222 p.]. The search was performed by selecting hybrid primers for nearby RCGY sites for no more than 400 bp. from the position of the genomic primer. Used the methodology, the structure of the oligonucleotide adapter and hybrid primers according to the known method [Kuznetsov V. Century et al. The method for determining the nucleotide sequence of Pu (5mC) GPy in a given position of extended DNA // RF Patent No. 2525710 C1, publ. 08/20/2014, Bull. No. 23].

The structure of the hybrid primer is a 19-link sequence of the following composition: 5'- CCTGCTCTTTCATCG gYNN-3 ', where the 15-part primer complementary to the universal oligonucleotide adapter is highlighted, and gYNN is a 4-link complementary to the genomic sequence at the methyl hydrolysis point endonuclease GlaI. This structure implies 32 variants of hybrid primers corresponding to different points of DNA hydrolysis at the R (5mC) GY site.

1.5 n.a. of methyl-dependent site-specific GlaI DNA endonuclease was added to 45 ng of the DNA preparation. and buffer components to achieve the following composition in a volume of 21.7 μl: 20 mM Tris-SO ₄ , pH 8.0, 4 mM MgCl ₂ , 1 mM β-mercaptoethanol, 100 ng / μl BSA. Hydrolysis was carried out for 30 min at 30 ° C followed by inactivation of GlaI at 65 ° C for 20 min.

Then, ATP was added to the GlaI hydrolyzate to a final concentration of 0.5 mM, ß-mercaptoethanol to 6.8 mM, the universal oligonucleotide adapter 5'-CCTGCTCTTTCATCG-3 '/ 3'-p-GGACGAGAAAGTAGC-p-5', to the final concentrations of 0.5 μM and 1000 ea highly active T4 DNA ligase. The adapter ligation reaction was carried out in 30 μl of the reaction mixture for 15 min at 25 ° C, then the ligase was thermally inactivated at 65 ° C for 20 min.

For real-time PCR, the following components were added to the ligase mixture until the final concentrations were reached in a final volume of 60 μl: 50 mM Tris-SO ₄ , pH 9.0, 30 mM KCl, 10 mM ammonium sulfate, 3 mM MgCl ₂ , 0.2 mm mixture of deoxyribonucleoside triphosphates, 0.01% Tween-20, a mixture of genomic primer, hybrid primer and probe of 0.4 μm each and 0.05 EA / μl Hot Start DNA polymerase. To increase the efficiency of amplification of GC-rich DNA regions, a stabilizer was used. The resulting reaction mixture (60 μl) was divided into three equal parts.

Real-time PCR reaction was carried out in a volume of 20 μl in three repetitions on a CXF-96 detection amplifier (Bio-Rad, USA) according to the program: 95 ° C for 3 min, then 5 cycles without detection: 95 ° C for 10 sec, 61 ° C 15 sec; 72 ° C 20 sec; then 50 cycles with detection (FAM channel) at the annealing stage: 95 ° С 10 sec, 61 ° С 15 sec, 72 ° С 20 sec. The results were analyzed using the CXF-96 amplifier software and interpreted based on the presence (or absence) of intersection of the fluorescence curves of the samples with the threshold lines, which corresponded to the presence or absence of the threshold cycle value “Cq” in the corresponding column of the result table of the amplifier program.

In FIG. Figure 1 shows an example of a search for the most frequently methylated RCGY site in a selected region of the regulatory region of the FBN1 gene (3.3). Selection of the most methylated RCGY site and its corresponding hybrid primer for GLAD-PCR analysis in the regulatory region of the FBN1 gene. (a) A fragment of the nucleotide sequence of the regulatory region of the FBN1 gene. Genomic primers, fluorescent probes, GlaI specific sites (RCGY), and the four-nucleotide sequence of the corresponding hybrid primer are shown. Hybrid primers corresponding to the most methylated RCGY sites are shown in capital letters. The coordinates of the region on the chromosome are given in accordance with the genomic assembly GRCh38 / hg38. (b) Real-time PCR curves obtained using various hybrid primers in GLAD-PCR analysis of the regulatory region of the FBN1 gene (3.1).

As can be seen from FIG. 1, this turned out to be the third site in the amplicon, which corresponds to the hybrid primer 5'-CCTGCTCTTTCATCG GCCG- 3 '.

Search results for the most methylated RCGY sites from regulatory regions of the ADHFE1, ALX4, CNRIP1, EID3, ELMO1, ESR1, FBN1, HLTF, LAMA1, NEUROG1, NGFR, RARB, RXRG, RYR2, SDC2, SEPT9, SFRP2, SOCS, THOC gene regulatory regions TMEFF2, UCHL1 and VIM, promising for GLAD-PCR analysis of clinical samples and identification of colorectal cancer are shown in Table 1.

Example 3. GLAD-PCR analysis of methylation status of tumor markers of colorectal cancer

Samples of the operating material of tumors (n = 21) and normal intestinal mucosa (n = 9) from patients with colorectal cancer were obtained from the FSUE Seversky Biophysical Research Center of the FMBA of Russia (Seversk, Tomsk Region, Russian Federation). For GLAD-PCR analysis of the methylation status of RCGY sites at specific positions of the DNA region of a particular gene, genomic DNA preparations were isolated from clinical samples using the known phenol-chloroform extraction method [Sambrook J., Russel D. Molecular cloning: a laboratory manual. 3rd ed. - New York: Cold Spring Harbor Laboratory Press, 2001. - 2222 p.], Which were treated with RNAse A to purify RNA impurities and fragmented with TaqI restriction restriction endonuclease for more complete DNA hydrolysis. The concentration of DNA samples (ng / μl) was determined spectrophotometrically. The GLAD-PCR reaction was carried out as described in Example 2. 9 ng DNA was taken into the reaction, PCR was carried out in three repetitions for each sample (3 ng DNA, i.e., ~ 10 ³ copies of the genome per reaction). One of the genomic primers in PCR was replaced with a matched one, as described in example 2, i.e. hybrid primer.

The results of the analysis for the SEPT9 gene are presented in FIG. 2: Results of GLAD-PCR analysis of a selected RCGY site in the regulatory region of the SEPT9 gene in clinical samples. The horizontal axis shows the numbers of clinical samples, where T - corresponds to the tumor sample, and N - healthy. The vertical axis shows the average value of Cq for each sample with an indication of the confidence interval. In accordance with the obtained Cq values for each cycle of experiments, ROC curves were constructed and the area under the curve was estimated to evaluate the sensitivity and specificity of each marker [E. R. DeLong, D. M. DeLong, and D. L. Clarke-Pearson, “Comparing the areas under two or more correlated receiver operating characteristic curves: a nonparametric approach,” Biometrics, vol. 44, no. 3, pp. 837-845, 1988]. The evaluation results are shown in table 4, and the corresponding curves in figure 3 - ROC curve for GLAD-PCR analysis of methylation status of the RCGY site marker of colorectal cancer for the gene SEPT9.

During the ROC analysis, the optimal threshold cutoff cycle “Ct _opt ” was calculated, at which the maximum value of sensitivity and specificity was maximum. The analyzed sample was considered positive if the average “Ct” value for the sample was less than or equal to “Ct _opt ”. The analyzed sample was considered negative if the average “Ct” value for the sample exceeded “Ct _opt ”.

Table 4

Assessment of the diagnostic value of the selected RCGY site in the regulatory region of the SEPT9 colorectal cancer tumor marker gene by GLAD-PCR analysis.

Gene (region) The number of detected samples of colorectal cancer / total number of tumor samples Sensitivity,
% Number of negative results / total number of healthy samples Specificity,
% Area under the curve
(standard deviation) 95% confidence interval Sept9 16/21 76.2 9/9 one hundred 0.862 (0.067) 0.688–0.960

Thus, Example 3 shows the possibility of successful application of the GLAD-PCR method for identifying malignant lesions of the colon and rectum using the developed set of oligonucleotide primers and fluorescently-labeled probes for GLAD-PCR analysis of methylation status of target RCGY sites in regulatory regions of genes tumor markers of colorectal cancer.

Claims (55)

1. A set of oligonucleotide primers and fluorescently-labeled probes for the identification of malignant lesions of the colon and rectum by analyzing RCGY sites in DNA methylation samples at predetermined positions of the regulatory regions of tumor markers by GLAD-PCR with the following structure: - for specific primers and probe on sites of CpG islands of regulatory regions of the ADHFE1 tumor marker gene (5 '→ 3'): ADHFE1_g: 5'-GTGGGCACCCTGCGGTCC-3 ' (18 n.) ADHFE1_p: 5'-FAM-CCCGCCGGCCCCGCACTC-BHQ1-3 ' (18 n.) ADHFE1_h: 5'-CCTGCTCTTTCATCG GTAC -3 ' (19 n.) - for specific primers and probe on sites of CpG islands of regulatory regions of the ALX4 tumor marker gene (5 '→ 3'): ALX4_g: 5'-CGTCAACAACCTCTCATCC-3 ' (18 n.) ALX4_p: 5'-FAM-TCCATTTCTTATTTCAGTTTGCCACCA-BHQ1-3 ' (18 n.) ALX4_h: 5'-CCTGCTCTTTCATCG GCGC -3 ' (19 n.) - for specific primers and probe on sites of CpG islands of regulatory regions of the CNRIP1 tumor marker gene (5 '→ 3'): CNRIP1_g: 5'-GCCAGACCCTCGCCCAGACA-3 ' (20 n.) CNRIP1_p: 5'-FAM-CGAGGCCCGGCAGGTCCCCC-BHQ1 (20 n.) CNRIP1_h: 5'-CCTGCTCTTTCATCG GCGA -3 ' (19 n.) - for specific primers and probe on the sites of CpG islands of regulatory regions of the tumor marker EID3 (5 '→ 3'): EID3_g: 5'-GCTCCGCGGGAAGACAGCC-3 ' (19 n.) EID3_p: 5'-FAM-CCCGGCCCAGCCACAAGC-BHQ1-3 ' (18 n.) EID3_h: 5'-CCTGCTCTTTCATCG GTGT -3 ' (19 n.) - for specific primers and probe on sites of CpG islands of regulatory regions of the ELMO1 tumor marker gene (5 '): ELMO1_g: 5'-GGGTCGCCGGAGCTCTGA-3 ' (18 n.) ELMO1_p: 5'-FAM-AACCCTTGCCGCTGCTGTCCTGC-BHQ1-3 ' (23 n.) ELMO1 _h: 5'-CCTGCTCTTTCATCG GCCG -3 ' (19 n.) - for specific primers and probe on the sites of CpG islands of regulatory regions of the tumor marker ESR1 (5 '→ 3'): ESR1_g: 5'-CGCAGGGCAGAAGGCTCAGAA-3 ' (21 n.) ESR1_p: 5'-FAM-TGCTCTTTTTTAGAGGTGGCCCGCC-BHQ1-3 ' (24 n.) ESR1_h: 5'-CCTGCTCTTTCATCG GTGT -3 ' (19 n.) - for specific primers and probe on sites of CpG islands of regulatory regions of the tumor marker gene FBN1 (1) (5 '→ 3'): FBN1 (1) _g: 5'-GCGGGGAGACTTTCAGGGCA-3 ' (20 n.) FBN1 (1) _p: 5'-FAM-ATGCTGAAGCCTCGCGGTCCCC-BHQ1-3 ' (22 n.) FBN1 (1) _h: 5'-CCTGCTCTTTCATCG GCGC -3 ' (19 n.) - for specific primers and probe on sites of CpG islands of regulatory regions of the tumor marker gene FBN1 (2) (5 '→ 3'): FBN1 (2) _g: 5'-CAGCAGCCCCGGCCGATC-3 ' (18 n.) FBN1 (2) _p: 5'-FAM-CCTCCCGGGCCCCGCCAGA-BHQ1-3 ' (19 n.) FBN1 (2) _h: 5'-CCTGCTCTTTCATCG GCTC -3 ' (19 n.) - for specific primers and probe on sites of CpG islands of regulatory regions of the tumor marker gene FBN1 (3.1) (5 '→ 3'): FBN1 (3.1) _g: 5'-GTAGCGGCCACGACTGGGA-3 ' (19 n.) FBN1 (3.1) _p: 5'-FAM-CAGCCGCCGCCGCCTCCTC-BHQ1-3 ' (19 n.) FBN1 (3.1) _h: 5'-CCTGCTCTTTCATCG GCGG -3 ' (19 n.) - for specific primers and probe on sites of CpG islands of regulatory regions of the tumor marker gene FBN1 (3.3) (5 '→ 3'): FBN1 (3.3) _g: 5'-GAGCCCGGCACCAAGAGC-3 ' (18 n.) FBN1 (3.3) _p: 5'-FAM-CCCTCCCCTGCCTGACAGCTTCC-BHQ1-3 ' (23 n.) FBN1 (3.3) _h: 5'-CCTGCTCTTTCATCG GCCG -3 ' (19 n.) - for specific primers and probe on the sites of CpG islands of the regulatory regions of the HLTF tumor marker gene (5 '→ 3'): HLTF_g: 5'-AACAAAACACCGGCACCGCA-3 ' (20 n.) HLTF_p: 5'-FAM-CAGTCGCACTCCTGGGGCCTCGT-BHQ1-3 ' (23 n.) HLTF_h: 5'-CCTGCTCTTTCATCG GCGG -3 ' (19 n.) - for specific primers and probe on the sites of CpG islands of regulatory regions of the tumor marker gene LAMA1 (5 '→ 3'): LAMA1_g: 5'-CCACCTTCTCTGCCCACCTCCTA-3 ' (23 n.) LAMA1_p: 5'-FAM-CTGACCGCGGCCGCCTCCC-BHQ1-3 ' (19 n.) LAMA1_h: 5'-CCTGCTCTTTCATCG GCGG -3 ' (19 n.) - for specific primers and probe on the sites of CpG islands of regulatory regions of the gene tumor marker NEUROG1 (5 '→ 3'): NEUROG1_g: 5'-GTGCCTCGGCCGCTAATCG-3 ' (19 n.) NEUROG1_p: 5'-FAM-CCGACCCCGCCTCTGTTTCACTGC-BHQ1-3 ' (24 n.) NEUROG1_h: 5'-CCTGCTCTTTCATCG GCGG -3 ' (19 n.) - for specific primers and probe on sites of CpG islands of regulatory regions of the tumor marker gene NGFR (5 '→ 3'): NGFR_g: 5'-TGGCTTCACCCAGCCTCTCTC-3 ' (19 n.) NGFR_p: 5'-FAM-CAGCCAGAGCGAGCCGAGCC-BHQ1-3 ' (20 n.) NGFR_h: 5'-CCTGCTCTTTCATC GGCTC -3 ' (19 n.) - for specific primers and probe on sites of CpG islands of regulatory regions of the RARB tumor marker gene (5 '→ 3'): RARB_g: 5'-TTCAGAGGCAGGAGGGTCTATTC-3 ' (23 n.) RARB_p: 5'-FAM-TCCCAGTCCTCAAACAGCTCGCATGG-BHQ1-3 ' (26 n.) RARB_h: 5'-CCTGCTCTTTCATCG GTTC -3 ' (19 n.) - for specific primers and probe on the sites of CpG islands of regulatory regions of the tumor marker gene RXRG (5 '→ 3'): RXRG_g: 5'-GCCGCCGTCACCGCTACT-3 ' (18 n.) RXRG_p: 5'-FAM-CCACCGCCGTCGCTGCTGC-BHQ1-3 ' (19 n.) RXRG_h: 5'-CCTGCTCTTTCATCG GCGG -3 ' (19 n.) - for specific primers and probe on sites of CpG islands of regulatory regions of the tumor marker RYR2 (5 '→ 3'): RYR2_g: 5'-GGGGACCACGGAGGCGACT-3 ' (19 n.) RYR2_p: 5'-FAM-TTTCCCCCAAGTCAAGGTGCTGCGAAA-BHQ1-3 ' (27 n.) RYR2_h :. 5'-CCTGCTCTTTCATCG GCGT -3 ' (19 n.) - for specific primers and probe on the sites of CpG islands of regulatory regions of the tumor marker SDC2 (5 '→ 3'): SDC2_g: 5'-GCGATTGCGGCTCAGGCT-3 ' (18 n.) SDC2_p: 5'-FAM-PrivGAGCCCGAGTCCCCG-BHQ1-3 ' (19 n.) SDC2_h: 5'-CCTGCTCTTTCATCG GTTC -3 ' (19 n.) - for specific primers and probe on the sites of CpG islands of regulatory regions of the gene tumor marker SEPT9 (5 '→ 3'): SEPT9_g: 5'-GCAGGAGGCTGTATTTGGG-3 ' (19 n.) SEPT9_p: 5'-FAM-AGCCAAACAAAGTTCTCTGTCACCGCC-BHQ1-3 ' (27 n.) SEPT9_h: 5'-CCTGCTCTTTCATCG GCAG -3 ' (19 n.) - for specific primers and probe on sites of CpG islands of regulatory regions of the tumor marker gene SFRP2 (5 '→ 3'): SFRP2_g: 5'-GCACAGCCAGAGTTTTTTTG-3 ' (20 n.) SFRP2_p: 5'-FAM-TACCCTTCATTGGCTCCTCCCTTGCT-BHQ1-3 ' (26 n.) SFRP2_h: 5'-CCTGCTCTTTCATCG GCGT -3 ' (19 n.) - for specific primers and probe on sites of CpG islands of regulatory regions of the SOCS3 tumor marker gene (5 '→ 3'): SOCS3_g: 5'-CAGTCCCGGGGGGCCCTTCT-3 ' (19 n.) SOCS3_p: 5'-FAM-TGCTCCCCACCCGGCCACACTCC-BHQ1-3 ' (23 n.) SOCS3_h: 5'-CCTGCTCTTTCATCG GCGG -3 ' (19 n.) - for specific primers and probe on sites of CpG islands of regulatory regions of the tumor marker gene SOX17 (5 '→ 3'): SOX17_g: 5'-CGCCCTCCGACCCTCCAA-3 ' (18 n.) SOX17_p: 5'-FAM-TCCCGGATTCCCCAGGTGGCC-BHQ1-3 ' (21 n.) SOX17_h: 5'-CCTGCTCTTTCATCG GCCG -3 ' (19 n.) - for specific primers and probe on sites of CpG islands of regulatory regions of the THBD tumor marker gene (5 '→ 3'): THBD_g: 5'-GTTCGGGAAAAGGAAGGAAGTGC-3 ' (23 n.) THBD_p: 5'-FAM-ATTGCTGGGTTCTCTGGCCGCC-BHQ1-3 ' (22 n.) THBD_h: 5'-CCTGCTCTTTCATCG GCGA -3 ' (19 n.) - for specific primers and probe on the sites of CpG islands of regulatory regions of the TMEFF2 tumor marker gene (5 '→ 3'): TMEFF2_g: 5'-GGTGGGCTACCCGCACACTCATA-3 ' (23 n.) TMEFF2_p: 5'-FAM-CCATTCGCCTCACTCTCCGCTCCA-BHQ1-3 ' (24 n.) TMEFF2_h. 5'-CCTGCTCTTTCATCG GCGG -3 ' (19 n.) - for specific primers and probe on sites of CpG islands of regulatory regions of the tumor marker UCHL1 (5 '→ 3'): UCHL1_g: 5'-GCAGAACCAAGCGAGGGGGGAA-3 ' (21 n.) UCHL1_p: 5'-FAM-CGTACCCATCTGGCCGCGACCGTC-BHQ1-3 ' (24 n.) UCHL1_h: 5'-CCTGCTCTTTCATCG GCTG -3 ' (19 n.) - for specific primers and probe on the sites of CpG islands of regulatory regions of the VIM tumor marker gene (5 '→ 3'): VIM_g: 5'-TCCGCAGCCATGTCCACCA-3 ' (19 n.) VIM_p: 5'-FAM-CCGTGTCCTCGTCCTCCTACCGCAG-BHQ1-3 ' (25 n.) VIM_h: 5'-CCTGCTCTTTCATCG GCGC -3 ' (19 n.) where g is the genomic primer (genome); p - fluorescently-labeled probe (zond); h - hybrid primer (hybrid); FAM - fluorescein; BHQ1 - fluorescence quencher (Black Hole Quencher 1). 2. A method for identifying malignant lesions of the colon and rectum by analyzing RCGY sites in DNA methylation samples at specified positions of the regulatory regions of tumor markers by GLAD-PCR, including forming a panel of tumor markers of colorectal cancer: ADHFE1, ALX4, CNRIP1, EID3, ELMO1 , ESR1, FBN1, HLTF, LAMA1, NEUROG1, NGFR, RARB, RXRG, RYR2, SDC2, SEPT9, SFRP2, SOCS3, SOX17, THBD, TMEFF2, UCHL1 and VIM; hydrolysis of highly purified genomic DNA from the studied biomaterial by the methyl-dependent site-specific DNA endonuclease GlaI, ligation of the universal oligonucleotide adapter 5'-CCTGCTCTTTCATCG-3 '/ 3'-p-GGACGAGAAAGTAGC-p-5', where p is the time-dependent phosphate amplification using genomic primers and probes complementary to the sequences of regulatory regions of these genes in the studied DNA, and hybrid primers, the 3'-ends of which are complementary to the 5'-ends of the DNA at the given GlaI hydrolysis sites, and the rest of the complement on the adapter sequence, and conclude that there is an R (5mC) GY sequence, where 5mC is 5-methylcytosine, R-A or G, Y-T or C in the regulatory regions of these genes by the appearance of a fluorescent signal to determine the methylation status of sites in clinical samples by the method of GLAD-PCR analysis and based on information on the methylation status of one or more sites conclude the presence or absence of colorectal cancer, and when implementing the method using a set of primers and probes according to claim 1.

Images