CN114807362B - Diagnostic kit for colorectal cancer or adenoma - Google Patents
Diagnostic kit for colorectal cancer or adenoma Download PDFInfo
- Publication number
- CN114807362B CN114807362B CN202110107656.3A CN202110107656A CN114807362B CN 114807362 B CN114807362 B CN 114807362B CN 202110107656 A CN202110107656 A CN 202110107656A CN 114807362 B CN114807362 B CN 114807362B
- Authority
- CN
- China
- Prior art keywords
- chr9
- region
- methylation
- gene
- adenoma
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 206010009944 Colon cancer Diseases 0.000 title claims abstract description 48
- 208000001333 Colorectal Neoplasms Diseases 0.000 title claims abstract description 48
- 201000002758 colorectal adenoma Diseases 0.000 title claims abstract description 37
- 238000009007 Diagnostic Kit Methods 0.000 title description 4
- 230000011987 methylation Effects 0.000 claims abstract description 64
- 238000007069 methylation reaction Methods 0.000 claims abstract description 64
- 238000003745 diagnosis Methods 0.000 claims abstract description 43
- 101150069012 C9orf50 gene Proteins 0.000 claims abstract description 33
- 108090000623 proteins and genes Proteins 0.000 claims abstract description 25
- 239000003153 chemical reaction reagent Substances 0.000 claims abstract description 15
- 239000002773 nucleotide Substances 0.000 claims description 64
- 125000003729 nucleotide group Chemical group 0.000 claims description 64
- 238000001514 detection method Methods 0.000 claims description 45
- 108020004707 nucleic acids Proteins 0.000 claims description 25
- 150000007523 nucleic acids Chemical class 0.000 claims description 25
- 102000039446 nucleic acids Human genes 0.000 claims description 25
- 238000007855 methylation-specific PCR Methods 0.000 claims description 12
- 238000000034 method Methods 0.000 claims description 11
- 239000003795 chemical substances by application Substances 0.000 claims description 7
- 238000001369 bisulfite sequencing Methods 0.000 claims description 4
- 238000007847 digital PCR Methods 0.000 claims description 4
- 238000004090 dissolution Methods 0.000 claims description 4
- 238000004128 high performance liquid chromatography Methods 0.000 claims description 4
- 238000012164 methylation sequencing Methods 0.000 claims description 4
- 238000002493 microarray Methods 0.000 claims description 4
- 238000012175 pyrosequencing Methods 0.000 claims description 4
- 108091008146 restriction endonucleases Proteins 0.000 claims description 4
- 238000002360 preparation method Methods 0.000 claims description 2
- 230000035945 sensitivity Effects 0.000 abstract description 21
- 206010028980 Neoplasm Diseases 0.000 abstract description 12
- 239000003550 marker Substances 0.000 abstract description 3
- 108020004414 DNA Proteins 0.000 description 36
- 239000000523 sample Substances 0.000 description 19
- OPTASPLRGRRNAP-UHFFFAOYSA-N cytosine Chemical group NC=1C=CNC(=O)N=1 OPTASPLRGRRNAP-UHFFFAOYSA-N 0.000 description 18
- 208000003200 Adenoma Diseases 0.000 description 16
- 206010001233 Adenoma benign Diseases 0.000 description 11
- 201000011510 cancer Diseases 0.000 description 11
- 108010085238 Actins Proteins 0.000 description 10
- 208000037062 Polyps Diseases 0.000 description 10
- 102000007469 Actins Human genes 0.000 description 9
- 229940104302 cytosine Drugs 0.000 description 9
- 210000002381 plasma Anatomy 0.000 description 8
- 201000010989 colorectal carcinoma Diseases 0.000 description 6
- 238000004458 analytical method Methods 0.000 description 4
- 238000006243 chemical reaction Methods 0.000 description 4
- 230000000694 effects Effects 0.000 description 4
- 239000013642 negative control Substances 0.000 description 4
- 239000013641 positive control Substances 0.000 description 4
- 206010048832 Colon adenoma Diseases 0.000 description 3
- 230000003698 anagen phase Effects 0.000 description 3
- 210000004027 cell Anatomy 0.000 description 3
- 210000002966 serum Anatomy 0.000 description 3
- 239000000243 solution Substances 0.000 description 3
- 238000011144 upstream manufacturing Methods 0.000 description 3
- 101000989503 Homo sapiens Uncharacterized protein C9orf50 Proteins 0.000 description 2
- 102100029311 Uncharacterized protein C9orf50 Human genes 0.000 description 2
- 238000002474 experimental method Methods 0.000 description 2
- 238000000605 extraction Methods 0.000 description 2
- 230000000968 intestinal effect Effects 0.000 description 2
- 230000004048 modification Effects 0.000 description 2
- 238000012986 modification Methods 0.000 description 2
- 230000001575 pathological effect Effects 0.000 description 2
- 239000008213 purified water Substances 0.000 description 2
- 238000010791 quenching Methods 0.000 description 2
- 230000000171 quenching effect Effects 0.000 description 2
- 125000006853 reporter group Chemical group 0.000 description 2
- 210000001519 tissue Anatomy 0.000 description 2
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Chemical compound O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 2
- 238000007400 DNA extraction Methods 0.000 description 1
- 108091027757 Deoxyribozyme Proteins 0.000 description 1
- 206010058314 Dysplasia Diseases 0.000 description 1
- 206010016654 Fibrosis Diseases 0.000 description 1
- 102000029749 Microtubule Human genes 0.000 description 1
- 108091022875 Microtubule Proteins 0.000 description 1
- 108091081021 Sense strand Proteins 0.000 description 1
- LSNNMFCWUKXFEE-UHFFFAOYSA-N Sulfurous acid Chemical compound OS(O)=O LSNNMFCWUKXFEE-UHFFFAOYSA-N 0.000 description 1
- 230000002159 abnormal effect Effects 0.000 description 1
- 230000005856 abnormality Effects 0.000 description 1
- 238000009825 accumulation Methods 0.000 description 1
- 230000003321 amplification Effects 0.000 description 1
- 239000011324 bead Substances 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 210000004369 blood Anatomy 0.000 description 1
- 239000008280 blood Substances 0.000 description 1
- 239000007853 buffer solution Substances 0.000 description 1
- 238000013461 design Methods 0.000 description 1
- 238000011161 development Methods 0.000 description 1
- 230000018109 developmental process Effects 0.000 description 1
- 238000005516 engineering process Methods 0.000 description 1
- 210000003608 fece Anatomy 0.000 description 1
- 230000004761 fibrosis Effects 0.000 description 1
- 230000002068 genetic effect Effects 0.000 description 1
- 210000004907 gland Anatomy 0.000 description 1
- 239000010931 gold Substances 0.000 description 1
- 229910052737 gold Inorganic materials 0.000 description 1
- 210000003917 human chromosome Anatomy 0.000 description 1
- 230000006872 improvement Effects 0.000 description 1
- 210000004347 intestinal mucosa Anatomy 0.000 description 1
- YOBAEOGBNPPUQV-UHFFFAOYSA-N iron;trihydrate Chemical compound O.O.O.[Fe].[Fe] YOBAEOGBNPPUQV-UHFFFAOYSA-N 0.000 description 1
- 210000001165 lymph node Anatomy 0.000 description 1
- 230000003211 malignant effect Effects 0.000 description 1
- 230000001394 metastastic effect Effects 0.000 description 1
- 206010061289 metastatic neoplasm Diseases 0.000 description 1
- 210000004688 microtubule Anatomy 0.000 description 1
- 238000003199 nucleic acid amplification method Methods 0.000 description 1
- 239000013612 plasmid Substances 0.000 description 1
- 239000000047 product Substances 0.000 description 1
- 238000003908 quality control method Methods 0.000 description 1
- 238000007430 reference method Methods 0.000 description 1
- 238000011160 research Methods 0.000 description 1
- 239000013589 supplement Substances 0.000 description 1
- 230000004083 survival effect Effects 0.000 description 1
- 230000001360 synchronised effect Effects 0.000 description 1
- 238000012360 testing method Methods 0.000 description 1
- 230000009466 transformation Effects 0.000 description 1
- 208000022271 tubular adenoma Diseases 0.000 description 1
- 208000009540 villous adenoma Diseases 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/154—Methylation markers
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Immunology (AREA)
- Analytical Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Pathology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Hospice & Palliative Care (AREA)
- Oncology (AREA)
- Plant Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a diagnosis kit for colorectal cancer or adenoma, and relates to the technical field of tumor diagnosis. The kit disclosed by the invention contains a reagent for detecting methylation of a target gene, wherein the target gene comprises a C9orf50 gene. The diagnosis kit disclosed by the invention takes the C9orf50 gene as a marker, and has higher sensitivity and specificity by detecting methylation results to diagnose or assist diagnosis of colorectal cancer or adenoma; the invention provides a new idea for diagnosing colorectal cancer or adenoma.
Description
Technical Field
The invention relates to the technical field of tumor diagnosis, in particular to a diagnosis kit for colorectal cancer or adenoma.
Background
Colorectal cancer is one of the most common malignant tumors worldwide, and the five-year survival rate can reach 90% if early detection is performed, and is less than 10% if later detection is performed. Colorectal cancer usually develops from benign precancerous polyps, which are locally growing or the accumulation of abnormal cells within the intestinal mucosa protruding into the intestinal lumen. Over time, dividing cells in these polyps may accumulate enough genetic changes to gain the ability to invade the intestinal wall, which is an indication of the onset of colorectal cancer, and eventually they may spread to regional lymph nodes and distant metastatic sites. Fortunately, only a small fraction of polyps eventually develop into cancer, and for those already developing into cancer, the progression usually takes years or even decades, so early detection can reduce the incidence of colorectal cancer.
There are two main types of potential malignant polyps: adenomas and sessile serrated polyps, both types are different from the risk of developing colorectal cancer. In general, most adenomas have tubular histological features of small, circular atypical glands, but as the adenoma grows, areas of long filiform structure are usually formed, described in pathological reports as villous or microtubule. As the name suggests, adenomas are characterized by dysplasia (low degree of fibrosis and structural abnormality). Tubular and villous adenomas, especially those with a villus content of 25%, are generally larger in size and have the potential for larger crypt cancer cells, whereas sessile serrated polyps are flat like carpets. Sessile serrated polyps include sessile serrated adenomas, traditional serrated adenomas and mixed polyps, all of which are associated with the development of colorectal cancer. As the size of polyps increases, the risk of adenomas developing colorectal cancer increases, with 60% -70% of colorectal cancers developing from adenomas. The remaining 25% to 35% of CRC develops from sessile serrated polyps.
From the above, it can be seen that increasing the detection rate of adenoma is extremely important for reducing the incidence and mortality of colorectal cancer, and most of the detection markers disclosed in the prior art have low detection rates of colorectal cancer and adenoma, and low sensitivity and specificity.
In view of this, the present invention has been made.
Disclosure of Invention
The invention aims to provide a diagnostic kit for colorectal cancer or adenoma. The kit provided by the invention uses the C9orf50 gene as a marker, and diagnosis or auxiliary diagnosis is carried out on colorectal cancer or adenoma by detecting methylation of the gene, so that the kit has higher sensitivity and specificity; the invention provides a new idea for diagnosing colorectal cancer or adenoma.
The invention is realized in the following way:
in one aspect, the invention provides a kit for diagnosis or assisted diagnosis of colorectal or adenoma comprising reagents for detecting methylation of a gene of interest, said gene of interest being the C9orf50 gene.
The C9orf50 gene is located on the negative sense strand of human chromosome 9, with GRCh38.p13 as the reference genome, and specific positions are 129,612,225bp-129,622,275bp, and the positions of the sites or regions referred to herein are all referenced to GRCh38.p13.
The invention discovers that the C9orf50 gene is used as a marker, diagnosis or auxiliary diagnosis can be carried out on colorectal cancer or adenoma by detecting methylation occurrence, and the kit has higher sensitivity and specificity and effectively improves the detection rate of colorectal cancer or adenoma.
In an alternative embodiment, the target region detected by the agent is the full length region of chr9:129619882-129620879 of the C9orf50 gene or a partial region thereof.
The methylation of different areas on the C9orf50 gene is used for diagnosis, the sensitivity and the specificity are different, and the colorectal cancer or adenoma diagnosis is performed by the full-length area of chr9:129619882-129620879 or a partial area thereof, so that the sensitivity and the specificity can be improved.
In alternative embodiments, the target region is selected from any one or a combination of several of the following regions (1) - (5);
region (1): full length or partial region of chr9: 129620154-129620400;
region (2): full length or partial region of Chr9: 129620272-129620431;
region (3): full length or partial region of Chr9: 129620551-129620722;
region (4): full length or partial region of Chr9: 129620328-129620513;
region (5): full length of Chr9:129620018-129620103 or a partial region thereof.
The above regions (1) - (5) or partial regions thereof are used as methylation detection regions, have higher sensitivity and specificity, and are beneficial to improving the accuracy of diagnosis results.
In alternative embodiments, the target region is the positive strand of the chr9:129620154-129620400 region, the positive strand of the chr9:129620272-129620431 region, the positive strand of the chr9:129620551-129620722 region, the negative strand of the chr9:129620328-129620513 region, or the negative strand of the chr9:129620018-129620103 region.
In alternative embodiments, the target region is the Chr9:129620154, chr9:129620166, chr9:129620184, chr9:129620186, chr9:129620192, chr9:129620386, chr9:129620395, chr9:129620397, and Chr9:129620400 sites on the forward strand of the Chr9:129620154-129620400 region.
In alternative embodiments, the target region is the Chr9:129620282, chr9:129620294, chr9:129620355, chr9:129620358, chr9:129620367, chr9:129620410, and Chr9:129620427 sites on the forward strand of the Chr9:129620272-129620431 region.
In alternative embodiments, the target region is the Chr9:129620555, chr9:129620561, chr9:129620564, chr9:129620598, chr9:129620609, chr9:129620611, chr9:129620613, chr9:129620709, chr9:129620714, and Chr9:129620717 sites on the forward strand of the Chr9:129620551-129620722 region.
In alternative embodiments, the target region is the Chr9:129620512, chr9:129620502, chr9:129620499, chr9:129620491, chr9:129620486, chr9:129620484, chr9:129620465, chr9:129620345, chr9:129620342, chr9:129620340, and Chr9:129620332 sites on the negative strand of the Chr9:129620328-129620513 region.
In alternative embodiments, the target region is the Chr9:129620089, chr9:129620086, chr9:129620078, chr9:129620057, chr9:129620055, chr9:129620035, and Chr9:129620024 sites on the negative strand of the Chr9:129620018-129620103 region.
Based on the present disclosure, one of skill in the art can employ any technique known in the art for detecting methylation of a combination of one or more of the above sites to diagnose colorectal or adenoma, whichever technique is employed, is within the scope of the present invention.
In alternative embodiments, the agent effects detection of methylation of the target gene by one or more of the following methods:
methylation-specific PCR, quantitative methylation-specific PCR, bisulfite sequencing, methylation-specific microarray, whole genome methylation sequencing, pyrosequencing, methylation-specific high performance liquid chromatography, digital PCR, methylation-specific high resolution dissolution profile, methylation-sensitive restriction endonuclease, and fluorescent quantitation.
Based on the present disclosure, one of ordinary skill in the art will readily recognize the detection of methylation of a target region using a variety of methods and corresponding reagents. The detection method is not limited to the above, and other methods and corresponding reagent detection are adopted to fall within the protection scope of the invention.
In alternative embodiments, the reagent detects methylation of the target gene by methylation-specific PCR.
In alternative embodiments, the agent comprises one or a combination of several of the following nucleic acid combinations:
the reagent comprises one or a combination of several of the following nucleic acid combinations:
a nucleic acid combination comprising the nucleotides set forth in SEQ ID NO. 4-6; the nucleic acid combination allows detection of methylation in region (1) above.
A nucleic acid combination comprising the nucleotides set forth in SEQ ID NO. 7-9; the nucleic acid combination allows detection of methylation of the above region (2).
A nucleic acid combination comprising the nucleotides set forth in SEQ ID NO. 13-15; the nucleic acid combination allows detection of methylation in region (3) above.
A nucleic acid combination comprising the nucleotides set forth in SEQ ID NO. 22-24; the nucleic acid combination allows detection of methylation of the above region (4).
A nucleic acid combination comprising the nucleotides set forth in SEQ ID NO. 28-30; the nucleic acid combination detects methylation of the above region (5).
On the premise that the detection area is disclosed, other primers and probes for detecting methylation of the target area, which are not described in the invention, can be designed by a person skilled in the art and are used for methylation detection of the C9orf50 gene so as to diagnose or assist diagnosis of colorectal cancer or adenoma, and the design of the primers and/or the probes does not need creative labor, so that the primers and/or the probes belong to the protection scope of the invention.
In an alternative embodiment, the sample to be tested by the kit is selected from any one of plasma, serum, stool and tissue. The kit provided by the invention can detect methylation of target genes extracted from samples such as blood plasma, serum, feces, tissues and the like.
In another aspect, the invention provides the use of a reagent for detecting methylation of a target gene, which is the C9orf50 gene, in the preparation of a kit for diagnosis or assisted diagnosis of colorectal cancer or adenoma.
In an alternative embodiment, the target region detected by the agent is the full length region of chr9:129619882-129620879 of the C9orf50 gene or a partial region thereof.
In alternative embodiments, the target region is selected from any one or a combination of several of the following regions (1) - (5);
region (1): full length or partial region of chr9: 129620154-129620400;
region (2): full length or partial region of Chr9: 129620272-129620431;
region (3): full length or partial region of Chr9: 129620551-129620722;
region (4): full length or partial region of Chr9: 129620328-129620513;
region (5): full length of Chr9:129620018-129620103 or a partial region thereof.
In alternative embodiments, the target region is the positive strand of the chr9:129620154-129620400 region, the positive strand of the chr9:129620272-129620431 region, the positive strand of the chr9:129620551-129620722 region, the negative strand of the chr9:129620328-129620513 region, or the negative strand of the chr9:129620018-129620103 region.
In alternative embodiments, the target region is the Chr9:129620154, chr9:129620166, chr9:129620184, chr9:129620186, chr9:129620192, chr9:129620386, chr9:129620395, chr9:129620397, and Chr9:129620400 sites on the forward strand of the Chr9:129620154-129620400 region.
In alternative embodiments, the target region is the Chr9:129620282, chr9:129620294, chr9:129620355, chr9:129620358, chr9:129620367, chr9:129620410, and Chr9:129620427 sites on the forward strand of the Chr9:129620272-129620431 region.
In alternative embodiments, the target region is the Chr9:129620555, chr9:129620561, chr9:129620564, chr9:129620598, chr9:129620609, chr9:129620611, chr9:129620613, chr9:129620709, chr9:129620714, and Chr9:129620717 sites on the forward strand of the Chr9:129620551-129620722 region.
In alternative embodiments, the target region is the Chr9:129620512, chr9:129620502, chr9:129620499, chr9:129620491, chr9:129620486, chr9:129620484, chr9:129620465, chr9:129620345, chr9:129620342, chr9:129620340, and Chr9:129620332 sites on the negative strand of the Chr9:129620328-129620513 region.
In alternative embodiments, the target region is the Chr9:129620089, chr9:129620086, chr9:129620078, chr9:129620057, chr9:129620055, chr9:129620035, and Chr9:129620024 sites on the negative strand of the Chr9:129620018-129620103 region.
In alternative embodiments, the agent effects detection of methylation of the target gene by one or more of the following methods:
methylation-specific PCR, quantitative methylation-specific PCR, bisulfite sequencing, methylation-specific microarray, whole genome methylation sequencing, pyrosequencing, methylation-specific high performance liquid chromatography, digital PCR, methylation-specific high resolution dissolution profile, methylation-sensitive restriction endonuclease, and fluorescent quantitation.
In alternative embodiments, the reagent detects methylation of the target gene by methylation-specific PCR.
In alternative embodiments, the agent comprises one or a combination of several of the following nucleic acid combinations:
a nucleic acid combination comprising the nucleotides set forth in SEQ ID NO. 4-6;
a nucleic acid combination comprising the nucleotides set forth in SEQ ID NO. 7-9;
a nucleic acid combination comprising the nucleotides set forth in SEQ ID NO. 13-15;
a nucleic acid combination comprising the nucleotides set forth in SEQ ID NO. 22-24;
a nucleic acid combination comprising the nucleotides set forth in SEQ ID No. 28-30.
Drawings
In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings that are needed in the embodiments will be briefly described below, it being understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and other related drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.
FIG. 1 is a ROC curve for region a, region b, region c, region d, region e and region f, distinguishing colorectal adenoma samples from normal samples;
FIG. 2 is a ROC curve for region g, region h, region i and region j distinguishing colorectal adenoma samples from normal samples;
FIG. 3 is a ROC curve for region a, region b, region c, region d, region e and region f distinguishing colorectal cancer samples from normal samples;
fig. 4 is a ROC curve for distinguishing colorectal cancer samples from normal samples for region g, region h, region i, and region j.
Detailed Description
In order to make the objects, technical solutions and advantages of the embodiments of the present invention more clear, the technical solutions of the embodiments of the present invention will be clearly and completely described below. The specific conditions are not noted in the examples and are carried out according to conventional conditions or conditions recommended by the manufacturer. The reagents or apparatus used were conventional products commercially available without the manufacturer's attention.
The features and capabilities of the present invention are described in further detail below in connection with the examples.
Example 1
The embodiment provides a kit for diagnosis or auxiliary diagnosis of colorectal cancer or adenoma, which comprises a nucleotide combination 1, wherein the nucleotide combination 1 comprises nucleotides shown in SEQ ID NO.1-3, and the specific sequence table 1. The nucleotide combination 1 can detect methylation of the positive strand (region a) of the chr9:129619882-129620048 region on the C9orf50 gene;
the base sequence of the positive strand of region a is as follows:
TAGTCATGTGGCCTCGGGGTGATGGCAGACCAGCCCTCAAGGACGGGTTGCGAGGGCTCTGAGATACTCAGCTAACATTAGCATCCTTCTAGCCTGGGTGGTGGGGTGGTGGGTGCGGGGACACAAGGGACCACCCCCCACCGGAAATGACTCGGGCCCGCCCCCCG。
the nucleotides shown in SEQ ID Nos. 1-3 detect methylation of cytosine at positions of the forward strand of the region, chr9:129619896, chr9:129619925, chr9:129619932, chr9:129620034, chr9:129620040 and chr9: 129620047.
Example 2
The embodiment provides a kit for diagnosis or auxiliary diagnosis of colorectal cancer or adenoma, which comprises a nucleotide combination 2, wherein the nucleotide combination 2 comprises nucleotides shown in SEQ ID NO.4-6, and the specific sequence table 1. This nucleotide combination 2 detects methylation of the positive strand (region b) of the chr9:129620154-129620400 region of the C9orf50 gene.
The base sequence of the positive strand in region b is as follows:
CGCCCAAGAAGTCGGGGTCCTCCCTGGCCACGCGCCTCCGGGGGCGCTCGCGCTCTCCAGGCCCTGGCTGCCTGGGCGCCGATTCCCGGGACGCGCCGGCCGACAGCAGGGGAGGCGGCAGCAGGGACCGCAGCAGCCCCCGCTTCCGCACGGCCCGCCGGGTCGCGGTGAGCAAGGCGGGCAGGCGCGGCGGGAGGCGTCCGACGCCCACCCCGGGCTTGGCGTCCCCTTCCGGCCACCACGCGGC。
the nucleotides shown in SEQ ID Nos. 4-6 detect methylation of cytosine at positions of the forward strand of the region, where the positions are Chr9:129620154, chr9:129620166, chr9:129620184, chr9:129620186, chr9:129620192, chr9:129620386, chr9:129620395, chr9:129620397 and Chr9: 129620400.
Example 3
The embodiment provides a kit for diagnosis or auxiliary diagnosis of colorectal cancer or adenoma, which comprises a nucleotide combination 3, wherein the nucleotide combination 3 comprises nucleotides shown in SEQ ID NO.7-9, and the specific sequence table 1. The nucleotide combination 3 can detect methylation of the forward strand (region C) of the Chr9:129620272-129620431 region on the C9orf50 gene.
The base sequence of the positive strand in region c is as follows:
CAGCAGGGACCGCAGCAGCCCCCGCTTCCGCACGGCCCGCCGGGTCGCGGTGAGCAAGGCGGGCAGGCGCGGCGGGAGGCGTCCGACGCCCACCCCGGGCTTGGCGTCCCCTTCCGGCCACCACGCGGCGCCGCCCCCCGGGATCCTCCAGTCCCCGGAG。
the nucleotides shown in SEQ ID Nos. 7-9 allow for the detection of methylation of cytosine at positions of the forward strand of the region, chur 9:129620282, chur 9:129620294, chur 9:129620355, chur 9:129620358, chur 9:129620367, chur 9:129620410 and Chur 9: 129620427.
Example 4
The embodiment provides a kit for diagnosis or auxiliary diagnosis of colorectal cancer or adenoma, which comprises a nucleotide combination 4, wherein the nucleotide combination 4 comprises nucleotides shown in SEQ ID NO.10-12, and the specific sequence table 1. The nucleotide combination 4 can detect methylation of the forward strand (region d) of the Chr9:129620469-129620541 region of the C9orf50 gene.
The base sequence of the positive strand in region d is as follows:
TCAGCTTGGGCAGCCGCGGGTCGCTGCTGCGTCGGAAGTCTCCGTCGCCAGGGAGCCCCTTGGGCGCCAGGTC。
the nucleotides shown in SEQ ID Nos. 10-12 detect methylation of cytosine at positions of the forward strand of the region, where the positions are Chur 9:129620483, chur 9:129620485, chur 9:129620498, chur 9:129620501, chur 9:129620511, chur 9:129620514 and Chur 9: 129620533.
Example 5
The embodiment provides a kit for diagnosis or auxiliary diagnosis of colorectal cancer or adenoma, which comprises a nucleotide combination 5, wherein the nucleotide combination 5 comprises nucleotides shown in SEQ ID NO.13-15, and the specific sequence table 1. This nucleotide set 5 detects methylation of the forward strand of the Chr9:129620551-129620722 region (region e) of the C9orf50 gene.
The base sequence of the positive strand in region e is as follows:
TGGGCGAAGTCGACGCCAGAACATGCTTGGCCCCGCACTCAGCTCACCGCACCCTCAGCGCGCGTGGGTGGGGGGCGCCGGCTGAGGTGGGGAGGGCATAGTCCAGCCCCAGGCCATAGTGCCCCGGGCGGGGCAGCGCGGTGCGGGGTGAACGCCACCGGCCCGGCGGACA。
the nucleotides shown in SEQ ID Nos. 13-15 detect methylation of cytosine at positions of the forward strand of the region, where the positions are Chr9:129620555, chr9:129620561, chr9:129620564, chr9:129620598, chr9:129620609, chr9:129620611, chr9:129620613, chr9:129620709, chr9:129620714 and Chr9: 129620717.
Example 6
The embodiment provides a kit for diagnosis or auxiliary diagnosis of colorectal cancer or adenoma, which comprises a nucleotide combination 6, wherein the nucleotide combination 6 comprises nucleotides shown in SEQ ID NO.16-18, and the specific sequence table 1. The nucleotide combination 6 can detect methylation of the forward strand (region f) of the Chr9:129620729-129620879 region of the C9orf50 gene.
The base sequence of the forward strand in region f is as follows:
GGCTTCAGGCGAGAGCTCCCAGAGCCTCTGTTTCCTCACCTGAAAAATGGTGACAGCAAGAGTAGCCAACTTTGGGGGTTGCTGTGACGTTTAAATGAGCAAGTACATGCCAGTCTTAGAACAGCAAGCTCGGTACAGTGCCAGGCACGCTGG。
the nucleotides shown in SEQ ID Nos. 16-18 detect methylation of cytosine at positions chr9:129620738, chr9:129620816, chr9:129620859 and chr9:129620876 on the forward strand of the region.
Example 7
The embodiment provides a kit for diagnosis or auxiliary diagnosis of colorectal cancer or adenoma, which comprises a nucleotide combination 7, wherein the nucleotide combination 7 comprises nucleotides shown in SEQ ID NO.19-21, and the specific sequence table 1. This nucleotide combination 7 detects methylation of the negative strand (region g) of the Chr9:129620550-129620735 region on the C9orf50 gene.
The base sequence of the negative strand in region g is as follows:
TGAAGCCACTCGCTGTCCGCCGGGCCGGTGGCGTTCACCCCGCACCGCGCTGCCCCGCCCGGGGCACTATGGCCTGGGGCTGGACTATGCCCTCCCCACCTCAGCCGGCGCCCCCCACCCACGCGCGCTGAGGGTGCGGTGAGCTGAGTGCGGGGCCAAGCATGTTCTGGCGTCGACTTCGCCCAG。
the nucleotides shown in SEQ ID Nos. 19-21 allow for the detection of methylation of cytosine at positions of the negative strand of the region, chr9:129620725, chr9:129620718, chr9:129620715, chr9:129620695, chr9:129620690, chr9:129620688, chr9:129620680, chr9:129620565, chr9:129620562 and Chr9: 129620556.
Example 8
The embodiment provides a kit for diagnosis or auxiliary diagnosis of colorectal cancer or adenoma, which comprises a nucleotide combination 8, wherein the nucleotide combination 8 comprises nucleotides shown in SEQ ID NO.22-24, and the specific sequence table 1. This nucleotide set 8 detects methylation of the negative strand (region h) of the Chr9:129620328-129620513 region on the C9orf50 gene.
The base sequence of the negative strand in region h is as follows:
ACGGAGACTTCCGACGCAGCAGCGACCCGCGGCTGCCCAAGCTGACCCCGCCCGCGCTCCGAGCGGCTCTGGGCGCGCGGGGCTCCGGGGACTGGAGGATCCCGGGGGGCGGCGCCGCGTGGTGGCCGGAAGGGGACGCCAAGCCCGGGGTGGGCGTCGGACGCCTCCCGCCGCGCCTGCCCGCCT。
the nucleotides shown in SEQ ID Nos. 22-24 allow for the detection of methylation of cytosine at positions of the negative strand of the region, chr9:129620512, chr9:129620502, chr9:129620499, chr9:129620491, chr9:129620486, chr9:129620484, chr9:129620465, chr9:129620345, chr9:129620342, chr9:129620340 and chr9: 129620332.
Example 9
The embodiment provides a kit for diagnosis or auxiliary diagnosis of colorectal cancer or adenoma, which comprises a nucleotide combination 9, wherein the nucleotide combination 9 comprises nucleotides shown in SEQ ID NO.25-27, and the specific sequence table 1. This nucleotide combination 9 allows detection of methylation of the negative strand (region i) of the Chr9:129620165-129620291 region on the C9orf50 gene.
The base sequence of the negative strand of region i is as follows:
GGCTGCTGCGGTCCCTGCTGCCGCCTCCCCTGCTGTCGGCCGGCGCGTCCCGGGAATCGGCGCCCAGGCAGCCAGGGCCTGGAGAGCGCGAGCGCCCCCGGAGGCGCGTGGCCAGGGAGGACCCCGA。
the nucleotides shown in SEQ ID Nos. 25-27 allow the methylation of cytosines at positions Chr9:129620283, chr9:129620205, chr9:129620185 and Chr9:129620167 on the negative strand of this region to be detected.
Example 10
The embodiment provides a kit for diagnosis or auxiliary diagnosis of colorectal cancer or adenoma, which comprises a nucleotide combination 10, wherein the nucleotide combination 10 comprises nucleotides shown in SEQ ID NO.28-30, and the specific sequence table 1. This nucleotide set 10 detects methylation of the negative strand (region j) of the Chr9:129620018-129620103 region on the C9orf50 gene.
The base sequence of the negative strand of region j is as follows:
CTCCAGGAGAAGTGCGCCGAGGAGCCGGAGCCACTGAGTGAGGCCCCGCGGGGCCCGGGGGGCGGGCCCGAGTCATTTCCGGTGGG。
the nucleotides shown in SEQ ID Nos. 28-30 allow the methylation of cytosine at positions Chr9:129620089, chr9:129620086, chr9:129620078, chr9:129620057, chr9:129620055, chr9:129620035 and Chr9:129620024 on the negative strand of the region.
TABLE 1
Example 11
This example provides a method for diagnosis of colorectal or adenomatous cancer using any one of the kits of examples 1-10, comprising the steps of:
1. extraction of DNA template:
the sample used was a blood sample and was subjected to plasma cfDNA extraction using the magnetic bead serum/plasma free DNA extraction kit (DP 709) from the company sienna biochemistry technology (beijing), limited, see kit instructions for specific operation.
2. Conversion of sulfite
The nucleic acid transformation Kit is EZ DNA Methylation-Gold (TM) Kit of ZYMO RESEARCH, and specific experimental operation is described in the specification of the Kit.
3. PCR reaction
The PCR reaction system using beta-actin as an internal reference gene is shown in Table 2. Beta-actin is used as an internal reference gene, wherein the upstream primer of the beta-actin is as follows: taggttagacgggggatatgtag (SEQ ID NO. 31); the beta-actin downstream primer is: cacaataaatctaaacaaactcccc (SEQ ID NO. 32); the beta-actin probe is as follows: gtgtgctggggtcttggga (SEQ ID NO. 33).
The reporter group at the 5 'end of the probe of the detection target area is FAM, the quenching group at the 3' end is MGB, the reporter group at the 5 'end of the beta-actin probe is VIC, and the quenching group at the 3' end is BHQ1.
TABLE 2
Component (A) | Specification of specification | Volume (mu L) |
Buffer solution | 5× | 5 |
dNTPs | 2.5mM each | 2 |
Upstream primer | 10μM | 1 |
Downstream primer | 10μM | 1 |
Probe with a probe tip | 10μM | 1 |
Beta-actin upstream primer | 10μM | 1 |
Beta-actin downstream primer | 10μM | 1 |
Beta-actin probe | 10μM | 1 |
DNAzymes | 5U/μL | 0.5 |
DNA of sample to be tested | / | 5 |
Purified water | / | Supplement to 25 |
The PCR reaction conditions are shown in Table 7 below.
TABLE 3 Table 3
Ct value reading: after the PCR is completed, a baseline is adjusted, and a threshold value is set in an exponential growth phase of an amplification curve to obtain Ct values of all genes of a sample.
And (3) quality control: synchronous detection is carried out on a negative control and a positive control during each detection, wherein the negative control is purified water, the positive control is an artificial synthetic plasmid containing beta-actin gene and target gene sequence, and the concentration is 10 3 Copy/microliter, negative control should have no significant exponential growth phase, positive control should have significant exponential growth phase, and Ct value of positive control should be between 26-30. Negative control, yangAfter both the sex control and the reference gene meet the requirements, the experiment is effective, and the next sample result can be judged. Otherwise, when the experiment is invalid, the detection is needed again.
Result analysis and interpretation method:
ROC analysis was performed using SPSS software to evaluate diagnostic efficacy of colorectal cancer and normal and colorectal adenoma samples and normal samples for each detection region, the state variable for normal samples was recorded as "0" and the state variable for cancer/adenoma samples was recorded as "1" during the analysis, the Ct value at maximum about log index was taken as cut-off, and the corresponding sensitivity, specificity and average AUC values were recorded.
For samples with unknown pathological states, after PCR is completed, the detection Ct value of each sample is read, and the samples are interpreted according to the comparison of the Ct value and a threshold value, and the reference method is as follows:
negative indicates that the sample subject has little or no colorectal adenoma/colorectal carcinoma, or both, and positive indicates that the sample subject has little or no colorectal adenoma/colorectal carcinoma, or both.
Experimental example 1
50 healthy human plasma samples, 94 colorectal adenoma patient plasma samples, 94 colorectal carcinoma patient plasma sample samples, 238 samples were tested by the method of example 11, the specificity of these markers was calculated from the results of the healthy human plasma samples (negative samples), and the detection sensitivity of these markers for colorectal adenoma and colorectal carcinoma was calculated from the detection results of colorectal adenoma and colorectal carcinoma samples (positive samples). ROC analysis was performed using SPSS software to evaluate the diagnostic efficacy of colorectal cancer and normal specimens and colorectal adenoma and normal specimens for each test area, taking the Ct value at maximum about the log index as the cut-off value, and recording the corresponding sensitivity, specificity, and average AUC values. The results are as follows.
(1) The detection sensitivity and specificity of the C9orf50 plus strand at region a, region b, region C, region d, region e and region f are shown in Table 4, and FIGS. 1 and 3.
TABLE 4 Table 4
From the above results, it can be seen that the AUC values of the C9orf50 gene in the positive strand, for region b, region C and region e, were significantly higher for both adenoma and normal samples than for region a, region d and region f. The sensitivity of the C9orf50 gene in the region b, the region C and the region e is more than 80 percent, the specificity is more than 90 percent, the detection sensitivity and the specificity of the colorectal cancer are more than 85 percent, the detection sensitivity of the C9orf50 gene in the region a, the region d and the region f for adenoma is less than 70 percent, and the detection specificity of the C9orf50 gene in the region a and the region f is only less than 80 percent; the AUC values for the C9orf50 gene positive strand, for region b, region C and region e, were significantly higher for both the cancer and normal samples than for region a, region d and region f. The detection sensitivity of the region d and the region to the cancer is only 70%, and the detection specificity of the region a and the region f to the cancer is not more than 80%. Overall, the detection effect of the region b, the region C and the region e on the positive strand of the C9orf50 gene is better than that of the region a, the region d and the region f.
(2) The detection sensitivity and specificity of region g, region h, region i and region j on the negative strand of C9orf50 are shown in Table 5, as well as FIGS. 2 and 4.
TABLE 5
From the above results, it can be seen that the AUC values of region h, region i on the negative strand of the C9orf50 gene, which distinguish adenoma from normal samples, are significantly higher than those of regions g and j. The sensitivity of the region h and the region i of the C9orf50 gene to colorectal carcinoma adenoma is over 75%, the specificity is over 90%, the adenoma detection specificity of the region g is only 77%, and the detection sensitivity and the specificity of the region j to adenoma are not high (the sensitivity is less than 70%, and the specificity is less than 90%); the AUC values of the region h and the region i on the negative strand of the C9orf50 gene for distinguishing cancer from normal samples are obviously higher than those of the region g and the region j, the detection sensitivity of the region h and the region i on the cancer is more than 80%, the specificity is more than 90%, the sensitivity of the region g and the region j is more than 80%, but the specificity is not more than 80%, and the detection effect of the region h and the region i on the negative strand of the C9orf50 gene is better than that of the region g and the region j as a whole.
The above description is only of the preferred embodiments of the present invention and is not intended to limit the present invention, but various modifications and variations can be made to the present invention by those skilled in the art. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
Sequence listing
<110> Wuhan Ai Misen life technologies Co., ltd
<120> diagnostic kit for colorectal cancer or adenoma
<160> 33
<170> SIPOSequenceListing 1.0
<210> 1
<211> 21
<212> DNA
<213> artificial sequence
<400> 1
tagttatgtg gtttcggggt g 21
<210> 2
<211> 19
<212> DNA
<213> artificial sequence
<400> 2
cgaaaaacga acccgaatc 19
<210> 3
<211> 20
<212> DNA
<213> artificial sequence
<400> 3
tttaaggacg ggttgcgagg 20
<210> 4
<211> 21
<212> DNA
<213> artificial sequence
<400> 4
cgtttaagaa gtcggggttt t 21
<210> 5
<211> 19
<212> DNA
<213> artificial sequence
<400> 5
gccgcgtaat aaccgaaaa 19
<210> 6
<211> 19
<212> DNA
<213> artificial sequence
<400> 6
ttggttacgc gttttcggg 19
<210> 7
<211> 24
<212> DNA
<213> artificial sequence
<400> 7
tagtagggat cgtagtagtt ttcg 24
<210> 8
<211> 22
<212> DNA
<213> artificial sequence
<400> 8
ctccgaaaac taaaaaatcc cg 22
<210> 9
<211> 22
<212> DNA
<213> artificial sequence
<400> 9
ttcgacgttt atttcgggtt tg 22
<210> 10
<211> 19
<212> DNA
<213> artificial sequence
<400> 10
ttagtttggg tagtcgcgg 19
<210> 11
<211> 21
<212> DNA
<213> artificial sequence
<400> 11
aacctaacgc ccaaaaaact c 21
<210> 12
<211> 21
<212> DNA
<213> artificial sequence
<400> 12
ttgcgtcgga agttttcgtc g 21
<210> 13
<211> 19
<212> DNA
<213> artificial sequence
<400> 13
tgggcgaagt cgacgttag 19
<210> 14
<211> 19
<212> DNA
<213> artificial sequence
<400> 14
tatccgccga accgataac 19
<210> 15
<211> 25
<212> DNA
<213> artificial sequence
<400> 15
tatcgtattt ttagcgcgcg tgggt 25
<210> 16
<211> 22
<212> DNA
<213> artificial sequence
<400> 16
ggttttaggc gagagttttt ag 22
<210> 17
<211> 24
<212> DNA
<213> artificial sequence
<400> 17
ccaacgtacc taacactata ccga 24
<210> 18
<211> 25
<212> DNA
<213> artificial sequence
<400> 18
taattttggg ggttgttgtg acgtt 25
<210> 19
<211> 22
<212> DNA
<213> artificial sequence
<400> 19
tgaagttatt cgttgttcgt cg 22
<210> 20
<211> 20
<212> DNA
<213> artificial sequence
<400> 20
ctaaacgaaa tcgacgccaa 20
<210> 21
<211> 24
<212> DNA
<213> artificial sequence
<400> 21
atttcgtatc gcgttgtttc gttc 24
<210> 22
<211> 23
<212> DNA
<213> artificial sequence
<400> 22
acggagattt tcgacgtagt agc 23
<210> 23
<211> 19
<212> DNA
<213> artificial sequence
<400> 23
aaacgaacaa acgcgacga 19
<210> 24
<211> 25
<212> DNA
<213> artificial sequence
<400> 24
ttcgcggttg tttaagttga tttcg 25
<210> 25
<211> 20
<212> DNA
<213> artificial sequence
<400> 25
ggttgttgcg gtttttgttg 20
<210> 26
<211> 21
<212> DNA
<213> artificial sequence
<400> 26
tcgaaatcct ccctaaccac g 21
<210> 27
<211> 25
<212> DNA
<213> artificial sequence
<400> 27
ttaggtagtt agggtttgga gagcg 25
<210> 28
<211> 21
<212> DNA
<213> artificial sequence
<400> 28
ttttaggaga agtgcgtcga g 21
<210> 29
<211> 20
<212> DNA
<213> artificial sequence
<400> 29
cccaccgaaa ataactcgaa 20
<210> 30
<211> 25
<212> DNA
<213> artificial sequence
<400> 30
tcggagttat tgagtgaggt ttcgc 25
<210> 31
<211> 23
<212> DNA
<213> artificial sequence
<400> 31
taggttagac gggggatatg tag 23
<210> 32
<211> 25
<212> DNA
<213> artificial sequence
<400> 32
cacaataaat ctaaacaaac tcccc 25
<210> 33
<211> 19
<212> DNA
<213> artificial sequence
<400> 33
gtgtgctggg gtcttggga 19
Claims (7)
1. A kit for the diagnosis or assisted diagnosis of colorectal cancer or colorectal adenoma, characterized in that it contains a reagent for detecting methylation of a target gene of a target region, said target gene being the C9orf50 gene;
taking GRCh38.p13 as a reference genome, wherein the target region is the negative strand of the region of Ch9: 129620328-129620513 or the negative strand of the region of Ch9: 129620018-129620103;
the target region is the sites of Chr9:129620512, chr9:129620502, chr9:129620499, chr9:129620491, chr9:129620486, chr9:129620484, chr9:129620465, chr9:129620345, chr9:129620342, chr9:129620340 and Chr9:129620332 on the negative strand of the Chr9:129620328-129620513 region;
the target region is the sites of Chr9:129620089, chr9:129620086, chr9:129620078, chr9:129620057, chr9:129620055, chr9:129620035 and Chr9:129620024 on the negative chain of the Chr9:129620018-129620103 region;
the reagent comprises one or a combination of several of the following nucleic acid combinations:
nucleic acid combinations of the nucleotides shown in SEQ ID No. 22-24;
nucleic acid combinations of the nucleotides shown in SEQ ID No. 28-30.
2. The kit of claim 1, wherein the reagent enables detection of methylation of the target gene by one or more of the following methods:
methylation-specific PCR, quantitative methylation-specific PCR, bisulfite sequencing, methylation-specific microarray, whole genome methylation sequencing, pyrosequencing, methylation-specific high performance liquid chromatography, digital PCR, methylation-specific high resolution dissolution profile, methylation-sensitive restriction endonuclease, and fluorescent quantitation.
3. The kit of claim 2, wherein the reagents detect methylation of the target gene by methylation-specific PCR.
4. Use of a reagent for detecting methylation of a target gene for the preparation of a kit for diagnosis or assisted diagnosis of colorectal cancer or colorectal adenoma, characterized in that the target gene is the C9orf50 gene;
taking GRCh38.p13 as a reference genome, wherein the target region of the target gene is the negative strand of the region of Ch9: 129620328-129620513 or the negative strand of the region of Ch9: 129620018-129620103;
the target region is the sites of Chr9:129620512, chr9:129620502, chr9:129620499, chr9:129620491, chr9:129620486, chr9:129620484, chr9:129620465, chr9:129620345, chr9:129620342, chr9:129620340 and Chr9:129620332 on the negative strand of the Chr9:129620328-129620513 region;
the target region is the sites of Chr9:129620089, chr9:129620086, chr9:129620078, chr9:129620057, chr9:129620055, chr9:129620035 and Chr9:129620024 on the negative chain of the Chr9:129620018-129620103 region.
5. The use according to claim 4, wherein the detection of methylation of the target gene is achieved by one or more of the following methods:
methylation-specific PCR, quantitative methylation-specific PCR, bisulfite sequencing, methylation-specific microarray, whole genome methylation sequencing, pyrosequencing, methylation-specific high performance liquid chromatography, digital PCR, methylation-specific high resolution dissolution profile, methylation-sensitive restriction endonuclease, and fluorescent quantitation.
6. The use according to claim 5, wherein the reagent detects methylation of the target gene by methylation-specific PCR.
7. The use of claim 6, wherein the agent comprises one or a combination of several of the following nucleic acid combinations:
nucleic acid combinations of the nucleotides shown in SEQ ID No. 22-24;
nucleic acid combinations of the nucleotides shown in SEQ ID No. 28-30.
Priority Applications (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202110107656.3A CN114807362B (en) | 2021-01-27 | 2021-01-27 | Diagnostic kit for colorectal cancer or adenoma |
PCT/CN2021/120581 WO2022160750A1 (en) | 2021-01-27 | 2021-09-26 | Diagnostic kit for colorectal cancer or adenoma |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202110107656.3A CN114807362B (en) | 2021-01-27 | 2021-01-27 | Diagnostic kit for colorectal cancer or adenoma |
Publications (2)
Publication Number | Publication Date |
---|---|
CN114807362A CN114807362A (en) | 2022-07-29 |
CN114807362B true CN114807362B (en) | 2023-11-10 |
Family
ID=82524422
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN202110107656.3A Active CN114807362B (en) | 2021-01-27 | 2021-01-27 | Diagnostic kit for colorectal cancer or adenoma |
Country Status (2)
Country | Link |
---|---|
CN (1) | CN114807362B (en) |
WO (1) | WO2022160750A1 (en) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN118421801A (en) * | 2024-07-03 | 2024-08-02 | 深圳市艾斯基因科技有限公司 | Colorectal cancer hypermethylation target and application thereof |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2014062218A1 (en) * | 2012-10-16 | 2014-04-24 | University Of Southern California | Colorectal cancer dna methylation markers |
RU2630669C1 (en) * | 2016-07-21 | 2017-09-11 | Федеральное бюджетное учреждение науки "Государственный научный центр вирусологии и биотехнологии "Вектор" (ФБУН ГНЦ ВБ "Вектор") | Method for determination of methylation of colorectal cancer tumor marker genes regulatory regions pucgpy sites by glad-pcr analysis, and set of oligonucleotide primers and fluorescence-labelled probes for implementation of this method |
-
2021
- 2021-01-27 CN CN202110107656.3A patent/CN114807362B/en active Active
- 2021-09-26 WO PCT/CN2021/120581 patent/WO2022160750A1/en active Application Filing
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2014062218A1 (en) * | 2012-10-16 | 2014-04-24 | University Of Southern California | Colorectal cancer dna methylation markers |
RU2630669C1 (en) * | 2016-07-21 | 2017-09-11 | Федеральное бюджетное учреждение науки "Государственный научный центр вирусологии и биотехнологии "Вектор" (ФБУН ГНЦ ВБ "Вектор") | Method for determination of methylation of colorectal cancer tumor marker genes regulatory regions pucgpy sites by glad-pcr analysis, and set of oligonucleotide primers and fluorescence-labelled probes for implementation of this method |
Also Published As
Publication number | Publication date |
---|---|
CN114807362A (en) | 2022-07-29 |
WO2022160750A1 (en) | 2022-08-04 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US11220714B2 (en) | Method of diagnosing bladder cancer | |
US20080145852A1 (en) | Methods and compositions for detecting adenoma | |
EP3800273A1 (en) | Use of detection reagent for detecting methylation of genes associated with colorectal cancer, and kit | |
WO2010113529A1 (en) | Method for detection of colorectal tumor | |
US10214778B2 (en) | Methods and nucleotide fragments of predicting occurrence, metastasis of cancers and patients' postoperative survival in vitro | |
EP4158068A1 (en) | Detection of colorectal neoplasms | |
CN113355415B (en) | Detection reagent and kit for diagnosis or auxiliary diagnosis of esophageal cancer | |
CN109593847B (en) | Primer pair, kit and method for detecting stability of NR24 locus of microsatellite | |
CN113789388B (en) | Esophageal cancer gene methylation level detection reagent and application thereof | |
CN114807362B (en) | Diagnostic kit for colorectal cancer or adenoma | |
CN106755293B (en) | Lung cancer auxiliary diagnosis related lncRNA marker and application thereof | |
CN111363811B (en) | Lung cancer diagnostic agent and kit based on FOXD3 gene | |
CN115433778B (en) | Detection reagent and kit for detecting colorectal cancer or colorectal adenoma related gene methylation and application of detection reagent and kit | |
Hunt | Understanding the genotype of follicular thyroid tumors | |
CN112375824A (en) | Application of MSC as cervical cancer diagnosis, prognosis and/or treatment marker | |
CN113430272B (en) | Reagent and kit for diagnosis or auxiliary diagnosis of esophageal cancer or precancerous lesion and application of reagent and kit | |
CN107326092B (en) | Application of colorectal cancer-related miRNA as biomarker and colorectal cancer detection kit | |
CN116144782A (en) | Combined marker for lung cancer detection and application thereof | |
CN116121387A (en) | Combined marker for colorectal cancer detection and application thereof | |
CN115537464B (en) | Diagnostic or auxiliary diagnostic reagent, nucleic acid combination, kit and application of colorectal cancer or precancerous lesions | |
CN104711368A (en) | Noninvasive polygenic hereditary colorectal cancer detection kit based on next-generation sequencing technology | |
EP2978861B1 (en) | Unbiased dna methylation markers define an extensive field defect in histologically normal prostate tissues associated with prostate cancer: new biomarkers for men with prostate cancer | |
CN102732516B (en) | Multiplex nested methylation specific PCR (polymerase chain reaction) amplification primer and use method and application thereof | |
CN114941028B (en) | Reagent and kit for detecting and diagnosing colorectal cancer | |
Bose et al. | Factors Affecting Performance of DNA Methylation as a Potential Biomarker in Ascites for Peritonitis and Peritoneal Carcinomatosis. |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |