CN114807362A

CN114807362A - Diagnostic kit for colorectal cancer or adenoma

Info

Publication number: CN114807362A
Application number: CN202110107656.3A
Authority: CN
Inventors: 张良禄; 董兰兰; 周谛晗; 孙帆; 吴志诚; 万康康; 李婷婷
Original assignee: Wuhan Aimisen Life Technology Co ltd
Current assignee: Wuhan Aimisen Life Technology Co ltd
Priority date: 2021-01-27
Filing date: 2021-01-27
Publication date: 2022-07-29
Anticipated expiration: 2041-01-27
Also published as: CN114807362B; WO2022160750A1

Abstract

The invention discloses a diagnostic kit for colorectal cancer or adenoma, and relates to the technical field of tumor diagnosis. The kit disclosed by the invention contains a reagent for detecting methylation of target genes, wherein the target genes comprise C9orf50 genes. The diagnostic kit disclosed by the invention takes the C9orf50 gene as a marker, detects the methylation result of the gene to diagnose or assist in diagnosing the colorectal cancer or adenoma, and has higher sensitivity and specificity; the invention provides a new idea for diagnosing colorectal cancer or adenoma.

Description

Diagnostic kit for colorectal cancer or adenoma

Technical Field

The invention relates to the technical field of tumor diagnosis, in particular to a diagnostic kit for colorectal cancer or adenoma.

Background

Colorectal cancer is one of the most common malignant tumors worldwide, and if the colorectal cancer is discovered early, the five-year survival rate of the colorectal cancer can be as high as 90%, and if the colorectal cancer is discovered later, the five-year survival rate of the colorectal cancer is less than 10%. Colorectal cancer typically develops from benign precancerous polyps, which are locally growing or aggregate of abnormal cells within the intestinal mucosa protruding into the intestinal lumen. Over time, the dividing cells in these polyps may accumulate enough genetic changes to gain the ability to invade the intestinal wall, which is a hallmark of the onset of colorectal cancer formation, and eventually they may spread to regional lymph nodes and distant metastatic sites. Fortunately, only a small fraction of polyps eventually develop into cancer, and for those that have already developed into cancer, the development process also typically takes years or even decades, so early detection can reduce the incidence of colorectal cancer.

There are two main types of potentially malignant polyps: adenomas and sessile jagged polyps, both types differing from the risk of developing colorectal cancer. In general, most adenomas have the tubular histological features of small, rounded atypical glands, but as adenomas grow, areas of generally filamentous structure are formed, described in pathological reports as villous or tubulous. As the name suggests, adenomas are characterized by dysplasia (low degree of fibrosis and structural dysplasia). Tubular renal glands and villous adenomas, especially those with a villous content of 25%, are generally larger in size and have a greater potential for cryptic carcinoma cells, whereas sessile jagged polyps are flat, like carpet. Sessile serrated polyps include sessile serrated adenomas, traditional serrated adenomas and mixed polyps, all of which are associated with the development of colorectal cancer. As polyp size increases, the risk of adenomas developing into colorectal cancer also increases, with 60% -70% of colorectal cancers developing from adenomas. The remaining 25% to 35% of CRC developed from sessile jagged polyps.

From the above, it can be known that, the improvement of the detection rate of adenoma is very important to reduce the morbidity and mortality of colorectal cancer, and most of the detection markers disclosed in the prior art have low detection rate of colorectal cancer and adenoma, and have low sensitivity and specificity.

In view of this, the invention is particularly proposed.

Disclosure of Invention

The invention aims to provide a diagnostic kit for colorectal cancer or adenoma. The kit provided by the invention takes the C9orf50 gene as a marker, and has higher sensitivity and specificity by detecting methylation of the gene to diagnose or assist in diagnosing colorectal cancer or adenoma; the invention provides a new idea for diagnosing colorectal cancer or adenoma.

The invention is realized by the following steps:

in one aspect, the present invention provides a kit for diagnosis or aided diagnosis of colorectal cancer or adenoma, which contains a reagent for detecting methylation of a target gene, which is C9orf50 gene.

GRCh38.p13 is taken as a reference genome, the C9orf50 gene is positioned on the negative strand of human chromosome 9, the specific position is 129,612,225bp-129,622,275bp, and the positions of the sites or regions mentioned in the text are all taken as reference GRCh38. p13.

The invention discovers that the C9orf50 gene is used as a marker, and the diagnosis or the auxiliary diagnosis of the colorectal cancer or the adenoma can be carried out by detecting the occurrence of the methylation of the gene, so that the sensitivity and the specificity are higher, and the detection rate of the colorectal cancer or the adenoma is effectively improved.

In alternative embodiments, the target region detected by the reagent is the full-length region or a partial region of chr9:129619882-129620879 of the C9orf50 gene.

The diagnosis of the colorectal cancer or adenoma is carried out by methylation of different regions on the C9orf50 gene, has different sensitivity and specificity, and can improve the sensitivity and specificity by carrying out the diagnosis of the colorectal cancer or adenoma in the full-length region or partial region of chr9: 129619882-129620879.

In alternative embodiments, the target region is selected from any one or a combination of regions (1) - (5) below;

region (1): the whole length of the chr9:129620154-129620400 or a partial area thereof;

region (2): the whole length of the Chr9:129620272-129620431 or a partial region thereof;

region (3): the whole length of the Chr9:129620551-129620722 or a partial region thereof;

region (4): the whole length or partial area of the Chr9: 129620328-129620513;

region (5): the whole length of the Chr9: 129620018-.

The regions (1) - (5) or partial regions thereof are used as methylated detection regions, so that the sensitivity and specificity are higher, and the accuracy of a diagnosis result is improved.

In alternative embodiments, the target regions are the positive strand of the region Chr9:129620154-129620400, the positive strand of the region Chr9:129620272-129620431, the positive strand of the region Chr9:129620551 551-551 129620620722, the negative strand of the region Chr9:129620328-129620513, or the negative strand of the region Chr9: 129620018-129620103.

In alternative embodiments, the target region is the Chr9:129620154, Chr9:129620166, Chr9:129620184, Chr9:129620186, Chr9:129620192, Chr9:129620386, Chr9:129620395, Chr9:129620397 and Chr9:129620400 sites on the positive strand of the Chr9:129620154 and 129620400 regions.

In alternative embodiments, the target region is the Chr9:129620282, Chr9:129620294, Chr9:129620355, Chr9:129620358, Chr9:129620367, Chr9:129620410 and Chr9:129620427 sites on the positive strand of the Chr9:129620272 and 129620431 regions.

In alternative embodiments, the target region is the Chr9:129620555, Chr9:129620561, Chr9:129620564, Chr9:129620598, Chr9:129620609, Chr9:129620611, Chr9:129620613, Chr9:129620709, Chr9:129620714 and Chr9:129620717 sites on the positive strand of the Chr9:129620551-129620722 region.

In alternative embodiments, the target region is the Chr9:129620512, Chr9:129620502, Chr9:129620499, Chr9:129620491, Chr9:129620486, Chr9:129620484, Chr9:129620465, Chr9:129620345, Chr9:129620342, Chr9:129620340 and Chr9:129620332 sites on the minus strand of the Chr9:129620328 and 129620513 regions.

In alternative embodiments, the target regions are the Chr9:129620089, Chr9:129620086, Chr9:129620078, Chr9:129620057, Chr9:129620055, Chr9:129620035 and Chr9:129620024 sites on the minus strand of the Chr9:129620018-129620103 region.

Based on the present disclosure, one skilled in the art can use any technique known in the art to detect methylation of a combination of one or more of the above sites to diagnose colorectal cancer or adenoma, regardless of the technique used, and the scope of the present invention is thus intended.

In alternative embodiments, the reagent allows detection of methylation of the target gene by one or more of the following methods:

methylation specific PCR, quantitative methylation specific PCR, bisulfite sequencing, methylation specific microarray, whole genome methylation sequencing, pyrosequencing, methylation specific high performance liquid chromatography, digital PCR, methylation specific high resolution solubility curves, methylation sensitive restriction endonuclease, and fluorescence quantification.

Based on the present disclosure, one of ordinary skill in the art will readily recognize that a variety of methods and corresponding reagents can be used to detect methylation of a target region. The method is not limited to the above detection method, and other methods and corresponding reagents are also within the scope of the present invention.

In alternative embodiments, the reagents detect methylation of the target gene by methylation specific PCR.

In alternative embodiments, the agent comprises one or a combination of nucleic acid combinations:

the reagent comprises one or more of the following nucleic acid combinations:

nucleic acid combinations comprising the nucleotides shown in SEQ ID No. 4-6; the combination of nucleic acids can detect methylation of the above region (1).

A nucleic acid combination comprising the nucleotides shown in SEQ ID No. 7-9; the combination of nucleic acids can detect methylation of the above region (2).

A nucleic acid combination comprising the nucleotides shown in SEQ ID NO. 13-15; the combination of nucleic acids can detect methylation of the above-mentioned region (3).

A nucleic acid combination comprising the nucleotides shown in SEQ ID NO. 22-24; the combination of nucleic acids can detect methylation of the above-mentioned region (4).

A nucleic acid combination comprising the nucleotides shown in SEQ ID NO. 28-30; the combination of nucleic acids can detect methylation of the above-mentioned region (5).

On the premise that the invention discloses the detection region, the skilled person can also design other primers and probes for detecting methylation of the target region, which are not described in the invention, for detecting methylation of the C9orf50 gene to diagnose or assist in diagnosing colorectal cancer or adenoma, and the design of such primers and/or probes does not need creative labor, which also belongs to the protection scope of the invention.

In alternative embodiments, the sample detected by the kit is selected from any one of plasma, serum, stool, and tissue. The kit provided by the invention can detect the methylation condition of the target gene extracted from samples such as plasma, serum, feces, tissues and the like.

In another aspect, the present invention provides use of an agent for detecting methylation of a target gene, which is C9orf50 gene, in the preparation of a kit for diagnosis or aided diagnosis of colorectal cancer or adenoma.

region (1): the whole length of chr9:129620154-129620400 or partial area thereof;

region (4): the whole length or partial area of the Chr9: 129620328-129620513;

region (5): the whole length of the Chr9: 129620018-.

In alternative embodiments, the agent comprises one or a combination of more of the following nucleic acid combinations:

a nucleic acid combination comprising the nucleotides shown in SEQ ID No. 4-6;

a nucleic acid combination comprising the nucleotides shown in SEQ ID No. 7-9;

a nucleic acid combination comprising the nucleotides shown in SEQ ID NO. 13-15;

a nucleic acid combination comprising the nucleotides shown in SEQ ID NO. 22-24;

nucleic acid combinations comprising the nucleotides shown in SEQ ID NO. 28-30.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and for those skilled in the art, other related drawings can be obtained according to the drawings without inventive efforts.

FIG. 1 is a ROC curve for distinguishing a colorectal adenoma sample from a normal sample for region a, region b, region c, region d, region e and region f;

FIG. 2 is a ROC curve for distinguishing a colorectal adenoma sample from a normal sample for region g, region h, region i and region j;

FIG. 3 is a ROC curve for distinguishing colorectal cancer samples from normal samples for region a, region b, region c, region d, region e and region f;

FIG. 4 is a ROC curve for region g, region h, region i and region j distinguishing colorectal cancer samples from normal samples.

Detailed Description

In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.

The features and properties of the present invention are described in further detail below with reference to examples.

Example 1

This example provides a kit for diagnosis or assisted diagnosis of colorectal cancer or adenoma, comprising nucleotide set 1, nucleic acid set 1 comprising nucleotides shown in SEQ ID nos. 1 to 3, in particular sequence table 1. The nucleotide combination 1 can detect the methylation of the plus strand of the chr9:129619882-129620048 region (region a) on the C9orf50 gene;

the positive strand base sequence of the region a is as follows:

TAGTCATGTGGCCTCGGGGTGATGGCAGACCAGCCCTCAAGGACGGGTTGCGAGGGCTCTGAGATACTCAGCTAACATTAGCATCCTTCTAGCCTGGGTGGTGGGGTGGTGGGTGCGGGGACACAAGGGACCACCCCCCACCGGAAATGACTCGGGCCCGCCCCCCG。

the nucleotides shown in SEQ ID NO.1-3 can detect methylation of cytosine at the positions of Chr9:129619896, Chr9:129619925, Chr9:129619932, Chr9:129620034, Chr9:129620040 and Chr9:129620047 on the positive strand of the region.

Example 2

This example provides a kit for the diagnosis or assisted diagnosis of colorectal cancer or adenoma, comprising nucleotide set 2, nucleic acid set 2 comprising nucleotides represented by SEQ ID nos. 4 to 6, in particular sequence listing 1. The nucleotide combination 2 can detect the methylation of the positive strand of the chr9:129620154-129620400 region (region b) of the C9orf50 gene.

The base sequence of the positive strand of the region b is as follows:

CGCCCAAGAAGTCGGGGTCCTCCCTGGCCACGCGCCTCCGGGGGCGCTCGCGCTCTCCAGGCCCTGGCTGCCTGGGCGCCGATTCCCGGGACGCGCCGGCCGACAGCAGGGGAGGCGGCAGCAGGGACCGCAGCAGCCCCCGCTTCCGCACGGCCCGCCGGGTCGCGGTGAGCAAGGCGGGCAGGCGCGGCGGGAGGCGTCCGACGCCCACCCCGGGCTTGGCGTCCCCTTCCGGCCACCACGCGGC。

the nucleotides shown in SEQ ID NO.4-6 can detect the methylation of cytosine at the positions of Chr9:129620154, Chr9:129620166, Chr9:129620184, Chr9:129620186, Chr9:129620192, Chr9:129620386, Chr9:129620395, Chr9:129620397 and Chr9:129620400 on the positive strand of the region.

Example 3

This example provides a kit for the diagnosis or assisted diagnosis of colorectal cancer or adenoma, comprising nucleotide combination 3, nucleic acid combination 3 comprising the nucleotides shown in SEQ ID nos. 7 to 9, in particular sequence listing 1. The nucleotide combination 3 can detect the methylation of the plus strand of the Chr9:129620272-129620431 region (region C) of the C9orf50 gene.

The base sequence of the positive strand of the region c is as follows:

CAGCAGGGACCGCAGCAGCCCCCGCTTCCGCACGGCCCGCCGGGTCGCGGTGAGCAAGGCGGGCAGGCGCGGCGGGAGGCGTCCGACGCCCACCCCGGGCTTGGCGTCCCCTTCCGGCCACCACGCGGCGCCGCCCCCCGGGATCCTCCAGTCCCCGGAG。

the nucleotides shown in SEQ ID NO.7-9 can detect the methylation of cytosine at the positions of Chr9:129620282, Chr9:129620294, Chr9:129620355, Chr9:129620358, Chr9:129620367, Chr9:129620410 and Chr9:129620427 on the positive strand of the region.

Example 4

This example provides a kit for the diagnosis or assisted diagnosis of colorectal cancer or adenoma, comprising nucleotide set 4, nucleic acid set 4 comprising the nucleotides shown in SEQ ID nos. 10 to 12, in particular sequence listing 1. The nucleotide combination 4 can detect the methylation of the plus strand of the Chr9:129620469-129620541 region (region d) on the C9orf50 gene.

The base sequence of the positive strand of the region d is as follows:

TCAGCTTGGGCAGCCGCGGGTCGCTGCTGCGTCGGAAGTCTCCGTCGCCAGGGAGCCCCTTGGGCGCCAGGTC。

the nucleotides shown in SEQ ID NO.10-12 can detect the methylation of cytosine at the positions of Chr9:129620483, Chr9:129620485, Chr9:129620498, Chr9:129620501, Chr9:129620511, Chr9:129620514 and Chr9:129620533 in the positive strand of the region.

Example 5

This example provides a kit for the diagnosis or assisted diagnosis of colorectal cancer or adenoma, comprising nucleotide set 5, nucleic acid set 5 comprising the nucleotides shown in SEQ ID nos. 13-15, detailed sequence listing 1. This nucleotide combination 5 detected methylation of the plus strand of the region Chr9:129620551-129620722 (region e) of the C9orf50 gene.

The base sequence of the positive strand of the region e is as follows:

TGGGCGAAGTCGACGCCAGAACATGCTTGGCCCCGCACTCAGCTCACCGCACCCTCAGCGCGCGTGGGTGGGGGGCGCCGGCTGAGGTGGGGAGGGCATAGTCCAGCCCCAGGCCATAGTGCCCCGGGCGGGGCAGCGCGGTGCGGGGTGAACGCCACCGGCCCGGCGGACA。

the nucleotides shown in SEQ ID NO.13-15 can detect the methylation of cytosine at the positions of Chr9:129620555, Chr9:129620561, Chr9:129620564, Chr9:129620598, Chr9:129620609, Chr9:129620611, Chr9:129620613, Chr9:129620709, Chr9:129620714 and Chr9:129620717 on the positive strand of the region.

Example 6

This example provides a kit for the diagnosis or assisted diagnosis of colorectal cancer or adenoma, comprising nucleic acid set 6, nucleic acid set 6 comprising the nucleotides shown in SEQ ID nos. 16 to 18, detailed sequence listing 1. The nucleotide combination 6 can detect the methylation of the positive strand (region f) of the Chr9:129620729-129620879 region on the C9orf50 gene.

The base sequence of the positive strand of the region f is as follows:

GGCTTCAGGCGAGAGCTCCCAGAGCCTCTGTTTCCTCACCTGAAAAATGGTGACAGCAAGAGTAGCCAACTTTGGGGGTTGCTGTGACGTTTAAATGAGCAAGTACATGCCAGTCTTAGAACAGCAAGCTCGGTACAGTGCCAGGCACGCTGG。

the nucleotides shown in SEQ ID NO.16-18 detect methylation of cytosine at positions Chr9:129620738, Chr9:129620816, Chr9:129620859 and Chr9:129620876 on the positive strand of the region.

Example 7

This example provides a kit for the diagnosis or assisted diagnosis of colorectal cancer or adenoma comprising nucleotide combination 7, nucleic acid combination 7 comprising the nucleotides shown in SEQ ID nos. 19 to 21, detailed sequence listing 1. This nucleotide combination 7 detected methylation of the minus strand of the Chr9:129620550-129620735 region (region g) of the C9orf50 gene.

The base sequence of the region g minus strand is as follows:

TGAAGCCACTCGCTGTCCGCCGGGCCGGTGGCGTTCACCCCGCACCGCGCTGCCCCGCCCGGGGCACTATGGCCTGGGGCTGGACTATGCCCTCCCCACCTCAGCCGGCGCCCCCCACCCACGCGCGCTGAGGGTGCGGTGAGCTGAGTGCGGGGCCAAGCATGTTCTGGCGTCGACTTCGCCCAG。

the nucleotides shown in SEQ ID NO.19-21 can detect the methylation of the cytosine at the positions of Chr9:129620725, Chr9:129620718, Chr9:129620715, Chr9:129620695, Chr9:129620690, Chr9:129620688, Chr9:129620680, Chr9:129620565, Chr9:129620562 and Chr9:129620556 on the negative strand of the region.

Example 8

This example provides a kit for the diagnosis or assisted diagnosis of colorectal cancer or adenoma, comprising nucleic acid set 8, nucleic acid set 8 comprising the nucleotides shown in SEQ ID nos. 22-24, detailed sequence listing 1. This nucleotide combination 8 detects methylation of the minus strand of the Chr9:129620328-129620513 region (region h) of the C9orf50 gene.

The base sequence of the negative strand of the region h is as follows:

ACGGAGACTTCCGACGCAGCAGCGACCCGCGGCTGCCCAAGCTGACCCCGCCCGCGCTCCGAGCGGCTCTGGGCGCGCGGGGCTCCGGGGACTGGAGGATCCCGGGGGGCGGCGCCGCGTGGTGGCCGGAAGGGGACGCCAAGCCCGGGGTGGGCGTCGGACGCCTCCCGCCGCGCCTGCCCGCCT。

the nucleotides shown in SEQ ID NO.22-24 can detect methylation of cytosine at the positions of Chr9:129620512, Chr9:129620502, Chr9:129620499, Chr9:129620491, Chr9:129620486, Chr9:129620484, Chr9:129620465, Chr9:129620345, Chr9:129620342, Chr9:129620340 and Chr9:129620332 located on the negative strand of the region.

Example 9

This example provides a kit for the diagnosis or assisted diagnosis of colorectal cancer or adenoma, comprising a nucleotide combination 9, the nucleic acid combination 9 comprising the nucleotides shown in SEQ ID nos. 25 to 27, in particular sequence listing 1. This nucleotide combination 9 detected methylation of the minus strand of the Chr9:129620165-129620291 region (region i) of the C9orf50 gene.

The base sequence of the minus strand of the region i is as follows:

GGCTGCTGCGGTCCCTGCTGCCGCCTCCCCTGCTGTCGGCCGGCGCGTCCCGGGAATCGGCGCCCAGGCAGCCAGGGCCTGGAGAGCGCGAGCGCCCCCGGAGGCGCGTGGCCAGGGAGGACCCCGA。

the nucleotides shown in SEQ ID NO.25-27 detect methylation of cytosine at positions Chr9:129620283, Chr9:129620205, Chr9:129620185 and Chr9:129620167 on the negative strand of the region.

Example 10

This example provides a kit for the diagnosis or assisted diagnosis of colorectal cancer or adenoma, comprising a nucleotide combination 10, the nucleic acid combination 10 comprising the nucleotides shown in SEQ ID No.28-30, in particular sequence listing 1. The nucleotide combination 10 can detect methylation of the minus strand of the Chr9:129620018-129620103 region (region j) of the C9orf50 gene.

The base sequence of the minus strand of the region j is as follows:

CTCCAGGAGAAGTGCGCCGAGGAGCCGGAGCCACTGAGTGAGGCCCCGCGGGGCCCGGGGGGCGGGCCCGAGTCATTTCCGGTGGG。

the nucleotides shown in SEQ ID NO.28-30 can detect methylation of cytosine at positions Chr9:129620089, Chr9:129620086, Chr9:129620078, Chr9:129620057, Chr9:129620055, Chr9:129620035 and Chr9:129620024 located on the negative strand of the region.

TABLE 1

Example 11

This example provides a method for diagnosing colorectal or adenoma carcinoma using the kit of any one of examples 1 to 10, comprising the steps of:

1. extraction of DNA template:

the used sample is a blood sample, and the blood plasma cfDNA is extracted by a magnetic bead method serum/blood plasma free DNA extraction kit (DP709) of Tiangen Biochemical technology (Beijing) Co., Ltd.

2. Conversion of sulphites

The nucleic acid transformation Kit is EZ DNA Methylation-Gold (TM) Kit of ZYMO RESEARCH, and the specific experimental operation is described in the Kit specification.

3. PCR reaction

The PCR reaction system using beta-actin as the reference gene is shown in Table 2. Beta-actin is used as an internal reference gene, wherein the upstream primer of the beta-actin is as follows: taggttagacgggggatatgtag (SEQ ID NO. 31); the downstream primer of the beta-actin is as follows: cacaataaatctaaacaaactcccc (SEQ ID NO. 32); the beta-actin probe is as follows: gtgtgctggggtcttggga (SEQ ID NO. 33).

The 5 'end of the probe in the detection target region is a report group FAM, the 3' end of the probe is a quenching group MGB, the 5 'end of the beta-actin probe is a report group VIC, and the 3' end of the probe is a quenching group BHQ 1.

TABLE 2

Components	Specification of	Volume (mu L)
			Buffer solution	5×	5
dNTPs	2.5mM each	2
			Upstream primer	10μM	1
Downstream primer	10μM	1
			Probe needle	10μM	1
Beta-actin upstream primer	10μM	1
			Beta-actin downstream primer	10μM	1
Beta-actin probe	10μM	1
			DNA enzyme	5U/μL	0.5
DNA of sample to be tested	/	5
			Purified water	/	Supply to 25

The PCR reaction conditions are shown in Table 7 below.

TABLE 3

Ct value reading: and after the PCR is finished, adjusting the base line, and setting the threshold value in the exponential growth period of the amplification curve to obtain the Ct value of each gene of the sample.

Quality control: the negative control and the positive control are synchronously detected during each detection, the negative control is purified water, the positive control is artificially synthesized plasmid containing beta-actin gene and target gene sequence, and the concentration is 10 ³ Copy/microliter, negative control should have no significant exponential growth period, positive control should have significant exponential growth period, and positive control should have Ct value between 26-30. After the negative control, the positive control and the reference gene all meet the requirements, the experiment is effective, and the next step of sample result judgment can be carried out. Otherwise, when the experiment is invalid, the detection is required to be carried out again.

Results analysis and interpretation methods:

and performing ROC analysis by using SPSS software to evaluate the diagnosis effectiveness of each detection area on colorectal cancer samples and normal samples and colorectal adenoma samples and normal samples, wherein during analysis, the state variable of the normal samples is marked as '0', the state variable of the cancer/adenoma samples is marked as '1', the Ct value at the maximum john index is taken as the cut-off value, and the corresponding sensitivity, specificity and average AUC value are recorded.

For samples with unknown pathological states, after PCR is finished, reading the detection Ct value of each sample, and judging according to the comparison between the Ct value and a threshold value, wherein the reference method is as follows:

a negative result indicates that the sample does not have colorectal adenoma/colorectal carcinoma or has a low probability of having both, and a positive result indicates that the sample has a high probability of having colorectal adenoma/colorectal carcinoma or both.

Experimental example 1

The plasma samples of 50 healthy human plasma samples, 94 plasma samples of colorectal adenomas patients and 94 plasma samples of colorectal carcinoma patients were selected, the 238 samples were tested by the method of example 11, the specificity of the markers was calculated from the results of the plasma samples of healthy human (negative samples), and the sensitivity of the markers to the detection of colorectal adenomas and colorectal carcinomas was calculated from the results of the detection of colorectal adenomas and colorectal carcinoma samples (positive samples). And performing ROC analysis by using SPSS software to evaluate the diagnostic efficacy of each detection area on colorectal cancer samples and normal samples and colorectal adenoma samples and normal samples, taking the Ct value at the maximum Yoden index as cut-off value, and recording corresponding sensitivity, specificity and average AUC value. The results are as follows.

(1) The detection sensitivity and specificity of region a, region b, region C, region d, region e and region f on the C9orf50 positive strand are shown in table 4, and fig. 1 and 3.

TABLE 4

From the above results, it can be seen that AUC values of the regions b, C and e on the positive strand of the C9orf50 gene for distinguishing adenomas and normal samples are all significantly higher than those of the regions a, d and f. The sensitivity of the region b, the region C and the region e of the C9orf50 gene to colorectal adenoma is more than 80%, the specificity is more than 90%, the detection sensitivity and the specificity for colorectal carcinoma are more than 85%, the detection sensitivity of the region a, the region d and the region f to the adenoma is less than 70%, and the detection specificity of the region a and the region f is only less than 80%; the AUC values of the cancer-differentiated and normal samples of the region b, the region C and the region e on the positive strand of the C9orf50 gene are all significantly higher than those of the region a, the region d and the region f. The sensitivity of detection of cancer by the region d and the region f is more than 70%, and the specificity of detection of cancer by the region a and the region f is not more than 80%. In general, regions b, C and e on the positive strand of the C9orf50 gene were more effective in detection than regions a, d and f.

(2) The detection sensitivity and specificity of region g, region h, region i and region j on the minus strand of C9orf50 are shown in Table 5, and FIGS. 2 and 4.

TABLE 5

As can be seen from the above results, the AUC values in the area h, the area i, which distinguish adenomas from normal samples, on the negative strand of the C9orf50 gene were significantly higher than those in the area g and the area j. The sensitivity of the region h and the region i of the C9orf50 gene to colorectal carcinoma adenomas is more than 75%, the specificity is more than 90%, the adenoma detection specificity of the region g is only 77%, and the sensitivity and the specificity of the region j to adenoma detection are not high (the sensitivity is less than 70%, and the specificity is less than 90%); the AUC values of the cancer and normal samples distinguished by the regions h and i on the negative strand of the C9orf50 gene are both obviously higher than those of the regions g and j, the sensitivity of cancer detection of the regions h and i is higher than 80%, the specificity of the cancer detection of the regions h and i is higher than 90%, while the sensitivity of the cancer detection of the regions g and j is higher than 80%, the specificity of the cancer detection of the regions g and i is not higher than 80%, and overall, the detection effect of the regions h and i on the negative strand of the C9orf50 gene is better than that of the regions g and j.

The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Sequence listing

<110> Wuhan Amisen Life technologies Ltd

<120> diagnostic kit for colorectal cancer or adenoma

<160> 33

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> DNA

<213> Artificial sequence

<400> 1

tagttatgtg gtttcggggt g 21

<210> 2

<211> 19

<212> DNA

<213> Artificial sequence

<400> 2

cgaaaaacga acccgaatc 19

<210> 3

<211> 20

<212> DNA

<213> Artificial sequence

<400> 3

tttaaggacg ggttgcgagg 20

<210> 4

<211> 21

<212> DNA

<213> Artificial sequence

<400> 4

cgtttaagaa gtcggggttt t 21

<210> 5

<211> 19

<212> DNA

<213> Artificial sequence

<400> 5

gccgcgtaat aaccgaaaa 19

<210> 6

<211> 19

<212> DNA

<213> Artificial sequence

<400> 6

ttggttacgc gttttcggg 19

<210> 7

<211> 24

<212> DNA

<213> Artificial sequence

<400> 7

tagtagggat cgtagtagtt ttcg 24

<210> 8

<211> 22

<212> DNA

<213> Artificial sequence

<400> 8

ctccgaaaac taaaaaatcc cg 22

<210> 9

<211> 22

<212> DNA

<213> Artificial sequence

<400> 9

ttcgacgttt atttcgggtt tg 22

<210> 10

<211> 19

<212> DNA

<213> Artificial sequence

<400> 10

ttagtttggg tagtcgcgg 19

<210> 11

<211> 21

<212> DNA

<213> Artificial sequence

<400> 11

aacctaacgc ccaaaaaact c 21

<210> 12

<211> 21

<212> DNA

<213> Artificial sequence

<400> 12

ttgcgtcgga agttttcgtc g 21

<210> 13

<211> 19

<212> DNA

<213> Artificial sequence

<400> 13

tgggcgaagt cgacgttag 19

<210> 14

<211> 19

<212> DNA

<213> Artificial sequence

<400> 14

tatccgccga accgataac 19

<210> 15

<211> 25

<212> DNA

<213> Artificial sequence

<400> 15

tatcgtattt ttagcgcgcg tgggt 25

<210> 16

<211> 22

<212> DNA

<213> Artificial sequence

<400> 16

ggttttaggc gagagttttt ag 22

<210> 17

<211> 24

<212> DNA

<213> Artificial sequence

<400> 17

ccaacgtacc taacactata ccga 24

<210> 18

<211> 25

<212> DNA

<213> Artificial sequence

<400> 18

taattttggg ggttgttgtg acgtt 25

<210> 19

<211> 22

<212> DNA

<213> Artificial sequence

<400> 19

tgaagttatt cgttgttcgt cg 22

<210> 20

<211> 20

<212> DNA

<213> Artificial sequence

<400> 20

ctaaacgaaa tcgacgccaa 20

<210> 21

<211> 24

<212> DNA

<213> Artificial sequence

<400> 21

atttcgtatc gcgttgtttc gttc 24

<210> 22

<211> 23

<212> DNA

<213> Artificial sequence

<400> 22

acggagattt tcgacgtagt agc 23

<210> 23

<211> 19

<212> DNA

<213> Artificial sequence

<400> 23

aaacgaacaa acgcgacga 19

<210> 24

<211> 25

<212> DNA

<213> Artificial sequence

<400> 24

ttcgcggttg tttaagttga tttcg 25

<210> 25

<211> 20

<212> DNA

<213> Artificial sequence

<400> 25

ggttgttgcg gtttttgttg 20

<210> 26

<211> 21

<212> DNA

<213> Artificial sequence

<400> 26

tcgaaatcct ccctaaccac g 21

<210> 27

<211> 25

<212> DNA

<213> Artificial sequence

<400> 27

ttaggtagtt agggtttgga gagcg 25

<210> 28

<211> 21

<212> DNA

<213> Artificial sequence

<400> 28

ttttaggaga agtgcgtcga g 21

<210> 29

<211> 20

<212> DNA

<213> Artificial sequence

<400> 29

cccaccgaaa ataactcgaa 20

<210> 30

<211> 25

<212> DNA

<213> Artificial sequence

<400> 30

tcggagttat tgagtgaggt ttcgc 25

<210> 31

<211> 23

<212> DNA

<213> Artificial sequence

<400> 31

taggttagac gggggatatg tag 23

<210> 32

<211> 25

<212> DNA

<213> Artificial sequence

<400> 32

cacaataaat ctaaacaaac tcccc 25

<210> 33

<211> 19

<212> DNA

<213> Artificial sequence

<400> 33

gtgtgctggg gtcttggga 19

Claims

1. A kit for use in the diagnosis or aided diagnosis of colorectal cancer or adenoma, comprising a reagent for detecting methylation of a target gene, said target gene being the C9orf50 gene.

2. The kit as claimed in claim 1, wherein the target region detected by the reagent is the full-length region or partial region of chr9:129619882-129620879 of C9orf50 gene.

3. The kit according to claim 2, wherein the target region is selected from any one or a combination of the following regions (1) to (5);

region (4): the whole length or partial area of the Chr9: 129620328-129620513;

region (5): the whole length or partial area of the Chr9: 129620018-129620103;

preferably, the target areas are the positive strand of the region Chr9:129620154-129620400, the positive strand of the region Chr9:129620272-129620431, the positive strand of the region Chr9:129620551 551-129620722, the negative strand of the region Chr9:129620328-129620513 or the negative strand of the region Chr9: 129620018-129620103;

preferably, the target region is the sites of Chr9:129620154, Chr9:129620166, Chr9:129620184, Chr9:129620186, Chr9:129620192, Chr9:129620386, Chr9:129620395, Chr9:129620397 and Chr9:129620400 on the positive strand of the region Chr9: 129620154-129620400;

preferably, the target region is the sites of Chr9:129620282, Chr9:129620294, Chr9:129620355, Chr9:129620358, Chr9:129620367, Chr9:129620410 and Chr9:129620427 on the positive strand of the Chr9:129620272 and 129620431 regions;

preferably, the target region is the sites of Chr9:129620555, Chr9:129620561, Chr9:129620564, Chr9:129620598, Chr9:129620609, Chr9:129620611, Chr9:129620613, Chr9:129620709, Chr9:129620714 and Chr9:129620717 on the positive strand of the Chr9: 129620551-one region;

preferably, the target region is the sites of Chr9:129620512, Chr9:129620502, Chr9:129620499, Chr9:129620491, Chr9:129620486, Chr9:129620484, Chr9:129620465, Chr9:129620345, Chr9:129620342, Chr9:129620340 and Chr9:129620332 on the minus strand of the region Chr9: 129620328;

preferably, the target regions are the Chr9:129620089, Chr9:129620086, Chr9:129620078, Chr9:129620057, Chr9:129620055, Chr9:129620035 and Chr9:129620024 sites on the minus strand of the region Chr9: 129018-.

4. The kit of claim 3, wherein the reagent detects methylation of the target gene by one or more of the following methods:

methylation specific PCR, quantitative methylation specific PCR, bisulfite sequencing, methylation specific microarray, whole genome methylation sequencing, pyrosequencing, methylation specific high performance liquid chromatography, digital PCR, methylation specific high resolution solubility curves, methylation sensitive restriction endonuclease, and fluorescence quantification;

preferably, the reagent detects methylation of the target gene by methylation specific PCR.

5. The kit according to any one of claims 1 to 4, wherein the reagent comprises one or a combination of several of the following nucleic acid combinations:

nucleic acid combinations comprising the nucleotides shown in SEQ ID No. 4-6;

a nucleic acid combination comprising the nucleotides shown in SEQ ID No. 7-9;

a nucleic acid combination comprising the nucleotides shown in SEQ ID NO. 28-30;

preferably, the sample detected by the kit is selected from any one of plasma, serum, feces and tissue.

6. Use of an agent for detecting methylation of a target gene for the manufacture of a kit for the diagnosis or the aided diagnosis of colorectal cancer or adenoma, wherein the target gene is the C9orf50 gene.

7. The use as claimed in claim 6, wherein the target region detected by the reagent is the full-length region or partial region of chr9:129619882-129620879 of C9orf50 gene.

8. The use according to claim 7, wherein the target region is selected from any one or a combination of the following regions (1) - (5);

region (4): the whole length or partial area of the Chr9: 129620328-129620513;

region (5): the whole length or partial area of the Chr9: 129620018-129620103;

9. The use of claim 7, wherein the reagent allows detection of methylation of the target gene by one or more of the following methods:

10. The use according to any one of claims 6 to 9, wherein the agent comprises one or a combination of nucleic acid combinations selected from the group consisting of:

nucleic acid combinations comprising the nucleotides shown in SEQ ID No. 4-6;

a nucleic acid combination comprising the nucleotides shown in SEQ ID No. 7-9;

nucleic acid combinations comprising the nucleotides shown in SEQ ID NO. 28-30.