RU2577138C1 - Method of producing of recombinant protein sav-rgd - Google Patents

Abstract

FIELD: bioengineering.

SUBSTANCE: invention relates to the method of producing of a recombinant protein SAV-RGD, where SAV is a streptavidin monomer, RGD is a melanoma addressing oligopeptide, having an amino-acid sequence Ser-Arg-Ala-Gly-Ala-Asp-Gly-Phe-Pro-Gly-Cys-Arg-Gly-Asp-Cys-Ser-Gln-Glu. The described method includes the cultivation in a culture medium of the bacteria strain E. coli MG1655/pSAV-RGD, produced by the transformation of the strain E. coli MG1655 by the plasmid pSAV-RGD, in its turn produced based on the vector pUC18 and including the sequence encoding the poured pro-protein SAV-RGD (pro-sav-rgd) under the control of the uridinephosphorylase promoter (Pudp) E. coli. The production of a fraction of cells of the bacteria strain, cleaning of the produced recombinant protein. Cultivation is carried out in two stages. At the first stage makeup by a glucose source is performed, and at the second stage makeup by peptone and yeastrel is performed.

EFFECT: increased efficiency of the use for the production of pharmaceuticals for the medical treatment of human melanoma.

5 cl, 15 dwg, 2 tbl, 10 ex

Description

Technical field

The present invention relates to the microbiological industry and medical biotechnology and is a method for preparatively producing a recombinant SAV-RGD protein specifically recognizing melanoma cells, where: SAV is a streptavidin monomer having the amino acid sequence of SEQ NO 1; RGD is a melanoma-addressing oligopeptide having the amino acid sequence of SEQ NO 2 using Escherichia coli strain MG1655 / pSAV-RGD, a producer of these fusion proteins.

State of the art

It is known that RGD-containing peptides are capable of exerting a toxic effect on cells by binding to integrin receptors on the surface of tumor cells; they trigger intracellular signaling cascades leading to stunted growth, decreased proliferation, and, as a result, cell death. This principle underlies the action of the Cilengitide preparation manufactured by Merck KGaA (Germany), which is a cyclic peptide RGDfV (Arg-Gly-Asp- (D-Phe) -Val). [Mas-Moruno C., Rechenmacher F., Kessler H. (2010) Anti-Cancer Agents in Medicinal Chemistry, 10, 753-768.] However, the use of low concentrations of such peptides has the opposite effect due to clustering of integrin and activation of another signaling pathway. This creates additional difficulties when using drugs that include RGD-containing peptides that do not carry the toxic part. To eliminate the above effect, such peptides are conjugated with toxic agents or placed on the surface of nanostructures or liposomes loaded with a toxic agent [Pattillo CB. et al. (2005) Pharm. Res., 22, 1117-1120; Dubey P.K. Mishra V., Jain S., Manor S., Vyas S.P. (2004) J. Drug Target, 12, 257-264], which is a rather time-consuming procedure.

For effective binding to integrin receptors on the surface of melanoma cells, the protein must contain the Arg-Gly-Asp tripeptide (RGD). [Pierschbacher M.D. and Ruoslahti E. (1984) Nature, 309, 30-33] However, several integrin receptors are able to bind the RGD motif (this is a group of integrins containing the αv subparticle, as well as integrins α5β1, α8β1 αIIbβ3). To ensure selectivity, the environment of the RGD motif is important. By varying the sequence of amino acid residues surrounding the RGD motif, a panel of RGD-containing oligopeptides was created with different tissue specificity due to selective interaction with various integrin receptors. Among others, RGD-containing oligopeptides were obtained that have the ability to selectively bind to receptors on the surface of melanoma cells and endothelial cells of human and mouse tumor vessels (RGD10, RGD13, RGD15). [Hölig P., Bach M, Völkel T., Nahde T., Hoffmann S., Müller R. and Kontermann R.E. (2004) Protein Eng. Des. Sel., 17,433-441.]

It should be noted that for effective binding to the receptor, the RGD tripeptide must take a curved conformation that is stabilized either by cyclization of the peptide chain [Aumailey M., Gurrath M., Müller G., Calvete J., Timple R., Kessler H. (1991) FEBS Lett., 291, 50-54; Gurrath M., Müller G., Kessler H., Aumailey M. Timple R. (1992) Eur. J. Biochem., 210, 911-921], or by the formation of a disulfide bond between flanking RGD motif cysteine residues [Pierschbacher M.D. and Ruoslahti, E. (1987) J. Biol. Chem., 262, 17924-17928; Hölig P., Bach M., Völkel T., Nahde T., Hoffmann S., Müller R. and Kontermann R.E. (2004) Protein Eng. Des. Sel., 17, 433-441].

Short peptides are usually obtained by chemical synthesis. However, when implementing this method, racemization of amino acid residues is possible. Replacing the L-form of amino acids with the D-form can lead to the formation of non-functional peptides, in this case with reduced receptor affinity. [Han Y., Albericio F., Barany G. (1997), J Org Chem, 62, 4307-4312; Palasek S.A., Cox Z.J., Collins J.M. (2007) J. Peptide Sci., 13, 143-148].

Short RGD peptides have other disadvantages in addition to the above.

The bent conformation of the RGD tripeptide, due to the ring structure of chemically synthesized peptides like Cilengitide, can also be maintained by a disulfide bond formed between flanking RGD motif cysteine residues. [Pierschbacher M.D. and Ruoslahti E. (1987) J. Biol. Chem., 262, 17924-17928; Hölig P., Bach M., Völkel T., Nahde T., Hoffmann S., Müller R. and Kontermann R.E. (2004) Protein Eng. Des. Sel., 17, 433-441]. This provides an opportunity for biotechnological production of peptides, eliminating the very possibility of racemization. However, the main problem that arises during the production of proteins in the cells of microorganisms is the degradation of short molecules by proteolytic enzymes in the cell cytoplasm. Small peptides, as a rule, have a short circulation time in the body, which, along with a reduced affinity for the receptor, can lead to the need to increase both the amount of the drug used and the frequency of its administration. These processes can significantly reduce the effectiveness of the drug.

In the prior art, the amino acid sequence of soluble streptavidin excreted in the periplasm is known; the nucleotide sequence encoding this protein; a vector has been created that includes the aforementioned nucleotide sequence under the control of a strong constitutive promoter or promoter of the E. coli uridine phosphorylase (Pudp); E. coli strain containing said vector and producing streptavidin; and also a method for producing this polypeptide in bacterial cells using chromatographic purification [RF patent 2153535]. The prototypes of such expression systems can be vectors that we previously described in the patent [RF patent 2153535] and the article [Syrkina MS et al. Preparation and functional evaluation of RGD-modified streptavidin targeting to integrin-expressing melanoma cells. Protein Eng Des Sel. 2013 Feb; 26 (2): 143-50]. ”

In addition, the amino acid sequence of the melanoma-addressing oligopeptides RIO, R13 and R15 (referred to in the literature as RGD10, RGD13 and RGD15) is known [Hölig P., Bach M., Völkel T., Nahde T., Hoffmann S., Müller R . and Kontermann RE (2004) Protein Eng. Des. Sel., 17.433-441].

Finally, the RGD-containing cyclic peptide RGDfV, sold under the trademark Cilengitide by Merck KgaA (Germany), is described and characterized in detail. [Mas-Moruno S., Rechenmacher F., Kessler H. (2010) Anti-Cancer Agents in Medicinal Chemistry, 10, 753-768].

The inclusion of an oligopeptide in the tetramerizing carrier protein streptavidin leads to the fact that the recombinant fusion protein will contain four integrin-addressing oligopeptides. As a result of the interaction of such a structure with a receptor on the cell surface, an increase in the local concentration of RGD motifs near this receptor occurs, which increases the binding efficiency. Literature data confirm the increased binding efficiency of such polyvalent structures as compared to monovalent ones [RF patent 2153535].

In addition, streptavidin is able to bind the d-biotin residue with high affinity (Kd = 10-15). Given the fact that each streptavidin subunit binds 1 biotin molecule, the tetramer is able to bind 4 biotin molecules, which can lead to amplification of the signal when using a biotinylated diagnostic agent or to enhance the toxic effect when using a biotinylated therapeutic agent [Xia N., Liu L., Harrington MG, Zhou F. (2010), Anal. Chem., 82, 10151-10157].

The use of a patented expression system that allows producing preparative quantities of recombinant streptavidin in the periplasm of E. coli [RF patent 2153535] provides localization of the chimeric protein based on streptavidin in the periplasmic space of the cell, which allows not only to limit its cleavage by proteolytic enzymes present in the cytoplasm, but and substantially simplify the isolation step using affinity chromatography.

Previously, the inventors of the present invention created a system for the expression of recombinant SAV-RGD fusion proteins that specifically recognize melanoma cells, which include streptavidin (S) and melanoma-addressing oligopeptide (R), connected to streptavidin via a peptide linker containing an enteropeptidase cleavage site ; designed recombinant plasmid DNA, providing heterologous expression of these fusion proteins; and also received strains of bacteria belonging to the genus Escherichia, producers of these fusion proteins. These plasmid DNAs provide expression of a protein containing a leader peptide, which secrets it into the periplasmic space of bacterial cells where the leader peptide is cleaved, and the indicated SAV-RGD protein is localized in a biologically active soluble state [Syrkina MS et al. Preparation and functional evaluation of RGD -modified streptavidin targeting to integrin-expressing melanoma cells. Protein Eng Des Sel. 2013 Feb; 26 (2): 143-50].

A brief description of the present invention

The aim of the present invention is to provide a highly efficient and economical method for preparative production of recombinant protein SAV-RGD, specifically recognizing melanoma cells, as a drug for the production of drugs for the treatment of human melanoma.

This goal was achieved through the development and optimization of a method for preparative production of recombinant protein SAV-RGD using strain MG1655 / pSAV-RGD Escherichia coli.

The problem is solved in that a method for the preparative production of recombinant SAV-RGD protein using the Escherichia coli strain MG1655 / pSAV-RGD was developed and optimized.

The bacterial strain Escherichia coli MG1655 / pSAV-RGD was obtained by transformation of the Escherichia coli strain MG1655 recombinant plasmid DNA pSAV-RGD based on the vector pUC18, which includes the sequence of the uridine phosphorylase promoter E. coli (Pudp), as well as the sequence encoding RGV fusion protein SA . In turn, the recombinant fusion protein SAV-RGD, specifically recognizing melanoma cells, has the formula SAV-RGD, where:

SAV is a streptavidin monomer having the amino acid sequence of SEQ NO 1;

RGD is a melanoma-addressing oligopeptide having the amino acid sequence of SEQ NO 2, where

The aforementioned method for preparative production of a recombinant SAV-RGD protein comprises the following steps:

- cultivation in a nutrient medium (LB, M9 ⁺ + glucose) of a strain of Escherichia coli MG1655 / pSAV-RGD with pH-statization in the pH range of 7.5-7.8 and reduced aeration (the concentration of dissolved oxygen does not exceed 20-25%), comprising 2 stages, where at the first stage they are fed with a source of glucose, and at the second stage they are fed with a source of amino acids (peptone and / or yeast extract);

- obtaining the periplasmic fraction of cells of the bacterial strain Escherichia coli MG1655 / pSAV-RGD using lysis buffer, which includes lysozyme at a concentration of 1 g / l;

- purification of the recombinant protein according to SAV-RGD by ion exchange chromatography followed by ultrafiltration; and

- lyophilization of the purified recombinant protein SAV-RGD to obtain a preparation based on a self-assembled fusion protein containing melanoma-recognizing peptides and an adapter part for attaching a toxic agent.

In this method, the cultivation conditions are optimized for the most efficient production of SAV-RGD protein, purification of the target recombinant protein SAV-RGD by ion exchange chromatography can significantly reduce the costs of the process at the stage of purification compared with the use of affinity chromatography on 2-iminobiotin agarose with comparable yields for the target protein and its degree of purity.

The present invention is described in more detail below.

 Detailed description of the present invention.

The method according to the present invention is a method for preparative production of recombinant protein SAV-RGD, where SAV is a streptavidin monomer having the amino acid sequence of SEQ ID NO 1, RGD is a melanoma-addressing oligo peptide having the amino acid sequence of SEQ ID NO 2 using the bacterial strain Escherichia coli MG1655 / pSAV-RGD.

The specified method includes the following stages:

- culturing in a nutrient medium of a bacterial strain Escherichia coli MG1655 / pSAV-RGD - producer of the recombinant protein SAV-RGD, while cultivation is carried out in a nutrient medium with pH-statirovanie in the pH range of 7.5-7.8 and reduced aeration (concentration of dissolved oxygen does not exceed 20-25%), in 2 stages, where at the first stage they are fed with a source of glucose, and at the second stage they are fed with a source of amino acids (peptone and / or yeast extract);

- obtaining periplasmic fraction of cells of the specified producer strain of the recombinant protein SAV-RGD;

- purification of recombinant protein SAV-RGD by ion exchange chromatography followed by ultrafiltration; and

- lyophilization of the purified recombinant protein SAV-RGD to obtain a preparation based on a self-assembled fusion protein containing melanoma-recognizing peptides and an adapter part for attaching a toxic agent.

The recombinant SAV-RGD protein obtained by the method according to the present invention is a protein of the formula SAV - streptavidin monomer having the amino acid sequence of SEQ ID NO 1, RGD is a melanoma-addressing oligopeptide having the amino acid sequence of SEQ ID NO 2.

An example of a recombinant plasmid expressing the indicated recombinant protein SAV-RGD containing a leader peptide that secures a gap in the periplasmic space of E. coli cells, where the leader peptide is cleaved and streptavidin is localized in a biologically active soluble state, is the base plasmid pSAV-RGD pUC18 vector, comprising a sequence encoding a fused gap under the control of the E. coli uridine phosphorylase promoter (Pudp). A schematic representation of the plasmid pSAV-RGD is shown in FIG. 1. It should be understood that the circle of plasmids that can be used in the present method is not limited to the indicated plasmid.

The bacterium used in the method according to the present invention is a bacterium belonging to the genus Escherichia - producer of the recombinant protein SAV-RGD.

The term "bacterium belonging to the genus Escherichia, means that the bacterium belongs to the genus Escherichia in accordance with the classification known to the specialist in the field of microbiology. Among examples of bacteria belonging to the genus Escherichia, but not limited to, the bacterium Escherichia coli (E. coli) may be mentioned.

The range of bacteria belonging to the genus Escherichia that can be used in the present invention is not limited in any way, however, for example, the bacteria described in Neidhardt F.C. et al. (Escherichia coli and Salmonella typhimurium, American Society for Microbiology, Washington D.C., 1208, Table 1), can be included in the number of bacteria according to the present invention.

According to the present invention, the term “bacterium producing the recombinant SAV-RGD protein” means a bacterium capable of producing and accumulating the recombinant SAV-RGD protein, preferably in the periplasm of said bacterium, when such a bacterium is cultured in a nutrient medium. The term “bacterium-producer of recombinant SAV-RGD protein” means that the microorganism is capable of producing and accumulating recombinant SAV-RGD protein in an amount of not less than 0.05 g per 1 liter of culture fluid and more preferably not less than 0.1 g per 1 l of culture fluid after growing for preferably 18 hours.

An example of a bacterial strain belonging to the genus Escherichia, a producer of the recombinant protein SAV-RGD, is the Escherichia coli strain MG1655 transformed with the above plasmid, for example, but not limited to the Escherichia coli strain MG1655 / pSAV-RGD. The specified strain is stored in the collection of the Faculty of Biology of Moscow State University.

According to the present invention, the cultivation of bacteria producing the recombinant protein SAV-RGD is carried out in a suitable nutrient medium. The growth medium can be either synthetic or natural, provided that it contains sources of carbon, nitrogen, mineral compounds and, if necessary, nutritional supplements in the amount necessary for the growth of bacteria. Carbon sources include various carbohydrates, such as glucose and sucrose, and various organic acids. Depending on the method of assimilation of the bacteria used, alcohols such as ethanol and glycerin may be used. Ammonia, various ammonium salts such as ammonium sulfate, other nitrogen compounds such as amines, natural nitrogen sources such as peptone, soybean hydrolyzate, and microbial fermentolizate are used as nitrogen sources. As mineral compounds, monosubstituted potassium phosphate, sodium chloride, calcium chloride, magnesium salts, iron salts, manganese salts and the like are used. As vitamins, thiamine, yeast extract and the like are used.

The cultivation is preferably carried out under aerobic conditions, such as shaking and aeration with stirring, at a temperature of from 20 ° C to 40 ° C, preferably from 30 ° C to 38 ° C, most preferably at 37 ° C. The pH usually ranges from 5 to 9, preferably from 7.0 to 8.0, most preferably from pH 7.5 to 7.8. The pH of the medium can be adjusted with ammonia, calcium carbonate, various acids, bases and buffers. Usually, growing for 18 hours leads to the accumulation of biomass of bacteria containing the target protein in the periplasmic space.

During the optimization of the cultivation conditions of the producer strain of the recombinant protein SAV-RGD, it was found that the pH of the nutrient medium is the most optimal 7.5.

Also, during optimization of the cultivation conditions of the producer strain of the recombinant SAV-RGD protein, it was found that a decrease in aeration due to stirring at a speed of preferably 450 rpm leads to an increase in the yield of the target recombinant SAV-RGD protein. Forced aeration is carried out by supplying 1 volume of air per 1 volume of nutrient medium.

Also, during the optimization of the cultivation conditions of the producer strain of the recombinant SAV-RGD protein, it was found that the two-stage cultivation of the strain is the most optimal. In the first part of the cultivation, the population of the producer strain cells is increased by feeding with a carbon source, in particular glucose, while it is preferable to control the feeding rate so that the final concentration of glucose in the nutrient medium does not exceed 1-2 g / l. In the second part of the cultivation, amino acids are fed for the effective biosynthesis of the recombinant SAV-RGD protein. Peptone and / or yeast extract are used as sources of amino acids.

After growing receive periplasmic fraction of these cells. For this, cells are pelleted by centrifugation, preferably at 5000 rpm at a temperature of 4 ° C. for preferably 10 minutes. The culture fluid is removed and the resulting biomass resuspended in a lysis buffer solution, after which centrifugation at preferably 12,500 rpm at 4 ° C for preferably 20 minutes gives the supernatant, which is the total fraction of E. coli periplasmic proteins. Variants of this process are described in detail in Sambrook J., Fritsch E.F., Maniatis T. (1989) [Cold Spring Harbor Laboratory Press].

In the course of optimizing the conditions for obtaining the periplasmic fraction of bacterial cells, it was found that it is economically feasible to use a lysis buffer containing lysozyme at a concentration of 1 g / l in a ratio of volumes of 1:20 to the volume of cell biomass.

The selection of the target recombinant protein SAV-RGD from the fraction of periplasmic proteins is carried out by ion exchange chromatography. In the course of optimizing the cleaning conditions, it was found that the use of SP-sepharose (granular agarose modified with sulfopropyl groups) instead of 2-iminobiotinagarose is economically feasible as a carrier in the method of ion exchange chromatography. In addition, SP-Sepharose as a carrier is quite stable and can withstand multiple cycles of protein purification. The yields of the target protein and its purity are comparable when using SP-Sepharose and 2-iminobiotinagarose.

After chromatography, the target recombinant proteins are purified by ultrafiltration through a membrane, which allows the filtering of proteins larger than preferably 30 kDa for concentration and translation. For ultrafiltration, it is preferable to use a YM-30 membrane (Amicon, USA). It is preferable to use a 1:20 dilution with at least five-fold buffer changes. Ultrafiltration is carried out under inert gas pressure (argon, helium with a pressure of at least 4.7 atm).

As a result of the above procedures, purified preparations of recombinant SAV-RGD proteins are obtained. The structures of the obtained fusion proteins are confirmed by mass spectrometry (MALDI-TOF MS). The homogeneity of the recombinant proteins is confirmed by denaturing polyacrylamide gel electrophoresis. The purity of the obtained preparation of recombinant proteins SAV-RGD obtained by this method was not less than 97%.

To obtain a drug for the preparation of a medicament for the treatment of human melanoma, the resulting solution of purified recombinant SAV-RGD protein is lyophilized. Lyophilization is carried out by pouring the solution into vials, the solution is frozen at a temperature of preferably -70 ° C and placed in a freeze dryer. The freeze drying process is carried out for 10-16 hours in vacuum. At the end of drying, the vials are packed. Storage of the lyophilized preparation is carried out at a temperature of 4 ° C.

Brief Description of the Drawings

In FIG. 1 is a schematic representation of the plasmid pSAV - RGD containing the pro-sav-rgd fusion gene. Pudp is the promoter of the uridine phosphorylase gene from E. coli, pro-sav is the streptavidin precursor gene (prostreptavidin) from Streptomyces avidinii, rgd is the artificial gene for the melanoma-addressing peptide, AP _r is the ampicillin (beta-lactamase) resistance gene.

In FIG. Figure 2 shows the growth dynamics of the producer strain of the recombinant protein SAV-RGD (control fermentation). Glu - glucose content in the culture medium (g / l); OD is the optical density of the cell suspension at 600 nm; pH is the pH of the culture medium.

In FIG. Figure 3 shows the kinetics of accumulation of the target product, recombinant protein SAV-RGD (mg / l) under control fermentation.

In FIG. 4 shows the content of recombinant protein SAV-RGD mg in terms of unit biomass in the control fermentation.

In FIG. Figure 5 shows the growth dynamics of the producer strain of the recombinant protein SAV-RGD in a 1.5-liter fermenter at pH-statization. Glu - glucose content in the culture medium (g / l); OD is the optical density of the cell suspension at 600 nm; pH is the pH of the culture medium.

In FIG. Figure 6 shows the kinetics of accumulation of the target product, recombinant protein SAV-RGD (mg / l) in a 1.5-liter fermenter during pH-statization.

In FIG. 7 shows the content of the recombinant protein SAV-RGD mg, calculated on the basis of a unit of biomass in a 1.5-liter fermenter at pH-statization.

In FIG. Figure 8 shows the growth dynamics of the producer strain of the recombinant protein SAV-RGD in a 1.5-liter fermenter with a reduced level of aeration. Glu - glucose content in the culture medium (g / l); OD is the optical density of the cell suspension at 600 nm; pH is the pH of the culture medium.

In FIG. Figure 9 shows the kinetics of accumulation of the target product, recombinant protein SAV-RGD (mg / L) in a 1.5-liter fermenter with a reduced level of aeration.

In FIG. 10 shows the content of recombinant protein SAV-RGD mg in terms of unit biomass in a 1.5-liter fermenter with a reduced level of aeration.

In FIG. 11 shows the growth dynamics of the producer strain of the recombinant protein SAV-RGD in a 1.5-liter fermenter under conditions of feeding with carbon and amino acid sources. Glu - glucose content in the culture medium (g / l); OD is the optical density of the cell suspension at 600 nm; pH is the pH of the culture medium.

In FIG. 12 shows the kinetics of accumulation of the target product, recombinant protein SAV-RGD (mg / l) in a 1.5-liter fermenter under conditions of feeding with carbon and amino acid sources.

In FIG. 13 shows the content of recombinant protein SAV-RGD mg in terms of biomass in a 1.5-liter fermenter under conditions of feeding with carbon and amino acid sources.

In FIG. 14 shows the purity assessment of the recombinant SAV-RGD protein purified by affinity chromatography (A) and ion exchange chromatography (B) using HPLC.

In FIG. 15 shows the results of an experiment evaluating the binding efficiency of a recombinant SAV-RGD protein by human melanoma cells of the Me Wo line.

The recombinant plasmid pSAV-RGD shown in FIG. 1, consists of the following DNA fragments:

1) a sequence from 1 nucleotide to 404 nucleotides (n.) Includes a 404 bp DNA fragment containing a DNA fragment of plasmid pUC18 with 1N. 404 n each

2) a sequence with 405 N. 455 n each includes a 51 bp DNA fragment containing the RGD gene.

3) sequence with 456 N. 461 n each includes a 6 bp synthetic DNA fragment containing a synthetic polylinker;

4) a sequence with 462 N. 1010 n each includes a 549 bp DNA fragment containing the prostreptavidin gene, SAV (there is no sequence encoding a stop codon);

5) a sequence with 1011 N. 1017 n each includes a 6 bp DNA fragment containing a synthetic polylinker;

6) sequence with 1018 N. 1196 N. includes a 180 bp DNA fragment containing the sequence of the E. coli uridine phosphorylase promoter, Pudp;

7) sequence from 1197 N. 3433 n each includes a DNA fragment of plasmid pUC18 with 450 N. 2686 N 2237 bp containing the promoter of the β-lactamase gene (P (BLA)), the ampicillin resistance gene (AP ^r ), the sequence responsible for plasmid replication (ori) and the lac promoter (P (LAC)).

The present invention will be described in more detail below with reference to the following non-limiting Examples.

EXAMPLES

Example 1. Construction of the SAV-RGD gene and the creation of plasmids pSAV-RGD.

To obtain fusion genes, it is necessary to obtain the streptavidin gene (SAV) and the RGD-containing oligopeptide (RGD) genes. The nucleotide sequence of the RGD gene DNA coding chain: GCGGGTGCAGATGGCTTCCCAGGTTGCCGTGGTGATTGCAGTCAGGAATGA

The gene of the RGD-containing oligopeptide was obtained by annealing and PCR completion of the synthetic oligonucleotides RGD_F (5'-GCGATCTAGAGCGGGTGCAGATGGCTTCCCAGGTTGCCGTGGTG-3 ') and RGD_R (5'-TGACGCGTAGCGTAGCTAGCGTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCGCCA

The reaction mixture had the following composition: 10x PCR buffer (final concentration in the mixture: 75mM Tris-HCl (pH 8.8 at 25 ° C), 20 mM (NH4) 2S04, 0.01% (v / v) Tween 20) - 2 μl, 25 mM MgC12 (final concentration - 3 mM) - 3 μl, 1.25 mM dNTP (final concentration - 0.125 mM) - 2 μl, primers - 10 pmol per reaction, Taq polymerase - 5 units. Act. per reaction, mQ H20 - up to 20 μl. Amplification included: preliminary denaturation at 94 ° С for 2 min, 5 cycles (denaturation 94 ° С - 10 sec., Annealing of primers 65 ° С - 10 sec, elongation 72 ° С - 20 seconds), final elongation 72 ° С - 2 minutes. The nucleotide sequences thus obtained contained the Xbal and Hindlll restriction endonuclease cleavage sites for ligation with the vector.

After PCR, the obtained DNA fragments were besieged by 3.5 volumes of 96% ethanol with the addition of 1/10 by volume of 3 M sodium acetate (pH 5.0) for 30 minutes at -70 ° C, after which they were centrifuged at 13400 rpm for 10 minutes, the supernatant was removed, the precipitate was washed with 70% ethanol, then centrifuged for another 5 minutes at 13,400 rpm and dried on vacuum drying.

To obtain fusion genes in the vector pUC18 under the control of the E. coli uridine phosphorylase (Pudp) promoter, the vector pLSAVdS (H), similar to plasmid pflSAV19 [Gulko LB, Dyakov NA, Okorokova NA, Veiko V., was used P., Debabov V.G. (1999) Biotechnology, 4, p. 3-8]. This vector contains the streptavidin gene (there is no sequence encoding a stop codon) under the control of the E. coli uridine phosphorylase promoter (Pudp).

Then, the vector and fragment were co-digested with Xbal and Hindlll restriction endonucleases. The restriction reaction mixture had the following composition: plasmid - 6 μl (900 ng); fragment - 5 μl (100 ng); 10x Trango Yellow + buffer (Fermentas (Lithuania) (final concentration in the mixture: 33 mM Tris-acetate, pH 7.9, 10 mM Mg-acetate, 66 mM K-acetate, 0.1 mg / ml BSA) - 2 μl; restriction enzyme XbaI - 1 μl (10 units), Hindlll restrictase - 1 μl (10 units); mQ H2O - 5 μl. The molar ratio of vector: fragment in the mixture was 1: 5. The restriction was carried out at 37 ° C. within 1 hour.

After cleavage, DNA was precipitated with 3.5 volumes of 96% ethanol in the presence of 0.3 M sodium acetate (pH 5.0) for 30 minutes at -70 ° C, then centrifuged at 13,400 rpm for 10 minutes, the supernatant was removed washed the precipitate with 70% ethanol and dried.

The resulting mixture of the digested gene and plasmid was ligated for 1 hour at 22 ° C. The ligation reaction mixture had the following composition: 10x ligation buffer (Fermentas (Lithuania); final concentration in the mixture: 40 mM Tris-HCl, 10 mM MgC12, 10 mM DTT, 2.5 mM ATP (pH 7.8 at 2 ° C)) - 2 μl, the pLSAVdS (H) vector and the RGD gene split at the Xbal and Hindlll sites in a molar ratio of 1: 5-15 μl, T4 ligase - 2 μl (10 units), mQ H2O - 1 μl. After ligation, the DNA in the ligase mixture was precipitated with 3.5 volumes of 96% ethanol in the presence of 0.3 M sodium acetate (pH 5.0) for 30 minutes at -70 ° C, after which it was centrifuged at 13,400 rpm for 10 minutes, the supernatant was removed, the precipitate was washed with 70% ethanol, precipitated by centrifugation and dried.

Next, competent cells of E. coli strain JM110 were transformed with a ligase mixture and scattered on a Petri dish with agarized LB medium containing 100-150 mg / L ampicillin. The reprecipitated ligase mixture was added to the competent cells. The amount of DNA used for transformation was about 300 ng in terms of plasmid DNA), 40 minutes incubated in an ice bath, then 2 minutes at 42 ° C, then 1 ml of LB medium was added, 1 hour incubated at 32-37 ° C and scattered the cells in a cup. The plates were incubated at 32-37 ° C. overnight.

The grown clones were screened by PCR using primers M13F (5-TAACTAGTACGCAAGTTCACG-3 ') and Seq2SAV (5'-AGACCGCTTCTGCGTTCTG-3'). The reaction mixture had the following composition: 10x PCR buffer (final concentration in the mixture: 75 mM Tris-HCl (pH 8.8 at 25 ° C), 20 mM (NH4) 2S04, 0.01% (v / v) Tween 20) - 2 μl , 25 mM MgC12 (final concentration - 3 mM) - 2.4 μl, 1.25 mM dNTP (final concentration - 0.125 mM) - 2 μl, primers - 5 pmol each, cells from the colony suspended in sterile water, - 1 μl per reaction, Taq polymerase - 5 units. Act. per reaction, mQ H2O - up to 20 μl. Amplification included: preliminary denaturation at 94 ° С for 2 min, 25 cycles` (denaturation 94 ° С - 10 sec, annealing of primers 60 ° С - 10 sec, elongation 72 ° С - 10 seconds), final elongation 72 ° С - 2 minutes.

After PCR, the reaction mixture was subjected to electrophoretic separation on a 3% agarose gel containing ethidium bromide. The presence of a fused gene in the DNA of bacterial cells was identified by the presence of luminous PCR amplification products of the required size (about 150 bp).

Colonies that showed a positive response by PCR screening were plated in LB liquid medium containing 100-150 mg / L ampicillin and cultured at 32-37 ° C overnight with shaking.

The next day, cells were pelleted by centrifugation (3-5 minutes at 4500-6000 rpm) and plasmid DNA was isolated using the GeneJETTM Plasmid Miniprep Kit (Fermentas, Lithuania). A schematic representation of the plasmid pSR is shown in FIG. one.

Example 2. Obtaining strains of E. coli MG1655 / pSAV-RGD - producer of the recombinant fusion protein SAV-RGD

The pSAV-RGD plasmid obtained in the previous step was sequenced in the region containing the RGD gene. The sequencing reaction was carried out on an Eppendorf thermocycler (Germany) according to the following program: preliminary denaturation of 94 ° С - 2 min, 25 cycles (denaturation of 94 ° С - 10 sec, annealing of primers 60 ° С - 10 sec, elongation 72 ° С - 20 seconds) , final elongation 72 ° C - 5 minutes. Sequencing was performed using the following primers: Seq2SAV and M13F. The reaction mixture had the following composition: 10x sequencing buffer - 1 μl, primer - 10 pmol per reaction, plasmid -200 ng per reaction, radioactive label (α32P-dATP, activity 250 mkKu) - 1 μl, terminator di-deoxyribonucleoside triphosphates - 2 μl (each in each reaction), Taq polymerase - 1 μl (10 units), mQ H2O - up to 8 μl. The reaction was stopped by adding StopSolution reagent. Next, the products of the sequencing reaction were heated to 95 ° C and applied on a 5% polyacrylamide gel with urea. Electrophoresis was performed for 2-3 hours. After that, the gel was soaked for 20 minutes in 10% acetic acid, transferred onto a sheet of 3 mm Whatman paper and dried on a gel driver. Next, the gel was placed in a cassette with an x-ray film and left overnight in complete darkness. The next day, the film was developed, the nucleotide sequence was read by hand, the evaluation was carried out in the VectorNTI 8.0 program (Invitrogen, USA). The plasmid with the verified nucleotide sequence transformed the E. coli strain MG1655. The transformation was carried out by a chemical method: a plasmid in an amount of 20 ng was added to competent cells, the mixture was incubated for 40 minutes first in an ice bath, then 2 minutes at 42 ° C, then 1 ml of LB medium was added, 1 hour incubated at 32-37 ° C and cells were scattered on a Petri dish with LB medium with agar containing 100-150 mg / l ampicillin. The plates were incubated at 37 ° C. overnight.

As a result of the above procedures, the E. coli strain MG1655 / p SAV-RGD, a producer of the SAV-RGD fusion protein, was obtained.

Example 3. Preparation of sterile culture media.

Sterile medium LB

The sterile medium has the following composition (g / l): Bacto-Trypton Difco 10.0 Difco Bacto-Yeast Extract 5,0 NaCl 10.0

The medium is prepared in a 1000 ml measuring cup, into which 900 ml of distilled water is poured, a portion of bacto-tryptone (10 g), bacto-yeast extract (5 g), sodium chloride (10 g) are added, mixed. The pH of the medium was adjusted with 10 N aqueous NaOH to 7.5. The prepared solution was transferred into a 2000 ml flask, closed with a cotton-gauze plug and sterilized for 20 min at 121 ° C in an autoclave (Sanyo MLS 2420 U, Japan). After sterilization, sterile ampicillin (Russia) is added under aseptic conditions to a concentration of 150 μg / ml. The medium is stored at room temperature for no more than 3 months.

Sterile medium M9 ⁺ + glucose

The sterile medium has the following composition (g / l):

Difco Bacto-Yeast Extract 2.0 Ammonium sulfate 4.0 NaCl 0.6 Potassium phosphate 2-substituted 2.0 Magnesium sulfate 0.4 Iron sulfate 0.02 Manganese Sulfate 0.02 Thiamine 0.04 Glucose 4.0

The medium is prepared in a 1000 ml measuring cup, into which 990 ml of distilled water is poured, a portion of bacto-yeast extract (2 g), ammonium sulfate (4 g), sodium chloride (0.6 g), and potassium phosphate 2-substituted are added ( 2 g), magnesium sulfate (0.4 g), iron sulfate (0.02 g), manganese sulfate (0.02 g), stirred. The pH of the medium is adjusted to 10 N. aqueous NaOH solution to a value of 7.0-7.2. The prepared solution was transferred into a 2000 ml flask, closed with a cotton-gauze plug and sterilized for 20 min at 121 ° C in an autoclave (Sanyo MLS 2420 U, Japan). After sterilization, sterile ampicillin (Russia) is added under aseptic conditions to a concentration of 150 μg / ml and sterile thiamine to a concentration of 0.04 g / l. The medium is stored at room temperature for no more than 3 months.

To prepare a 40% glucose solution in 100 ml of distilled water, 40 g of glucose is dissolved and sterilized for 15 min at 115 ° C in an autoclave (Sanyo MLS 2420 U, Japan). The solution is stored at room temperature for no more than 6 months.

Before use, 10 ml of a sterile 40% glucose solution is added to the sterile medium under aseptic conditions. The resulting glucose medium cannot be stored.

Example 4. Optimization of the cultivation process of a producer strain by pH-statization of the culture medium.

During the cultivation (control, simulating the process at the laboratory level "bulb-fermenter") used the following composition: M9 ⁺ + glucose, previously selected as optimal for laboratory experiments, which contained 2 g / l of yeast extract, 4 g / l of glucose and 200 μg / ml ampicillin. When the seed was applied, the optical density was monitored until an OD ₆₀₀ value of 0.09 was reached. The stirrer speed was maintained at 750 rpm. Forced aeration was carried out by supplying 1 V air to V medium (1.5 l / min). It should be noted that in this mode, according to the sensor, the dissolved oxygen content decreased during the first 5 hours (to min. 15%), then there was a rise in the dissolved oxygen concentration to 30 - 40%. pH-stating was turned off to assess the dynamics of pH during the transition to “extreme” fermentation conditions. Glucose concentration was determined on a Biosen C-line glucose analyzer (EKF Diagnostic). Fermentation results are shown in FIG. 2-4.

When switching to cultivation under conditions of pH-stating, the standard procedure was used - titration of the cultivation medium with solutions of 10% H ₂ SO ₄ and 10% NH ₄ OH, and the pH was maintained at 7.5. When conducting fermentation with pH stating, the following composition was used: M9 ⁺ + glucose, previously selected as optimal for laboratory experiments, which contained 2 g / l of yeast extract, 4 g / l of glucose and 200 μg / ml of ampicillin. When the seed was applied, the optical density was monitored until an OD ₆₀₀ value of 0.05 was reached. The stirrer speed was maintained at 750 rpm. Forced aeration was carried out by supplying 1 V air to V medium (1.5 l / min). It should be noted that in this mode, according to the testimony of BS, the content of dissolved oxygen decreased during the first 5 hours (to min. 17%), then there was a rise in the concentration of dissolved oxygen to 35-40%. Glucose concentration was determined on a Biosen C-line glucose analyzer (EKF Diagnostic). The cultivation results are shown in FIG. 5-7.

The data obtained show that pH-statization slows down the process of autolysis of the cells of the producer strain and maintains biomass accumulation at a constant level (Fig. 5). A comparative analysis of the growth dynamics of the culture (OD ₆₀₀ ) and the biosynthesis of the recombinant protein SAV-RGD shows that the growth rate of the target product in the cells is significantly higher than the biomass accumulation rate: the density of the culture between 2 and 15 hours of cultivation increased by 3.7 times, and the amount of synthesized the target protein increased 10.8 times, FIG. 6 and 7). The correlation of these parameters shown in FIG. 8 shows that the cells of the producer strain not only retain their biosynthetic potential, but also increase it.

Thus, pH-stating is one of the key factors of this cultivation process, which allows us to conclude that it is necessary to maintain a pH of 7.5 in an optimized cultivation process.

Example 5. The study of the effect of aeration on the level of production of the target protein.

As noted above, during the cultivation of E. coli cells in the presence of glucose as a carbon source, an active production of an acidic product is observed. An analysis of the scientific and technical literature shows that acetate and / or formate can be such an acidic product [Tao, N., C. Bausch, C. Richmond, F. R. Blattner, and T. Conway. 1999. Functional genomics: expression analysis of Escherichia coli growing on minimal and rich media. J. Bacteriol. V. 181P. 6425-6440].

This process is largely influenced by aeration (the degree of saturation of the culture medium with oxygen). In this regard, the next stage of optimization was the study of the effect of aeration (the rotation speed of a laboratory fermenter stirrer) on the cultivation of cells of a producer strain in a laboratory fermenter.

During the cultivation, a medium of the following composition was used: M9 ⁺ + glucose, previously selected as optimal for laboratory experiments, which contained 2 g / l of yeast extract, 4 g / l of glucose and 200 μg / ml of ampicillin. For pH-stating, the standard procedure described above was used, and the pH was maintained at 7.5. When seed was applied, optical density was monitored until an OD ₆₀₀ value of 0.06 was reached. The stirrer speed was maintained at 450 rpm, thus reducing the level of aeration in the volume of the culture medium. Forced aeration was carried out by supplying 1 V air to V medium (1.5 l / min). It should be noted that in this mode, according to the testimony of BS, the content of dissolved oxygen decreased during the first 5 hours (to a minimum value of 10%), then there was a rise in the concentration of dissolved oxygen to 20 - 25%. Glucose concentration was determined on a Biosen C-line glucose analyzer (EKF Diagnostic).

The results of cultivation with a decrease in aeration level - a decrease in the rotation speed of a laboratory fermenter mixer - are shown in FIG. 8-10. From the obtained experimental data, it follows that a decrease in the aeration level to 450 revolutions of the stirrer per minute, and therefore, a decrease in the saturation of the nutrient medium with oxygen, led to an increase in the biomass and the amount of the target protein (Figs. 8 and 9). It should be noted that the content of the recombinant protein SAV-RGD increased to 90 - 95 mg / L.

However, the yield of the target protein per unit of biomass was lower than in the experiments at 750 rpm, and amounted to 5.6 mg / g of biomass (Fig. 10).

Thus, the data obtained show that a decrease in the speed of the fermenter stirrer (oxygen saturation of the culture medium), along with the additional automatic regime of pH-statization, have a significant effect on the biosynthetic potential of the cells of the producer strain, improving this indicator by an average of 15-18% compared with fermentations without pH-stating and at high speeds stirrers laboratory fermenter.

Example 6. The study of the effect of glucose and amino acid supplementation on the level of production of the target protein.

It is known that one of the parameters that limit the stage of biosynthesis is the rapid depletion of the main components — sources of carbon and nitrogen — in the nutrient medium. This process is particularly active in the cultivation of cells of the producer strain in the fermenter (Fig. 3, 7, 11). In connection with the foregoing, experimental fermentation was performed on a medium with the addition of glucose and a source of amino acids.

When choosing the glucose supply rate, the features of the promoter-operator region, under the control of which the artificial gene sav-rgd, were taken into account. According to published data, the activation of this promoter-operator region is carried out by the CRP-cAMP complex (Hammer - Jespersen K. // Metabolism of Nucleotides, Nucleosides and Nucleobases in Microorganisms / Ed. Munch - Petersen A. London, New York, San Francisco: Acad. Press - 1983. - P. 203 - 258. Kolb A., Busby S., Buc H., Garges S., Adhya S. (1993) Transcriptional regulation by cAMP and its receptor protein. Annu. Rev. Biochem. 62, 749 -795). In its most general form: this promoter is catabolite-sensitive and is repressed in the presence of high glucose concentrations by the CytR repressor. In this regard, the glucose supply rate was regulated so that the final concentration in the nutrient medium was not higher than 1 - 2 g / l.

When carrying out the fermentation, a medium of the following composition was used: M9 ⁺ + glucose, previously selected as optimal for laboratory experiments, which contained 2 g / l of yeast extract, 4 g / l of glucose and 200 μg / ml of ampicillin. For pH-stating, the standard procedure described above was used, and the pH was maintained at 7.5. When seed was applied, optical density was monitored until an OD ₆₀₀ value of 0.06 was reached. The stirrer speed was maintained at 450 rpm. Forced aeration was carried out by supplying 1 V air to V medium (1.5 l / min). It should be noted that in this mode, according to the testimony of BS, the content of dissolved oxygen decreased during the first 5 hours (to min. 10%), then there was a rise in the concentration of dissolved oxygen to 20 - 25%. Glucose concentration was determined on a Biosen C-line glucose analyzer (EKF Diagnostic). The initial volume of medium in the fermenter was 1.1 l. The seed was inoculated and a 40% glucose solution was immediately forced into the fermenter at a feed rate of 25 ml / h and the cells of the producer strain were cultured in this mode for 10 hours. At the end of glucose administration, a sterile solution of peptone (10 g / l), yeast extract (5 g / l) and ampicillin (100 mg / l) were added fractionally for another 8 hours. The flow rate of the solution was 25 ml / hour. The total volume of the culture suspension was at the time of the end of fermentation approximately 1.35 L. In total, the cultivation process was carried out for 18 hours.

The fermentation results, provided that carbon and amino acid sources are fed, are shown in FIG. 11-13.

Analysis of the data (Fig. 11-13) suggests that during the cultivation period from 10 to 14 hours there is an exhaustion of the main carbon source - glucose (the culture grows when the carbon source is limited). In the same period, the culture is metabolically converted to the consumption of amino acids from peptone and yeast extract, which is expressed in a decrease in the growth rate of the culture (despite the beginning of fractional introduction of amino acid sources) and, at the same time, the production of the target protein. After that, there is a sharp increase in both the density of the culture suspension and the level of accumulation of the recombinant protein SAV-RGD (Fig. 11-13). These data suggest that, under cultivation in a laboratory fermenter, initial intensive glucose utilization occurs, which leads to the production of a cell population of the producer strain capable of actively producing the target recombinant protein, and subsequent fractional feeding of amino acid components serves as a kind of “inducer” activating the recombinant biosynthesis SAV-RGD protein.

At the same time, it should be recognized that the chosen approach of fractional glucose supply is optimal, because a high concentration of this carbon source is not created in the nutrient medium, leading to too intensive formation of acetate, the inhibitory effect of which on the growth of the culture of the recombinant strain of E. coli producer of the target protein in the fermenter was previously detected.

In this regard, it could be suggested that the process of cultivating the cells of the producer strain be divided into two stages: increasing the total biomass and the stage of active biosynthesis of the recombinant protein. In this case, the stage of "induction" of amino acid additives can be carried out not by fractional supply, but by the simultaneous introduction of amino acid components.

Thus, the optimal cultivation conditions of the recombinant strain of E. coli producer of the target protein in the fermenter are: M9 ⁺ medium + glucose of the following composition (g / l):

Difco Bacto-Yeast Extract 2.0 Ammonium chloride 4.0 NaCl 0.6 Potassium phosphate 1-substituted 3.0 2-substituted sodium phosphate 15,2 Magnesium sulfate 0.25 Calcium chloride 0.02 Yeast extract 2.0 Glucose 4.0 Ampicillin 0.2

pH stating - pH 7.5.

The amount of seed seeded is OD ₆₀₀ 0.05-0.09 culture medium.

The stirrer speed is 450 rpm.

Forced aeration - 1.5 liters of air per minute.

Make-up - with a 40% glucose solution (feed rate of 25 ml / hour, maintaining a glucose concentration of 1 g / l) for 10 hours.

Fractional recharge - a solution of peptone (10 g / l), yeast extract (5 g / l) and ampicillin (100 mg / l) for the next 8 hours with a feed rate of 25 ml / hour.

Fermentation time is 18 hours.

Example 7. Preparation of solutions for chromatography, cell lysis, gel filtration and ultrafiltration.

To prepare buffer “A”, 950 ml of distilled water was added to a 1000 ml measuring cup and weighed portions of NaCl (29 g) and Na ₂ CO ₃ (5.3 g) were added and stirred on a magnetic stirrer until completely dissolved. The solution is titrated until a pH of 10.8 is reached. Then the volume is adjusted to 1000 ml and stored at a temperature of + 4 ° C.

To prepare buffer “B”, 950 ml of distilled water is added to a 1000 ml measuring cup and weighed portions of NaCl (29 g) are added and stirred on a magnetic stirrer until completely dissolved. Then the volume is adjusted to 1000 ml and stored at a temperature of + 4 ° C.

To prepare buffer “B”, 950 ml of distilled water is added to a 1000 ml measuring cup and weighed portions of CH ₃ СООNa (4.1 g) and NaCl (29 g) are added and stirred on a magnetic stirrer until completely dissolved. The solution is titrated until a pH of 4.0 is reached. Then the volume is adjusted to 1000 ml and stored at a temperature of + 4 ° C.

To prepare a gel filtration buffer, 950 ml of distilled water is added to a 1000 ml measuring beaker and weighed portions of Na ₂ HPO ₄ (1.42 g) and NaCl (8.7 g) are added and stirred on a magnetic stirrer until completely dissolved. The solution is titrated until a pH of 7.4 is reached. Then the volume is adjusted to 1000 ml and stored at a temperature of + 4 ° C.

To prepare the TE buffer, 950 ml of distilled water is added to a 1000 ml measuring cup and weighed portions of Tris-C1 (3.94 g) and EDTA (1.47 g) are added and stirred on a magnetic stirrer until completely dissolved. The solution is titrated until a pH of 8.0 is reached. Then the volume is adjusted to 1000 ml and stored at a temperature of + 4 ° C.

To prepare a lysis buffer buffer, 750 ml of distilled water are added to a 1000 ml measuring cup and weighed portions of Tris-C1 (1.57 g), EDTA (2.92 g), lysozyme (1 g) and sucrose (200 g) are mixed on a magnetic stirrer until completely dissolved. The solution is titrated until a pH of 8.0 is reached. Then the volume is adjusted to 1000 ml and stored at a temperature of + 4 ° C.

Example 8. Optimization of the process of obtaining the periplasmic fraction of cells of the producer strain of the recombinant protein SAV-RGD.

The resulting biomass is washed twice with 100 ml of TE-buffer (10 mm Tris-C1, pH 8.0; 5 mm EDTA) with separation by centrifugation under the same conditions. Lysing buffer containing 20% sucrose, 10 mM EDTA, 1 mg / ml lysozyme, 25 mM Tris-C1, pH 8.0 is added to the resulting biomass and incubated for 15-20 minutes at + 4 ° C (ice bath) at constant stirring. The mixture is centrifuged for 10 minutes at 10,000 rpm (+ 4 ° C). The supernatant containing the periplasmic protein fraction is collected and used to purify the target protein.

The optimization process included the selection of the ratio of the biomass suspension and the volume of the lysing mixture with a variation of this ratio - 1: 1, 1: 5, 1:10, 1:15, 1:20 and 1:25. The control parameter was the amount of the selected target protein. The content of the target protein in the periplasmic fraction was determined using HPLC. The optimization results are summarized in Table 1.

As can be seen from the above data, the ratio of lysis buffer to biomass can be significantly reduced by bringing it to a value of 1:20 (1 volume of lysis buffer: 20 volumes of cell suspension after fermentation). Moreover, almost the entire SAV-RGD protein was localized in the supernatant (fractions of the periplasmic proteins of the producer strain). A further increase in the amount of biomass per lysing volume led to an increase in the viscosity of the resulting protein solution, as well as to losses in the separation of the periplasmic protein solution from the precipitate after centrifugation. In this regard, subsequently used the ratio of lysis buffer to the volume of the suspension of cells 1:20.

Example 9. Purification of recombinant protein SAV-RGD by ion exchange chromatography.

Previously, the authors of the present invention showed that the use of affinity chromatography on 2-iminobiotin agarose allows to achieve the degree of purification of the target product by 17.5 times, and the purity of 95-97%. In order to increase the purity of the target protein and reduce the cost of this stage of the technological process, experiments were carried out in comparison with the processes of isolation of the recombinant protein SAV-RGD from the periplasmic fraction on columns with 2-iminobiotin-agarose and SP-sepharose. The volume of the carrier was increased in accordance with the scaling factor, which corresponded to an increase in the obtained culture fluid at the scaling stage 1 — flasks, the scaling stage 2 — a 1.5-liter fermenter and the scaling stage 3 — a 7-liter fermenter.

Purification of the recombinant protein SAV-RGD by ion exchange chromatography was carried out as follows. The periplasmic fraction was introduced with constant stirring in a buffer solution of 0.01 M sodium acetate, pH 4.0 to remove part of the ballast proteins. The resulting solution was titrated to pH 4.0 with glacial acetic acid and incubated for 10 minutes with constant stirring. Then the solution was centrifuged for 30 min (5000xg, + 4 ° C). The supernatant was carefully drained and applied to a fast flow SP-Sepharose column (GE, USA) using a peristaltic pump (flow rate 2.5 ml / min). The column was washed sequentially with 100 ml of 0.01 M sodium acetate, pH 4.0; 250 ml of 0.15 M NaCl in 0.01 M sodium acetate, pH 4.0. The protein was eluted with 0.25 M NaCl in 0.01 M sodium acetate, pH 4.0. Protein yield was monitored using an ultraviolet detector. The resulting protein solution was collected and the protein concentration was determined using the BCA method (BCA-kit, Sigma), protein purity was monitored by HPLC on a Symmetry 300C4 column (4.6 × 150 mm) in a gradient of 0.1% TFA - acetonitrile, as well as by electrophoresis in 14% polyacrylamide gel. The eluate was concentrated using an Amicon cell (PM-30 membrane) to a protein concentration of 10-20 mg / ml and dialyzed against 3 L of 0.01 M sodium phosphate, pH 7.4 (+ 4 ° C, 18 h). The dialysate is filtered through a 0.22 μm membrane filter, aliquots of the filtrate are transferred into 10 ml sterile penicillin vials, the vials are covered with a Petryanov sterile cloth, kept at -70 ° C (at least 2 hours) and lyophilized for 20 hours. Vials with dried the drug is sealed with sterile rubber stoppers and clamped with aluminum caps. Store at (+ 4 ° C).

The amount of recombinant SAV-RGD protein obtained was determined by HPLC, the protein concentration was determined using the BCA method (BCA-kit with the protocol of the manufacturer's method Sigma, Cat. No. BCA1-1KT, USA). The data obtained are summarized in Table 2.

As can be seen from the data obtained, both the yield of the target protein and its degree of purity were comparable or higher when using ion exchange chromatography. The purity of the target proteins obtained by two methods was evaluated by HPLC. The data are presented in FIG. 14. The results of chromatographic analysis indicate that the purity of the recombinant SAV-RGD protein isolated by affinity chromatography and the purity of the recombinant SAV-RGD protein isolated by ion exchange chromatography are comparable. However, with comparable yields and purity of the target protein, the economic indicators of the two isolation methods differ significantly. With maximum scaling, the cost of the sorbent when isolating 1 mg of the target SAV-RGD protein is: when using affinity chromatography, 28.3 euros / mg, and when using ion exchange chromatography, 0.14 euros / mg. That is, the method of affinity chromatography is more than 200 times more expensive. Therefore, replacing the carrier for isolation and purification of the recombinant protein SAV-RGD allows you to reduce the cost of this stage of the process. In addition, the capacity of 2-imnobiotin agarose and its low stability (crosslinked agarose) do not allow counting on a large number of protein purification cycles based on streptavidin, which is necessary for scaling the process. At the same time, SP-Sepharose as a carrier is quite stable and can withstand multiple cycles of protein purification.

Thus, the results obtained showed the promise of using ion exchange chromatography for the isolation and purification of recombinant SAV-RGD protein.

Example 10. Verification of the biological activity of the obtained SAV-RGD protein.

The binding efficiency of the target protein to human melanoma cells of the Me Wo line was determined as follows:

Cell preparation

The cell culture of MeWo metastatic human pigmentless melanoma (malignant melanoma (derived from metastatic site, lymph node by Y. Kodera and M. Bean, 1974), ATCC® HTB-65 ™) was plated on 10-cm culture dishes (Greiner, Austria) and were grown for 72 hours in the Needle modified Dulbecco medium (DMEM, Dulbecco's modified Eagles medium) (PanEco, Russia) supplemented with 10% fetal calf serum (Hyclone, USA), 100 units / ml penicillin and 100 μg / ml streptomycin (or 200 μg / ml kanamycin). Cultivation was carried out at 37 ° C in a humid atmosphere containing 5% carbon dioxide. The density of the culture was evaluated visually. In the experiments, cells were used in the exponential growth stage, passing 3-4 passages after thawing. By the time of the experiment, the cells occupied approximately 30-50% of the bottom surface of the cup.

Immediately before the experiment to evaluate the efficiency of protein binding to cells from the culture plates, the medium was removed, the cells were washed 3 times with DPBS solution (PanEco, Russia), after which 4 ml of Versen solution (PanEco, Russia) was added and incubated for 5 minutes at room temperature . The Versen solution was removed, the cells were washed from the plate with 3 ml of serum-free DMEM medium, resuspended and incubated for 30 minutes. The number of cells was determined by counting in a Goryaev chamber.

Based on the counting data, the cells were diluted with serum-free DMEM until a density of 200-250 thousand cells / 1 ml of suspension was reached.

Obtaining FITC-labeled recombinant protein SAV-RGD.

The lyophilized recombinant SAV-RGD protein was dissolved in PBS to a concentration of 1 mg / ml. FITC-conjugated biotin (5 - ((N- (5- (N- (6- (biotinoyl) amino) hexanoyl) amino) pentyl) thioureidyl) fluorescein (fluorescein biotin), B1370, Molecular Probes, Inc.) was dissolved in DMSO to a concentration of 25 mg / ml. The FITC-Biotin solution was added to the SAV-RGD recombinant protein solution, mixed and incubated in the dark at room temperature for 60 minutes. Since the SAV-RGD protein contains 4 biotin binding sites, the molar ratio of SAV-RGD: FITC-biotin in solution was 1: 4. Thus, 44.5 μg FITC-Biotin was used to label 1 mg of the recombinant protein.

Evaluation of the binding efficiency of the FITC-labeled recombinant protein SAV-RGD with MeWo cells.

Preparation of an experimental sample (E). 250 μl of the prepared cell suspension containing 50-60 thousand cells was placed in a 1.5 ml tube and 25 μl of the FITC-labeled SAV-RGD test protein solution was added. Thus, the final concentration of protein in the solution was 1.25 * 10-6 mol / L. Tubes with cell suspension were placed in a thermostat and incubated for 1 hour at 37 ° C in an atmosphere of 5% CO ₂ , shaking every 10-15 minutes. After 1 hour, the cells were pelleted by centrifugation in a benchtop centrifuge (3 min at 3000 rpm (800 g)) and the supernatant was removed. The precipitate was washed with 400 μl of DPBS solution, precipitated by centrifugation, and then resuspended in 250 μl of DPBS solution.

Preparation of control sample (K)

250 μl of the prepared cell suspension containing 50-60 thousand cells was placed in a test tube and 25 μl of DPBS solution was added. Tubes with a cell suspension were placed in a thermostat and incubated for 1 hour at 37 ° C in an atmosphere of 5% CO ₂ , periodically shaking (every 10-15 minutes). After 1 hour, the cells were pelleted by centrifugation (3 min at 3000 rpm (800 g)) and the supernatant was removed. The precipitate was washed with 400 μl of DPBS solution, precipitated by centrifugation, and then resuspended in 250 μl of DPBS solution.

The fluorescence intensity of the cells from the experimental (E) and control (K) samples was analyzed using a flow cytometer (FACS Aria SORP, Beckton Dickinson, or analog), determining the median distribution of fluorescence intensity of the cells of the experimental (Me) and control (Mk) samples, respectively.

The conclusion about the effectiveness of the protein preparation was made on the basis of the value of M, which is calculated by the formula M = (Me / Mk * 5). If the obtained value is greater than or equal to 1, then the analyzed drug is considered effective, if less than 1 - ineffective.

The results of an experiment to evaluate the binding efficiency of recombinant SAV-RGD protein by human MeWo melanoma cells are shown in FIG. fifteen.

Although the invention has been described in detail above, it will be apparent to those skilled in the art that various changes can be made and equivalent replacements made, and such changes and replacements are not beyond the scope of the present invention. All cited documents are part of the description of the present invention and are fully incorporated into this description by reference.

Claims (5)

1. A method of producing a recombinant protein SAV-RGD, where SAV is a streptavidin monomer, RGD is a melanoma-addressing oligopeptide having the amino acid sequence Ser-Arg-Ala-Gly-Ala-Asp-Gly-Phe-Pro-Gly-Cys-Arg- Gly-Asp-Cys-Ser-Gln-Glu, including:
- culturing in a nutrient medium the bacterial strain MG1655 / pSAV-RGD obtained by transforming the Escherichia coli strain MG1655 with the plasmid pSAV-RGD, in turn obtained on the basis of the pUC18 vector and including the sequence encoding the fused gap SAV-RGD (pro-sav-rgd) under control of the promoter of uridine phosphorylase (Pudp) E. coli, while cultivation is carried out with pH-stating in the pH range of 7.5-7.8, and with a concentration of dissolved oxygen not exceeding 20-25%, in two stages, where in the first stage, lasting for 8-12 hours, provide a source of glitch ozas, and in the second stage, which lasts for 6-10 hours, they are fed with a source of amino acids, which use peptone and yeast extract;
- obtaining the periplasmic fraction of the cells of the bacterial strain using a lysis buffer, which includes lysozyme at a concentration of 1 g / l;
- purification of the recombinant protein by ion exchange chromatography followed by ultrafiltration; and
- lyophilization of purified recombinant protein SAV-RGD. 2. The method according to p. 1, characterized in that M9 ⁺ + glucose is used as a nutrient medium. 3. The method according to p. 1, characterized in that at the first stage of cultivation control the rate of glucose replenishment so that the final concentration of glucose in the nutrient medium does not exceed 1-2 g / l. 4. The method according to p. 1, characterized in that upon receipt of the periplasmic fraction of cells of the producer strain of the recombinant protein SAV-RGD, the ratio of the volumes of lysis buffer and cell biomass is 1:20. 5. The method according to p. 1, characterized in that SP-Sepharose is used as a carrier in the method of ion exchange chromatography, and ultrafiltration is carried out using a membrane with a pore size of 30 kDa.

Images