RU2153535C1

RU2153535C1 - Recombinant plasmid dna psa v27 encoding synthesis of soluble streptavidine from streptomyces avidinii and bacterial strain escherichia coli as producer of soluble streptavidine from streptomyces avidinii

Info

Publication number: RU2153535C1
Application number: RU99109717A
Authority: RU
Inventors: Л.Б. Гулько; Н.А. Окорокова; Н.А. Дьяков; А.К. Соколов; В.П. Вейко; В.Г. Дебабов
Original assignee: Государственный научно-исследовательский институт генетики и селекции промышленных микроорганизмов
Priority date: 1999-05-14
Filing date: 1999-05-14
Publication date: 2000-07-27

Abstract

FIELD: molecular biology, microbiological industry, medicinal biotechnology, genetic engineering. SUBSTANCE: invention proposes recombinant plasmid DNA pSA V27 encoding synthesis of soluble streptavidine secreted into periplasm and used as the base for construction of the strain Escherichia coli VKPM B-7758 as a producer of streptavidine. Strain accumulates 180-240 mg/l of streptavidine in cultural fluid for 1-14 h of fermentation. EFFECT: recombinant plasmid indicated above, increased yield of streptavidine. 3 cl, 3 dwg, 4 ex

Description

Изобретение относится к микробиологической промышленности, медицинской биотехнологии, генной инженерии и представляет собой сконструированную in vitro рекомбинантную плазмидную ДНК, обеспечивающую гетерологичную экспрессию растворимого стрептавидина из Streptomyces avidinii, и содержащий рекомбинантную плазмиду штамм Escherichia coli - продуцент стрептавидина. The invention relates to the microbiological industry, medical biotechnology, genetic engineering, and is an in vitro recombinant plasmid DNA that is designed to heterologously express soluble streptavidin from Streptomyces avidinii, and an Escherichia coli strain streptavidin producer that contains a recombinant plasmid.

Стрептавидин (SAV) представляет собой четырехсубъединичный негликозилированный белок, специфически связывающий витамин H (d-биотин) [Biochemistry. 1992. V. 31. P. 9350-9354]. Биологическая функция этого белка в клетках S. avidinii окончательно не выяснена, но предполагается, что он, как и гликопротеин авидин (белок куриных яиц), играет защитную роль, подавляя рост биотинзависимых микроорганизмов. К настоящему времени аналоги стрептавидина, белки V1 и V2, обнаружены в S. venezuelae [Biochim. Biophys. Acta, Gene Struct. Expr. 1995. V. 1263. P. 60-66]. Streptavidin (SAV) is a four-subunit non-glycosylated protein that specifically binds vitamin H (d-biotin) [Biochemistry. 1992. V. 31. P. 9350-9354]. The biological function of this protein in S. avidinii cells has not been fully elucidated, but it is believed that it, like the avidin glycoprotein (egg white protein), plays a protective role, inhibiting the growth of biotin-dependent microorganisms. To date, streptavidin analogues, proteins V1 and V2, are found in S. venezuelae [Biochim. Biophys. Acta, Gene Struct. Expr. 1995. V. 1263. P. 60-66].

Тетрамерный белок стрептавидин связывает четыре молекулы биотина (K_d= 10^-15). В современной медицине и биологии это свойство стрептавидина нашло широкое применение при создании спектра препаратов, предназначенных для высокочувствительной нерадиоактивной детекции биомолекул [Биоорган. химия. 1989. Т. 15. С. 354-357; Clin. Chem. 1991. V. 37. Р. 625-636; Proc. Natl. Acad. Sci. 1995. V. 92. P. 7590-7594]. В последнее время повышенное внимание вызывают исследования, направленные на создание терапевтических препаратов на основе стрептавидина, применяемых для лечения онкологических заболеваний человека. Известны работы по изучению распределения стрептавидина при его экзогенном введении в организм млекопитающих, по селективному накоплению SAV в почках человека [Kidney Intern. 1995. V. 47. P. 1327-1335], а также по использованию стрептавидина в химерных конструкциях в качестве белка-носителя, к которому присоединена адресующая часть и терапевтический агент химической или белковой природы [Proc. Natl. Acad. Sci. 1992. V.89. P.1534-1538; Bioconjugate Chem. 1995. V. 6. P. 139-144].The tetrameric protein streptavidin binds four biotin molecules (K _d = 10 ^-15 ). In modern medicine and biology, this property of streptavidin has found wide application in the creation of a spectrum of drugs intended for highly sensitive non-radioactive detection of biomolecules [Bioorgan. chemistry. 1989.Vol. 15. S. 354-357; Clin. Chem. 1991. V. 37. R. 625-636; Proc. Natl. Acad Sci. 1995. V. 92. P. 7590-7594]. Recently, studies aimed at creating therapeutic drugs based on streptavidin used to treat human oncological diseases have attracted increased attention. Known works on the distribution of streptavidin during its exogenous administration into mammals, on the selective accumulation of SAV in human kidneys [Kidney Intern. 1995. V. 47. P. 1327-1335], as well as the use of streptavidin in chimeric constructs as a carrier protein, to which an addressable part and a therapeutic agent of a chemical or protein nature are attached [Proc. Natl. Acad Sci. 1992. V. 89. P.1534-1538; Bioconjugate Chem. 1995. V. 6. P. 139-144].

Промышленное получение стрептавидина в настоящее время базируется на культивировании S. avidinii АТСС 27419 и обладает рядом существенных недостатков: препарат часто загрязнен биотином, что приводит к уменьшению свободных валентностей стрептавидина при связывании биотина. Кроме того, длительное время культивирования продуцента S. avidinii (5 - 8 суток) и высокая природная антибиотикоустойчивость рода Streptomyces (устойчив к ряду стандартных доступных селективных агентов) делает процесс недостаточно эффективным [Proc. Natl. Acad. Sci. 1980. V. 77. Р. 4666-4668; Biochem. Biophys. Methods. 1986. V. 13. P. 103-112; J. lmmunol. Methods. 1988. V. 113. P. 83-91]. The industrial production of streptavidin is currently based on the cultivation of S. avidinii ATCC 27419 and has a number of significant drawbacks: the drug is often contaminated with biotin, which leads to a decrease in the free valencies of streptavidin upon binding of biotin. In addition, the long cultivation time of the producer S. avidinii (5–8 days) and the high natural antibiotic resistance of the genus Streptomyces (resistant to a number of standard available selective agents) makes the process insufficiently effective [Proc. Natl. Acad Sci. 1980. V. 77. R. 4666-4668; Biochem. Biophys. Methods 1986. V. 13. P. 103-112; J. lmmunol. Methods 1988. V. 113. P. 83-91].

К настоящему времени проведены исследования, направленные на преодоление вышеперечисленных недостатков и создание более дешевого источника рекомбинантного стрептавидина, не содержащего примесей биотина. Нуклеотидная последовательность гена стрептавидина из S.avidinii известна [Nucleic Acids Res. 1986. V. 14. P. 1871-1882], в литературе описан ряд продуцентов рекомбинантного стрептавидина, его мутантных форм и химерных белков на его основе [Gene. 1993. V. 136. Р. 243-246; Proc. Natl. Acad. Sci. V. 87. Р. 142-146; BioTechnology. 1995. V. 13. P. 11]. Однако, оптимальной конструкции экспрессионной плазмиды для наработки стрептавидина не было найдено. Ближайшими аналогами к заявляемой группе изобретений являются рекомбинантная плазмидная ДНК и штамм-продуцент стрептавидина в работе Sano Т., Cantor C. [Proc.Natl. Acad.Sci. 1990. V. 87. Р. 142-146], в которой приведено получение продуцента рекомбинантного стрептавидина на основе клеток Е.coli. Первоначально, конструкция гибридной плазмиды включала полную нуклеотидную последовательность гена стрептавидина с лидерной частью, а также дополнительный фрагмент плазмидной ДНК, кодирующий 25 аминокислот. Полученный белок не обнаруживал основной биологической функции стрептавидина - связывания биотина. Авторы отказались от использования фрагмента лидерного пептида, предполагая, что либо лидерный пептид, либо пептид, кодируемый фрагментом плазмидной ДНК, приводят к инактивации белка. Дальнейшее конструирование привело к получению рекомбинантной плазмиды, где под регуляцией индуцибельного промотора Ф10 клонирована только структурная область гена стрептавидина от 15-й аминокислоты зрелого белка. Недостатками штамма Е. coli, продуцирующего стрептавидин на основе вышеприведенной экспрессионной системы, являются:
1) накопление стрептавидина в цитоплазме клеток в нерастворимом биологически неактивном состоянии в составе телец включения, в связи с чем дальнейшее выделение и очистка этого белка требуют проведения ряда стадий денатурации-ренатурации с использованием ионных детергентов типа гуанидинхлорида, что может приводить к необратимой утрате биологической активности белка, снижает выход конечного продукта и повышает его себестоимость.To date, studies have been conducted aimed at overcoming the above disadvantages and creating a cheaper source of recombinant streptavidin that does not contain biotin impurities. The nucleotide sequence of the streptavidin gene from S. avidinii is known [Nucleic Acids Res. 1986. V. 14. P. 1871-1882], the literature describes a number of producers of recombinant streptavidin, its mutant forms and chimeric proteins based on it [Gene. 1993. V. 136. R. 243-246; Proc. Natl. Acad Sci. V. 87. R. 142-146; BioTechnology. 1995. V. 13. P. 11]. However, no optimal expression plasmid construct for streptavidin production was found. The closest analogues to the claimed group of inventions are recombinant plasmid DNA and a strain producing streptavidin in the work of Sano T., Cantor C. [Proc.Natl. Acad.Sci. 1990. V. 87. P. 142-146], which shows the preparation of a producer of recombinant streptavidin based on E. coli cells. Initially, the construction of the hybrid plasmid included the entire nucleotide sequence of the streptavidin gene with the leader portion, as well as an additional fragment of plasmid DNA encoding 25 amino acids. The obtained protein did not reveal the main biological function of streptavidin - binding of biotin. The authors abandoned the use of a leader peptide fragment, suggesting that either a leader peptide or a peptide encoded by a plasmid DNA fragment leads to inactivation of the protein. Further construction led to the production of a recombinant plasmid, where, under the regulation of the inducible promoter F10, only the structural region of the streptavidin gene from the 15th amino acid of the mature protein was cloned. The disadvantages of E. coli strain producing streptavidin based on the above expression system are:
1) the accumulation of streptavidin in the cytoplasm of cells in an insoluble biologically inactive state as a part of inclusion bodies, and therefore further isolation and purification of this protein require a series of denaturation-renaturation stages using ionic detergents such as guanidine chloride, which can lead to irreversible loss of protein biological activity , reduces the yield of the final product and increases its cost.

2) недостаточно высокий уровень накопления SAV, который до очистки составляет 40-65 мг/л культуральной жидкости. 2) insufficiently high level of accumulation of SAV, which before purification is 40-65 mg / l of culture fluid.

Задачей заявляемой группы изобретений является создание эффективного продуцента стрептавидина на основе штаммов Е.coli, обеспечивающего повышенный уровень накопления белка в биологически активном растворимом состоянии. The task of the claimed group of inventions is to create an effective producer of streptavidin based on E. coli strains, providing an increased level of protein accumulation in a biologically active soluble state.

Для решения задачи получают рекомбинантную плазмидную ДНК pSAV27, состоящую из фрагмента хромосомной ДНК Streptomyces avidinii, включающего структурную часть гена стрептавидина (нуклеотидная последовательность лидерного пептида совместно с нуклеотидной последовательностью зрелого белка) и мультикопийного вектора, обеспечивающего высокоэффективную экспрессию гена стрептавидина в клетках Е.coli. Причем лидерный пептид прострептавидина обеспечивает секрецию прострептавидина в периплазматическое пространство клеток Е. coli, где происходит отщепление лидерного пептида, и стрептавидин локализуется в биологически активном растворимом состоянии. Штамм Е.coli JM110, трансформированный рекомбинантной плазмидой pSAV27 за 12-14 часов ферментации при 37^oC на полусинтетической среде накапливает 180-240 мг растворимого стрептавидина на 1 л культуральной жидкости. Наблюдаемый эффект достигается, во-первых, за счет введения в реципиентную клетку Е.coli мультикопийного вектора (количество копий клонированного гена составляет 300-500 копий на геномный эквивалент), во-вторых, за счет использования сильного, конститутивного в применяемых условиях промотора, обеспечивающего эффективную транскрипцию клонированного гена, и, в-третьих, за счет использования лидерного пептида стрептавидина, приводящего к экскреции белкового продукта в периплазму и пост - либо коэкскреторному его отщеплению.To solve the problem, a recombinant plasmid DNA pSAV27 is obtained, consisting of a fragment of the Streptomyces avidinii chromosomal DNA, which includes the structural part of the streptavidin gene (the nucleotide sequence of the leader peptide together with the nucleotide sequence of the mature protein) and a multicopy vector that provides highly efficient expression of E. streptavidin gene in the streptavidin gene. Moreover, the leader peptide of prostreptavidin provides secretion of prostreptavidin into the periplasmic space of E. coli cells, where the leader peptide is cleaved, and streptavidin is localized in a biologically active soluble state. Strain E. coli JM110, transformed with the recombinant plasmid pSAV27 for 12-14 hours of fermentation at 37 ^o C in a semi-synthetic medium accumulates 180-240 mg of soluble streptavidin per 1 liter of culture fluid. The observed effect is achieved, firstly, by introducing a multicopy vector into the E. coli recipient cell (the number of copies of the cloned gene is 300-500 copies per genomic equivalent), and secondly, by using a strong, constitutive promoter under the applicable conditions, which ensures efficient transcription of the cloned gene, and, thirdly, through the use of the streptavidin leader peptide, which leads to the excretion of the protein product in periplasm and its postexcretory cleavage.

Заявляемый штамм E.coli JM110/pSAV27 депонирован во Всероссийской коллекции промышленных микроорганизмов и имеет регистрационный номер ВКПМ В- 7758. The inventive strain of E. coli JM110 / pSAV27 deposited in the All-Russian collection of industrial microorganisms and has a registration number VKPM B-7758.

Конструирование штамма состояло из нескольких этапов. The construction of the strain consisted of several stages.

Этап 1. Выделение из Streptomyces avidinii M170791 фрагмента ДНК, кодирующего лидерный пептид стрептавидина совместно с зрелым белком (прострептавидин), и введение в данный фрагмент сайтов для эндонуклеаз рестрикции. Step 1. Isolation from Streptomyces avidinii M170791 of a DNA fragment encoding the streptavidin leader peptide together with a mature protein (prostreptavidin), and introduction of restriction endonuclease sites into this fragment.

Этап 2. Конструирование рекомбинантной плазмиды рSAV27, основными характеристиками которой являются высокая копийность (300-500 копий на геномный эквивалент), удобный селективный маркер (ампициллинустойчивость), сильный промотор, обеспечивающий в штаммах Е.coli эффективную экспрессию клонированного гена стрептавидина. Stage 2. Construction of the recombinant plasmid pSAV27, the main characteristics of which are high copy number (300-500 copies per genomic equivalent), a convenient selectable marker (ampicillin resistance), a strong promoter that provides for the expression of the cloned streptavidin gene in E. coli strains.

Этап 3. Трансформация штамма E.coli JM110 сконструированной рекомбинантной плазмидой, подтверждение соответствия нуклеотидной последовательности клонированного гена стрептавидина вместе с лидерной последовательностью природному гену из S.avidinii. Stage 3. Transformation of E. coli strain JM110 with the constructed recombinant plasmid, confirmation of the correspondence of the nucleotide sequence of the cloned streptavidin gene together with the leader sequence to the natural gene from S. avidinii.

Этап 4. Определение продуктивности штамма Е.coli ВКПМ В-7758 - продуцента растворимого стрептавидина из S.avidinii. Stage 4. Determination of the productivity of the strain E. coli VKPM B-7758 - producer of soluble streptavidin from S.avidinii.

Этап 5. Определение биологической активности растворимого стрептавидина, продуцируемого штаммом Е.coli ВКПМ В-7758. Step 5. Determination of the biological activity of soluble streptavidin produced by E. coli strain VKPM B-7758.

Штамм E. coli ВКПМ В-7758 обладает следующими культурально-морфологическими и физиолого- биохимическими признаками. Strain E. coli VKPM B-7758 has the following cultural, morphological and physiological and biochemical characteristics.

1. Морфологические признаки. Клетки - прямые палочки, 1,1-1,5 • 2.0-6,0 мкм, подвижные за счет перитрихальных жгутиков, грамотрицательные, неспороносные. 1. Morphological features. Cells - straight rods, 1.1-1.5 • 2.0-6.0 microns, motile due to peritrichal flagella, gram-negative, non-spore.

2. Культуральные признаки. Клетки штамма хорошо растут на стандартных, описанных для Е. coli средах. При выращивании на полноценных агаризованных средах (LB-агар, агаризованная среда Хоттингера) колонии блестящие, гладкие, круглые, с ровными краями. При 37^oC достаточно 12 - 14 часов роста. При выращивании в жидких средах в пробирках клетки образуют равномерную муть, достигая оптической плотности 2,4-2,6 при A₆₀₀ за 10-12 часов роста при 37^oC.2. Cultural traits. The cells of the strain grow well on standard media described for E. coli. When grown on complete agar media (LB agar, Hottinger agar medium), the colonies are shiny, smooth, round, with even edges. At 37 ^o C, 12-14 hours of growth are sufficient. When grown in liquid media in test tubes, the cells form a uniform turbidity, reaching an optical density of 2.4-2.6 at A ₆₀₀ for 10-12 hours of growth at 37 ^o C.

3. Физиолого-биохимические признаки. Температурный оптимум для роста клеток 37^oC, факультативный анаэроб, оксидазоотрицательные, каталазоположительные, отрицательные по признакам образования H₂S, гидролиза мочевины и активности липазы, катаболизируют D-глюкозу и другие углеводы с образованием кислоты и газа, источником азота могут служить минеральные соли в аммонийной форме, а также органические соединения в виде пептона, триптона, дрожжевого экстракта и аминокислот.3. Physiological and biochemical characteristics. The temperature optimum for cell growth is 37 ^o C, facultative anaerobic, oxidase-negative, catalase-positive, negative by the signs of H ₂ S formation, urea hydrolysis and lipase activity, catabolize D-glucose and other carbohydrates to form acid and gas, mineral salts can serve as a nitrogen source ammonium form, as well as organic compounds in the form of peptone, tryptone, yeast extract and amino acids.

4. Генотипические признаки. 4. Genotypic characters.

Основной генотипический признак заявляемого штамма Е.coli ВКПМ В-7758 (thi, thr, leu, lacY, supE44, galK, tonA, recA, dam, dcm, Δ(lac-proAB), [F', traD36, proAB, lacI^qZΔM15] ) состоит в наличии под регуляцией промоторного фрагмента гена udp из Е.coli нуклеотидной последовательности кодирующей области гена стрептавидина с лидерной последовательностью, интегрированной в состав многокопийного экспрессионного вектора, содержащего в качестве селективного маркера ген β-лактамазы.The main genotypic trait of the claimed E. coli strain VKPM B-7758 (thi, thr, leu, lacY, supE44, galK, tonA, recA, dam, dcm, Δ (lac-proAB), [F ', traD36, proAB, lacI ^q ZΔM15]) consists in the presence under the regulation of the promoter fragment of the udp gene from E. coli the nucleotide sequence of the coding region of the streptavidin gene with a leader sequence integrated into the multi-copy expression vector containing the β-lactamase gene as a selective marker.

5. Устойчивость к антибиотикам. Устойчивость к ампициллину у штамма не ниже 150 мкг/мл на твердых агаризованных средах, при наращивании в жидких полноценных средах - не менее 100 мкг/мл. 5. Resistance to antibiotics. The resistance to ampicillin in the strain is not lower than 150 μg / ml on solid agarized media, and when built up in full-fledged liquid media - not less than 100 μg / ml.

6. Стабильность плазмиды pSAV27 в штамме Е.coli ВКПМ В-7758. 6. Stability of the plasmid pSAV27 in the E. coli strain VKPM B-7758.

При хранении клеток на агаризованной среде (сроком до 1 месяца), при серии последовательных пересевов (в течение не менее 6 месяцев) и в процессе культивирования в жидкой среде с антибиотиком не происходит потери и перестройки плазмиды pSAV27. When storing cells on an agar medium (for up to 1 month), during a series of successive reseeding (for at least 6 months), and during cultivation in a liquid medium with an antibiotic, the plasmid pSAV27 is not lost and rearranged.

Процесс биосинтеза стрептавидина в штаммах Е.coli включает стадии получения посевного материала, основную ферментацию, выделение биомассы и получение периплазматической фракции клеток. Выращивание посевного материала и основную ферментацию Е.coli ВКПМ В-7758 осуществляют в аэробных условиях на традиционно используемых для культивирования Е.coli питательных средах, содержащих ассимилируемые источники углерода, азота, минеральные соли, стимуляторы роста, например, в виде триптона, пептона, дрожжевых автолизатов или экстрактов. В питательные среды вносят ампициллин в концентрации 100 мг/л. Биомассу выращивают при pH 7-7.4 и температуре 37^oC до концентрации, определяемой составом питательной среды и массообменными характеристиками ферментера.The process of biosynthesis of streptavidin in E. coli strains includes the stages of obtaining seed, basic fermentation, the allocation of biomass and obtaining periplasmic fraction of cells. The cultivation of seed and the main fermentation of E. coli VKPM B-7758 is carried out under aerobic conditions on nutrient media traditionally used for E. coli cultivation, containing assimilable sources of carbon, nitrogen, mineral salts, growth stimulants, for example, in the form of tryptone, peptone, yeast autolysates or extracts. Ampicillin at a concentration of 100 mg / L is added to the culture media. Biomass is grown at pH 7-7.4 and a temperature of 37 ^o C to a concentration determined by the composition of the nutrient medium and mass transfer characteristics of the fermenter.

После завершения процесса ферментации бактериальные клетки отделяют от культуральной среды центрифугированием и ресуспендируют в соответствующем буферном растворе, после чего центрифугированием отделяют периплазматическую фракцию растворимых белков клетки (в виде супернатанта), которую и используют для последующего выделения целевого продукта. Для этого применяют методы ионообменной хроматографии на колонке с Q-сефарозой, либо аффинную хроматографию на колонке с 2-иминобиотином. Данные методы очистки обеспечивают высокий выход целевого белка и его 95-97% чистоту. Степень очистки стрептавидина в процессе выделения анализируют с помощью SDS-полиакриламидного электрофореза. Выход конечного продукта составляет 180-240 мг/л культуральной жидкости. Определение N-концевой последовательности белка проводят методом деградации по Эдману на автоматическом секвенаторе "Beckman" 890В. Идентификацию Pth-производных аминокислот осуществляют методом ВЭЖХ на колонках "Zorbax РТН". After the fermentation process is completed, the bacterial cells are separated from the culture medium by centrifugation and resuspended in an appropriate buffer solution, after which the periplasmic fraction of soluble cell proteins (in the form of a supernatant) is separated by centrifugation, which is used for subsequent isolation of the target product. To do this, apply methods of ion exchange chromatography on a column with Q-Sepharose, or affinity chromatography on a column with 2-iminobiotin. These purification methods provide a high yield of the target protein and its 95-97% purity. The degree of purification of streptavidin during the isolation process is analyzed by SDS-polyacrylamide electrophoresis. The yield of the final product is 180-240 mg / l of culture fluid. Determination of the N-terminal sequence of the protein is carried out by the method of degradation according to Edman on an automatic sequencer "Beckman" 890B. The identification of Pth-derived amino acids is carried out by HPLC on Zorbax PTH columns.

Заявляемая группа изобретений иллюстрируется следующими фигурами графических изображений. The claimed group of inventions is illustrated by the following figures of graphic images.

Фиг. 1. Физико-генетическая карта рекомбинантной плазмиды pSAV27. FIG. 1. Physico-genetic map of the recombinant plasmid pSAV27.

Рекомбинантная плазмида сконструирована с использованием следующих фрагментов ДНК: 1). Sac1-Sa1G1 фрагмент (размером 2684 н.п.) плазмиды pUC18, который содержит репликон pMB1, ген rop, участвующий в регуляции копийности плазмиды, ген β-лактамазы, определяющий устойчивость к антибиотику ампициллину. Фрагмент получен рестрикцией плазмиды pUC18. 2). Sacl-BamHI фрагмент (размером 169 н.п.) промоторной области гена уридинфосфорилазы из Е.coli, содержащий все элементы, необходимые для эффективной инициации транскрипции и трансляции. Сайты Sac1 и BamH1 введены в промоторный фрагмент методом ПЦР. Фрагмент получен методом рестрикции сконструированной нами плазмиды pUU18 [Биоорган. химия. 1995. Т. 21. С. 354-358]. 3). BamH1-Sa1G1 фрагмент (размером 571 н.п.) гена стрептавидина, включающий нуклеотидную последовательность лидерного пептида. Сайты для BamH1 и Sa1G1 введены при получении фрагмента методом ПЦР. The recombinant plasmid was constructed using the following DNA fragments: 1). Sac1-Sa1G1 fragment (2684 bp in size) of the pUC18 plasmid, which contains the replicon pMB1, the rop gene involved in the regulation of plasmid copying, and the β-lactamase gene, which determines the antibiotic resistance to ampicillin. The fragment was obtained by restriction of the plasmid pUC18. 2). Sacl-BamHI fragment (169 bp) of the promoter region of the uridine phosphorylase gene from E. coli, containing all the elements necessary for the efficient initiation of transcription and translation. Sac1 and BamH1 sites were introduced into the promoter fragment by PCR. The fragment was obtained by the restriction method of the plasmid pUU18 constructed by us [Bioorgan. chemistry. 1995. T. 21. S. 354-358]. 3). BamH1-Sa1G1 fragment (571 bp) of the streptavidin gene, including the nucleotide sequence of the leader peptide. Sites for BamH1 and Sa1G1 were introduced upon fragment preparation by PCR.

Фиг. 2. Электрофоретическое разделение в денатурирующем 12% ПААГ фракций клеточных белков Escherichia coli. FIG. 2. Electrophoretic separation in denaturing 12% PAAG fractions of cell proteins of Escherichia coli.

Белки периплазматических (дорожки 1 и 2), цитоплазматических (дорожки 3 и 4) и мембранных (дорожки 5 и 6) фракций штамма-продуцента (дорожки 2, 4, 6) и штамма-реципиента (дорожки 1, 3, 5). М - белковые маркеры с молекулярными массами 66, 45, 36, 29, 24, 20.1, 14.2 кДа. Стрелкой показана полоса, соответствующая стрептавидину (дорожка 2). Proteins of periplasmic (lanes 1 and 2), cytoplasmic (lanes 3 and 4) and membrane (lanes 5 and 6) fractions of the producer strain (lanes 2, 4, 6) and the recipient strain (lanes 1, 3, 5). M - protein markers with molecular weights of 66, 45, 36, 29, 24, 20.1, 14.2 kDa. The arrow indicates the band corresponding to streptavidin (lane 2).

Фиг. 3. Электрофоретическое разделение в 12% ПААГ выделенного очищенного стрептавидина. FIG. 3. Electrophoretic separation in 12% PAGE of purified purified streptavidin.

Электрофоретическая подвижность очищенного стрептавидина в денатурирующих (A2) и неденатурирующих (A3) условиях. Окрашивание геля Кумасси синим. Радиоавтограф электрофоретического разделения неденатурированного комплекса очищенного стрептавидина с небиотинилированным (Б2) и биотинилированным (Б1) радиоактивно меченным олигонуклеотидом. A1 - маркерные белки 16.4, 14.4, 10.6, 8.1, 6.2 кДа. SAV-olig - комплекс стрептавидин-радиоактивномеченный биотинилированный олигонуклеотид. Olig - радиоактивномеченный небиотинилированный олигонуклеотид в отсутствие связывания со стрептавидином. Electrophoretic mobility of purified streptavidin under denaturing (A2) and non-denaturing (A3) conditions. Coomassie gel staining with blue. Radio autograph of electrophoretic separation of the undenatured complex of purified streptavidin with non-biotinylated (B2) and biotinylated (B1) radioactively labeled oligonucleotide. A1 - marker proteins 16.4, 14.4, 10.6, 8.1, 6.2 kDa. SAV-olig is a streptavidin-radioactive labeled biotinylated oligonucleotide complex. Olig is a radiolabeled non-biotinylated oligonucleotide in the absence of streptavidin binding.

Заявляемая группа изобретений иллюстрируется примерами. The claimed group of inventions is illustrated by examples.

Пример 1. Выделение фрагмента ДНК, содержащего структурную часть гена стрептавидина и введение в него участков для узнавания эндонуклеаз рестрикции. Example 1. The selection of a DNA fragment containing the structural part of the streptavidin gene and the introduction of sections for recognition of restriction endonucleases.

Фрагмент гена стрептавидина, включающий нуклеотидную последовательность лидерного пептида и кодирующую область стрептавидина получают ПЦР-амплификацией соответствующего участка хромосомной ДНК из S.avidinii М 170791 с использованием синтетических олигонуклеотидов (1) 5'CGTGGGATC CATGCGCAAAATCGTCGTTG3' и (2) 5'CGGGGTCGACTTACTGCTGAACTGC GTC3'. Амплификационная смесь (50 мкл) содержит 10 мМ Трис-HCl (pH 8.4), 0.5 мМ MgCl₂, 50 мМ KCl₂, 0,2 мМ dNTP, 10 нг хромосомной ДНК S.avidinii, по 50 пмоль праймеров (1) и (2), 2.5 ед. акт. Taq-полимеразы. Режим амплификации (^oC/с): 1 цикл -95/120 - денатурация хромосомной ДНК; 7 циклов - денатурация 95/10, отжиг 48/10, элонгация 72/30; 25 циклов - денатурация 95/10, отжиг 60/10, элонгация 72/30. Полученный фрагмент ДНК размером 571 н.п., кодирующий структурную часть гена прострептавидина, выделяют препаративным электрофорезом в 1.2% агарозном геле. В олигонуклеотиды при синтезе вводят нуклеотидные последовательности сайтов эндонуклеаз рестрикции BamH1 и Sa1G1, необходимые для последующего клонирования гена в составе экспрессионного вектора.A fragment of the streptavidin gene, including the nucleotide sequence of the leader peptide and the streptavidin coding region, is obtained by PCR amplification of the corresponding chromosomal DNA fragment from S. avidinii M 170791 using synthetic oligonucleotides (1) 5'CGTGGGGCGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT. The amplification mixture (50 μl) contains 10 mM Tris-HCl (pH 8.4), 0.5 mM MgCl ₂ , 50 mM KCl ₂ , 0.2 mM dNTP, 10 ng of S.avidinii chromosomal DNA, 50 pmol of primers (1) and ( 2), 2.5 units. Act. Taq polymerase. Amplification mode ( ^o C / s): 1 cycle -95/120 - denaturation of chromosomal DNA; 7 cycles - denaturation 95/10, annealing 48/10, elongation 72/30; 25 cycles - denaturation 95/10, annealing 60/10, elongation 72/30. The resulting DNA fragment 571 bp in size, encoding the structural part of the prostreptavidin gene, was isolated by preparative electrophoresis in 1.2% agarose gel. In the synthesis, the nucleotide sequences of the restriction endonucleases BamH1 and Sa1G1 are introduced into the oligonucleotides, which are necessary for subsequent cloning of the gene in the expression vector.

Пример 2. Конструирование рекомбинантной плазмиды pSAV27 и получение штамма Е.coli ВКПМ В-7758 - продуцента растворимого стрептавидина. Example 2. Construction of a recombinant plasmid pSAV27 and obtaining a strain of E. coli VKPM B-7758 - producer of soluble streptavidin.

Для подготовки экспрессионного вектора используют мультикопийную плазмиду pUC18 [Маниатис Т. и др. Молекулярное клонирование. М.: Мир, 1984], репликон которой в благоприятных условиях обеспечивает накопление до 300-500 копий плазмидной ДНК на клетку. Для этого плазмидную ДНК pUC18 расщепляют рестриктазами Sac1 и BamH1 в условиях, рекомендуемых фирмой-изготовителем рестриктаз ("Fermentas") и лигируют с промоторным фрагментом гена udp, размером 169 п. н., полученным рестрикцией по Sac1 и BamH1 из ранее полученной нами [ДАН. 1994. Т. 339. N. 4. С. 1-3; Биоорганическая химия. 1995. Т. 21. N 5. С. 354-358] плазмиды pUU18, так как данный фрагмент ДНК промотора udp обеспечивает эффективную транскрипцию как гомологичных, так и гетерологичных генов в Е.coli. To prepare the expression vector using multicopy plasmid pUC18 [Maniatis T. et al. Molecular cloning. M .: Mir, 1984], the replicon of which under favorable conditions provides the accumulation of up to 300-500 copies of plasmid DNA per cell. For this, pUC18 plasmid DNA was digested with restriction enzymes Sac1 and BamH1 under the conditions recommended by the manufacturer of restriction enzymes ("Fermentas") and ligated with the promoter fragment of the udp gene, size 169 bp, obtained by restriction by Sac1 and BamH1 from previously obtained by us [DAN . 1994. T. 339. N. 4. S. 1-3; Bioorganic chemistry. 1995. T. 21. N 5. P. 354-358] plasmids pUU18, as this DNA fragment of the udp promoter provides efficient transcription of both homologous and heterologous genes in E. coli.

После трансформации и отбора целевого клона, содержащего плазмидную ДНК с промотором udp, полученный вектор расщепляют рестриктазами BamH1 и Sa1G1 и лигируют с описанным в примере 1 и расщепленным по сайтам BamH1 и Sa1G1 фрагментом ДНК, включающим структурную часть гена стрептавидина с лидерной последовательностью. Трансформацию проводят в компетентную культуру штамма Е.coli JM110 (ВКПМ В-6527). Эффективность трансформации составляет около 10⁵ клонов на 1 мкг плазмидной ДНК. Трансформанты отбирают на среде с ампициллином, изменение генотипа определяют методом ПЦР с помощью праймеров (1) и (2), структура которых приведена в описании примера 1.After transformation and selection of the target clone containing plasmid DNA with the udp promoter, the resulting vector is digested with restriction enzymes BamH1 and Sa1G1 and ligated with the DNA fragment described in Example 1 and the BamH1 and Sa1G1 site fragment containing the structural part of the streptavidin gene with a leader sequence. The transformation is carried out in a competent culture of E. coli strain JM110 (VKPM B-6527). The transformation efficiency is about 10 ⁵ clones per 1 μg of plasmid DNA. Transformants are selected on a medium with ampicillin, the genotype change is determined by PCR using primers (1) and (2), the structure of which is described in the description of example 1.

Выделенную из целевых клонов плазмиду обозначили pSAV27 (фиг. 1). Нуклеотидную последовательность клонированного фрагмента подтверждают секвенированием по Сэнгеру [J.Mol.Biol. 1975. V. 94. P. 441-446]. Определение уровня накопления стрептавидина и его локализацию в клетках штамма-продуцента исследуют электрофорезом в 12.5% ПААГ в денатурирующих условиях. Для этого клетки из 1 мл ночной культуры Е.coli ВКПМ В-7758 осаждают центрифугированием (12000 g, 1 мин). К осадку добавляют 100 мкл буфера, содержащего 30 мМ Трис HCl pH 8.0, 5 мМ ЭДТА pH 8.0, 20% сахарозу, 1 мг/мл лизоцима. После выдерживания клеток в течение 10 мин в ледяной бане суспензию центрифугируют (12000 g, 1 мин), отобранный супернатант представляет собой периплазматическую фракцию клеток. К осадку добавляют 100 мкл 100 мМ Трис HCl pH 8.0 и три раза проводят быстрое замораживание при - 70^oC, и медленное оттаивание при 37^oC. После центрифугирования супернатант содержит суммарные белки цитоплазматической фракции клеток, а осадок - белки мембранных фракций. Для солюбилизации мембранных белков к осадку добавляют 100 мкл 1% Тритона X-100. До проведения анализа в ПААГ фракции хранят во льду. Анализ со става фракций в денатурирующем 12.5% ПААГ показал (фиг. 2), что описанная экспрессионная система приводит к накоплению стрептавидина (белок размером 18 кДа) именно в периплазматическом пространстве клеток штамма-продуцента. При этом белок остается активным, что подтверждается экспериментами по связыванию биотинсодержащего олигонуклеотида (см. пример 4) суммарными белками соответствующих фракций клеток штамма-продуцента.The plasmid isolated from the target clones was designated pSAV27 (Fig. 1). The nucleotide sequence of the cloned fragment is confirmed by Sanger sequencing [J. Mol. Biol. 1975. V. 94. P. 441-446]. Determination of the level of accumulation of streptavidin and its localization in the cells of the producer strain is studied by electrophoresis in 12.5% SDS page under denaturing conditions. For this, cells from 1 ml of overnight culture of E. coli VKPM B-7758 precipitated by centrifugation (12000 g, 1 min). To the precipitate was added 100 μl of buffer containing 30 mM Tris HCl pH 8.0, 5 mM EDTA pH 8.0, 20% sucrose, 1 mg / ml lysozyme. After keeping the cells for 10 min in an ice bath, the suspension is centrifuged (12000 g, 1 min), the selected supernatant is the periplasmic fraction of the cells. 100 μl of 100 mM Tris HCl pH 8.0 is added to the pellet, and three times they are quickly frozen at -70 ^o C and slowly thawed at 37 ^o C. After centrifugation, the supernatant contains the total proteins of the cytoplasmic fraction of the cells, and the pellet contains the proteins of the membrane fractions. To solubilize the membrane proteins, 100 μl of 1% Triton X-100 is added to the pellet. Before analysis in PAG, the fractions are stored in ice. An analysis of the composition of fractions in denaturing 12.5% PAAG showed (Fig. 2) that the described expression system leads to the accumulation of streptavidin (protein with a size of 18 kDa) precisely in the periplasmic space of the cells of the producer strain. In this case, the protein remains active, as evidenced by experiments on the binding of a biotin-containing oligonucleotide (see Example 4) by total proteins of the corresponding fractions of cells of the producer strain.

В результате вышеописанных процедур получают штамм-продуцент растворимого стрептавидина coli ВКПМ В-7758. As a result of the above procedures, a soluble streptavidin coli VKPM B-7758 producer strain is obtained.

Пример 3. Определение продуктивности штамма Е.coli ВКПМ В-7758 - продуцента растворимого стрептавидина из S.avidinii. Example 3. Determination of the productivity of the strain E. coli VKPM B-7758 - producer of soluble streptavidin from S.avidinii.

Для препаративной наработки стрептавидина и определения продуктивности штамма плазмидосодержащие клетки выращивают на агаризованной LB-среде с ампициллином (150 мкг/мл) при 37^oC в течение 12-14 часов, затем используют выросшую биомассу для получения посевного материала. Для этого клетки переносят в колбу Эрленмейера на 750 мл со 100 мл LB-среды, содержащей 2 г/л глюкозы и 100 мкг/мл ампициллина. Культуру выращивают на качалке при интенсивном перемешивании при 37^oC до плотности 2.4 - 2.6 при A₆₀₀. Основное культивирование проводят в ферментерах "Anglicon" объемом 750 мл на среде следующего состава, г/л: бактопептон - 20, дрожжевой экстракт - 5, NaCl - 6, (NH₄)₂SO₄ - 4, К₂HPO₄ - 2, MgSO₄ - 0.4, FeSO₄ - 0.02, MnSO₄ - 0.02. Ферментацию проводят в условиях термо- и pH-статирования, доза засева 2%, ампициллин - 100 мкг/мл, содержание растворенного кислорода в среде поддерживают на уровне 5%, в качестве источника углерода используют глюкозу в дробной подаче в количестве 1-2 г/л/час, поддержание pH 7.0-7.2 достигают автоматической подтитровкой аммиачной водой, при 37^oC культуру наращивают в течение 12-14 часов.For preparative production of streptavidin and determining the productivity of the strain, plasmid-containing cells are grown on agarized LB medium with ampicillin (150 μg / ml) at 37 ^° C for 12-14 hours, then the grown biomass is used to obtain seed. For this, the cells are transferred into a 750 ml Erlenmeyer flask with 100 ml of LB medium containing 2 g / l glucose and 100 μg / ml ampicillin. The culture is grown on a rocking chair with vigorous stirring at 37 ^o C to a density of 2.4 - 2.6 at A ₆₀₀ . The main cultivation is carried out in Anglicon fermenters with a volume of 750 ml on a medium of the following composition, g / l: bactopeptone - 20, yeast extract - 5, NaCl - 6, (NH ₄ ) ₂ SO ₄ - 4, K ₂ HPO ₄ - 2, MgSO ₄ - 0.4, FeSO ₄ - 0.02, MnSO ₄ - 0.02. Fermentation is carried out under thermo- and pH-stating conditions, the dose is 2%, ampicillin is 100 μg / ml, the dissolved oxygen content in the medium is maintained at 5%, glucose is used as a carbon source in a fractional feed in an amount of 1-2 g / l / h, maintaining a pH of 7.0-7.2 is achieved by automatically subtitling with ammonia water, at 37 ^o C, the culture is expanded within 12-14 hours.

После завершения ферментации биомассу отделяют центрифугированием из предварительно охлажденной до 12^oC культуральной жидкости и используют для получения периплазматической фракции клеток. Для этого клетки суспендируют в буфере, содержащем 30 мМ Трис-HCl pH 8.0, 5 мМ ЭДТА pH 8.0, 20% сахарозу, 1 мг/мл лизоцима, выдерживают 10 мин в ледяной бане и центрифугируют при 6-10 тыс. об. Супернатант используют для получения очищенного стрептавидина методом аффинной хроматографии на колонках с 2-иминобиотинагарозой ("Sigma") и для определения продуктивности штамма методом SDS-ПААГ, которая составляет 180 мг стрептавидина, нарабатываемого в 1 л культуральной жидкости.After fermentation is completed, the biomass is separated by centrifugation from the culture fluid previously cooled to 12 ^° C. and used to obtain the periplasmic fraction of the cells. For this, the cells are suspended in a buffer containing 30 mM Tris-HCl pH 8.0, 5 mM EDTA pH 8.0, 20% sucrose, 1 mg / ml lysozyme, incubated for 10 min in an ice bath and centrifuged at 6-10 thousand vol. The supernatant is used to obtain purified streptavidin by affinity chromatography on columns with 2-iminobiotinagarose ("Sigma") and to determine the productivity of the strain by SDS-PAGE, which is 180 mg of streptavidin produced in 1 liter of culture fluid.

Очистку стрептавидина от белков периплазматической фракции проводят с использованием 2-иминобиотинагарозы. Для этого полученную периплазматическую фракцию переводят с помощью ультрафильтрации в ячейке "Amicon" с мембраной YM30 в буфер следующего состава: 0.5 М NaCl, 50 mM Na₂CO₃, pH 11.0. Колонку, содержащую 10 мл геля 2-иминобиотинагарозы уравновешивают буфером 0.5 М NaCl, 50 mM Na₂CO₃, pH 11.0, вносят периплазматическую фракцию и колонку промывают 50 мл 1 М NaCl (pH 7.0). Элюцию стрептавидина ведут буфером, содержащим 50 mM CH₃COOH, pH 4.0. Элюированный стрептавидин переводят в буфер 5 mM Tris-HCl, pH 7.5, содержащий 0.01% NaN₃ в ячейке для ультрафильтрации на мембране YM30, и высушивают на установке для лиофилизации "Hetosicc" (США). Уровень очистки стрептавидина составляет 95-97%.Purification of streptavidin from proteins of the periplasmic fraction is carried out using 2-iminobiotinagarose. For this, the obtained periplasmic fraction was transferred by ultrafiltration in an Amicon cell with a YM30 membrane into a buffer of the following composition: 0.5 M NaCl, 50 mM Na ₂ CO ₃ , pH 11.0. A column containing 10 ml of 2-iminobiotinagarose gel was equilibrated with 0.5 M NaCl buffer, 50 mM Na ₂ CO ₃ , pH 11.0, the periplasmic fraction was introduced, and the column was washed with 50 ml of 1 M NaCl (pH 7.0). Streptavidin was eluted with a buffer containing 50 mM CH ₃ COOH, pH 4.0. The eluted streptavidin was transferred to a buffer of 5 mM Tris-HCl, pH 7.5, containing 0.01% NaN ₃ in an ultrafiltration cell on a YM30 membrane, and dried on a Hetosicc lyophilization unit (USA). The level of purification of streptavidin is 95-97%.

Пример 4. Определение биологической активности растворимого стрептавидина, продуцируемого штаммом Е.coli ВКПМ В-7758. Example 4. Determination of the biological activity of soluble streptavidin produced by E. coli strain VKPM B-7758.

Для исследования связывания полученного стрептавидина с d-биотином используют синтетический биотинилированный олигонуклеотид, полученный по ранее предложенной нами схеме [Биоорган. химия. 1991. Т. 17. С. 625-629]. To study the binding of the obtained streptavidin to d-biotin, a synthetic biotinylated oligonucleotide obtained according to the previously proposed scheme is used [Bioorgan. chemistry. 1991.Vol. 17. S. 625-629].

Данный олигонуклеотид содержит остаток биотина, введенный по межнуклеотидной фосфатной группе, что позволяет осуществлять его дополнительное радиоактивное мечение фосфорилированием с помощью полинуклеотидкиназы бактериофага T4 и [γ³²P]АТР. После проведения комплексообразования (выдерживают смесь олигонуклеотида со стрептавидином при комнатной температуре 10 мин) смесь разделяют в ПААГ и образовавшийся комплекс выявляют радиоавтографией. Данный подход позволяет с помощью измерения радиоактивности соответствующих зон ПААГ провести сравнительную количественную оценку эффективности связывания. Полученные данные позволяют утверждать, что выделенный рекомбинантный стрептавидин связывает 3.7 - 3.8 ммоль остатка биотина на 1 ммоль тетрамера стрептавидина, что соответствует практически полной биологической активности.

This oligonucleotide contains a biotin residue introduced at the internucleotide phosphate group, which allows its additional radioactive labeling by phosphorylation using the polynucleotide kinase of bacteriophage T4 and [γ ³² P] ATP. After complexation was carried out (the mixture of the oligonucleotide with streptavidin was kept at room temperature for 10 minutes), the mixture was separated into PAG and the resulting complex was detected by radio autography. This approach allows for a comparative quantitative assessment of the binding efficiency by measuring the radioactivity of the corresponding PAAG zones. The data obtained suggest that the isolated recombinant streptavidin binds 3.7 - 3.8 mmol of the biotin residue per 1 mmol of streptavidin tetramer, which corresponds to almost complete biological activity.

Как показал анализ N-концевой последовательности выделенного белка, отщепление лидерного пептида в Е.coli происходит по связи -S-A²²/²³ S-A-D-P-S-K-, что отличается от указанного ранее места расщепления -S-A-S-A²⁴/²⁵D-P-S-K- для S.avidinii [Nucl. Acids Res. 1986. V. 14. P. 1871-1882].As the analysis of N-terminal sequence of the isolated protein, cleavage of the leader peptide in E. coli occurs via communication -SA ^{^22/23} SADPSK-, which differs from the direction of travel cleavage -SASA ^{^24/25} DPSK- for S.avidinii [Nucl. Acids Res. 1986. V. 14. P. 1871-1882].

Таким образом, заявляемая группа изобретений позволяет получать стрептавидин в бактериальных клетках Е.coli в виде растворимого белка с сохранением полной биологической активности и в количествах, в три и более раза превышающих таковые у ближайшего аналога. Thus, the claimed group of inventions allows to obtain streptavidin in the bacterial cells of E. coli in the form of a soluble protein while maintaining complete biological activity and in quantities three or more times higher than those of the closest analogue.

Claims

1. Recombinant plasmid DNA pSAV27 encoding the synthesis of soluble streptavidin, having a length of 3424 bp and consisting of the following elements: a) Sacl-SalG1 fragment (2684 bp in size) of the pUC18 plasmid (contains the replicon pMB1, the ror gene involved in the regulation of plasmid copying, the β-lactamase gene, which determines antibiotic resistance to ampicillin); b) Sacl-BamH1 fragment (169 bp in size) of the promoter region of the E. coli uridine phosphorylase gene containing all the elements necessary for the efficient initiation of transcription and translation; c) BamH1-SalG1 fragment (571 bp in size) of the coding region of the streptavidin gene, including the nucleotide sequence of the leader peptide obtained using synthetic primers with the nucleotide sequence 5'CGTGGGATCCATGCGCAAAATCGTCGTGTTG3 'and 5'CGGGGTCTTCG3' and 5'CGGGGTCTCTGT '3'.

2. The bacterial strain E. coli VKPM B-7758 is a producer of soluble streptavidin from Streptomyces avidinii.