RU2575046C2 - METHOD OF MOLECULAR-GENE INTRAGROUP TYPING OF V. cholerae O1 AND O139 SEROGROUPS - Google Patents

Abstract

FIELD: bioengineering.

SUBSTANCE: method of the molecular-gene intragroup typing of Vibrio cholerae O1 and O139 serogroups. The method includes the DNA extraction from the studied strain V. cholerae of serogroup O1 or O139, PCR setting with specific primers and accounting of the reaction by electrophoresis. The amplification of the studied DNA is performed by designed specific primers for each of six INDEL-genes, namely for genes ompU, 1606, eamA, 096, CoA and cheA, each of them having two discriminate alleles. The accounting of the typing results is performed as visual identification after electrophoresis, wherein for each studied strain the unique INDEL-gene type is determined by two or more of the INDEL-genes. By the comparison of the determined INDEL-gene types the total or different origin of the studied strains V.cholerae O1 and O139 serogroups is determined.

EFFECT: invention determines unique gene markers of the said strains, this can be used in the work of special institutions involved in cholera monitoring.

1 dwg, 4 tbl, 3 ex

Description

The invention relates to the field of medical microbiology, namely to laboratory diagnostics, and can be used for molecular genetic intraspecific typing of serogroup Vibrio cholerae O1 and O139 strains.

Among the many laboratory tests that can determine the origin of strains of the cholera pathogen, only molecular typing techniques allow us to determine the unique genetic characteristics of cholera vibrio strains, which allows us not only to characterize the circulating strains of the pathogen, but also to determine the cause of the disease and identify the sources of skidding based on the complete coincidence of genetic markers.

The most informative method is the analysis of variable tandem repeats - VNTR analysis [1, 2], which allows to determine a unique allelic formula for each culture and thereby clearly differentiate strains of the most diverse pathogens.

The essence of the VNTR analysis is that the DNA of the studied strain is amplified with a set of specific primers for the individual VNRT locus. The obtained specific fragments are examined by various methods in order to accurately determine the molecular weight of the amplified DNA fragment. Depending on the established mass of each fragment, the number of tandem repeats for the studied locus is calculated. A similar study is carried out for several loci. The combination of numbers characterizing the number of repeats of each of the studied loci makes up a unique allelic VNTR formula for the analyzed strain of cholera vibrio.

However, this method has several significant disadvantages. Individual amplified VNTR fragments have a large molecular weight, and neighboring alleles differ very slightly: usually only six nucleotides, which makes it very difficult to determine their true weight accurate to the nucleotide. To accurately determine the size of the alleles, complex and laborious methods for determining the molecular weight of the amplified fragment are necessary.

In one case, it can be polyacrylamide or agarose gel electrophoresis with a set of markers of known molecular weight [3]. It is known that the electrophoretic mobility of nucleic acid molecules is inversely proportional to the logarithm of molecular weight. Therefore, by accurately measuring the mean free path of the studied fragment and standard fragments of known mass after gel electrophoresis, it is possible to accurately determine the molecular weight of DNA [4].

Studies are known that showed the presence of special stably inherited genetic characteristics in the genes of various living organisms consisting in insertions / deletions of short DNA fragments, while such genes are designated as INDEL genes [5]. The study of the polymorphism of INDEL genes is currently widely used in molecular typing [6].

For the prototype, the VNTR analysis method [7] was selected, which consists in isolating DNA from the studied culture by thermal lysis, PCR with specific primers labeled with fluorescent labels to VNTR loci, and taking into account the results, the latter is carried out by electrophoresis of amplification products in a sequencer ABI Prism 310 DNA in the presence of fluorescently labeled MapMaker LOW markers (lot 030600; BioVentures, Inc).

However, this method has several disadvantages. First of all, for its implementation requires a set of primers labeled with fluorescent labels. This dramatically complicates and increases the cost of the synthesis of primers. The study requires a complex and expensive imported DNA sequencer, and the analysis itself requires the use of expensive supplies that are supplied by the manufacturer.

In addition, the reaction requires the use of imported expensive fluorescently labeled markers. These circumstances lead to the extremely high cost of analysis and the complete dependence of the researcher on the supply of consumables by the manufacturer from abroad.

The technical task of the invention is to develop a new low cost method for determining the identity of strains of the cholera pathogen O1 and O139 serogroups isolated in different regions, regions and countries by searching the genome of various strains of cholera vibrios of genes that have clearly discriminated INDEL alleles in different strains.

This object is achieved by the fact that in the known method of molecular genetic intraspecific typing of V. cholerae O1 and O139 serogroups, including the extraction of DNA from the studied strain of V. cholerae serogroup O1 or O139, PCR staging with specific primers and taking into account the reaction by electrophoresis, amplification of the studied DNA carried out with specific designed primers for each of the six INDEL genes having two discriminated alleles, namely:

with primers for the ompU gene AACAAGACTCTGATTGCTCTTGC,

CTTTCAGAGATAGGCGAGCTTC,

with an amplified fragment length of 166 bp or 133 bp .;

with primers for the 1606 ATGCCACACAAAAACCTCAATCTA gene,

AATATCGCGTTCAGTGATGGTAG,

with an amplified fragment length of 206 bp or 194 bp .;

with primers for the eamA gene TCAGCTTATCTCAGTGGTTATGGA,

AGAGGCAGAATAATCATTCCAATC,

with an amplified fragment length of 217 bp or 133 bp .;

with primers for the gene 096 CATGAATTAGGGCATAACTTTGG,

GCCCTTTAATCCCATAACCATAA,

with an amplified fragment length of 130 bp or 112 bp .;

with primers for the CoA gene CATCATTTACAGCATTGCCAGT,

CTTCACCAATCGGCTTAATCG,

with an amplified fragment length of 98 bp or 83 bp .;

with cheA gene primers ACTTCGCGAGATTCATCAGAA,

CTGTTTCTAGTGATGCGAAAGC,

with an amplified fragment length of 193 bp or 169 bp,

at the same time, typing results are taken into account as visual identification after electrophoresis, and for each strain a unique INDEL genotype is established for two or more INDEL genes, and by comparing the identified INDEL genotypes, the common or different origin of the studied V. cholerae O1 and O139 strains is established serogroups.

The method is as follows.

Before setting the method of molecular genetic typing, the DNA of the studied culture is isolated. For this, a mass of bacteria that formed a colony or lawn is introduced into a 1.5 ml Eppendorf microtube containing 200 μl of distilled water using a standard bacteriological loop (2 mm in diameter), after which DNA is isolated, as is customary (Guidelines MU 1.3.1791-9 "Organization of work during the PCR study of a material infected with microorganisms of pathogenicity group 1 and 2. - M., 2003-38 p.).

The next step in the method is PCR.

In the process of computer analysis of the nucleotide sequences of Vibrio cholerae, the authors identified a number of INDEL genes that differ in length in strains of cholera vibrio of different origin (see table 1). Specific primers were designed for the varying regions of the indicated ompU, hutB, 1606, eamA, his, CoA genes.

An analysis of the collection of strains of cholera vibrio of the Rostov Anti-Plague Institute of various origin and degree of virulence confirmed the existence of polymorphism of the lengths of these genes. The existence of only two alleles clearly discriminated by electrophoretic mobility was found (see table 1).

The amplified DNA is then amplified with specific designed primers for the ompU, 1606, eamA, 096, CoA, and cheA genes.

Amplification reaction conditions.

Amplification is carried out according to the following scheme: denaturation at 95 ° C for 3 min (1 cycle); then 35 cycles: denaturation at 95 ° C for 20 s, annealing at 63 ° C for 20 s, synthesis at 72 ° C for 20 s; synthesis at 72 ° C - 7 min (1 cycle).

An incubation mixture with a volume of 25 μl was prepared from the calculation: 1.5 mM Mg-buffer, 0.2 mM dNTP mixture, 1.0 μM primer mixture (0.5 μM each primer) 25 ng DNA template, 0.25 units DNA polymerase; the remaining volume is water. As a matrix using genomic DNA (5 μl volume) obtained from different strains of vibrios.

The amplification results are taken into account by electrophoresis in 2% agarose or 10% polyacrylamide gel. The typical amplification result obtained at six loci is presented in the figure.

The figure shows a reference marker of loci reflecting the result of electrophoresis in an 8% polyacrylamide gel of DNA amplification products of various V. cholerae strains with specific primers for INDEL genes. 1A — distribution of alleles for the che gene, wells 1, 3 allele 193 bp designated as “top”; 2, 4 allele 169 bp designated as “bottom”. 1B - distribution of alleles for the 1606 gene (1, 2 upper allele 206 bp, 3, 4 - lower allele 194 bp 1C - distribution of alleles for the 096 gene (1, 2 "top" 130 bp, 3, 4 - “bottom” 112 bp), 1D - distribution of alleles for the CoA gene (1, 3 allele “bottom” 83 bp, 2 - allele “top” 98 bp). 1E - the distribution of alleles for the ompU gene (1 - “bottom” 133 bp, 2 and 3 “top” 166 bp). and 1F - distribution of alleles for the eamA gene (1, 3 “top” 217 bp , 2 - “bottom” 133 bp).

Therefore, based on the electrophoresis of amplification products in a polyacrylamide gel, the applicant obtained a reference marker of loci by comparing with which visual identification of the alleles of INDEL genes is performed as “bottom” or “top” of the studied V. cholerae O1 and O139 serogroup strains.

Example 1, confirming the intraspecific differentiation of strains of Vibrio cholerae serovar O1 isolated from environmental objects in the analysis of INDEL genes

The DNA of the studied strains (MU 1.3.1791-9) is preliminarily isolated and then PCR is carried out with species-specific oligonucleotide primers for the ompU and cheA genes and amplification is performed according to the above scheme. The result of electrophoretic separation of DNA fragments in a 10% polyacrylamide gel is presented in table 2.

Table 2 shows that, comparing with the reference marker of 4 strains isolated in 2013 at two loci ompU and cheA, three different INDEL genotypes were found. So, strains 65 and 28 have the identical genotype “ompU top and cheA top”; strain 27 “ompU bottom and cheA” top, and strain 43 “ompU top and cheA bottom.” The revealed differences in the INDEL genotypes suggest that strains 65 and 28 are of common origin, and strains 27 and 43 differ in origin.

Output. For the molecular typing of cholera vibrio strains isolated in Russia in 2013 from environmental objects, amplification with only two loci ompU and cheA, which are visually identified for each strain, is sufficient.

Example 2, confirming the intraspecific differentiation of strains of Vibrio cholerae O1 isolated during epidemic manifestations of cholera in the analysis of INDEL genes

The strains of cholera vibrios isolated during an epidemic outbreak in the USSR in 1973-1974 are investigated. The DNA of the studied strains is preliminarily isolated, as described above, and then PCR is carried out according to the above scheme with species-specific oligonucleotide primers for the 1606, 096, ompU and CoA amplification genes. The result of electrophoretic separation of DNA fragments in a 10% polyacrylamide gel is presented in table 3.

A comparative analysis with a reference marker of five strains isolated during an epidemic outbreak in 1973-1974 at four loci 1606,096, ompU and CoA showed that each of the studied strains has a unique INDEL genotype, which indicates the different origin of each studied strain . Based on the results obtained, it can be concluded that in 1971-1974, there was a circulation of cholera vibrio strains originating from different sources in the USSR.

Thus, for the molecular genetic typing of cholera vibrio strains isolated in the USSR during the cholera outbreak in 1971-1973, it is sufficient to study only four INDEL genes.

Example 3, confirming the species differentiation of strains of Vibrio cholerae of serovar O139 isolated from humans and from environmental objects in the analysis of INDEL genes

The DNA of the studied strains is preliminarily isolated (MU 1.3.1791-9) and then PCR is carried out with species-specific oligonucleotide primers for the eamA and cheA genes and amplification is performed according to the above scheme. The result of electrophoretic separation of DNA fragments in a 10% polyacrylamide gel is presented in table 4.

From the data in Table 4, we conclude that, in a comparative analysis of the eamA cheA INDEL INDEL genes in four Vibrio cholerae serovar O139 isolated from humans and from environmental objects, it was found that toxigenic strains isolated from humans differ in the distribution of INDEL alleles from non-toxigenic strains isolated from environmental objects. So, non-toxigenic strains of serovar O139 have the genotype “eamA top and cheA top”, and toxigenic strains “eamА bottom and cheA bottom”. Therefore, strains of Vibrio cholerae of serovar O139 isolated from humans have a common origin and differ from strains of Vibrio cholerae of serovar O139 isolated from environmental objects. Thus, based on the analysis of only two INDEL genes eamA and cheA, it is possible to type the strains of Vibrio cholerae of serovar O139.

Using the proposed method of INDEL typing, based on the study of ompU, 1606, eamA, 096, CoA, and cheA INDEL genes, unique genetic markers of Vibrio cholerae strains of serovars O1 and O139 can be identified.

New testing and low cost makes it possible to apply the proposed method in the practice of specialized institutions involved in monitoring cholera.

In addition, based on the information obtained on the INDEL genotype, it is possible to create databases of cholera vibrio strains circulating in different regions of the world, comparing the data with a reference marker to carry out molecular typing.

Information sources

1. Belkum van, A., S. Sherer, W. van Leeuwen Variable number of tandem repeats in clinical strains of Haemophilus influenzae // Infect. Immun. - 1997. - N. 65. - P. 5017-5027.

2. Jackson, P.J., E.A. Walthers, A.S. Kalif, K.L. Richmond et al. Characterization of the variable number of tandem repeats in vvrA from different Bacillus anthracis isolates. // Appl. Environ. Microbiol .. - 1997 .-- Vol. 63, N 4. - P. 1400-1405.

3. Vodopyanov CO, Goncharov EK, Duvanova OB, Mishankin MB, Suchkov I.Yu., Oleinikov IP, Vodopyanov AS, Shishiyanu MV, Shcherbakova EV, Kornienko I. V., Mishankin B.N. Variable tandem repeat VcA Vibrio cholerae. // Molecular Biology, 2002, Volume 36, No. 6, S. 1074-1079.

4. Methods of genetic engineering. Molecular Cloning: Per. / Maniatis T., Fritsch E., Sambrook J. - M .: Mir, 1984. - 480 p., Ill. (157-185.)

5. Larsson P., Svensson K., Karlsson L., Guala D., Granberg M., Forsman M., and Johansson A. Canonical insertion-deletion markers for rapid DNA typing of Francisella tularensis.// Emerging Infectious Diseases 2007. Vol. 13, No. 11, P. 1725-1732.

6. Natsoulis G., Zhang N., Welch K., Bell J., and Hanlee P.J. Identification of insertion deletion mutations from deep targeted resequencing.// J Data Mining Genomics Proteomics .; 4 (3). doi: 10.4172 / 2153-0602.1000132.

7. Danin-Poleg, Y., Cohen, H. Gancz, Y.Y. Broza, H. Goldshmidt, E. Malul, L. Valinsky, L. Lerner, M. Broza, Y. Kashi Vibrio cholerae strain typing and phylogeny study based on simple sequence repeats // J. Clin. Microbiol. - 2007. - Vol. 45. - P. 736-746.

Claims (1)

The method of molecular genetic intraspecific typing of V. cholerae O1 and O139 serogroups, including the isolation of DNA from the studied strain of V. cholerae serogroup O1 or O139, PCR with specific primers and reaction by electrophoresis, characterized in that the studied DNA is amplified by specific specific primers to each of the six INDEL genes having two discriminated alleles, namely:
with primers for the ompU gene AACAAGACTCTGATTGCTCTTGC,
CTTTCAGAGATAGGCGAGCTTC,
with an amplified fragment length of 166 bp or 133 bp .;
with primers for the 1606 ATGCCACACAAAAACCTCAATCTA gene,
AATATCGCGTTCAGTGATGGTAG,
with an amplified fragment length of 206 bp or 194 bp .;
with primers for the eamA gene TCAGCTTATCTCAGTGGTTATGGA,
AGAGGCAGAATAATCATTCCAATC,
with an amplified fragment length of 217 bp or 133 bp .;
with primers for the gene 096 CATGAATTAGGGCATAACTTTGG,
GCCCTTTAATCCCATAACCATAA,
with an amplified fragment length of 130 bp or 112 bp .;
with primers for the CoA gene CATCATTTACAGCATTGCCAGT,
CTTCACCAATCGGCTTAATCG,
with an amplified fragment length of 98 bp or 83 bp .;
with cheA gene primers ACTTCGCGAGATTCATCAGAA,
CTGTTTCTAGTGATGCGAAAGC,
with an amplified fragment length of 193 bp or 169 bp,
at the same time, typing results are taken into account as visual identification after electrophoresis, and for each strain a unique INDEL genotype is established for two or more INDEL genes, and by comparing the identified INDEL genotypes, the common or different origin of the studied V. cholerae O1 and O139 strains is established serogroups.

Images