RU2709174C1 - Method for differentiating legionella pneumophila strains by molecular-genetic typing - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: substance of the invention consists in the fact that from the DNA of the analyzed strain of L. pneumophila four common INDEL-genes are detected, having deletions of a certain size, namely IND- A9P84_02210, A9P84_08285, A9P84_03850 and A9P84_07165, with their subsequent amplification using constructed specific primers detecting two alternative alleles: to a gene IND- A9P84_02210 – primers TTCCCCTTATTTAAATGACACCA and AAGCATAATAGGCGGGAAGA, with length of amplified fragment 80 base pairs or 110 base pairs, to a gene IND- A9P84_08285 – primers CAGAAGACAAAGCGGAATCTG and TGAGGCCGAGTTTCTTGACT, with length of amplified fragment 62 base pairs or 74 base pairs, to a gene IND- A9P84 03850 – primers CAGGTATCTGCCACGAATCA and TGGTTGTTGTCCATTTGACTG, with length of amplified fragment 63 base pairs or 75 base pairs, to a gene IND- A9P84_07165 – primers TGGGTATTAAGCAATACGCAAG and AACAGAAACACCATTTATGCTTTG, with length of amplified fragment 84 base pairs or 96 base pairs, wherein the differentiation results are recorded visually after electrophoresis in 8 % polyacrylamide gel in the presence of a DNA molecular weight marker, wherein for each strain a unique INDEL-genotype is established on four INDEL-genes, and by comparing the detected INDEL-genotypes, the common or different origin of the analyzed strains of L. pneumophila is stated.

EFFECT: invention allows typing strains of infectious agents that are used in microbiological and molecular-genetic monitoring of L. pneumophila strains circulating in different territories for their differentiation.

3 cl, 4 tbl, 2 dwg, 3 ex

Description

The present invention relates to the field of medical microbiology, and in particular to methods of molecular genetic typing of strains of pathogens of infectious diseases, which are used in microbiological and molecular genetic monitoring of L. pneumophila strains circulating in different territories, with the aim of their differentiation.

In recent years, in different countries of the world there has been an increase in the incidence of Legionnaire infection. In this regard, since 1995, under the auspices of WHO and the European Working Group on Legionellosis, the International Travel-associated Legionellosis Monitoring System has been operating. This system has revealed more than 10 thousand cases of legionellosis in 65 countries. The frequency of annually recorded deaths varies from 6 to 15% (1, 2).

Nosocomial cases of legionellosis can be caused by different serotypes of L. pneumophila (not SG1) and other types of legionella (L. longbeachae, L. bozemanii, etc., about 50 species in total), other than L. pneumophila. A pan-European study of 1335 cases of legionellosis showed that 35.9% of the number of cases of nosocomial legionellosis caused by L. pneumophila is not SG1 (3).

Thus, legionella infection is an urgent medical problem and, despite the wide arsenal of various laboratory diagnostic methods (ELISA, ICA, RIF (MFA), PCR), there are a limited number of methods for typing legionella. At the moment, the most common can be considered: the use of panels of monoclonal antibodies, sequence typing (for example, comparison of sequenced fragments of six genes: flaA, pilE, asd, mip, mompS and pro A) VNTR typing (4).

A known method of INDEL typing of strains of Vibrio cholerae (5), based on the definition of "insertion deletions" (INsertion-DELetion) in different genes, which allows to identify individual differences between the strains. In view of the presence of only two alleles ("insert" and "deletion"), this method is much simpler than other typing methods.

However, there are no data on the use of INDEL markers for typing Legionella; therefore, it became necessary to develop a new method that allows reliable, fast and low cost differentiation of L. pneumophila strains isolated in different regions, regions and countries.

For the prototype, the VNTR-typing method (6) was selected, which consists in isolating DNA from the studied culture, staging PCR with specific primers for 10 VNTR-loci (Lpms1_b, Lpms3, Lpms13, Lpms17, Lpms19_b, Lpms31, Lpms33, Lpms34, Lpms35 and Lpms35 ) L. pneumophila, PCR products were counted in a 2% -4% agarose gel, it was stained with 0.5-1.0 μg / ml ethidium bromide for 15-30 minutes, washed with water and photographed under ultraviolet light, after which some fragments (Lpms31 and Lpms37) capillary electrophoresis or sequencing was required to uniquely determine the type.

However, this method has several disadvantages. The study requires a complex and expensive imported DNA sequencer, and the analysis itself requires the use of expensive imported consumables, and a complex procedure for interpreting the results using expensive software. These circumstances lead to the extremely high cost of the analysis, its long duration in time (several days) and the researcher's complete dependence on supplies by the manufacturer of supplies from abroad.

The technical task of the proposed invention is the development of a new method that can reliably, quickly and at low cost to differentiate L. pneumophila strains isolated in different regions, regions and countries.

The problem is achieved in that in the known method for differentiating L. pneumophila strains by molecular genetic typing, including DNA extraction from the studied L. pneumophila strain, PCR staging with specific primers and reaction accounting by electrophoresis, the DNA of the studied L. pneumophila strain is detected four common INDEL genes with deletions of a certain size, namely IND-A9P84_02210, A9P84_08285, A9P84_03850 and A9P84_07165, followed by their amplification using designed specific primers that reveal two alternatives tive alleles:

to the gene IND-A9P84_02210 - primers TTCCCCTTATTTAAATGACACCA and AAGCATAATAGGCGGGAAGA, with an amplified fragment length of 80 bp or 110 bp,

to the gene IND-A9P84_08285 - primers CAGAAGACAAAGCGGAATCTG and TGAGGCCGAGTTTCTTGACT, with an amplified fragment length of 62 bp or 74 bp

to the gene IND-A9P84_03850 - primers CAGGTATCTGCCACGAATCA and TGGTTGTTGTCCATTTGACTG, with an amplified fragment length of 63 bp or 75 bp

to the gene IND-A9P84_07165 - primers TGGGTATTAAGCAATACGCAAG and AACAGAAACACCATTTATGCTTTG, with an amplified fragment length of 84 bp or 96 bp,

the results of differentiation are taken into account visually after electrophoresis in an 8% polyacrylamide gel in the presence of a molecular weight marker for DNA, and for each strain a unique INDEL genotype is established for four INDEL genes, and by comparing the identified INDEL genotypes, the common or different origin of the studied strains is established L. pneumophila.

In this case, PCR is carried out in a volume of 10 μl and the reaction mixture contains:

1.5 MMMg buffer,

0.2 mm mixture of dNTP, 1.0 μm of a mixture of primers (0.5 μm of each primer),

25 ng DNA template

1 unit DNA polymerase, the remaining volume is water, and 5 μl of genomic DNA, which is obtained from different strains of Legionella pneumophila, is used as a matrix.

In addition, PCR is carried out in compliance with the following modes:

Stage 1 - denaturation at 94 ° С - 35 s;

Stage 2 - annealing at 60 ° С - 25 s;

Stage 3 - synthesis at 72 ° С - 35 s (40 cycles);

Justification for the selection of primers

Using software developed by the authors (FKUZ Rostov-on-Don Antiplague Institute of Rospotrebnadzor), more than 3005 genes of L. pneumophila were analyzed in the GenBank database. In the process of computer analysis of the nucleotide sequences of L. pneumophila strains in the GenBank database, the authors identified a number of INDEL genes that differ in size in L. pneumophila strains of various origins and have only two alternative amplicon sizes. As a result, 4 common genes having deletions of a certain size were isolated, namely:

IND-А9Р84_02210, А9Р84_08285, А9Р84_03850 and А9Р84_07165 (see table 1).

Using PrimerMi BLAST NCBI software, specific primers were designed to varying regions of the indicated genes A9P84_02210, A9P84_08285, A9P84_03850 and A9P84_07165.

The set of fragment size values for each strain for each of the four INDEL genes is its individual characteristic and allows one to differentiate one strain from another and determine their origin using cluster analysis.

The method is as follows

Before setting the method for differentiation of L. pneumophila strains, the DNA of the studied culture is isolated. A bacterial suspension of the studied strain in distilled water is introduced into a 1.5 ml microtube, after which the material is decontaminated and DNA is isolated according to MU 1.3.2569-09 (7). Then, in PCR, the amplified DNA is amplified with specific primers:

to the gene IND-A9P84_02210 - primers TTCCCCTTATTTAAATGACACCA and AAGCATAATAGGCGGGAAGA, with an amplified fragment length of 80 bp or 110 bp,

to the gene IND-A9P84_08285 - primers CAGAAGACAAAGCGGAATCTG and TGAGGCCGAGTTTCTTGACT, with an amplified fragment length of 62 bp or 74 bp

to the gene IND-A9P84_03850 - primers CAGGTATCTGCCACGAATCA and TGGTTGTTGTCCATTTGACTG, with an amplified fragment length of 63 bp or 75 bp

to the gene IND-A9P84_07165 - primers TGGGTATTAAGCAATACGCAAG and AACAGAAACACCATTTATGCTTTG, with an amplified fragment length of 84 bp or 96 bp,

Amplification reaction conditions

Amplification is carried out according to the following scheme: denaturation at 94 ° C for 35 s, annealing at 60 ° C for 25 s, synthesis at 72 ° C for 35 s (40 cycles).

The reaction mixture with a volume of 10 μl is prepared from the calculation: 1.5 MMMg-buffer, 0.2 mm mixture of dNTP, 1.0 μm of a mixture of primers (0.5 μm of each primer) 25 ng of the DNA template, 1 unit .. DNA- polymerase; the remaining volume is water. Genomic DNA (5 μl volume) obtained from different strains of L. pneumophila was used as a matrix. The amplification results are taken into account by electrophoresis in 8% polyacrylamide gel in the presence of a molecular weight marker for DNA.

In this case, typing results are recorded visually after electrophoresis, and for each strain a unique INDEL genotype is established for four INDEL genes, and by comparing the identified NDEL genotypes with each other and with the known genotypes of identification table 1, the common or different origin of the studied strains L is established pneumophila, which makes it possible to differentiate one strain from another.

Studies have shown that the use of the developed method of molecular genetic typing of L. pneumophila strains by the structure of INDEL genes makes it possible to identify strains with different allelic variants of INDEL genes.

Example 1

In the experiment, L. pneumophila strains from the collection of the Rostov-on-Don Research Anti-Plague Institute, isolated in the Rostov Region, were used. L. pneumophila bacteria (strains 15, 21, 23, 24, 25, 26, 15978/1, 39152) were suspended in 100 μl of deionized water, not containing nucleases. Next, DNA was isolated according to MU 1.3.2569-09 (7). For the formulation of the polymerase chain reaction, primers for the A9P84_02210 gene TTCCCCTTATTTAAATGACACCA and AAGCATAATAGGCGGGAAGA, with an amplified fragment length of 80 bp, are used. or 110 bp; and primers for the gene A9P84_08285 CAGAAGACAAAGCGGAATCTG and TGAGGCCGAGTTTCTTGACT, with an amplified fragment length of 62 bp or 74 bp

1 microliter of specific primers, 1 microliter of thermostable DNA polymerase were added to the reaction PCR mixture, and 5 microliters of DNA supernatant were added. The total volume of the reaction mixture is 10 microliters. The mixture was vortexed and amplified under conditions: denaturation at 94 ° C for 35 s, annealing at 60 ° C for 25 s, synthesis at 72 ° C for 35 s (40 cycles). The amplification results are taken into account by electrophoresis in an 8% polyacrylamide gel in the presence of a molecular weight marker for DNA (photo 1). In photo 1 we see: electrophoresis of amplification products of INDEL genes A9P84_02210 and A9P84_08285.

In photo 1 - the numbering from 1-8 corresponds to the numbers of the strains: 1-15, 2-21, 3-23, 4-24, 5-25, 6-26, 7-15978 / 1, 8 - 39152. M - marker DNA

Conclusion: analysis of amplification products of the INDEL gene A9P84_02210. shows that two of the eight strains studied (No. 25 and 15978/1) do not have the A9P84_02210 allele, one strain (39152) 80 bp, and five - 110 bp allele. Analysis of the amplification products of the INDEL gene A9P84_08205 shows that two strains (15978/1, 39152) have the same allele 62 bp, and six strains 74 bp

Therefore, these strains are differentiated and four groups are distinguished by the presence / absence of deletions, which confirms the differences between the groups of these strains and is their individual characteristic, and for more complete characterization of the strains, additional studies on other INDEL genes will be required. Data on the size of alleles for each strain are entered in table 2, similarly to identification table 1.

Example 2

L. pneumophila strains (No. 15, 21, 23, 24, 25, 26, 15978/1, 39152) were taken from the Rostov-on-Don collection of the research anti-plague institute. L. pneumophila bacteria were suspended in 100 μl of nuclease-free deionized water. Next, DNA was isolated according to MU 1.3.2569-09 (7).

For the formulation of the polymerase chain reaction, primers for the A9P84_03850 gene CAGGTATCTGCCACGAATCA and TGGTTGTTGTCCATTTGACTG, with an amplified fragment length of 63 bp, are used. or 75 bp; primers for the gene A9P84_07165 TGGGTATTAAGCAATACGCAAG and AACAGAAACACCATTTATGCTTTG, with an amplified fragment length of 84 bp or 96 bp

1 microliter of specific primers, 1 microliter of thermostable DNA polymerase were added to the reaction PCR mixture, and 5 microliters of DNA supernatant were added. The total volume of the reaction mixture is 10 microliters. The mixture was vortexed and amplified under conditions: denaturation at 94 ° C for 35 s, annealing at 60 ° C for 25 s, synthesis at 72 ° C for 35 s (40 cycles). The amplification results are taken into account by electrophoresis in an 8% polyacrylamide gel in the presence of a molecular weight marker for DNA (photo 2). In photo 2 we see: electrophoresis of amplification products of INDEL genes A9P84_03850 and A9P84_07165 (see photo 2).

In photo 2, the numbers from 1-8 correspond to the numbers of the strains: 1-15, 2-21, 3-23, 4-24, 5-25, 6-26, 7-15978 / 1, 8-39152. M is marker DNA.

Conclusion: the analysis of the amplification products of the INDEL gene A9P84_03850 shows that two (strains No. 15978/1 and 39152) of the eight strains studied have a 63 bp allele. and six 75 bp Analysis of the amplification products of the INDEL gene A9P84_07165 shows that one (strain No. 25) of the eight strains studied has an 84 bp allele, the remaining seven - 96 bp

Therefore, these strains are differentiated by two loci and three groups are distinguished by the presence / absence of deletions, which confirms the differences between the groups of these strains and is their individual characteristic, and for more complete characterization of the strains, additional studies on other INDEL genes will be required. Data on the size of alleles for each strain are entered in table 3, similarly to identification table 1.

Example 3

Using computer simulation of the polymerase chain reaction (PCR), we analyzed the complete genomic sequences of 58 L. pneumophila strains taken from the database of the US National Center for Biotechnological Information (http://www.ncbi.nlm.nih.gov/genome), using the program Virtual PCR.

Thus, it became possible to combine all 58 strains into 10 groups according to the presence or absence of deletions in amplicons (see table 4). As a result of the analysis of Table 4, it can be seen that this method can differentiate L. pneumophila strains from one another, give a more accurate genetic characterization and determine their origin, which is important when investigating outbreaks of Legionellosis and monitoring this pathogen.

Using the proposed invention allows to reliably and quickly, due to the selection of primers, unify and create a set of allele fragment size values for each L. pneumophila strain for each of the four INDEL genes, which are its individual characteristic and allow one to differentiate one strain from another and determine their origin.

Sources of information

1. Tartakovsky I.S., Kozhevnikova G.M., Gruzdeva O.A. International standards for the identification and monitoring of travelers legionellosis, their importance for modern preventive medicine. Proceedings of the IV Annual All-Russian Congress on Infectious Diseases (Moscow, March 26--28, 2012). Infectious diseases. 2012; 10 (adj. 1).

2. European Guidelines for control and prevention of travel associated legionellosis. EWGLI. London 2002.5. Legionella and the prevention of legionellosis. WHO Geneva: 2007.

3. Helbig J.H., Bernander S., Castellani Pastoris M. et. al. Pan-European Study on Culture-Proven Legionnaires' Disease: Distribution of Legionella pneumophila Serogroups and Monoclonal Subgroups. Eur J Clin Microbiol Infect Dis. 2002. No. 21. P. 710-716. DOI 10.1007 / s 10096-002-0820-3.

4. Gaia V., Fry N.K., Afshar B. et al. Consensus Sequence-Based Scheme for Epidemiological Typing of Clinical and Environmental Isolates of Legionella pneumophila. J. Clin, microbiol. 2005, 43 (5): 2047-2052

5. A.C. Vodopyanov, CO. Vodopyanov, I.P. Olenikov, B.N. Mishankin, V.D. Kruglikov, I.V. Arkhangelskaya, D.A. Zubkova, M.I. Yezhova / INDEL- and VNTR-typing of Vibrio cholerae strains isolated in 2013 from environmental objects on the territory of the Russian Federation / Journal of Public Health and Habitat, 2015. No. 5 (266). S. 41-44.

6. Christine Pourcel, Paolo Visca, Baharak Afshar, Silvia D'Arezzo, Gilles Vergnaud, and Norman K. Fry / Identification of Variable-Number Tandem-Repeat (VNTR) Sequences in Legionella pneumophila and Development of an Optimized Multiple-Locus VNTR Analysis Typing Scheme / J Clin Microbiol. 2007 April; 45 (4): 1190-1199, doi: 10.1128 / JCM.02078-06

7. Organization of the work of laboratories using nucleic acid amplification methods when working with material containing microorganisms of pathogenicity groups I-IV: Methodological guidelines. MU 1.3.2569-09. - M .: Federal Service for Supervision of Consumer Rights Protection and Human Well-Being, 2009. - 35 p.

Claims (18)

1. A method for differentiating strains of Legionella pneumophila by molecular genetic typing, including the isolation of DNA from the studied L. pneumophila strain, PCR with specific primers and reaction by electrophoresis, characterized in that four common INDELs are detected from the DNA of the studied L. pneumophila strain -gene having deletions of a certain size, namely IND-А9Р84_02210, А9Р84_08285, А9Р84_03850 and А9Р84_07165, followed by their amplification using designed specific primers, revealing two alternative alleles: to the gene IND-A9P84_02210 - primers TTCCCCTTATTTAAATGACACCA and AAGCATAATAGGCGGGAAGA, with an amplified fragment length of 80 bp or 110 bp, to the gene IND-A9P84_08285 - primers CAGAAGACAAAGCGGAATCTG and TGAGGCCGAGTTTCTTGACT, with an amplified fragment length of 62 bp or 74 bp to the gene IND-A9P84_03850 - primers CAGGTATCTGCCACGAATCA and TGGTTGTTGTCCATTTGACTG, with an amplified fragment length of 63 bp or 75 bp to the gene IND-A9P84_07165 - primers TGGGTATTAAGCAATACGCAAG and AACAGAAACACCATTTATGCTTTG, with an amplified fragment length of 84 bp or 96 bp, the results of differentiation are taken into account visually after electrophoresis in an 8% polyacrylamide gel in the presence of a molecular weight marker for DNA, and for each strain a unique INDEL genotype is established for four INDEL genes, and by comparing the identified INDEL genotypes, the common or different origin of the studied strains is established L. pneumophila. 2. The method according to p. 1, characterized in that the PCR is carried out in a volume of 10 μl, and the reaction mixture contains: 1.5 MMMg buffer, 0.2 mm mixture of dNTP, 1.0 μm of a mixture of primers (0.5 μm of each primer), 25 ng DNA template 1 unit DNA polymerase the remaining volume is water, moreover, 5 μl of genomic DNA, which is obtained from different strains of Legionella pneumophila, is used as a matrix. 3. The method according to p. 1, characterized in that the PCR is carried out in compliance with the modes: Stage 1 - denaturation at 94 ° С - 35 s; Stage 2 - annealing at 60 ° С - 25 s; Stage 3 - synthesis at 72 ° С - 35 s (40 cycles).

Images