RU2569002C1 - Mineral feed additive with probiotic activity - Google Patents

Abstract

FIELD: chemistry.

SUBSTANCE: invention refers to agriculture and biotechnology, namely to a composition of a feed additive with probiotic activity and may be used in producing feed for farm animals and poultry. The feed additive consists of viable spores of spore-forming bacteria of the strain Bacillus subtilis and a filling agent. The spore-forming bacterial strain is the bacterial strain Bacillus subtilis 111 deposited in Russian National Collection of Microorganisms of G.K. Skryabin Institute of Microorganism Biochemistry and Physiology of the Russian Academy of Sciences (IBFM RAN) under registration No VKM B-2334 D, stored in Collection of Microorganisms of BIOTROF, OOO and consisting of viable spores of the spore-forming bacteria Bacillus subtilis 111 with a titre of 2·10⁶-6·10⁹ CFU/g. The filling agent is diatomite burnt crumb. The viable spores of the spore-forming bacteria Bacillus subtilis 111 and diatomite burnt crumb are taken in mass ratio 1:10 respectively. The feed additive as a part of feed is taken in ratio 0.001:1.

EFFECT: feeding of the feed additive provides higher feed accessibility, inhibits pathogen growth and promotes formation of an alimentary beneficial microflora, ensures higher productivity of farm animals and poultry.

11 tbl, 4 ex

Description

The invention relates to agricultural biotechnology, in particular to the composition of the feed additive with probiotic activity on a mineral basis and can be used in the preparation of feed for farm animals and poultry.

There is a method of obtaining a complex biologically active feed additive for sturgeon, which consists in the separate deep cultivation of strains of Cellulomonas uda ATCC 491, Bacillus subtilis VKPM B-8130 and Bacillus subtilis VKPM B-2984 on nutrient media of a given composition, the resulting cultures are mixed, carry out solid-phase fermentation in conditions of limited access of oxygen and dried to a moisture content of 8-10%, RU No. 2506810 C1, A23K 1/165, 02.20.2014.

It is known to use the bacterial strain Bacillus subtilis for the preparation of animal feed and feed additives, RU No. 2433738 C1, A23K 1/00, 11/20/2011; RU No. 2422506 C1, C12N 1/00, A23K 1/00, A23K 1/16, A23K 1/175, 06/27/2011.

Known strains of Bacillus subtilis with a high level of phytase production registered in DSMZ (Deutshe Sammlung von Mikroorganismen und Zellkulturen GmbH) under inventory numbers DSM 19466, 19467, 19489, on the basis of which the composition for feeding animals in combination with other additives is obtained, RU No. 2506307 C2 , C12N 1/20, A23K 1/16, 02/10/2014.

A known bacterial strain Bacillus subtilis IC-1435-1-1, providing restoration of microbiocenosis of the gastrointestinal tract of animals, having bactericidal, fungicidal and virucidal activity and deposited in the All-Russian Collection of Industrial Microorganisms FSUE State Research Institute of Genetics under registration number VKPM B-10641, on the basis of which receive VKPM B-10641, on the basis of which a preparation using a powdered sorbent from bran or zeolite, RU No. 2482174 C2, C12N 1/20, A61K 35/74, 05/20/2013 as a filler.

Known probiotic strain Bacillus subtilis 8130, on the basis of which a probiotic feed additive "Probiocel" was created, which affects the intestinal microflora, secretory and enzymatic activity of the gastrointestinal tract of animals and generally activates functional activity, improving metabolism, dissercat.com/content / izuchenie ..., RU No. 2346463 C2, A23K 1/165, 02.20.2009.

Known probiotic preparation intended for the treatment and prevention of gastroenteritis of weaned pigs, based on the strain Bacillus subtilis TPI and strain Bacillus lichemformis, which is a mixture of culture fluids containing products of microbial synthesis of these strains, with a concentration of microbial cells of 5 billion m / cm ³ in a volume ratio of the indicated strains 1: 1, to which an equal weight mixture of bran and dicalcium phosphate mixture, RU No. 2399662 C1, C12N 1/20, A23K 1/16, 09/20/2010; RU No. 2399661 C1, C12N 1/20, A23K 1/16, 09/20/2010.

Known probiotic composition for animals and birds, containing bacteria Rhuminococcus albus, Bacillus subtilis, taken in equal amounts, and a method for producing a probiotic composition, RU No. 2266747 C1, A61K 35/66, A23K 1/165, 12/27/2005; RU No. 2266126 C1, A61K 35/66, A23K 1/165, 20.12.2005.

Known probiotic additive containing the biomass of spore-forming bacteria Bacillus subtilis and a hydrophilic carrier brand A and hydrophobic brand AM, RU No. 2252956 C2, C12N 1/20, A23K 1/165, A23K 35/66, 05/27/2005.

Known probiotic feed additive comprising a mixture of bacterial biomass of strains of Bacillus subtilis VKPM 10172 and Bacillus licheniformis VKPM 10135 in equal proportions in spore form with a total amount of at least 2 · 10 ⁸ spores / g and carbohydrate protector, RU No. 2437563 C1, A23K 1 / 12/27/2011.

Known feed additive for broiler chickens containing a natural mineral - glauconite and made in the form of a dry powder, ground to a particle size of not more than 0.1 mm, with the additional introduction of the probiotic "Biosporin", RU No. 2352135 C2, A23K 1/00, A23K 1/16, A23K 1/175, 04/20/2009.

Known strains and feed additives based on them have individual production biotechnologies.

Known organic-mineral feed additive containing a filler and a siliceous material, the additive of which contains diatomite from the Inza deposit of the Ulyanovsk region with a silica content of 81.30-85.60% or flask of the Dubinsky deposit of the Ulyanovsk region with a silica content of 84.10-89.62%, having high porosity and hygroscopicity with the possibility of accumulating physiologically active substances from the filler, RU No. 2199883 C1, A23K 1/16, A23K 1/175, 03/10/2003.

Known feed additive for cattle, including vegetable and grain components and a mineral additive in the form of blue clay, which is a natural sorbent and a cheap source of vital macro- and microelements and has high adsorption and ion exchange properties, RU No. 2238659 C2, A23K 1/16 A23K 1/175, 10.27.2004.

Known feed additive for animals and birds, including natural zeolite, RU No. 2484640 C1, A23K 1/00, 06/20/2013; RU No. 2467591 C1, A23K 1/16, A23K 1/00, 11.27.2012; RU No. 2448472 C2, A23K 1/175, 04/27/2012; RU No. 2390254 C1, A23K 1/00, A23K 1/16, A23K 1/175, 05/27/2010; RU No. 2385623 C2, A23K 1/16, A23K 1/175, 04/10/2010; RU No. 2374896 C1, A23K 1/00, A23K 1/175, 12/10/2009; RU No. 2262863 C2, A23K 1/16, A23K 1/175, 10.27.2005.

Known feed additive to stimulate the growth of pigs containing filler and antibiotics, while as a filler it contains the adsorbent "Bazhedin", RU No. 2386343 C2, A23K 1/00, A23K 1/17, A23K 1/175, 04/20/2010.

Known medicinal feed additive from peat of the Bastyanovsky peat enterprise of the Sverdlovsk region with the addition of an alkaline component, RU No. 2475038 C2, A23K 1/00, 02/20/2013.

Known feed additive for pigs, which is a natural mineral of the Vodinsky deposit of the Krasnoyarsk district of the Samara region, containing 47.37% sulfur and 21.4% calcium, RU No. 2480025 C2, A23K 1/175, 04/27/2013.

Known feed additive for young cattle, including bentonite Donguz deposits, sunflower fuz and inorganic sodium selenite, and as a filler - wheat bran, RU No. 2497382 C2, A23K 1/16, A23K 1/175, 10.11.2013.

Known active coal feed additive to increase the productivity of laying hens, including a sorbent, which is used activated carbon obtained from softwood, having a particle size of from 0.1 to 2 mm, in an amount of 400 g per 1 ton of feed, U No. 2505069 C1, A23K 1/00, 01/27/2014.

Known feed additives contain natural materials based on clay or peat, or sorbent fillers in the form of activated carbon or natural zeolite (the most common), which in each case have individual processing technologies.

Known probiotic feed additive used in the feed for farm animals and poultry, consisting of viable spores of spore-forming bacteria of the strain Bacillus subtilis and filler, RU No. 2458526 C1, A23K 1/16, C12N 1/20, 08/20/2012.

This technical solution is made as the closest analogue of the present invention.

Spore-forming bacteria of the genus Bacilus, whose common biological property is antagonistic activity against the opportunistic intestinal microflora of animals and the production of enzymes, improve feed absorption. The probiotic feed supplement of the closest analogue optimizes the microbial balance in the intestine due to the restoration of normal flora, helps to increase the nonspecific resistance of the animal organism.

However, the feed additive of the closest analogue was made on the basis of the association of three species of spore-forming bacteria Bacillus subtilis VKPM B-2574, Bacillus licheniformis B-020, Bacillus cereus VKPM B-2492, a filler and a dispersant. Lactose, sucrose, skimmed milk powder are used as a filler, and Tween-80 is used as a dispersant.

The use of another composition in the nearest equivalent is not provided.

The present invention is based on the solution of the problem, to expand the range of feed additives with high probiotic activity on a mineral basis and increased functionality, designed to increase the productivity of farm animals and birds.

The technical result of the present invention is to combine the two functions of feed additives as a feed enzyme and a probiotic, while the enzyme function increases feed digestibility and effectively affects diatamite in the form of burnt chips, and the probiotic function inhibits the development of pathogenic microorganisms and contributes to the formation of beneficial microflora in the digestive tract through the use of viable spores of spore-forming bacteria Bacillus subtilis 111.

According to the invention, this problem is solved due to the fact that the feed additive with probiotic activity on a mineral basis, used in the feed for farm animals and poultry, consists of viable spores of spore-forming bacteria of the strain Bacillus subtilis and filler.

The strain of bacteria Bacillus subtilis 111 was taken as a strain.

The bacterial strain Bacillus subtilis 111 was deposited in the All-Russian collection of microorganisms of the Institute of Biochemistry and Physiology of Microorganisms named after G.K. Scriabin RAS (IBPM RAS) under the registration number VKM V-2334 D and is stored in the collection of microorganisms LLC BIOTROF.

The bacterial strain Bacillus subtilis 111 consists of viable spores of the spore-forming bacteria Bacillus subtilis 111 with a titer of 2 · 10 ⁶ - 6 · 10 ⁹ CFU / g.

Diatomite in the form of burnt chips was used as a filler in a mass ratio: viable spores of spore-forming bacteria Bacillus subtilis 111 and diatomite in the form of burnt chips as 1:10, respectively.

The feed additive in the feed was taken at a ratio of 0.001: 1.

The applicant has not identified sources containing information about technical solutions identical to the present invention, which allows us to conclude that it meets the criterion of "novelty."

Due to the implementation of the distinguishing features of the invention (together with the features indicated in the restrictive part of the formula), important new properties of the object are achieved.

The use of viable spores of spore-forming bacteria Bacillus subtilis 111 when interacting with diatomite in the form of burnt chips allows you to get a new feed additive with high probiotic activity when performing the functions of two feed additives: a feed enzyme and a probiotic.

The applicant is not aware of any publications that would contain information on the influence of the distinguishing features of the invention on the achieved technical result. In this regard, according to the applicant, it can be concluded that the claimed technical solution meets the criterion of "inventive step".

The present invention is carried out as follows.

A feed additive with probiotic activity is used as feed for farm animals and poultry.

Species identification of microorganism strains

The production of a pure culture of the bacterial strain, which is the basis of the developed feed additives with probiotic activity, was produced and tested in the period from October 17, 2011 to October 21, 2011 at the production base of BIOTROF LLC, St. Petersburg.

A pure culture of the bacterial strain was analyzed by molecular genetic sequencing.

DNA from a bacterial strain was isolated according to the standard protocol of the “Kit for the isolation of genomic DNA from various sources”.

Conservative primers were selected for the production of 16S rDNA.

27F AGAGTTTGATCMTGGCTCAG

1525r AAGGAGGTGWTCCARCC

The following PNR reaction regime was determined:

1) 95 ° C - 3 min

2) 35 cycles

95 ° C - 30 s

55 ° C - 30 s

72 ° C - 1 min

3) 72 ° C - 20 min

Electrophoresis of the studied samples was carried out in a 1.0% agarose gel with an electric field strength of 5 V / cm.

Isolation of DNA from the gel was carried out using the Silica DNA sorbent.

Cloning of PCR fragments was carried out in pTZ-57R vector into competent cells of E. coli strain DH5A.

Transformants were screened using the method of "PCR colonies" using primers M13

fM13: 5′-GCCAGGGTTTTCCCAGTCACGA-3 ′,

rM13: 5′-GAGCGGATAACAATTTSAC ACAGG-3

The following PCR reaction mode was established:

one). 95 ° C - 3 min

2). 35 cycles

95 ° C - 40 s

50 ° C - 40 s

72 ° C - 1 min

3). 72 ° C - 20 min

The nucleotide sequence of PCR fragments was determined using a reagent kit from Beckman (USA) in accordance with the manufacturer's recommendations. Separation of fragments and their registration was carried out using an automatic sequencing device CEQ8000, Beckman Coulter, USA.

Phylogenetic affiliation was determined in the NCBI BLAST database (http://blast.ncbi.nlm.nih.gov/Blast.cgi)

Based on the database, species were selected that have the maximum correspondence (at least 99%) of the bacterial strain — the basis of the feed additive with probiotic activity (Bacillus subtilis strain TCCC11441 16S ribosomal RNA gene, partial sequence (100%)).

The bacterial strain Bacillus subtilis 111 is the basis of a feed additive with probiotic activity.

The selection of a strain of bacteria for use as the basis of a feed additive with probiotic activity

The selection criterion for the bacterial strain Bacillus subtilis 111 as the basis of a feed additive with probiotic activity is a high antagonistic activity to test cultures of putrefactive bacteria and molds.

The results of the selection of the bacterial strain Bacillus subtilis 111 by antagonistic activity are presented in Table 1.

From Table 1 it can be seen that the bacterial strain Bacillus subtilis 111 has a high antagonistic activity against putrefactive bacteria, molds, and yeast.

The bacterial strain Bacillus subtilis 111 was tested for pathogenic properties.

In accordance with GOST 12.1.007-76, the bacterial strain Bacillus subtilis 111 was studied for pathogenic properties: virulence, toxicity, toxigenicity, the ability to cause desimination in the internal organs of warm-blooded animals.

Tests were conducted on outbred white rats and outbred white mice.

The virulence and dissemination of the bacterial strain Bacillus subtilis 111 was studied with a single administration of daily agar culture in physiological solution into the stomach of white mice and white rats at doses of 10 ⁶ , 10 ′, 10 ^x and 10 ⁹ and intraperitoneally 10 ⁶ , 10 ⁷ , 10 ⁸ and 10 ⁹ microbial cells (μl) per animal. In the experiment, 12 animals were used per dose (6 males and 6 females). During the observation of clinical symptoms of the disease in animals was not observed, death was absent. 30 days after the introduction of the culture of microorganisms, the animals were sacrificed by inhalation of CO _2, and the inoculum was inoculated from blood and internal organs (lungs, liver, kidneys and spleen) onto Petri dishes with agar medium. The culture growth in seeding from animal organs with both methods of administration was not detected.

The toxicity of the bacterial strain Bacillus subtilis 111 was evaluated by intraperitoneal administration to mice of a suspension of an agar culture of microorganisms prepared in sterile physiological saline and inactivated by heating at 60 ° C for 30 min at concentrations of 10 ⁸ and 10 ⁹ (micro cells) per animal (6 individuals per dose). During the observation period - the first two days - there was no death of mice.

The toxicity of the bacterial strain Bacillus subtilis 111 was studied in mice by intraperitoneal and intragastric administration of sterile filtrate of culture fluid (filtration through a Millipor filter with a pore size of 0.45 μm) of 3 and 7 day old cultures in doses of 0.3 ml, 0.6 ml and 1.0 ml (6 animals per dose). The animals of the control groups were injected with sterile liquid nutrient medium in the same volumes. The death of mice was not. LD _{50 has} not been established, with both methods of administration it exceeded 1.0 ml per animal for 3 and 7 day old culture fluids.

The results are presented in Table 2.

Table 2 shows that the bacterial strain Bacillus subtilis 111 in terms of virulence, dissemination, toxicity and toxigenicity is not pathogenic for warm-blooded animals and belongs to hazard class 4 (low hazard), which meets the requirements for industrial microorganisms.

The bacterial strain Bacillus subtilis 111 is the basis of a feed additive with probiotic activity.

Determination of optimal conditions for the growth of a strain of the bacterium Bacillus subtilis 111 for a feed additive with probiotic activity

The selection results are shown in Table 3, where

- Wednesday 1 - molasses - 1.5%; corn extract - 0.9%; fodder yeast 2%.

- Wednesday 2 - corn extract - 5%; lactose - 1%.

- Medium 3 - soy flour - 3%, sodium nitrate - 0.3%, potassium disubstituted phosphate - 0.1%, monosubstituted potassium phosphate - 0.1%, magnesium sulfate - 0.02%, potassium chloride - 0.02 %

Table 3 shows that the best conditions for the growth of the strain of the bacterium Bacillus subtilis 111 corresponds to medium 3.

Preparation of a feed additive with probiotic activity based on a bacterial strain Bacillus subtilis 111

The composition of the production environment is shown in Table 4.

The nutrient medium is prepared in a fermenter, thoroughly mixing and sterilizing with hot steam at a pressure of 1.6 atm and a temperature of 128 ° C for 1 hour.

Experimental samples of the culture of the strain of bacteria narabatana in fermenters.

A culture of microorganisms based on the bacterial strain Bacillus subtilis 111 was developed to obtain a feed additive with probiotic activity.

The characteristics of the culture of microorganisms Bacillus subtilis 111:

- appearance and color: light brown liquid with a slight sediment of the nutrient medium;

- the culture of microorganisms consists of a bacterial strain Bacillus subtilis 111,

not subjected to genetic engineering modifications;

- the bacterium titer is 2.0 · 10 ⁶ - 6.0 · 10 ⁹ CFU / g;

- extraneous microflora is absent.

The selected range of concentrations (titer) of bacteria is optimal.

In the feed additive, diatomite from the Inza deposit of the Ulyanovsk region was used as a filler.

Diatomite - sedimentary rock loose or slightly cemented, consisting of the remains of diatoms and having a gray or yellow color of weak tones.

Chemically, diatomite is more than 80% composed of aqueous silica.

Diatomite in the form of burnt chips is supplied by the "Diatom Plant" in Inza, Ulyanovsk Region.

In the feed additive, diatomite was used in the form of burnt chips of fractions of 0.3-0.7 mm with a moisture content of not more than 9%.

Preparation of feed additives in the form of a dry powder.

Viable bacterial spores of Bacillus subtilis 111 are applied to the diatomaceous earth as burnt chips placed in a CM-150 mixer at a ratio of 1:10. The wet preparation is laid out on trays.

Drying of the drug is carried out in drying cabinets RT-ShS. Trays with the drug spread on them are imported into the cabinets.

Drying of the drug is carried out by air-heat method at a temperature of from 55 ° C to 60 ° C for 9 hours to a final moisture content of 7.0-7.2%.

After drying, the drug is sent for grinding to a feed mill DKR-3. The drug is ground to a powder.

The feed additive in the feed is taken at a ratio of 0.001: 1.

The ratio is confirmed by experimental studies.

Studies on the use of the proposed feed additives are presented in examples 1-3.

Example 1

Use of a food supplement with probiotic activity in calf feed

The experiment was conducted at CJSC PLEMZAVOD BOLSHEVIK in the Leningrad Region. The duration of the experiment was 89 days.

Black-motley calves from 30-45 days old to 4 months old were selected for the experiment. Animals were kept in cages of 5 animals each.

The first control group received the main diet (RR) of feed.

The second experimental group received the main diet (OR) with a feed additive with probiotic activity.

The basic diet up to three months of age on average contained: milk - 10 l, including milk replacer, compound feed - 0.2 kg, hay - 0.2 kg, Ministry of Internal Affairs - 0.08 kg. From three months of age, the diet has changed: milk replacer - 3-5 l, feed - 0.8-1.5 kg, hay - 0.5 kg, silage - 2-4 kg, chalk - 0.05 kg, salt - 0.01 kg, MVD-0.6 kg.

A feed additive with probiotic activity was mixed with feed at the Gatchinsky feed mill at the rate of 1 kg per 1 ton of feed and added to milk in the first month of the experiment, and included in the diet for the next two months.

The results of the studies are shown in table 5 (Effect of feed additives with probiotic activity on the increase in live weight of calves).

From table 5 it is seen that due to the introduction of a feed additive with probiotic activity in calves in the 2nd experimental group, the microflora of the gastrointestinal tract normalized faster, which made it possible to increase the assimilation of nutrients in the diet and had a positive effect on weight gain. Calves earlier began to eat roughage (hay). The average daily gain in the 2nd experimental group was higher by 128 g (29.2%), which allowed to reduce feed consumption per 1 kg of weight gain by 1.32 units. compared with 1 control group.

In the diets of farm animals, a feed additive with probiotic activity serves as two feed additives: a feed enzyme and a probiotic. In calves, a feed supplement with probiotic activity increases immunity, promotes the maturation of cicatricial microflora and normalizes the digestive system, increases the viability of growing young animals and their early accustoming to eating roughage (hay).

Example 2

The use of feed additives with probiotic activity in the composition of feed for cows

The experiment was conducted at CJSC PLEMZAVOD BOLSHEVIK in the Leningrad Region. The duration of the experiment was 60 days.

Two groups of milk cows of the black-motley breed of the second and third lactation were formed. Animals were in tethered keeping.

The first control group received the main diet (RR) of feed.

The second experimental group received the main diet (OR) with a feed additive with probiotic activity.

The main diet contained: compound feed - 7 kg, silage - 30 kg, hay - 1.5 kg, beer pellet - 5 kg, sunflower meal - 1.2 kg, molasses - 0.2-1.0 kg, mineral and vitamin supplement - 0.2 kg.

A feed additive with probiotic activity was mixed with feed at the rate of 1 kg per 1 ton of feed.

The results of the studies are shown in table 6 (Cow productivity and milk quality of dairy cows of black-motley breed when using a feed additive with probiotic activity).

From table 6 it is seen that over the period of the experiment, the number of somatic cells in the milk of cows in the 2nd experimental group decreased by 29.6% compared with animals in the 1st control group. The average daily milk yield of milk of natural fat in the 2nd experimental group was 1.4 kg higher, the fat content in milk was higher by 0.3%, which made it possible to additionally obtain 3.2 kg of milk of 4% fat per 1 head per day.

The resulting difference in the amount of milk fat and protein in cows in the 2nd experimental group (57.7 kg and 46.8 kg, respectively) compared with animals in the 1st control group (50.2 kg and 43.2 kg, respectively), may be due to a change in the direction of interstitial exchange. A comparable analysis between the groups shows that a higher indicator of milk fat in animals in the 2nd experimental group was obtained both by increasing milk yield and increasing the percentage of fat and protein in milk.

As a probiotic, a feed supplement with probiotic activity inhibits the development of pathogenic microorganisms and contributes to the formation of beneficial microflora in the digestive tract, which provides increased productivity, increases the content of fat and protein in milk, and reduces the number of somatic cells.

The effect of the feed additive with probiotic activity on the microflora of the rumen of cows of the dairy herd is presented in table 7.

From Table 7 it is seen that the addition of a feed additive with probiotic activity to the diet contributed to a significant increase in the number of beneficial bacteria of the Ruminococcaceae family by 1.8 times.

The content of actinobacteria, among which pathogens of actinomycosis are often found, was high in the rumen of cows of the dairy herd in the 1st control group — 9.53%, while when the feed additive was added to the diet it decreased to 7.14%.

It should be noted that in the rumen of dairy herd cows in the 1st control group, a significant number of pathogenic microorganisms of the genera Staphylococcus (mastitis pathogen), Helicobacter (Campylobacter) (campylobacteriosis mastitis pathogen) and Fusobacterium (necrobacteriosis causative agent) were observed. The introduction of a feed additive with probiotic activity into the diet helped to reduce the number of these pathogens by 1.5, 1.25 and 2.5 times, respectively.

A feed supplement with probiotic activity has a positive effect on the microflora of the rumen of dairy cows. The condition of the microflora of the scar largely determines the performance indicators.

Example 3

The use of feed additives with probiotic activity in the feed for weaned piglets

The experiment was carried out at the pig farm OJSC PZ "Flame" of the Leningrad region. The duration of the experiment was 60 days.

2 groups of weaned piglets of 50 animals each were formed.

The first control group received the main diet (RR) of feed.

The second experimental group received the main diet (RR) of compound feed with a feed additive with probiotic activity.

Compound feed was prepared at the Gatchinsky feed mill, at the rate of 1 kg of feed additive with probiotic activity per 1 ton of feed.

The results of the studies are shown in table 8 (Effect of feed additives with probiotic activity on the cultivation of weaned piglets).

From table 8 it is seen that the use of feed additives with probiotic activity contributed to a more complete digestion. In the 2nd experimental group, the average daily gain in weaned piglets was 6.3% higher, and the feed cost per 1 kg of weight gain was lower by 0.48 units. than in 1 control group.

The effect of a feed additive with probiotic activity on the microbial community of the small intestine of weaned pigs is presented in table 9.

From table 9 it is seen that the content of bacteria of the phylum Bacteroidetes, among which there are species pathogenic for pigs, was high in the thin section of the gastrointestinal tract of animals in 1 control group. It was found that the proportion of bacteroids in the digestive tract of weaning pigs in the 2nd experimental group was 20.2 times lower compared to the 1st control group.

The content of actinobacteria phyla Actinobacteria, among which pathogens of animal actinomycoses are often found, was within the normal range in the gastrointestinal tract of animals in the 2nd experimental group. The share of these microorganisms in the digestive tract of weaning pigs should be no more than 6%. Moreover, the content of these microorganisms in the digestive tract of weaning pigs in the 1st control group exceeded the norm and was higher than in the gastrointestinal tract of animals in the 2nd experimental group by 4.16 times.

The research results showed that a feed supplement with probiotic activity significantly increases the number of beneficial lactic acid bacteria (family Lactobacillaceae).

A feed supplement with probiotic activity improves the microflora in the intestines of weaned pigs.

Example 4

The use of feed additives with probiotic activity in poultry farming

The experiment was carried out on the basis of the FSUE Zagorsk EPH VNITIP of the Russian Agricultural Academy on broilers of the Cobb Avian-48 cross.

Broiler chickens were raised in a P-15 type cell battery.

2 groups of broiler chickens were formed with 35 goals each.

The first and second groups of broiler chickens received loose feeds ad libitum.

The first control group received the main ration (RR) of feed.

The second experimental group received the main diet (OR) of feed with a feed additive with probiotic activity (1000 g / t).

The nutritional value of compound feeds corresponded to the recommended norms for cross-country, the structure of compound feeds included sunflower meal (12.5% by weight of compound feeds) and wheat bran (5% by weight of compound feeds) during the growth and finishing periods of cultivation.

The main zootechnical indicators of experience on broiler chickens when using a feed additive with probiotic activity are presented in table 10.

From table 10 it is seen that the effectiveness of introducing a feed additive with probiotic activity in OR in the 2nd experimental group is obvious: the average daily gain in live weight is higher in comparison with the 1 control group with a decrease in feed costs per 1 kg of live weight to 1.67 kg.

The effect of feed additives with probiotic activity on the intestinal microflora of broiler chickens is presented in table 11.

From table 11 it is seen that a feed additive with probiotic activity 2.7 times increases the number of beneficial lactic acid bacteria (lactobacilli), significantly reduces the number of actinomycetes and staphylococci harmful to the body of the bird, and prevents the development of opportunistic enterobacteria.

The results obtained on the basis of Examples 1-4 confirm the feasibility of using a new feed supplement with probiotic activity.

The probiotic activity of the feed additive was determined using the molecular genetic method based on the T-RFLP analysis.

DNA was extracted from the intestine using a commercial DNA Purification Kit (Fermentas, Lithuania).

PCR amplification of the bacteria 16S rRNA genes was performed using primers: 63F (CAGGCCTAACACATGCAAGTC) - labeled at the 5′-end (fluorophore D4 - WellRed); 1492R (TACGGHTACCTTGTTACGACTT).

The amplified fragment was isolated from agarose gel using a 3M guanidine thiocyanate solution.

Amplicon restriction was performed using restriction enzymes NaeIII, Hhal and MspI (Fermentas) for 2 hours at 37 ° C. After the restriction was complete, DNA from the reaction mixture was precipitated with ethanol, dissolved in SLS (Beckman Coulter), followed by the addition of a molecular weight marker of 600 bp. (Beckman Coulter). The next step in the analysis was fluorescence detection of the target DNA on a CEQ8000 automated sequencer (Beckman Coulter).

Peak sizes and their areas were calculated using the Fragment Analysis (Beckman Coulter) software unit. To identify peaks, T-RFLP grams for three endonucleases (NaeIII, HhaI, and MspI) were processed using the Fragment Sorter program (http://www.oardc.ohio-state.edu/trflpfragsort/index.php).

From the collection of production strains, a bacterial strain Bacillus subtilis 111 was identified, the viable spores of spore-forming bacteria of which are part of a feed additive with mineral-based probiotic activity in the form of burnt diatomaceous crumbs.

The proposed feed additive with probiotic activity was obtained according to well-known biotechnologies that are widely used in agriculture, and experimental work was carried out on the basis of the FSUE Zagorsk EPH VNITIP of the Russian Agricultural Academy, pig farms of the PZ Flame OJSC of the Leningrad Region and CJSC PLEMZAVOD according to Bolshevik region Leningrad oblast According to the applicant, his compliance with the criterion of "industrial applicability".

The proposed feed additive with high probiotic activity and increased functionality allows you to:

- increase the productivity of farm animals and poultry;

- normalize and improve the microflora of the gastrointestinal tract, inhibiting the development of pathogenic microorganisms and contributing to the formation of beneficial microflora in the digestive tract;

- increase the digestibility of feed nutrients.

Claims (1)

A feed additive with mineral-based probiotic activity, used in feed for farm animals and poultry, consisting of viable spores of spore-forming bacteria of the strain Bacillus subtilis and excipient, characterized in that the strain of bacteria Bacillus subtilis 111, deposited in the All-Russian collection of microorganisms, is taken as a strain Institute of Biochemistry and Physiology of Microorganisms named after G.K. Scriabin RAS (IBPM RAS) under registration number VKM V-2334 D, stored in the collection of microorganisms of BIOTROF LLC and consisting of viable spores of spore-forming bacteria Bacillus subtilis 111 with a titer of 2 · 10 ⁶ -6 · 10 ⁹ CFU / g, and in Diatomite in the form of burnt chips was used as a filler in a mass ratio: viable spores of the spore-forming bacteria Bacillus subtilis 111 and diatomite in the form of burnt chips as 1:10, respectively, while the feed additive in the feed was taken at a ratio of 0.001: 1.