RU2551227C1 - SET OF FLUORESCENTLY LABELLED OLIGONUCLEOTIDE PROBES FOR TYPING STRAINS OF Burkholderia mallei BY METHOD OF AMPLIFICATION OF DIFFERENTIATING DNA FRAGMENTS - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: probes included in the set have a structure of a "pin" with fluorophore and fluorescence extinguisher at the ends and have complementarity to products of an amplification reaction with primers. The developed set of hybridisation probes can be used for the fluorescent detection of the results of typing the actinobacillus mallei by a method of amplification of differentiating fragments of a genome in the implementation of the epidemiological surveillance of the glanderous infection.

EFFECT: possibility of simultaneous analysis of nine DFR-loci.

2 dwg, 1 tbl, 3 ex

Description

The invention relates to biotechnology and molecular biology and can be used to detect the results of amplification of differentiating DNA fragments when typing the glanders pathogen by specialists of reference centers for monitoring infectious disease pathogens, national centers for verifying diagnostic activities, as well as research organizations of the epidemiological and microbiological profile.

Can is a severe anthropozoonous infectious disease characterized by septicemia, the formation of specific granulomas, abscesses in organs and tissues, and high mortality. The causative agent of glanders, Burkholderia mallei, is categorized as potential B bioterrorism agent by the US Centers for Disease Control and Prevention.

The need for research aimed at the diagnosis and typing of B. mallei strains is associated with the continued threat of biological emergencies and possible terrorist attacks using this pathogen. Genotyping of B. mallei, based on the determination of differences in the genomes of strains of this species, is aimed at investigating outbreaks, monitoring the natural foci of glanders, genomic certification and determination of phylogenetic relationships of strains.

Various molecular genetic approaches are used to type glanders. However, multilocus sequence typing was ineffective for the highly conserved genome of B. mallei [Godoy D., Randle G., Simpson A.J. et al. Multilocus sequence typing and evolutionary relationships among the causative agents of melioidosis and glanders, Burkholderia pseudomallei and Burkholderia mallei / J. Clin. Microbiol. 2003; 41 (5): 20b8-79]. PCR with random primers, showing high discriminatory ability, was characterized by low and interlaboratory reproducibility [Antonov V.A., Altukhova V.V., Savchenko S.S., Zamaraev B.C., Ilyukhin V.I., Alekseev V.V. The use of multilocus sequence typing (MLST) and amplification with arbitrary primers (RAPD) for differentiation of glanders pathogen strains / Molecular Genetics, Microbiology and Virology, 2007; 3: 3-9]. Most genotyping methods include the mandatory stage of electrophoresis to detect results, which increases the analysis time.

Typing based on the amplification of differentiating fragments of the genome - DFR analysis (different region) consists of a series of polymerase chain reactions with primers flanking the variable fragments of target DNA present only in certain strains. To conduct amplification reactions during DFR typing, oligonucleotide primers specific for certain strains of glanders are used. The primers are complementary to DNA sequences at the boundaries of differentiating fragments and are oriented in such a way that the completion of a new DNA chain proceeds only between them. As a result of PCR, there is a multiple increase in the number of copies (amplification) of a specific region of the gene, catalyzed by the DNA polymerase enzyme. The choice of differentiating fragment and the selection of primers plays a crucial role in the specificity of amplification, which affects the quality of the analysis of the studied microorganisms.

Detection of amplification products using special fluorescence tags will make it possible to abandon the electrophoresis stage, which will not only shorten the analysis time, but also reduce the risk of cross-contamination with PCR products and, accordingly, reduce the risk of false positive results. Since the results are recorded directly during the amplification reaction, the entire analysis can be carried out in one or two rooms of the laboratory by one employee. This approach will allow for automatic interpretation of the results and will remove the problem subjectively and assess electrophoregrams. There are several fluorescence technologies that differ in how reporter fluorescence is generated. The present invention provides probes with complementary terminal sequences of the type of "molecular beacons."

The closest analogue of the invention is a genotyping scheme using amplification of differentiating fragments for the melioidosis pathogen proposed by Kwanjit Duangsonk et al. In 2006 [Use of a Variable Amplicon Typing Scheme Reveals Considerable Variation in the Accessory Genomes of Isolates of Burkholderia pseudomallei, Kwanjit Daniel Gal, Mark Mayo, C. Anthony Hart, Bart J. Currie, and Craig Winstanley]. However, this scheme is not effective for typing the glanders pathogen, nor has it developed fluorescence detection of the results.

The aim of the present invention is to develop a set of fluorescently-labeled oligonucleotide probes for detecting the results of DFR typing of glanders pathogen strains by real-time polymerase chain reaction.

The goal is achieved by constructing specific oligonucleotides having a hairpin structure with a fluorophore and a fluorescence quencher at the ends and having complementarity to differentiating fragments of the B. mallei genome:

BmVATIp 5 ′ (ROX) -CCGCGAGCACGCTCTCGACCGAGCGCACGCGG- (BHQ2) 3 ′,

complementary to the fragment of the BMA0577 locus of the B. mallei ACTC 23344 genome flanked by BmVAT1-Ch1s / BmVAT1-Ch1as primers;

BmVAT2p 5 ′ (FAM) -CGCGCTCGCCGCCTATCCGCTCGTGCTGCGCG- (BHQ 1) 3 ′, complementary to the fragment of the BMA0958 locus of the B. mallei ACTC 23344 genome flanked by BmVAT2-Ch1s / BmVAT2 primers;

BmVAT3p 5 ′ (ROX) -ACAGCGTCGTCGACGACCGCGGGCCGCTCT- (BHQ2) 3 ′, complementary to a fragment of the BMA2089 locus of the B. mallei ACTC 23344 genome flanked by BmVAT3-Ch1s / BmVAT3-Chlas primers;

BmVAT4p 5 ′ (HEX) -ACGTCGCGCCCCGCGCCGCAACCGACGT- (BHQ2) 3 ′, complementary to a fragment of the BMA2262 locus of the B. mallei ACTC 23344 genome flanked by BmVAT4-Ch1s / BmVAT4-Chlas primers;

BmVAT5p 5 ′ (HEX) -CCCGAATTTCTCGCGCTCAATCCGTTCGGG- (BHQ2) 3 ′, complementary to a fragment of the BMAA0107 locus of the B. mallei ACTC 23344 genome flanked by BmVAT5-Ch2s / BmVAT5-Ch2as primers;

BmVAT6p 5 ′ (Cy5) -ACCGAGTTAGTTCCGTTCCTTCGGT- (BHQ2) 3 ′, complementary to a fragment of the BMAA0416 locus of the B. mallei ACTC 23344 genome flanked by BmVAT6-Ch2s / BmVAT6-Ch2as primers;

BmVAT7p 5 ′ (HEX) -CTTGCCTACATCATCGAAAAGCTGGGCAAG- (BHQ2) 3 ′, complementary to the BMAA0871 locus fragment of the B. mallei ACTC 23344 genome flanked by BmVAT7-Ch2s / BmVAT7-Ch2as primers;

BmVATSp 5 ′ (ROX) -CCGCGATGCTGGTTTGCATGCGCCGCCGCGG- (BHQ2) 3 ′, complementary to the BMA10247_A0137 locus fragment of the B. mallei NCTC 10247 genome flanked by BmVAT8-Ch2s / Bm primers;

BmVAT9p 5 ′ (Cy5) -CGATCGCTGTATTCCATGCCGTCGATCG- (BHQ2) 3 ′, complementary to the fragment of the BMA10247_A1008 locus of the B. mallei NCTC 10247 genome flanked by BmVAT9-Ch2s / BmVAT9-Ch primers;

Where:

FAM is carboxyfluorescein, a fluorescent dye with an absorption wavelength of 492 nm and a fluorescence wavelength of 520 nm. HEX is a fluorescent dye with an absorption wavelength of 535 nm and a fluorescence wavelength of 556 nm. ROX is a carboxy-X-rhodamine, a fluorescent dye with an absorption wavelength of 580 nm and a fluorescence wavelength of 605 nm. Cy5 is a fluorescent dye with an absorption wavelength of 649 nm and a fluorescence wavelength of 670 nm. BHQ1 is a fluorescence quencher with a quenching range of 480-580 nm. BHQ2 is a fluorescence quencher with a quenching range of 550-650 nm.

Characterization of fluorescently-labeled oligonucleotide probes and target DNA for their hybridization.

Based on the data presented in the GenBank NCBI database (National Center for Biotechnology Information), oligonucleotides of the “molecular beacon” type were selected that have hybridization probe activity to fragments of the glanders pathogen flanked by primers BmVAT1-Ch1s / BmVAT1-Ch1as, BmVAT2, BmVAT / BmVAT2-Ch1as, BmVAT3-Ch1s / BmVAT3-Ch1as, BmVAT4-Ch1s / BmVAT4-Ch1as, BmVAT5-Ch2s / BmVAT5-Ch2as, BmVAT6-Ch2s / BmVAT8 Chatas, BmVAT8 BmVAT8 Chatas -Ch2as, BmVAT9-Ch2s / BmVAT9-Ch2as. The characteristics of the set of probes and corresponding targets in the genome of B. mallei are shown in table 1.

Testing of the probes was carried out on a set of strains of the pathogen glanders of the collection center FKUZ Volgograd Research Anti-Plague Institute of Rospotrebnadzor. It was demonstrated that the developed set of hybridization probes can be used for fluorescence detection of amplification products of differentiating DNA fragments of glanders, which allows us to determine the genetic profile of the studied B. mallei strains. This approach is easy to detect, using standard equipment for PCR and the speed of obtaining the result.

Case Studies

Example 1. The algorithm for constructing fluorescently-labeled oligonucleotide probes for typing strains of the pathogen glanders by amplification of differentiating DNA fragments.

Based on the analysis in silico of the nucleotide sequences of the glide pathogen differentiation fragments flanked by BmVAT1-Ch1s / BmVAT1-Ch1as, BmVAT2-Ch1s / BmVAT2-Ch1as, BmVAT3-Ch1s / BmVAT3-Ch1as, BmVAT4-Ch1as, BmVAT4-Ch1as BmVAT5-Ch2as, BmVAT6-Ch2s / BmVAT6-Ch2as, BmVAT7-Ch2s / BmVAT7-Ch2as, BmVAT8-Ch2s / BmVAT8-Ch2as, BmVAT9-Ch2s / BmVAT9-Ch2as, using the UGEN v.5 program. (Unipro, Russia) hybridization probes were designed (table).

The obtained oligonucleotides were analyzed using the Vector NTI Express v.1.1.2 computer program (Life Technologies, USA) for the formation of secondary structures with the corresponding primers, and their theoretical suitability for successful fluorescence detection of the results of amplification reactions was shown.

Example 2. Detection of amplification products of differentiating DNA fragments using the developed set of probes for typing strains of glanders.

The research material was pure glanders, previously identified to the species. The test samples were disinfected by adding a solution of sodium merthiolate to a final concentration of 0.01% and heating for 40 min at a temperature of 56 ° C (MU 4.2.2831-11 Laboratory diagnosis of glanders). DNA was isolated from pure cultures of the glanders pathogen using the method of lysis with guanidine isothiocyanate and reprecipitation of DNA with isopropanol (AmpliPrim RIBO-prep, Federal Research Institute of Epidemiology of Rospotrebnadzor).

In addition to the analyzed DNA, the reaction mixtures included oligonucleotide probes complementary to the differentiating DNA fragments of B. mallei, direct and reverse primers, deoxyribonucleoside triphosphates, buffer solution and DiaTak polymerase enzyme (Federal State Institution of Research of Epidemiology of Rospotrebnadzor). Amplification of 45 cycles was carried out in a volume of 25 μl using a "hot start", which was provided by a layer of wax.

Analysis of the products of the NDP was carried out in real time on a DT Lite instrument (ZAO NPF DNA Technology, Russia). The results were recorded in tabular and graphical form. The amplification result of each DFR fragment was considered positive if the fluorescence accumulation curve for a given channel crossed the threshold line in the region of the characteristic exponential increase in fluorescence, on a cycle not exceeding the boundary value Ct (Fig. 1.). Figure 1 shows a graph of the increase in fluorescence curves obtained by amplification of DNA of glanders pathogen strains with primers BmVAT3-Ch1s / BmVAT3-Ch1as (1 - B. mallei Muksuwar - 11, 2 - B. mallei Zagreb, 3 - B. mallei Bogor - 37) .

Example 3. Analysis of the typing results of strains of the glanders pathogen from the collection of FKUZ Volgograd Research Anti-Plague Institute of Rospotrebnadzor by amplification of differentiating DNA fragments with real-time detection.

To compile the genetic profile of the studied B. mallei strains, amplification was performed at nine DFR loci with real-time detection using the developed set of probes. For further analysis, the PCR results were converted into a binary matrix, in which the presence of an amplicon was designated “1I”, and its absence was designated “0”.

Then, using computer programs, we compared the DFR patterns of 14 collection glanders pathogen strains with the DFR types of 4 annotated strains from GeneBank determined in silico. Cluster analysis was performed using the Neighbor-Joining method and the categorical coefficient. The result of processing the data of the DFR analysis was the dendrogram shown in Figure 2, which displays the genetic distances or evolutionary relationships between the studied strains. The application of this approach allowed us to divide 18 studied strains of B. mallei into 11 genotypes.

Thus, the developed set of hybridization probes can be used for fluorescence detection of typing glanders by amplification of differentiating fragments of the genome. This approach provides the possibility of simultaneous analysis of nine DFR loci, is characterized by ease of interpretation, speed of obtaining results, using standard equipment and will be useful in carrying out epidemiological surveillance of glanders infection.

Characterization of a set of fluorescently-labeled oligonucleotide probes for DFR typing of glanders pathogen strains Probe name Sequence Locus in the genome of B. mallei Fluorescent dye / fluorescence quencher Bmvat1p CCGCGAGCACGCTCTCGACCGAGCGCACGCGG VMA0577 ROX / BHQ2 Bmvat2p CGCGCTCGCCGCCTATCCGCTCGTGCTGCGCG VMA0958 FAM / BHQ1 Bmvat3p ACAGCGTCGTCGACGACCGCGGGCCGCTCT VMA2089 ROX / BHQ2 Bmvat4p ACGTCGCGCCCCGCGCCGCAACCGACGT VMA2262 HEX / BHQ2 Bmvat5p CCCGAATTTCTCGCGCTCAATCCGTTCGGG VMAA0107 HEX / BHQ2 Bmvat6p ACCGAGTTAGTTCCGTTCCTTCGGT VMAA0416 Cy5 / BHQ2 Bmvat7p CTTGCCTACATCATCGAAAAGCTGGGCAAG VMAA0871 HEX / BHQ2 Bmvat8p CCGCGATGCTGGTTGCATGCGCCGCCGCGG VMA10247_A0137 ROX / BHQ2 Bmvat9p CGATCGCTGTATTCCATGCCGTCGATCG VMA10247_A1008 Cy5 / BHQ2

Claims (1)

A set of fluorescently-labeled oligonucleotide probes for typing strains of Burkholderia mallei by amplification of differentiating DNA fragments having the following structure:
BmVAT1p 5 '(ROX) -CCGCGAGCACGCTCTCGACCGAGCGCACGCGG- (BHQ2) 3', complementary to a fragment of the BMA0577 locus of the B. mallei ACTC 23344 genome flanked by BmVATl-Chls / BmVATl-Chlas primers;
BmVAT2p 5 '(FAM) -CGCGCTCGCCGCCTATCCGCTCGTGCTGCGCG- (BHQ1) 3', complementary to a fragment of the BMA0958 locus of the B. mallei ACTC 23344 genome flanked by BmVAT2-Chls / BmVAT2 primers;
BmVAT3p 5 '(ROX) -ACAGCGTCGTCGACGACCGCGGGCCGCTCT- (BHQ2) 3', complementary to a fragment of the BMA2089 locus of the B. mallei ACTC 23344 genome flanked by BmVAT3-Chls / BmVAT3-Chlas primers;
BmVAT4p 5 '(HEX) -ACGTCGCGCCCCGCGCCGCAACCGACGT- (BHQ2) 3', complementary to a fragment of the BMA2262 locus of the B. mallei ACTC 23344 genome flanked by BmVAT4-Chls / BmVAT4-Chlas primers;
BmVAT5p 5 '(HEX) -CCCGAATTTCTCGCGCTCAATCCGTTCGGG- (BHQ2) 3' complementary to the fragment of the BMAA0107 locus of the B. mallei ACTC 23344 genome flanked by BmVAT5-Ch2s / BmVAT5-Ch2as primers;
BmVAT6p 5 '(Cy5) -ACCGAGTTAGTTCCGTTCCTTCGGT- (BHQ2) 3' complementary to a fragment of the BMAA0416 locus of the B. mallei ACTC 23344 genome flanked by W VA T6-Ch2s / Bm VA T6-Ch2as primers;
BmVAT7p 5 '(HEX) -CTTGCCTACATCATCGAAAAGCTGGGCAAG- (BHQ2) 3', complementary to a fragment of the BMAA0871 locus of the B. mallei ACTC 23344 genome flanked by BmVAT7-Ch2s / BmVAT7-Ch2as primers;
BmVAT8p 5 '(ROX) -CCGCGATGCTGGTTTGCATGCGCCGCCGCGG- (BHQ2) 3' complementary to the fragment of the BMA10247A0137 locus of the B. mallei NCTC 10247 genome flanked by BmVAT8-Ch2s / BmVAT8 primers;
BmVAT9p 5 '(Cy5) -CGATCGCTGTATTCCATGCCGTCGATCG- (BHQ2) 3', complementary to a fragment of the BMA10247_A1008 locus of the B. mallei NCTC 10247 genome flanked by BmVAT9-Ch2s / BmVAT9-Ch primers; Where:
FAM is carboxyfluorescein, a fluorescent dye with an absorption wavelength of 492 nm and a fluorescence wavelength of 520 nm. HEX is a fluorescent dye with an absorption wavelength of 535 nm and a fluorescence wavelength of 556 nm, ROX is a carboxy-X-rhodamine, a fluorescent dye with an absorption wavelength of 580 nm and a fluorescence wavelength of 605 nm, Cy5 is a fluorescent dye whose absorption wavelength is 649 nm, and the fluorescence wavelength is 670 nm. BHQ1 is a fluorescence quencher with a quenching range of 480-580 nm, BHQ2 is a fluorescence quencher with a quenching range of 550-650 nm.

Images