RU2542968C2 - Set of oligodeoxyribonucleotide primers and fluorescent-marked dna probes for identification of rna of enteroviruses, rhinoviruses, viruses of hepatitis a and e from water medium by multiplex pcr method - Google Patents

Abstract

FIELD: biotechnologies.

SUBSTANCE: invention proposes a set of oligodeoxyribonucleotide primers and fluorescent-marked DNA probes for identification of RNA of enteroviruses, rhinoviruses, viruses of hepatitis A and E in water samples from the environment by means of a multiplex PCR. The invention can be used in virology and epidemiology.

EFFECT: improving use efficiency.

4 dwg, 2 tbl

Description

The invention relates to sets of oligodeoxyribonucleotide primers and fluorescently labeled DNA probes for identifying the genetic material (RNA) of enteroviruses, rhinoviruses, hepatitis A and E viruses in environmental water samples by the method of multiplex polymerase chain reaction and can be used in virology and epidemiology to provide epidemic safety of the population with various types of water use.

The problem of ensuring the epidemic safety of the population of Russia with various types of water use is a priority state task in the system of preventive sanitary and epidemiological surveillance. Being one of the leading in the implementation of intestinal viral infections, the waterway is currently one of the main factors in the formation of sporadic and outbreak incidence.

It is known that in order to indicate cytopathogenic viruses that spread by water, the practical laboratory service uses the method of their isolation on sensitive cell cultures. However, this method has several disadvantages that reduce its practical significance: the duration of the process (3-4 weeks), the inability to isolate non-cytolytic and damaged viral agents that are not able to cause a productive cytolytic infection in the in vitro system, but which nevertheless pose an epidemic danger living organism (The problem of laboratory diagnosis of acute intestinal infections of unknown etiology in children / T.V. Amvrosyeva, N.V. Poklonskaya, E.P. Kishkurno, N.L. Kluyko, O.N. Kazinets, A.A. Bezruchko, O.I. Kamyak // Persp Prospects for cooperation of the SCO member states in countering the threat of infectious diseases: Proceedings of the international scientific and practical conference / Federal State Institution “State Scientific Center of Virology and Biotechnology“ Vector ”of Rospotrebnadzor. - Novosibirsk, 2009. - P. 52-55). These problems arising in the study of the virological quality of water of various water bodies can be solved by using the detection method, which is a polymerase chain reaction with a reverse transcription step (RT-PCR), which allows detecting viral RNA in the test material within 3-6 hours .

The reverse transcription polymerase chain reaction (RT-PCR) is the most common method used in laboratory practice for the differential diagnosis of infectious diseases. The method is based on two reactions - reverse transcription and polymerase chain reaction. In the reverse transcription reaction, a complementary DNA (cDNA) is built on the viral RNA matrix. In the subsequent PCR reverse transcription reaction, multiple selective doubling of the target cDNA region occurs (amplification). The amplified cDNA region is marker, since it is strictly limited to the sequences of DNA seeds (primers), without which PCR cannot occur. In order to detect the accumulation of amplification products in real time, in addition to a pair of primers, a fluorescently-labeled DNA probe is also required. The complexity of the choice of primers and probe is due to the requirement of their strict species specificity. If the selected oligonucleotides do not have species specificity for the target object or do not have sufficient homology to the target nucleotide sequence, false negative results of the study are possible. If the selected primers and probes demonstrate an affinity for non-target DNA sequences, then false-positive test results are possible. The correct choice of a combination of a pair of primers and a fluorescently labeled DNA probe allows for strictly specific amplification of the target cDNA fragment and real-time detection of PCR products accumulation.

For PCR diagnostics of enteroviruses, PCR test systems with electrophoresis detection are used by companies such as BioChemMack CJSC (http://www.biochemmack.ru/product/moleculardiagnostics/infectious/) and Litekh CJSC (reagent kits for PCR production of IzoGen) (http://www.lytech.ru/ catalog_69.htm). A kit with hybridization-fluorescence detection is produced by InterLabService (http://www.interlabservice.ru/catalog/reagents/ index.php? Sid = 678).

For the diagnosis of hepatitis A viruses by PCR, a set of reagents is used to detect hepatitis A virus RNA (HAV) in clinical material and environmental objects using the polymerase chain reaction (PCR) with hybridization-fluorescence detection "AmpliSens® HAV-F (http: // www .product_3056.html).

For the diagnosis of hepatitis E virus by PCR, kits are not available in Russia.

The closest analogue (prototype) is a kit for the detection of human rhinovirus cDNA by PCR, including a set of primers: AmpliSens®ORVI-screen-FL (Central Research Institute of Epidemiology, Moscow). The indicated set of reagents makes it possible to identify the causative agents of acute human respiratory viral infections (ARVI) (RNA of the respiratory syncytial virus, metapneumovirus, type 1-4 parainfluenza viruses, coronaviruses, rhinoviruses, adenoviruses of groups B, C and E and bocavirus in the clinical material by the polymerase method reactions (PCR) with hybridization-fluorescence detection (http://www.pacxodka39.ru/product_3056.html) ..

Thus, at present, multiplex PCR test systems for the simultaneous diagnosis of enteroviruses, rhinoviruses, hepatitis A and E viruses in Russia and abroad are not known. Moreover, there are no specialized test systems for detecting viruses in water samples.

The technical result of the claimed invention is the creation of a set of reagents: primers and fluorescently-labeled probes, allowing to identify enteroviruses, rhinoviruses, hepatitis A and E viruses, by real-time multiplex PCR.

The indicated technical result is achieved by the development of a set of oligo-deoxyribonucleotide primers and fluorescently-labeled DNA probes for identification of RNA enteroviruses, rhinoviruses, hepatitis A and E viruses from an aqueous medium by the method of multiplex polymerase chain reaction and having the nucleotide structure presented below (and in the application) sequences:

for the detection of rinovirus RNA:

- direct (F1 and F2) and reverse (R1 and R2) primers:

F1: 5`-TARACCTIGCAGATGRGGC-3`

F2: 5`-TTAACCGTYAICCGCCA-3`

R1: 5`-GAAACACGGACACCCAAAGTAG-3`

R2: 5`-ACCCAAAGTAGTCGGTCCC-3`

- fluorescently-labeled DNA probes (Z1 and Z2):

Z1: FAM-CCYGCGTGGCIGCCTGC-BHQ1

Z2: FAM-YIAGCCTGCGTGGCGG-BHQ1

to detect RNA of all enteroviruses A, B, C, D and polioviruses:

- direct (F3) and reverse (R3) primers:

F3: 5`- CAAGIACTTCTGTTICCYCGGACIGA -3`

R3: 5`- ATITITCAATTGTCAICATAAGCAGCCA -3`

- fluorescently-labeled DNA probe (Z3):

Z3: ROX- CCTIGGCNCCTGAIGCGGCTAATCC -BHQ2

for the detection of hepatitis A virus RNA:

- direct (F4) and reverse (R4) primers:

F4: 5`- GTAGGCTACGGGTGAAACCTCTT -3 '

R4: 5`- CGGCGTTGAATGGTTTTTTGT -3 '

- fluorescently-labeled DNA probe (Z4):

Z4: R6G- AGGGTAACAGCGGCGGATATTGGTGAGT -BHQ2

for the detection of hepatitis E virus RNA:

- direct (F5) and reverse (R5) primers:

F5 5`- CGGCRGTGGTTTCTGGGGTGAC -3 '

R5 5`- GGGGTTGGTTGGATGAATATAGGGG -3 '

- fluorescently-labeled DNA probe (Z5):

Z5 Cy5- TGATTCTCAGCCCTTCGCCCTCCCC -BHQ2

List of graphic materials

In FIG. 1. graphs of the analysis of samples for the content of rhinoviruses by real-time PCR are shown. In FIG. 2. graphs of sample analysis for the content of enteroviruses by real-time PCR are presented. In FIG. 3. presents graphs of analysis of samples for the content of hepatitis A virus by real-time PCR. In FIG. 4. shows graphs of analysis of samples for the content of hepatitis E virus by real-time PCR

The oligonucleotides were tested using a laboratory viral collection of isolates of enteroviruses, rhinoviruses, hepatitis A and E viruses (the research procedure was approved by the ethical committee of the Federal State Budget Scientific Center of the World Bank "Vector" (IRB 00001360)). It was experimentally shown that the selected primers and DNA probes provide reliable synthesis of target DNA fragments. The specificity of amplification was further confirmed by sequencing.

Characterization of a set of primers and plot amplifiable genomic RNA of rhinoviruses. The primers proposed for patenting flank a portion of the gene encoding the viral glycoprotein 1 (VP1 gene). In PCR, the genome fragment from 28117 to 28630 nucleotides (513 bp) is amplified. The use of a fluorescently-labeled DNA probe complete with diagnostic primers allows real-time detection of the accumulation of amplification products.

Characterization of a set of primers and plot amplified genomic RNA enteroviruses. The primers proposed for patenting are complementary to the non-coding part of the genomic RNA (5 ”-UTR). In PCR, a fragment of the genome from 72 to 521 nucleotides (449 bp) is amplified. The use of a fluorescently-labeled DNA probe complete with diagnostic primers allows real-time detection of the accumulation of amplification products.

Characterization of the set of primers and the site of the amplified genomic RNA of hepatitis A. The primers proposed for patenting in PCR amplify a fragment of the genome from 311 to 421 nucleotides (110 bp). The use of a fluorescently-labeled DNA probe complete with diagnostic primers allows real-time detection of the accumulation of amplification products.

Characterization of the set of primers and the site of the amplified genomic RNA of hepatitis E. The primers proposed for patenting in PCR amplify a fragment of the genome from 5298 to 5370 nucleotides (72 bp). The use of a fluorescently-labeled DNA probe complete with diagnostic primers allows real-time detection of the accumulation of amplification products.

The optimization of the PCR was carried out using commercially available sets of reagents, devices and enzymes intended for mass use in laboratory practice, which allows quick and reliable application of this invention in medical and research laboratories.

The method of obtaining positive control samples

Positive control samples were obtained by cloning. Competent E. coli cells of the TOP 10 line (Invitrogen, USA) were transformed with recombinant plasmids pCR2.1 (Invitrogen, USA) carrying a virus-specific insert of artificially synthesized cDNA fragments. The presence of a viral genome-specific DNA insert was confirmed by sequencing.

The concentration of plasmid DNA was determined using a QUBIT fluorimeter (Invitrogen, USA) and Quant-iT DNA HS reagent kits. Fluorescence was measured using Rotor Gene 6000 instruments (Corbet), ABI Prizm 7000 and iQ5 BioRad (USA). The specificity of each of the obtained amplification fragments was confirmed by sequencing on a 3130x / Genetic Analyzer (Applied Biosystems, USA).

The analysis of the efficiency of the transformation was carried out by real-time PCR in accordance with the protocol described below, where a 1 × TE buffer containing a recombinant plasmid was added to the reaction mixture with the insertion of a virus-specific synthesized cDNA duplex. As a negative control, 1 × TE buffer was added to the reaction mixture.

Construction of an internal control sample

 As an internal control sample, protected double-stranded RNA of phage MS-2 was used. The pseudophage was obtained by cloning under T5 the phage promoter of the 370 bp fragment. phage MS-2 cDNA into pQE31 vector. Matrix RNA synthesis was induced by IPTG. Phage particles were purified by centrifugation.

The internal control sample (CTP) allows you to compensate for inhibition and control the processes of sample preparation and amplification, which provides a more accurate determination of RNA in each analyzed sample. EKO is a non-infectious protected RNA of the bacteriophage MS2 (concentration of 10 ⁵ copies of MS2 RNA / ml).

Isolation of virus-containing material from water samples.

A water sample was prepared by 1000-fold dilution of a clinical sample containing rotavirus in distilled and autoclaved water. Samples were filtered through a matched optimal filtration system. After that, elution from the membrane, RNA isolation, reverse transcription and real-time PCR were performed using the multiplex version of the test systems. The most convenient vacuum filtering system with a prefilter attachment (Sartorius, Germany) turned out to be the most convenient in operation, since it simultaneously allowed the bacterial component to be cut off from water samples (onto the first 0.22 μm filter) and the sorption of viral material onto an MMPA + -020-142 membrane (LLC NPP Technofilter, Russia). Membranes have increased sorption ability with respect to viruses, coliphages and pyrogens. Positive zeta-potential microporous polyamide membranes made on the basis of polyamide (Nylon-6 and Nylon-66). MMPA + membranes have a coarse-grained structure with thin microporous partitions, which determines the continuity of the membrane structure and provides strength and elasticity in a dry and moistened form. Due to their high porosity and controlled pore size, membranes have high microparticle retention efficiency at high filtration rates.

Viral RNA Extraction

Viral RNA was isolated from 100 μl of virus-containing liquid using the LITEX kit (Moscow) according to the manufacturer's instructions.

Reverse transcription reaction

The synthesis of complementary DNA (cDNA) was carried out on a total RNA matrix using the Revert-L reagent kit (FBUN TSNIIE, Moscow) according to the manufacturer's instructions.

Polymerase chain reaction

The amplification conditions were optimized by the concentration of magnesium ions, the concentration of primers and probes in the reaction mixture, and also by the annealing temperature of the primers.

The amplification reaction was carried out in 30 μl of a PCR mixture (Table 1) containing 1 × Taq amplification buffer, 2.5 mM MgCl ₂ , 0.17 mM each of the nucleoside triphosphates, 1.5 active units of Smart Taq DNA polymerase (all components of MEDIGEN Lab LLC ), 20 pM forward and reverse primers and 8 pM fluorescent DNA probe.

Table 1 PCR mixture (per tube) Component Volume μl PCR buffer × 10 3 dNTP (5 mm) one MgCl ₂ (50 mm) 1.5 Hot Start Taq DNA Polymerase 0.3 The mixture of direct primers - F (10 nm) 2 The mixture of reverse primers - R (10 nm) 2 A mixture of DNA probes - Z (15 nm) 0.5 Sample 3 diH ₂ O 16.7

Real-time PCR was performed according to the amplification program (table 2). The fluorescence intensity was detected through the channels - through the channels Green (FAM, 470 nm / 510 nm), Yellow (530 nm / 555 nm), Red (625 nm / 660 nm) and Orange (). Fluorescence was measured on a Rotor Gene 6000 instrument (Corbet Research, Australia) and iQ5 (BioRad, USA). The results were evaluated by the presence of fluorescence up to 30 cycles (Fig. 1-4).

table 2 Amplification program No. Operation T, ° C T, min: s one Hold / Activation of Smart-Taq-DNA Polymerase 95 05:00 2 Cycling 1 / Cycling 1 (10 cycles) 95 00:10 55 00:30 72 00:20 3 Cycling 2 / Cycling 2 (30 cycles) 95 00:10 55 00:30 detection 72 00:20

In a real-time PCR experiment, sequential tenfold dilutions of cDNA of enteroviruses, rhinoviruses, hepatitis A and E viruses from water samples were analyzed. In FIG. Figures 1–4 show real-time PCR analysis of samples.

In FIG. 1. presents the results of the analysis of samples for the content of rhinoviruses by real-time PCR using patented oligonucleotides, where:

1 - positive control sample (plasmid construct containing rhinovirus cDNA);

2 - rhinovirus cDNA, (1: 100 dilution);

3 - cDNA of rhinovirus, (dilution 1: 1000);

4 - cDNA of rhinovirus, (dilution 1: 10000);

5 - negative control sample (single TE buffer).

In FIG. 2. The results of analysis of samples for the content of enteroviruses by real-time PCR using patented oligonucleotides, where:

1 - positive control sample (plasmid construct containing enterovirus cDNA);

2 - enterovirus cDNA, (1: 100 dilution);

3 - enterovirus cDNA, (1: 1000 dilution);

4 - enterovirus cDNA, (dilution 1: 10000);

5 - negative control sample (single TE buffer).

In FIG. 3. presents the results of the analysis of samples for the content of hepatitis A virus by real-time PCR using patentable oligonucleotides, where:

1 - positive control sample (plasmid construct containing hepatitis A virus cDNA);

2 - hepatitis A virus cDNA, (1: 100 dilution);

3 - hepatitis A virus cDNA, (1: 1000 dilution);

4 - hepatitis A virus cDNA, (dilution 1: 10000);

5 - negative control sample (single TE buffer).

In FIG. 4. presents the results of the analysis of samples for the content of hepatitis E virus by real-time PCR using patentable oligonucleotides, where:

1 - positive control sample (plasmid construct containing hepatitis E virus cDNA);

2 - hepatitis E virus cDNA (1: 100 dilution);

3 - hepatitis E virus cDNA (dilution 1: 1000);

4 - hepatitis E virus cDNA (dilution 1: 10000);

5 - negative control sample (single TE buffer).

Thus, it follows from the foregoing that the claimed technical result is achieved, namely: a set of oligonucleotide primers and fluorescently-labeled probes have been developed that provide reliable detection of enteroviruses, rhinoviruses, hepatitis A and E viruses in water samples from the environment by the multiplex polymerase chain reaction.

In the framework of the claimed technical solution, the developed primers and DNA probes have a high degree of homology to all known nucleotide sequences of the genomes of RNA isolates of enteroviruses, rhinoviruses, hepatitis A and E viruses of humans, available in the GenBank international database of biotechnological information.

Claims (1)

A set of oligodeoxyribonucleotide primers and fluorescently-labeled DNA probes for the identification of RNA enteroviruses, rhinoviruses, hepatitis A and E viruses from an aqueous medium by the method of multiplex polymerase chain reaction and having the following structure:
To detect rhinovirus RNA:
forward (F1 and F2) and reverse (R1 and R2) primers:
F1: 5`-TA (A / G) ACCT (A / T / C / G) GCAGATG (A / G) GGC-3`
F2: 5`-TTAACCGT (A / C) A (A / T / C / G) CCGCCA-3`
R1: 5`-GAAACACGGACACCCAAAGTAG-3`
R2: 5`-ACCCAAAGTAGTCGGTCCC-3`
fluorescently-labeled DNA probes (Z1 and Z2):
Z1: FAM-CC (A / C) GCGTGGC (A / T / C / G) GCCTGC-BHQ1
Z2: FAM- (A / C) (A / T / C / G) AGCCTGCGTGGCGG-BHQ1
To detect RNA of all enteroviruses A, B, C, D and polioviruses:
- direct (F3) and reverse (R3) primers:
F3: 5`-CAAG (A / T / C / G) ACTTCTGTT (A / T / C / G) CC (A / C) CGGAC (A / T / C / G) GA-3`
R3: 5`-AT (A / T / C / G) T (A / T / C / G) TCAATTGTCA (A / T / C / G) CATAAGCAGCCA-3`
- fluorescently-labeled DNA probe (Z3):
Z3: ROX-CCT (A / T / C / G) GGC (A / T / C / G) CCTGA (A / T / C / G) GCGGCTAATCC-BHQ2
To detect hepatitis A virus RNA:
- direct (F4) and reverse (R4) primers:
F4: 5`-GTAGGCTACGGGTGAAACCTCTT-3 ′
R4: 5`-CGGCGTTGAATGGTTTTTTGT-3 ′
- fluorescently-labeled DNA probe (Z4):
Z4: R6G-AGGGTAACAGCGGCGGATATTGGTGAGT-BHQ2
To detect hepatitis E virus RNA:
- direct (F5) and reverse (R5) primers:
F5: 5`-CGGC (A / G) GTGGTTTCTGGGGTGAC-3 ′
R5: 5`-GGGGTTGGTTGGATGAATATAGGGG-3 ′
- fluorescently-labeled DNA probe (Z5):
Z5 Su5-TGATTCTCAGCCCTTCGCCCTCCCC-BHQ2

Images