RU2539733C2 - Set of differentiating nucleotides and biochip applicable in method for genetic typing of human y-chromosomes haplogroup markers: m130 (c), m145 (de) - Google Patents

Abstract

FIELD: medicine.

SUBSTANCE: group of inventions refers to genetics, molecular biology, forensic medicine and criminal science, and concerns an instrument for identifying human Y-chromosome haplogroups. The group of inventions is presented by a set of differentiating oligonucleotide probes, a biochip containing these probes, and a method for using the biochip for analysis. The biochip makes it possible to identify 10 haplogroups of human Y-chromosome. The haplogroup is identified by genetic typing of Y-chromosome by 10 markers: M130 (C), M145 (DE), P257 (G), M69 (H), U179 (I), M304 (J), M185 (L), M231 (N), M175 (O) and P224 (R) with the use of the biochip with the immobilised oligonucleotides a sequence of which is specified in table 1.

EFFECT: structure of the differentiating oligonucleotides used in each invention of the group enables providing binding them to complementary targets only, thereby providing a bright fluorescent signal in the respective biochip cells.

3 cl, 2 dwg, 1 tbl, 3 ex

Description

FIELD OF THE INVENTION

The invention relates to the field of genetics, molecular biology, forensic science and forensics and relates to a tool for determining haplogroups of the human Y-chromosome.

State of the art

The task of determining haplogroups of the Y chromosome is relevant both in the field of forensic medical examination to suggest the ethnicity of a criminal, and in the field of scientific studies of the settlement and migration of peoples. A number of methods are known for genotyping single-nucleotide DNA polymorphisms, which include SNP markers of haplogroups of the Y chromosome.

1. Analysis of length polymorphism of restriction enzyme fragments of DNA (RFLP analysis). As a result of mutations in the genomic DNA, new or previously existing restriction sites arise - the sites of restriction enzymes that break down the DNA chain. This, in turn, causes a change in the length of the resulting restriction enzyme fragments of DNA. The length distribution of the fragments is detected by agarose or polyacrylamide gel electrophoresis. The method is time-consuming, inefficient and not amenable to automation. These qualities, along with high demands on the quantity and preservation of the studied DNA, are the main disadvantages of the method that led to its disappearance from molecular biological practice. [Joseph T, Kusumakumary P, Chacko P, Abraham A, Radhakrishna Pillai M. Genetic polymorphism of CYP1A1, CYP2D6, GSTM1 and GSTT1 and susceptibility to acute lymphoblastic leukemia in Indian children. Pediatr Blood Cancer. 2004 Oct; 43 (5): 539-41.]

2. Sequencing of amplified DNA fragments, i.e. determination of an individual genetic code in a given DNA fragment. The most accurate and evidence-based method for analyzing individual genetic variations. The advantage is the high accuracy and sensitivity of the method, and the disadvantage is the high cost of equipment and analysis, which prevents the widespread introduction of the method in routine practice.

3. Detection of single nucleotide polymorphism by allele-specific PCR. Allelic variants differ due to the fact that the 3 'terminal nucleotide of one of the primers during the PCR hybridizes directly with the SNP position (i.e. if this primer is complementary to the DNA sequence, the product is amplified). The method requires moderate-cost equipment, but 2 wells of a plate will be required to analyze polymorphism at one locus. Those. to study 1 sample of ten markers of haplogroups, 20 holes of the plate will be required. Often, a sample from a crime scene may not have enough DNA to carry out so many reactions. The advantage of allele-specific PCR is the analysis time - only 3-4 hours. [Murata M, Shiraishi T, Fukutome K, Watanabe M, Nagao M, Kubota Y, Ito H, Kawamura J, Yatani R. Cytochrome P4501A1 and glutathione S-transferase M genotypes as risk factors for prostate cancer in Japan. Jpn J Clin Oncol. 1998 Nov; 28 (11): 657-60.]

4. Detection of single nucleotide polymorphism by hybridization of an amplified test sample with an oligonucleotide matrix. This method involves preliminary multiplex amplification of the studied DNA fragments using fluorescently labeled primers. The addition of excess labeled PCR primer results in the formation of a large amount of a predominantly labeled single chain product. This product is hybridized with oligonucleotide probes immobilized at a specific location on a solid substrate, or in gel microdrops attached to a substrate (this matrix of DNA probes is called a biological microchip or biochip). If the sequence of the analyzed DNA is completely complementary to the probe sequence, then a stable duplex is formed (a fluorescent signal is recorded), if the desired fragment is not there, or there is an incomplete base in it, then a stable duplex is not formed (the signal is significantly weakened or is not observed at all). The simplicity of the method, low cost and the possibility of using a fluorescent label makes it easy to automate the process. In addition, the method allows the use of multiplex PCR. Typically, with a good selection of PCR primers, up to 15 DNA loci can be amplified during a single reaction. This is a winning point, given the usually small amounts of DNA obtained from the crime scene. [Wen SY, Wang H, Sun OJ, Wang SQ. Rapid detection of the known SNPs ofCYP2C9 using oligonucleotide microarray. World J Gastroenterol. 2003 Jun; 9 (6): 1342-6.] An example of the implementation of this approach is described in the following work [Nasedkina TV, Fesenko DO, Mityaeva ON, Lysoe Yu.P., Barsky V.E., Zasedatelev A.S. (2007). A method for genetic identification of a person based on the analysis of a single nucleotide polymorphism of the human genome using an oligonucleotide biological microchip. Patent PCT / RU / 2007/000016, international application No. WO 2008088236], which proposes a tool that performs selective analysis of three genes and allows you to divide the entire population into 1350 groups.

The closest analogue of the present invention is the tool described in paragraph 4.

Disclosure of invention

The essence of the invention is to create a biochip (under the code name "Y-10"), in the cells of which original differentiating oligonucleotides are immobilized, selected in such a way as to specifically bind to the allele of the original or group-specific type. The use of the Y-10 biochip will allow genotyping of 10 markers of haplogroups of the Y chromosome: C, DE, G, H, I, J, L, N, O, and R.

Differentiating oligonucleotides (SEQ ID NO: 1-20) are immobilized in the cells of a hydrogel microchip, as described in the patent [Mirzabekov AD, Rubina A.Yu., Pankov SV, Perov AN, Chupeeva V.V. . A composition for immobilizing biological macromolecules in hydrogels, a method for preparing a composition, a biochip, a method for performing PCR on a biochip. RU 2206575 C2] at a concentration of 100-10000 pmol per 1 μl of gel, depending on the tasks of the researcher. The cell layout may be arbitrary; we used the circuit shown in Fig. 1. In the upper half of the biochip, cells with differentiating oligonucleotides of the initial type are deposited, and in the lower half, group-specific oligonucleotides. The fluorescent signal from the cells in the upper part indicates the initial genotype for this marker, the signal in the lower part indicates the belonging of the studied sample to the corresponding haplogroup. The analysis using the invention is carried out similarly to the method described in [Nasedkina T.V., Fesenko D.O., Mityaeva ON, Lysoe Yu.P., Barsky V.E., Zasedatelev A.S. (2007). A method for genetic identification of a person based on the analysis of a single nucleotide polymorphism of the human genome using an oligonucleotide biological microchip. Patent PCT / RU / 2007/000016, International Application No. WO 2008088236}. Based on the results of hybridization and washing, the obtained fluorescence pattern is analyzed, on the basis of which a conclusion is made about the genotype (haplogroup) in the test sample. An example of a hybridization pattern is shown in Fig.2.

Characteristics of the analyzed markers:

M130 is a marker of haplogroup C. It reaches a high concentration among the Mongols (up to 60%, as well as among the peoples related to them, Buryats, Kalmyks and Hazaras)

M145 is a marker of the DE haplogroup. It contains two subcomponents: haplogroup D and haplogroup E. It is quite widespread among the peoples of Russia and neighboring countries.

P257 - marker of the West Caucasian haplogroup G.

M69 is a marker of haplogroup N. Most common among gypsies, as well as among indigenous people of India,

U179 is a marker of haplogroup I. It occurs in almost 20% of the European population, is the only known "large" haplogroup that occurred in Europe.

M304 is a marker of haplogroup J. Subgroups of haplogroup J are J1 and J2. Haplogroup J1 (M267) - "West Asian" and "Middle Eastern", is most typical of the population of Eastern Anatolia. Distributed in the Caucasus.

M185 is a marker of haplogroup L. The origin of this haplogroup is associated with South Asia, with the west of the Indian subcontinent. Its carriers prevail in the same place. It is not common in Russia, but, nevertheless, it is enough to be included in the list of analyzed haplogroups.

M231 is a marker of haplogroup N. The haplogroup is found in Central, Northern Europe and everywhere in the European and Asian parts of Russia. The most genetically “pure” representatives are Yakuts, Udmurts (68%) and Finns (61%).

M175 is a marker of haplogroup O. It is characteristic of representatives of the Mongoloid race. A high concentration of carriers of this haplogroup is observed in the region of East and Southeast Asia among the Chinese, Japanese, Filipinos, Malays, as well as among neighboring peoples, which they influenced as a substrate. This haplogroup is completely absent in Europe, Africa, America and the Middle East.

P224 is a marker of haplogroup R. Most common in Europe, Western Eurasia, the Indian subcontinent.

The data obtained using the present invention can be used for search purposes (ethnicity, ethnic specificity of the surname), narrowing the circle of suspected persons, analyzing mixed samples of rape, determining the identity of ancient remains during research work.

Any biological materials containing genomic DNA can be used as samples for research: traces of blood, saliva, sweat, sperm, hair follicle, fingerprints containing particles of the epithelium, vaginal smear, bones, etc.

The main aspect of this invention is a set of differentiating oligonucleotides immobilized on a biochip and the sequence of which is shown in Table 1 and the List of sequences (SEQ ID NO: 1-20).

The implementation of the invention

The objective of the present invention is to create a biochip, which allows to determine 10 markers of haplogroups of the Y-chromosome: C, DE, G, H, I, J, L, N, O and R. The most important task in the implementation of this invention is to provide such a structure of differentiating oligonucleotide probes so that they only bind to fully complementary targets, providing a bright fluorescent signal in their corresponding biochip cells. At the same time, nonspecific binding should be minimized to eliminate false positive “triggering” of the cells. Due to the fact that the region of the polymorphic site is conservative (with the exception of the polymorphic nucleotide), paired probes (analyzing one single nucleotide polymorphic site) differ only in the internal nucleotide and are identical in flanks. In such a situation, it is necessary to vary the length of the flanking regions in order to ensure high specific and low non-specific binding of the studied target. Because At present, there are no exact thermodynamic methods for calculating the structure of the probe; the structure is selected empirically, by consistent selection and experimental verification. In the course of this work, such structures were chosen, and they are shown in Table 1 and the List of sequences (SEQ ID NO: 1-20).

Table 1 List of differentiating oligonucleotides immobilized on the Y-10 biochip. marker (haplogroup) SEQ ID NO: polymorphism 5'-3 'sequence title M130 (C) one from TTGGATTTCCCTGCCCAG C-M130_C 2 T TTGGATTTCTCTGCCCAG C-M130_T M145 (DE) 3 FROM GCTAAGGCTGGCTCTCGCCT DE-M145_C four T CTCTTGCCTTTCTTTCTGGTGT DE-M145_T M257 (G) 5 G CATTTCTGGTGGCCCAGAT G-M257_G 6 BUT CATTTCTGATGGCCCAGAT G-M257_A M69 (H) 7 T TCCTGAAATAAAATA H-M69_T 8 FROM ACTCCTGAAACAAAAAT H-M69_C U179 (I) 9 G ATGAAAGCCCAGGACC I-U179_G 10 BUT ATGAAAACCCAGGACCAG I-U179_A M304 (J) eleven BUT GTAACTTGTGAAACAACTGG J-M304_A 12 FROM AACTTGTGACACAACTGGTG J-M304_C M185 (L) 13 FROM GAGGCCGCATGGTCTTTACCAA L-M185_C fourteen T GAAGAGTCTGAGGCTGCATG L-M185_T M231 (N) fifteen G TCTACTGCTTTCAAATTGGG N-M231_G 16 BUT TCTACTGCTTTCGAATTGGG N-M231_A M175 (O) 17 TTSTS CTCACTTCTCTTCTCAAGAA O-M175_ + v eighteen del TTCTCACTTCTCAAGAATG O-M175_-v P224 (R) 19 FROM GAGTGTGACATCTTCCCCTGCT R-P224_C twenty T GTGTGACATCTTTCCCTGCTG R-P224_T

According to the structures shown in Table 1, the synthesis of differentiating oligonucleotides is performed. For fastening in a gel or on the surface — at the 5 ′ or 3 ′ end - anchor groups can be attached, providing immobilization, for example, NH ₂ . There are various chemical approaches to the synthesis of oligonucleotides, for example, the phosphodiester method, the hydrophosphoryl method, etc. but the most common is currently the phosphoramidite method. The synthesis of oligonucleotides is carried out using automatic DNA / RNA synthesizers, for example, manufactured by Applied Biosystems (USA). A wide range of groups can be used to modify immobilized oligonucleotides, such as an amino group, thiol, hydrazide, acrylamide group, benzaldehyde, thiophosphate, and the like. (Seliger H., Hinz M., Narr E, "Arrays of immobilized oligonucleotides - contributions to nucleic acids technology" Current Pharmaceutical Biotechnology, 2003, 4, 379-395). Modification of the oligonucleotide, with the aim of introducing an active group suitable for subsequent immobilization of the oligonucleotide on a biochip, can be carried out both automatically in the synthesis using a wide range of modifiers that are commercially available, for example, from Glen Research (USA), and postsynthetically in manual mode.

Biochips can be made by creating on the glass substrate surface a matrix of polyacrylamide gel cells, activating the cells and covalently immobilizing the modified oligonucleotides in the cells carrying active groups (Mirzabekov A. & Kolchinsky A. MAGIChip: Properties and applications in genomic studies. (2002) In Genomic Technologies: Present and Future. Eds. Galas DJ, SJMcCormack. Caister Academic Press, pp. 163-196). Biochips can also be made by chemically-induced or photo-induced copolymerization of an oligonucleotide in an acrylamide gel, as previously described (Vasiliskov, V., Timofeev E., Surzhikov S., Drobyshev, A., Shick, V. & Mirzabekov, A. 1999. Fabrication of microarray of gel-immobilized compounds on a chip by copolymerization. BioTechnique, 27, 592-606; Mirzabekov A.D., Rubina A.Yu., Pankov S.V., Chernov B.K. Patent for invention No. 2175972 "Method immobilization of oligonucleotides containing unsaturated groups in polymer hydrogels during microchip formation. ”Priority dated 12/28/1999). Biochips can also be made by any other methods known to a person skilled in the art (Seliger H., Hinz M., Narr E. "Arrays of immobilized oligonucleotides - contributions to nucleic acids technology" Current Pharmaceutical Biotechnology, 2003, 4, 379-395), and as a substrate, in addition to glass, another material can be used (plastic, metal, flexible membranes, etc.). Also, activated substrates commercially available from various manufacturers can be used for the manufacture of microchips (see, for example, Ramakrishnan R, Dorris D, Lublinsky A, Nguyen A, Domanus M, Prokhorova A, Gieser L, Touma E, Lockner R, Tata M , Zhu X, Patterson M, Shippy R, Sendera TJ, Mazumder A. 2002. An assessment of Motorola CodeLink microarray performance for gene expression profiling applications. Nucleic Acids Res. 30: e30).

For the manufacture of the biochip of the present invention using a set of oligonucleotides SEQ ID NO: 1-20, shown in the sequence List, as well as Table. 1. The location of the oligonucleotide probes on the biochip can vary and is determined only by the convenience for interpreting the results of hybridization.

The following is the sequence of analysis using this invention. A DNA sample is used as a template in a multiplex “nested” two-stage PCR using primers that specifically amplify Y-chromosome loci containing markers M130 (C), M145 (DE), P257 (G), M69 (H), U179 (I), M304 (J), M185 (L), M231 (N), M175 (O) and P224 (R). PCR primers are not an aspect of the present invention and can be selected and synthesized by a qualified researcher on their own. Labeling the PCR product in the second stage of PCR is carried out using primers carrying a fluorescent label at the 5'-end, or by incorporation of labeled triphosphates into the growing amplicon chain. Any fluorochrome can be used as a fluorescent label (for example, without limitation, FITC, Texas red, Su-3, Su-5, etc.), as well as biotin. At the second stage, multiplex “nested” PCR primers included in one pair are used in unequal amounts (the reverse primer predominates). This makes it possible to obtain a predominantly single-chain amplicon of the “-” chain, capable of hybridization with DCN probes.

Labeled PCR product is used for further hybridization on a biochip containing immobilized differentiating oligonucleotides. Before setting the hybridization, the amplicon is denatured by heating the finished hybridization mixture at 95 ° C for 5 minutes, followed by cooling in ice. Hybridization can be carried out in any hybridization buffer known to those skilled in the art, for example in an SSPE buffer or guanidine buffer. Typical hybridization conditions are 8-12 hours at 37 ° C. Washing can be carried out in any buffer known in the art with the addition of salt (SSC, SSPE, etc.) or in deionized water, for 10-15 minutes (JFSambrook and DW Russell, 2001, "Molecular cloning: a laboratory manual "Cold Spring Harbor Laboratory Press).

The analyzed DNA fragment forms perfect hybridization duplexes only with the corresponding oligonucleotides fully complementary to it. With all other oligonucleotides, the analyzed DNA fragment will form imperfect duplexes, the stability of which is significantly lower than the stability of perfect duplexes.

The hybridization pattern can be recorded using any detection system that recognizes a fluorescent signal (a fluorescence microscope with a CCD camera, a laser scanner or a portable biochip analyzer, available commercially from a large number of manufacturers, for example, a portable biochip analyzer, manufactured commercially by BIOCHIP-IMB LLC , and equipped with a recording device (CCD camera, video camera, camera)). Image analysis can be done both visually and automatically using a special program. Discrimination of perfect and imperfect duplexes is carried out after washing the biochip, comparing the fluorescence intensities of the corresponding cells of the biochip. The signal intensity in the case of the formation of a perfect duplex is higher than in the case of an imperfect one. Using the arrangement of oligonucleotides on the biochip, determine the genotype of the test sample.

Thus, using the Y-10 biochip, it is possible to genotyp a DNA sample using the markers M130 (C), M145 (DE), P257 (G), M69 (H), U179 (I), M304 (J), M185 ( L), M231 (N), M175 (O) and P224 (R).

The invention is further illustrated by examples that show the application of the rapid analysis method of genetic polymorphism. However, it should be understood that the examples provided are for illustration only and are not intended to limit the scope of the claims expressed in the claims. Based on the present description, a person skilled in the art will be able to easily propose their own variants and modifications of the invention without departing from the general concept of the present invention and without involving their own inventive activity, so it should be understood that such variants and modifications will also be included in the scope of the claims of this inventions.

Example 1. The manufacture of the biochip "Y-10".

Microchip immobilizing oligonucleotides are synthesized on a 394 DNA / RNA Synthesizer (Applied Biosystems, USA) using a standard phosphoamidite procedure. The 3 ′ end of the oligonucleotides contains a free amino group spacer, which is introduced into the oligonucleotide by synthesis using the 3′-Ammo-Modifier C7 CPG 500 (Glen Research, USA).

The addition of a fluorescent label to the free amino group oligonucleotides is carried out in accordance with the manufacturer's recommendations.

The biochip is made by copolymerization of an oligonucleotide in an acrylamide gel, as described previously (Patent for invention N 2175972 "Method for immobilization of oligonucleotides containing unsaturated groups in polymer hydrogels during microchip formation" Mirzabekov AD, Rubina A.Yu., Pankov S.V. ., Chernov B.K. Priority dated 12/28/1999). The biochip contains 20 types of oligonucleotides (SEQ ID NO: 1-20), a list of which is also presented in Table 1. The cells are applied according to the scheme in FIG. one.

Example 2. DNA research using a biochip "Y-10"

A DNA sample is isolated from a subject's saliva using the Qiagen kit. For amplification of all analyzed loci, a multiplex two-stage “nested” PCR with a set of locus-specific primers is used. PCR was performed on a MiniCycler instrument (MJ Research, Inc., USA) in a volume of 25 μl of the reaction mixture, composition: for the 1st stage: 1 × buffer (67 mm Tris-HCl, pH 8.6, 166 mm (NH ₄ ) ₂ SO ₄ , 0.01% Triton X-100), 1.5 mM MgCl ₂ , 0.2 mM of each of dNTP (Sileks, Russia), 1-5 rM of each of the primers of the 1st stage, 1 μl genomic DNA and 1.5 units Act. Taq polymerase (Sileks, Russia). DNA was denatured for 5 min at 94 ° C and in the first stage 35-45 amplification cycles were performed (94 ° C for 30 s, 60 ° C for 30 s, 72 ° C for 1 min), then 7 min at 72 ° C. The mixture of the second stage of PCR differs in the composition and concentration of primers: the upper primers are taken at a concentration of 1-5 pmol / μl, and the lower 5-50 pmol / μl. 2 μl of the product from the first stage is added to the mixture and amplified according to the scheme: 3.5 min 94 ° С, 34 cycles (94 ° С - 30 s, 62 ° С - 30 s, 72 ° С - 1 min), 7 min at 72 ° C. The mixture also contains 0.01 mm Cy5-dUTP. The lower primers of the 2nd stage are pre-labeled at the 5 'end with a Su5 fluorescent dye (exc./sp.: 640/657 nm). After PCR, the contents of the tube are used for hybridization on a biochip in a buffer of the following composition: 25% formamide (Gibco BRL), 5 × SSPE. Before hybridization, the finished hybridization mixture was denatured at 95 ° C for 5 min, cooled in ice, 2 min, and introduced into the biochip hybridization chamber (30 μl). Hybridization is carried out for 8-12 hours at a temperature of 37 ° C. Washing is carried out in 1 × SSPE buffer at room temperature for 10 minutes.

Example 3. Registration and interpretation of the results of hybridization.

The hybridization pattern is recorded using a portable biochip analyzer equipped with a CCD camera manufactured by BIOCHIP-IMB LLC. The image is recorded as a file with the extension .spe and can be converted to other graphic formats, such as .jpg, .jpeg, .tiff and so on.

We will determine the genotype by the hybridization pattern shown in Figure 2. For all markers except Ml 75 (haplogroup marker O, column 9 on the left), cells with differentiating oligonucleotides of the original type (upper rows) fluoresce, and for Ml 75 the upper cells of the original type do not give a signal, and the lower ones, group-specific, fluoresce, which indicates that the sample belongs to the Y-chromosome haplogroup O.

Claims (3)

1. A set of differentiating oligonucleotides for genotyping markers of 10 haplogroups (C, DE, G, H, I, J, L, N, O and R) of the human Y chromosome M130, M145, P257, M69, U179, M304, M185, M231 , M175, P224, the sequence of which is defined in Table 1. 2. Biochip for genotyping markers of 10 haplogroups (C, DE, G, H, I, J, L, N, O and R) of the human Y chromosome M130, M145, P257, M69, U179, M304, M185, M231, M175 , P224, containing the set of immobilized oligonucleotides described in claim 1. 3. A method for genotyping markers of 10 haplogroups (C, DE, G, H, I, J, L, N, O and R) of the human Y chromosome M130, M145, P257, M69, U179, M304, M185, M231, M175, P224, involving the use of a biochip, characterized in claim 2, and including the amplification of human DNA loci containing the above markers, and hybridization of amplicons with oligonucleotides immobilized on the biochip, characterized in claim 2.

Images