WO2008059578A1

WO2008059578A1 - Multiplex pcr method

Info

Publication number: WO2008059578A1
Application number: PCT/JP2006/322898
Authority: WO
Inventors: Tetsuya Tanabe; Nobuhiko Morimoto
Original assignee: Olympus Corporation
Priority date: 2006-11-16
Filing date: 2006-11-16
Publication date: 2008-05-22

Abstract

It is intended to provide a PCR amplification method which is a multiplex PCR method characterized by comprising using a primer of 32 bases or more in length, conducting annealing at a temperature lower than the Tm value of the above-described primer, and performing an extension reaction over a long period of time of 1 minute to 10 minutes.

Description

Specification

Multiplex PCR method

Technical field

[0001] The present invention relates to a multiplex PCR method.

Background art

[0002] The multiplex typing method has been proposed in the late 90s to meet the recent demands for lowering genotyping costs and higher throughput. For example, a microarray for SNP detection of cytochrome P450 protein from Roche is also more complex and more flexible in detection than a multiplex method in terms of reaction and detection in a single reaction vessel. A method is proposed.

[0003] This method is widely used for genetic diagnosis and the like. For example, in SNP analysis using a DNA computer, gene analysis is multiplexed using DCN. If the PCR that cuts around the SNP could be multiplexed in the same way, it would be desirable in terms of cost and work efficiency.

[0004] The key to such a multiplex typing method is an artificial sequence called a DNA tag, a reaction that converts a natural gene sequence into an artificial sequence, a probe shape for the reaction, and a DNA tag. It is the identification detection technology. Since multiple genes are converted into DNA tags in a one-to-one correspondence within the same solution and detected, each DNA tag does not cross-hybridize with each other so that it reacts independently. It is designed to have the same reaction force and melting temperature (Tm). Unlike microarrays, in which gene sequences themselves are probed using a detection device, they can be freely associated with genes, and if the same DNA tag is always detected at the detection stage, the same detection is possible even if the target gene changes. Since the method and detection device can be used, there is flexibility. Immediate design and optimization of the amount is of utmost importance and requires more care than PCR using a single strand and primer pair. In the multiplex PCR method used so far, the design guideline is 300 bases in product length as described in Patent Documents 1 and 2. Many papers have written that it should be in front and back and that the primer length should be between 18 and 30 bases. Thus, primer design for conventional multiplex PCR methods has been considered appropriate to meet the following criteria:

(1) PCR product length force Set the primer spacing so that it is relatively short, about ¾00 base pairs.

(2) Primers should be designed with a length of up to about 30 bases, which is inconvenient to synthesize.

(3) When amplifying the human genome, etc., investigate and select for homologous sites with BLAST etc. so that the specificity of the primer is as high as possible.

It was very difficult to design primer sequences that met these criteria for all saddle types. That is, because the product length is limited and the primer length is limited, the degree of freedom in selecting an appropriate primer is limited. Due to this limitation of primer selection, it was often impossible to obtain PCR products for all types of molds in a single design. -Even if you design primers for the multiplex PCR method, if you cannot obtain PCR products for all types, it will be necessary to re-select them over and over again. The primer design for the method was very difficult.

[0006] Various attempts have been made for multiplex PCR so far, such as adding DMSO, changing the KC1 concentration, and changing the primer concentration depending on the Tm of the primer. Forces Used Even when using a primer set that operates in a single plex, the multiplex PCR method often failed and the success rate of primer design was low. In addition, special proteins and additives had to be added to make the multiplex PCR method successful.

Disclosure of the invention

[0007] In view of the above circumstances, an object of the present invention is to provide an efficient multiplex PCR method in which primer design is easy and the certainty of obtaining an amplification product is high.

[0008] The present inventors predicted that the cause of failure of the multiplex PCR method was cross-hybridization and variation in amplification efficiency. In conventional primer design, the cross hive The focus was on suppression of redization, and variations in amplification efficiency were not considered. Therefore, focusing on this point, it is assumed that the main cause of "variation in amplification efficiency" is "variation in primer efficiency and irregularization efficiency", and a multiplex that suppresses variation in amplification efficiency. An attempt was made to design PCR primers.

[0009] Specifically, a new multiplex PCR method was developed with the following two important points to be considered in the primer design of the multiplex PCR method:

1. Suppression of cross-hybridization, ie improvement of primer specificity;

2. Uniform amplification efficiency, that is, improving the efficiency of primer-type hybridization.

[0010] That is, the present invention is a multiplex PCR method,

At the position of the primer that produces an amplification product with a length of 1000 bases or less,

Using primers with a length of 30 bases or more,

Annealing at the highest temperature among the temperatures at which the hybridization efficiency of each primer is 90% or more,

Annealing at least once in a thermal cycle, 3 min. To 10 min.Including extension reaction, or annealing.Extension reaction time is extended to 3 min. To 10 min in the last thermal cycle according to the cycle. And

A multiplex PCR method is provided.

[0011] Further, the present invention is the method described above,

Mixing the primer and target DNA strand and heat denaturing;

Annealing the primer to the template at a temperature lower than the Tm value of the primer;

At least once in the thermal cycle, 3 minutes to 10 minutes of annealing-extension reaction, or annealing-extension reaction time is extended from 3 minutes to 10 minutes in the last thermal cycle according to the cycle To synthesize the complementary DNA,

A PCR amplification method comprising the steps of:

[0012] Furthermore, the method described above, The primer provides a method that is 30-60 bases in length.

[0013] Further, the method described above,

The primer provides a method that is 32-50 bases in length.

[0014] Further, the method described above,

The primer provides a method that is 35-45 bases in length.

[0015] Further, the method described above,

The annealing / extension reaction provides a method that is performed to include at least one or more annealing period of 4 minutes or more during the thermal cycle.

[0016] Further, the method described above,

The annealing / elongation reaction provides a method in which at least one annealing cycle of 6 to 10 minutes is performed in the thermal cycle.

[0017] Further, the method described above,

The annealing temperature is based on the evaluation value (Q-Score) predicted by Visual OMP (DNA Software)! /, And the hybridization efficiency and prediction of an evaluation value (Q-Score) of 850 or more A method is provided that is less than or equal to the Tm of the primer to be produced.

Brief Description of Drawings

[0018] FIG. 1A is a graph showing a prediction result of hybridization efficiency.

FIG. 1B is a graph showing a prediction result of hybridization efficiency.

[FIG. 2] FIG. 2 is an electrophoretogram showing the PCR results in a single plex.

FIG. 3 is an electrophoretogram showing the results of annealing temperature examination.

[FIG. 4] FIG. 4 is an electrophoretogram showing the results of examining the primer concentration.

[FIG. 5] FIG. 5 is an electrophoretogram showing the results of examination of the enzyme DMSO concentration.

FIG. 6 is an electrophoretogram showing the results of thermal cycle studies.

FIG. 7 is a schematic diagram showing an outline of a method used in Examples.

FIG. 8 is a scatter plot of array detection intensity showing the typing results for each SNP using the method of the present invention.

FIG. 9 is a scatter plot of array detection intensity showing the typing results for each SNP using the method of the present invention. [FIG. 10] FIG. 10 is a scatter diagram of array detection intensities showing typing results for each SNP using the method of the present invention.

[FIG. 11] FIG. 11 is a diagram showing definitions of SNP typing results and QV values.

BEST MODE FOR CARRYING OUT THE INVENTION

Hereinafter, the multiplex PCR method of the present invention will be described in detail.

[0020] The multiplex PCR method of the present invention is characterized in that a primer longer than the primer length (for example, less than 30 bases) as in general common sense in ordinary PCR is used. It is considered that such primer design can make the primer hybridization efficiency uniform. At the same time, the primer specificity can be increased by designing the primer length longer. Therefore, even for a sample mixed with a long base such as 1000 bases, a multiplex PCR product can be obtained specifically by making the annealing efficiency uniform. In addition, even for a sample containing many complex or similar sequences such as the human genome, it is thought that the target product can be specifically amplified with the same amplification efficiency.

[0021] The length of the primer used in the multiplex PCR method of the present invention needs to be long enough to avoid cross-hybridization, and is longer than the range of general common sense. The length of the primer is, for example, about 30 to 60 bases, preferably about 32 to 50 bases, and more preferably about 35 to 45 bases. For such a long primer design, the Tm value of a normal primer is usually higher than that of a short primer.

[0022] In addition, the primers used in the multiplex PCR method of the present invention can be designed with various sequences depending on the vertical sequence to be amplified. Previously, the primers used in the multiplex PCR method had to be designed so that the PCR product could be up to 300 bases or the length of the amplified product would be the same. The length of is not limited. Therefore, the selection range of primer design is increased, and it is possible to design a primer set that was impossible with the conventional multiplex PCR method.

[0023] As shown in the following examples, for example, the primer predicts the secondary structure of the cage and the primer, makes the hybridization efficiency uniform, and provides a multiplex PCR product. Can design a rimer. Such design, secondary structure prediction, and calculation of high hybridization efficiency can be performed using, for example, Visual OMP (DNA Software). In order to achieve a hybridization efficiency of nearly 100% for all primers, the optimal sequence can be selected by setting the design parameters as follows: primer length 30-45mer; primer design Tm 70 ° C to 100 ° C. Other design parameters can be determined based on the results of analyzing the correlation between primer design parameters and PCR. In addition to the design method described above, those skilled in the art will be able to easily design a primer having the long sequence as described above and capable of amplifying a desired saddle type.

Next, a target nucleic acid amplification step is performed using the above primers.

[0025] Here, as used herein, "nucleic acid" means all DNA and RNA including cDNA, genomic DNA, synthetic DNA, mRNA, total RNA, hnRNA, and synthetic RNA. . The target nucleic acid to be detected or quantified can be any nucleic acid having an arbitrary sequence, but a nucleic acid that can serve as a disease marker, such as a gene causing a disease, a cancer-related gene, or a nucleic acid derived from a virus, Preferred target nucleic acids. Therefore, the sample includes body fluids such as blood, urine and saliva, but any sample other than body fluids can be used. If the sample is solid, it may be dissolved in the liquid by an appropriate method such as enzyme treatment, addition of a surfactant or organic solvent. In addition to the above, the target nucleic acid can be arbitrarily changed in carrying out this method. For example, by preparing a large amount of human genomic DNA necessary for this method by culturing cells in large quantities and culturing them in large quantities, or by obtaining a large amount of peripheral blood, the genomic DNA force detection reaction can be started directly. Alternatively, a small amount of genomic DNA is obtained, and a detection reaction is detected from a sample that has amplified genomic DNA nonspecifically using the WGA method (Whole Genome Amplification) such as the reagent kit GenomiPhi of Amersham Biosciences. You may start. Alternatively, the detection reaction may be started from the amplification of a specific sequence using primers such as PCR, multiplex PCR, and asymmetric PCR. In particular, when the method of the present invention is used for detecting an SNP-specific sequence, the target nucleic acid is assumed to be genomic DNA or the like. It may be amplified by such as. Depending on other enzymatic amplification methods In the case of a double-stranded sample, the obtained sample is heated to 95 ° C and rapidly cooled to 4 ° C to form a single strand, or heated to 95 ° C in a solution with a very low salt concentration. Then, after performing fragmentation operations such as single-strand and fragmentation, such as fragmentation with ultrasound, fragmentation with restriction enzymes, and cleavage with restriction enzymes, perform detection.

[0026] In the target nucleic acid amplification step, first, the primer, the target nucleic acid, and an appropriate reaction solution are mixed and thermally denatured. This step may be performed using general PCR conditions. For example, it is preferable to perform denaturation by heating at 94 ° C for 2 minutes before each cycle, and at 94 ° C for 30 seconds as the denaturation step for each cycle.

[0027] As a reaction solution used in the amplification step, a general PCR reaction solution can be used, and a commercially available kit can also be used. For example, as shown in the following examples, enzyme: AccuPnme II (Invitrogen), noffer ~~: AccuPnme II master mix, filma ~~ 0.1 μΜ each, vertical DNA: 5 ng, reaction volume: 20 L be able to.

[0028] Next, a primer is annealed to the single-stranded nucleic acid generated by heat denaturation. The multiplex PCR method of the present invention is characterized by annealing at a temperature relatively lower than the Tm value of the primer designed as described above. In particular, it is preferable to perform annealing at a temperature that is significantly lower than conventionally considered. Thereby, the hybridization efficiency is increased, and it is considered that the hybridization efficiency of the probe can be increased for any of the saddle types. Therefore, in the conventional multiplex PCR method, fragments that have not been amplified can be amplified, and the amplification efficiency is increased.

[0029] The Tm value of a primer is a Tm value predicted by a method well known in the art, and is a Tm value predicted by, for example, Visual OMP (DNA Software). In addition, since the primer used in the multiplex PCR method of the present invention is long, the temperature is significantly lower than the Tm value of the primer even at a relatively high annealing temperature. Usually, if the annealing temperature is lowered too much, nonspecific annealing of the primer is likely to occur, and the amplification of the target sequence is inhibited by nonspecific amplification, but the primer used in the present invention is more than the conventional primer. It is considered that amplification efficiency is good because of sufficient forex annealing efficiency. For example, even in the primer used in the following examples, even at the lowest Tm, the annealing temperature is 68. Even at ° c, the temperature is sufficiently low.

[0030] Next, a complementary strand is synthesized by a polymerase. The multiplex PCR method of the present invention is characterized in that an extension reaction is performed for a longer time compared to a normal extension time. The extension reaction is, for example, 3 minutes, 4 minutes, 5 minutes, and 6 minutes to less than 10 minutes, 5 minutes to less than 8 minutes, preferably about 6 minutes. Therefore, it is preferable that the enzyme used in the multiplex PCR method of the present invention has long-lasting activity. In addition, since the primer used in the multiplex PCR method of the present invention is long in length, it has a relatively high annealing temperature. Therefore, when annealing is performed, the temperature may reach a temperature at which the extension reaction proceeds. In such a case, it is also possible to use shuttle PCR, in which both the annealing temperature and the extension reaction temperature are the same, so that both proceed simultaneously.

[0031] Thus, since the multiplex PCR method of the present invention has a long extension time, the amplification reaction can sufficiently proceed even if the amplification product is long. Therefore, even if the length of the amplification product is not the same as in the conventional multiplex PCR method, according to the multiplex status PCR method of the present invention, all the different amplification products can be amplified uniformly.

[0032] As described above, the multiplex PCR method of the present invention uses a primer longer than the length of the primer (eg, less than 30 bases) as in common general knowledge in normal PCR, and normal extension. The reaction can be performed in the same process as the conventional PCR method, without being limited to the above-described step, except that the extension reaction is performed for a longer time compared to the time. For example, the step of heat denaturing a DNA strand and the step of synthesizing a complementary strand with a polymerase can be carried out under general reaction conditions depending on the type to be amplified. The reaction conditions to be considered include, for example, the temperature and time of each step, the composition of the reaction solution, the concentration of constituents, and the like. Moreover, the reaction conditions used can be those according to the seller's instructions if a commercially available enzyme is used. Those skilled in the art can easily select the temperature and time, conditions of the reaction mixture, the concentration of the components, etc., excluding the conditions peculiar to the multiplex PCR method of the present invention described above. Let's go.

[0033] As embodiments of the present invention, the following modes are conceivable. In particular, the following can be considered as uses and places of the detection method of the present invention. For example, the relationship between human genotype and disease There are research applications such as detection of drug sensitivity, detection of protein binding changes in the gene regulatory region, and molecular biological analysis of gene polymorphisms when the target organism is changed from human to another. These studies will be conducted in research institutes and laboratories such as universities and companies. In addition, when the relationship between the gene and a specific disease, risk of morbidity, and drug sensitivity are identified, testing to select treatment methods at the hospital's laboratory center and prevention at the clinical dock It can be used for medical purposes such as diagnosis and drug sensitivity testing for the selection of anticancer drugs with small side effects.

[0034] As a mode for carrying out the method of the present invention, the user himself / herself carries out as a genetic polymorphism detection reagent kit for research and diagnosis for carrying out the method, and by an automatic reaction apparatus that automatically processes the method. It is possible to conduct a contract research on behalf of the subject or a diagnosis at a laboratory.

[0035] Hereinafter, the examination of conditions and analysis results for performing the multiplex PCR method of the present invention will be described by taking the multiplex PCR method as an example for performing SNP typing.

Example

[0036] Example 1: Examination of SNP sequence amplification by multiplex PCR method

(1) SNP base sequence to be detected

The SNP base sequence to be detected was obtained from the Japanese SNP database JSNP (http://snp.ims.u-tokyo.ac.jp/indexja.html) maintained by the Institute of Medical Science, the University of Tokyo. . The respective accession numbers are IMS-JST164838 (SNP # 3), IMS-JST058048 (SNP # 4), IMS-JS T005689 (SNP # 5), IMS-JST054229 (SNP # 6), IMS-JST001164 (SNP # 7) ), IMS-JST017 558 (SNP # 8), IMS-JSTl 75404 (SNP # 9), IMS-JST054214 (SNP # 10), IMS-JST011815 (SNP # 11), IMS-JST156026 (SNP # 12) A total of 10 SNPs. Hereafter, since the name is long, it will be written with an abbreviated number in 0. The detected sample was distributed by the Human Science Research Resource Bank (http://www.jhsf.or.jp/bank/psc.html)!/, and human peripheral blood cells were stocked. This is the extracted human genomic DNA. The purchased samples were PSCDA0503, PSCDA0328, PSCDA0719, PSCDA0785, PS CDA0415, PSCDA0716, PSCDA0693, PSCDA0117. In the following, they will be called the numbers 503, 328, 719, 785, 415, 716, 693, 117 respectively. 1] Table 1 (1) Target SNP alleles

[Table 2]

[0037] Table 2 shows the results of sequencing the samples using the Sanger method. For this sequencing, we used the PRISM 3100 Genetic Analyzer from Applied Biosystems, and each of them using the Mitsui Information Development's sequencer output waveform analysis software wave flat. The SNP allele was determined. Hereinafter, the method of processing each genomic sample will be described in detail.

[0038] (2) Primer design Bu designed as follows.

[0039] In recent years, it has become possible to predict secondary structures with high accuracy by the development of computers and the determination of thermodynamic parameters of DNA. Therefore, we designed a primer for multiplex RPCR that made the hybridization efficiency uniform and predicted the secondary structure of the template and primer.

[0040] Visual OMP (DNA Software) was used for calculation of hybridization efficiency and secondary structure prediction. This software can calculate the hybridization efficiency of DNA by inputting DNA concentration, solution salt concentration, humidity, etc. When various parameters were tested, the hybridization efficiency at the PCR primer concentration in the PCR buffer was 30 to 40 mer primer length in order to make this value 100% for all primers. Primer design It was a force to calculate as Tm70 ~ 100 ° C. In the selection by the above Visual OMP, secondary structure prediction is also performed on other design parameters, primers, and the template to be hybridized with the primer, and in particular, the selected primer sequence is predicted to be truly hybridized and more difficult. Primer sequences that have stable intramolecular structure and high hybridization efficiency were selected.

[0041] Fig. 1 shows the design results related to hybridization efficiency, which is an important guideline for the above-mentioned multiplex PCR primer design. In the MTL series with longer primer lengths, hybridization efficiency was expected to be close to 100% at any SNP site (Figure 1 and Table 3).

[Table 3]

键薩

ST '' εοΊ1Ν906 2.

. ϋ 9 inch. ". ο ϋ 59 / · lls.

1 ο ϋ 8Ό∞ Mountain 926 8.

. ϋ 68Ζ-.

ο ϋ 6S 卜 .NV826 6 ..

cO L Lo m t L r ^ o c o sJ to cM m csi m cD in m oo

Dimension Dimension Dimension w SN3 Dimension Dimension

Mountain c c. . L Kenting 6 inch 1NV.

. VF

2 9.

. S 〇 T I

. 628 9S92906 21 ..

[0042] (3) Results of examination of multiplex PCR conditions

We examined conditions regarding annealing temperature, primer concentration, enzyme system, and thermal cycle, and searched for optimal multiplex PCR conditions. As a result, amplification products were observed up to 8/10 SNPs, and there were no SNPs clearly amplified. The optimized reaction conditions are shown below.

[0043] 3.1. Conditional examination results

1.PCR conditions (current optimization conditions)

Solution conditions Enzyme: AccuPrime II (Invitrogen)

Noffa ~~: AccuPrime II master mix

0.1 μ それぞれ each primer

Vertical DNA: 5ng

Reaction volume: 20 μL

2.Therma no Cycling

Preheating: 94 ° C 2 min

Denaturation: 94 ° C 0.5 min

Annealing and stretching: 68 ° C 6 min

Number of cycles: 40

Storage: 10 ° C

3.2 Condition review process

The condition examination process is shown. The condition study proceeded in the following order:

1. PCR in a single plex

2. Annealing temperature study

3. Primer concentration study

4. Enzyme '' DMSO concentration study

5. Thermal cycle study

First, PCR was performed using a single plex, and it was confirmed that the primer was working. The result is shown in figure 2. Although amplification was confirmed in all 10 SNP sites, multiplex PCR was not possible under the same PCR conditions.

[0044] Next, in order to examine the annealing temperature, all 20 types of primers were added, and a temperature gradient was applied in the range of 60 ° C to 70 ° C to examine the optimum annealing temperature. The results are shown in Figure 3. Even though the annealing temperature was changed, the change in the electrophoretic image was scarce. The optimum temperature was 67.5 ° C. Since the primer chain length is 30 to 45 bases and Tm is 70 ° C or more, it seems that the experiment in the range of 60 to 70 ° C showed no change.

[0045] DMSO was also added at the same time. Amplification is improved by adding DMSO. There was a part where the amplification weakened with the addition of DMSNO, and it became clear that uniform amplification could not be obtained with DMSO. Figure 3 shows the results of the annealing temperature study.

[0046] Further, optimum conditions were searched for by varying the primer concentration in the range of 0.1 to 0.4 / ζ M. As a result, uniform and strong amplification was observed at 0.1 μΜ (Fig. 4).

[0047] The result of the PCR reaction is greatly affected by the enzyme system. Therefore, the reaction was carried out using four types of enzymes, AmpliTaq Gold Master Mix (ABI), AccuPrime Super Mix I / II (Invitrogen), and HotStar Taq (Qiagen), and compared. In the AmpliTaq Gold Master Mix system, the effect was confirmed by changing the DMSO concentration at the same time. The results are shown in FIG.

[0048] The enzyme system that showed the best results was AccuPrime Super Mix IV / Ι, and AccuPrime Super Mix II, which produced a large amount of long-chain products, was optimized. In other enzyme systems, AmpliTaq Go Id Master Mix did not give a uniform amplification result even when DMSO with a small amount of amplification was added. In addition, HotStar Taq lacked a band around 450 bases that gave strong amplification results, and was unable to amplify all sites.

[0049] Finally, thermal cycle was examined using AccuPrime Super Mix II. Since the annealing temperature of 67.5 ° C is close to the optimal extension temperature of AccuPrime Super Mix, 68 ° C, we decided to perform a 68 ° C shuttle PCR and examined the extension reaction time. The results are shown in Fig. 6.

[0050] It was found that when the extension time was sufficiently long using shuttle PCR, amplification was performed uniformly and strongly. Therefore, the extension time was determined to be 6 minutes, which is considered to be a sufficiently long extension time. Seven bands were visible on electrophoresis, and up to eight bands could be observed on the bioanalyzer. Forces with unresolved peaks Clearly unamplified SNPs are gone. (Resolution head

(The value is ± 5% for 100 to 500bp, ± 10% for 500 to 1000bp)

(4) Conclusion of study

• Installation of multiplex PCR primers for 10SNP analysis using DNA computer technology

The total was successful. 'Hybridization efficiency is uniformized by using primers with long chain length (30-45b)

It became clear that it was possible to plan.

'Multiplex PCR primer design requires uniform hybridization efficiency

It was suggested to be effective.

[0051] Example 2: SNP detection using multiplex PCR

Hereinafter, the details of an example in which a region containing SNP is amplified from genomic DNA using the multiplex PCR method of the present invention and the SNP is detected using DNA computer technology will be described in detail.

[0052] Here, an outline of a method for detecting SNPs using DNA computer technology will be described with reference to FIG. This analysis method requires the following molecules. Therefore, the following molecules are prepared prior to this analysis. The preparation can be performed by a method known per se.

[0053] Two probes shown in Fig. 1 are prepared to detect the target nucleic acid contained in the solution.

One is a common probe of an oligonucleotide containing a sequence complementary to a partial sequence (partial sequence) of a target nucleic acid and labeled with 3 'end such as piotin. The label of the above-mentioned common probe may be any substance that can specifically bind to a specific substance such as piotin or an antibody that is not limited to piotin (for example, in the case of piotin, it is specific to streptavidin. Can be combined).

[0054] The other oligonucleotide has an artificially designed tag with a base sequence force of SD, D1 and ED at the 5 'end, is complementary to the sequence of a part of the target nucleic acid, and is A query probe having a sequence adjacent to the sequence complementary to the probe target.

Including at the 3 'end. The probe is referred to herein as a tag nucleic acid. In addition, the artificially designed base sequence is arranged on the 5 ′ end side with respect to the complementary sequence. In addition, the 5 'end of the sequence complementary to the target cDNA of the above common probe is phosphated. In addition, the tag portion and the query probe portion of the tag nucleic acid may be oligonucleotides that are partially or entirely in a stranded state. At this time, construct a double-stranded oligonucleotide. The other strand formed is an oligonucleotide with a sequence complementary to the sequence of SD, _01Ί and ED. The query probe portion and the common probe of the tag nucleic acid can be arbitrarily designed for each target gene that has been detected to be present or absent in the solution. At this time, the D1 sequence is designed to be different for each target, and SD and ED are designed to be common to all tag nucleic acids. Since these artificial arrays can be designed arbitrarily, it is possible to set a desired Tm value. Therefore, it is possible to carry out a reaction that is stable and has little mishybridization. For example, it is preferable to use an orthonormalized array as the artificial array. An orthonormalized sequence is a sequence of nucleic acid molecules having a uniform Tm value, that is, a sequence designed so that the Tm values are aligned within a certain range, and the nucleic acid molecule itself is within the molecule. (Intramolecular) is a sequence that does not inhibit hybridization with a complementary sequence, and a base sequence that does not form a stable hybrid other than a complementary base sequence. means. That is, a sequence included in one orthonormalized sequence group hardly reacts between sequences other than the desired combination and within a self-sequence, or does not generate a reaction. In addition, when the orthonormalized sequence is amplified by PCR, the amount corresponding to the initial amount of the nucleic acid molecule having the orthonormalized sequence is not affected by the problems such as the above-mentioned crossnodification and hybridization. This nucleic acid molecule has the property of being amplified quantitatively. The above orthonormalized sequence is described in detail in H. Yshida and A Suyama, "Solution to 3—SAT by breadth first search", DIMACS Vol.54 9-20 (2 000) and Japanese Patent Application 2003-108126. Is described. Orthonormalized sequences can be designed using the methods described in these references. In brief, a plurality of base sequences are randomly generated in advance, an average value of their melting temperatures is obtained, and candidate sequences are obtained based on a threshold value limited by ± t ° C of the average value. And a method for preparing an orthonormalized sequence group from a candidate sequence obtained using whether or not the sequence reacts independently as an index.

[0055] In addition to the nucleic acid, a primer 1 having the same sequence as the SD sequence and a primer having a sequence complementary to the ED sequence labeled at the 5 'end are required.

[0056] In the first step of the present method, a sample for detecting or quantifying the presence of the target nucleic acid, and a tag nucleic acid And the common probe are mixed, and the target nucleic acid is hybridized with the query probe portion of the tag nucleic acid and the common probe.

[0057] The second step of the present method is a step of linking a query probe portion of a tag nucleic acid hybridized to each corresponding target nucleic acid and a common probe. When hybridization is performed, the query probe portion and the common probe bind to the corresponding target nucleic acid, so that the ligation reaction is performed by ligase or the like, so that the query probe portion and the common probe are connected via the linking portion. Can be connected.

[0058] In the third step, the linked tag nucleic acid and common probe are recovered. For example, when the common probe is labeled with piotin, the linked oligonucleotide can be extracted via the piotin label of the common probe by using magnetic beads with streptavidin bound to the surface.

[0059] In the fourth step, the linked tag nucleic acid and common probe are dissociated from the corresponding target nucleic acid. By this operation, if the target nucleic acid is present in the first solution, an oligonucleotide containing the corresponding Dl_sequence is extracted.

[0060] Subsequently, in a fifth step, an amplification reaction is performed using an amplification method that yields a single-stranded amplification product, with the tag portion of the dissociated linking oligonucleotide as a template.

[0061] Next, in the sixth step, the amplified tag portion is detected.

Specifically, typing according to the method of the present invention was performed according to the following procedure.

[0063] (1) Amplification of genomic DNA

(2) Encoding reaction (including common probe, tag nucleic acid, and target nucleic acid are mixed and made into a hybrid, producing a linked oligonucleotide of tag nucleic acid and common probe, and recovering the linked oligonucleotide )

(3) Amplification reaction

(4) Detection

(l) Amplification of SNP region

In the detection of the Examples, first, a region containing the target SNP was amplified from 5 ng of genomic DNA by multiplex PCR. This operation was performed according to the following procedure.

[0064] As a master mix, 50 reaction solutions were prepared for the solution used in this PCR reaction. The yarn composition is as follows, and the primer sequences are as shown in Table 4, 4]

[0065] AccuPrime Super Mix II, a product of Invitrogen, was used as the reaction solution.

[0066] AccuPrime SuperMix II (Invitrogen) 500 μ 1

10 forward primers (50 μΜ each) each

10 reverse primers (50 μΜ each) each

Total 540 1

Add 5 ng of genomic DNA to this master mix 10.8 1 and add ultrapure water to 20 1 to complete the reaction solution. The thermal cycle for the reaction is as follows. The thermal cycler was a Bio-Rad PTC-200.

[0067] 1. Preheating 94 ° C 2 minutes

2. Denaturation 94 ° C 30 seconds

3. Elongation 68 ° C 6 minutes [2, 3 40 cycles]

4.Final heating 68 ° C 10 minutes

5.Storage 4 ° C temperature fixed

As described above, a genomic PCR product containing the target SNP was obtained.

[0068] (2) Encoding reaction

Next, the encoding reaction was performed. The encoding reaction includes mixing and hybridizing the common probe, the tag nucleic acid, and the target nucleic acid, producing a linked oligonucleotide of the tag nucleic acid and the common probe, and recovering the linked oligonucleotide.

[0069] The reaction of 50 master mixes is as follows. Since New England Biolab Taq ligase was used for the ligase, the attached 10 X buffer was used. Tables 5 and 6 show the sequences of the common probe and tag nucleic acid.

[Table 5] Table 5 Common

[Table 6]

Each tag sequence has a length of 23 bases. The ply sequence 1 (SD), the sequence for identifying each allele (Dl_.), And the ply sequence 2 (ED) were arranged in the 5 'end. Tag nucleic acid sequence Is an orthonormalized array.

[0071] Common probe (ΙΟΟηΜ) 10 types 5 1 each

Tag nucleic acid (ΙΟΟηΜ) 20 species 5 1 each

10 X Taq DNA ligase reaction buffer 150 μ 1

Total 300 1

The first genome PCR product is double-stranded, so it is not suitable for ligase reaction. Therefore, degeneration is performed. The PCR reaction solution was stored frozen and once the enzyme activity was lost, the solution was denatured by the following procedure. First, it was denatured by heating at 95 ° C for 5 minutes. Immediately after denaturation, it was placed in ice, and the denatured DNA strands took an intramolecular structure, making them difficult to reassociate.

Based on this, an encoding reaction solution having the following composition was prepared. The Taq ligase used is from New England Biolab. Ultrapure water was prepared by Milli-Q Synthesis from Millipore.

[0073] Genomic PCR product 1 μ 1

Encoding master mix 6 μ 1

Taq DNA ligase 0.5 μ 1

Ultrapure water 22.5 μ 1

Total 30 1

The encode reaction solution was reacted at the following temperature. The thermal cycler, PTC-200, was used for heating.

[0074] 1. Ligase reaction 58 ° C 15 minutes

2.Storage 4 ° C temperature fixed

As a result, the ligase ligation reaction is terminated in the encoding reaction. Next, a streptavidin magnetic bead was subjected to an operation for capturing a piotinated common probe and a linked tag nucleic acid and a common probe. The solution composition is as follows.

[0075] Encoding product 30

2 X B & W Buffow 16.5

Streptavidin magnetic beads 1 μ 1

The magnetic beads coated with streptavidin were Dynal Μ-280 magnetic beads. A solution having the following composition was used as a B & W buffer according to the bead's instructions. [0076] Tris-HCl (pH 7.5) 10 mM

EDTA 1 mM

NaCl 0.2 M

Streptavidin magnetic beads (hereinafter referred to as magnetic beads) are obtained by taking 1 μ 1 from the stock solution containing preservatives and replacing the stock solution with B & W to 1 μ 1 again. The solution thus prepared is shaken at room temperature for 15 minutes so that the magnetic beads are well dispersed in the solution.

[0077] When the shaking is completed, the magnetic beads are washed. Washing was performed by the following procedure.

[0078] 1. Aggregate the magnetic beads with a magnet and remove the B & W buffer.

[0079] 2. Re-disperse in 100 μΐ I X B & W buffer at room temperature, pipette, agglomerate magnetic beads with a magnet, and wash twice except B & W buffer.

[0080] 3. Re-disperse in 100 µ 1 of 0.2Ν NaOH aqueous solution at room temperature and shake for 4 minutes on a shaker.

[0081] 4. Aggregate the magnetic beads with a magnet and remove the aqueous NaOH solution.

[0082] 5. Wash twice with 100 µ 1 at room temperature in the same way as in step 2.

[0083] This washing operation yielded magnetic beads from which non-specifically attached DNA was removed. This is called an encoded magnetic bead.

[0084] Next, asymmetric PCR was performed in the amplification reaction, and tag amplification and labeling were performed.

This also produced a master mix solution for 50 batches with the following composition. Table 7 shows the primers used.

[Table 7] Table 7 Primers

[0085] Primer 1 is a sequence corresponding to SD, primer 2 is a sequence corresponding to ED, and Cy5-rED has a sequence corresponding to the complementary strand of ED and has a fluorescent dye Cy5 at the 5 'end. Is a label. In this example, the ratio of SD: Cy5-rED is 1: 5, but it may be 1:10. The concentration ratio may be appropriately selected if it is obtained in the state of a fluorescently labeled chain force i-strand as guasymmetric PCR. Since Takara Bio's Ex Taq was used as the polymerase, the 10-fold concentration buffer and dNTP mixture used for the preparation were the ones included in the kit. A 10-fold concentration buffer containing 20 mM magnesium ions was used. The primer was diluted with ultrapure water. Here, if cycle elongation is performed, the primer amount should be set to 0 without one detection label.

[0086] Primer SD (10 / z M) 12.5 1

Primer Cy5— rED (10 μΜ) 62.5 μ 1

10 X Ex Taq buffer 250 1

dNTP mixture 200 μ 1

Ultrapure water 62.5 μ 1

Total 587.5 μ 1

The following reaction liquid was produced using the above master mix.

[0087] Asymmetric Metric Master Mix 11.75 1

Ultrapure water 37.75 1

Ex Taq polymerase 0.5 μ 1

Total 50 1

Except for the solution, the reaction solution was mixed with the encoded magnetic beads to disperse the beads. The thermal cycle of the reaction is as follows. The PTC-200 was used for the thermal cycler. If the cycle elongation method is used, the number of cycles is preferably 30 to 40 cycles.

[0088] 1. Denaturation 94 ° C 1 min

2. Denaturation 94 ° C 30 seconds

3.Annealing 65 ° C 1 minute

4. Elongation 72 ° C 1 min [2-4, 15 cycles]

5. Cooling 4 ° C temperature fixed

Thus, the amplification reaction was completed. The product obtained here is called the labeled PCR product. Finally, a detection reaction was performed. For detection, a capillary array (JP-A-11-75812) was used. The capillary array is a device that detects nucleic acids using a hybridization similar to a DNA microarray, and is probed with a probe force S along a groove-shaped channel. In this case, the capillary array has 10 tag detection probes fixed in one groove, and the groove capacity is 25 1. The slide is formed on a silicon rubber plate, and is attached to a slide glass in which the probe is spotted in a straight line using the adhesiveness of silicon rubber. At the both ends of this groove, there is a hole that penetrates the opposite surface of the groove, and even if the grooved surface is attached to the slide glass side, the sample solution can be injected and extracted from these through holes. ing. For the probe fixing glass slide, a pineapple slide released by Takara Bio Inc. was used. For spotting the probe, Hitachi Software Engineering SP-BIO was used. The sequence of the probe DNA is as shown in Table 8, and a sequence complementary to the tag identification sequence obtained in the amplification reaction was used.

[Table 8]

Table 8 Detection array probe

[0090] Silicone rubber is pasted in advance to fit the spot on the glass slide. Warm to C ぉ.

[0091] The labeled PCR product was hybridized to this capillary array. Since magnetic beads remain in the asymmetric PCR solution, V was collected, and the magnetic beads were collected and collected as a supernatant.

[0092] Labeled PCR product 50 μ 1

10% SDS 2 μ \

Ultrapure water 23 μ 1

Total 100 This hybridization solution was warmed to 50 ° C. in advance, and 25 μl was injected into the similarly heated capillary array and hybridized at 50 ° C. for 30 minutes. A paper towel moistened with ultrapure water was laid so that the hybridization solution did not evaporate, and the hybridization was carried out by placing it in a tape cloth. Subsequently, washing was performed according to the following procedure.

[0093] 1. Pull out the hybridization solution with a pipette.

2. Immediately add 20 μl of washing solution containing 1 X SSC and 0.2% SDS to prevent drying.

3. Slide glass force Remove the silicon rubber groove.

4. Shake the glass slide in a washing solution containing 1 X SSC and 0.2% SDS at room temperature for 5 minutes.

5. Next, shake and wash the glass slide with 0.1 X SSC at room temperature for 10 minutes.

6. Dry the glass slide with air spray or centrifuge.

[0094] The hybridization reaction was completed by the above procedure. Subsequently, fluorescence was detected with a microarray scanner. Axon GenePix 4000 was used as the scanner, and detection was performed at the Cy5 detection wavelength. The laser power was 100% and the PMT gain was 750. The acquired fluorescence image was analyzed with the software attached to the device, and the abundance of each allele in the solution was detected. The numerical results are as shown in Table 9. Figures 8-10 show the scatter plots of array detection intensities for all eight samples for each SNP.

[Table 9]

LL1 ε699 Φτί 6ί-τ Λ dMS ε〇ς

τ 90 ε ^ ε. LZ-6τ 08 S τ ττττ

9〇ί ε〇ς

OT s〇s

〇 ^ τ 6 τ τ # ττ ν

τ LZ 88ττ 606 SI

80

τττ 68 L o

0 ττ 8

# ∞ <3N

ε τ 8 τ

S 6

9ST τ: τ

95τ.

0 S 6

τ 00ST

9

Although the intensity of the SNP # 7 T allele of sample 719 was poor in the shape of the chiral spot, the background exceeded the signal and the fluorescence detection value was calculated to be negative. -2), the detection value was set to 0 to make it easier to draw a scatter diagram. [0096] Data obtained by the above experiment was typed according to the typing standard. Typing determined that an allele was more than 3 times the strength of the opposing allele and that the allele was homozygous and the others were heterogeneous. As a result, except for SNP # 4 of sample 719, the typing result was completely consistent with that of the Sanger method, and the correct answer rate was 79/80, or 98.75%.

[0097] Example 3: In order to confirm the further effect of the present invention, the inventors conducted a 96SNP co-typing experiment using the multiplex PCR method of the present invention! /, V, and an effective multiplex of shoes. It was verified whether amplification was performed. Since the success or failure of SNP typing is affected by the quality of the probe sequence of the SNP typing reaction, a typing failure does not necessarily indicate a failure of the multiplex amplification. In other words, SNPs that could be typed were because both amplification and probe detection were successful, and those that could not be typed were either amplification or probe detection either failed, or both were not successful. it is conceivable that. Furthermore, SNPs that were sequenced using the Sangha method to obtain SNP sequences for controls were difficult to sequence and were not considered for PCR success. Also, depending on the sample population due to SNP, the probability of mutation is very low, and when alleles are present, even if a scatter diagram for type determination is drawn, cluster power may not appear. Such SNPs were excluded because their accuracy could not be evaluated.

[0098] In the simultaneous typing of 96SNP, the same human science promotion resource bank power as the 10SNP typing 16 human genome samples obtained and the same reaction principle as 10SNP were used. Table 10 shows the primers used for multiplex PCR.

[Table 10A]

Table 10 Additional PCR primer sequences for 96 SNP amplification

(Continue)

] [

] [

Table 10 Additional PCR primer sequences for 96 SNP augmentation

(Continue)

s star

Table 10 Additional PCR primer sequences for 96 SNP amplification

(Continue)

§Ϋ́ [

Table 10 Additional PCR primer sequences for 96 SNP augmentation

(Continue)

96 Additional PC R primer sequences for SNP amplification

Clontech Titanium Taq was used for the reaction. The composition of the reaction solution is Titanium Taq Buffer (Takara BioClontech) 2 μ 1

Titanium Ί aq 0.4 μ 1

Primer mix (each primer 1 μ プライマー) 0.74 μ 1

MgCl (25mM) 2.4 ^ 1

2

dNTP (lOmM) 1.6 ^ 1

Genomic DNA (5ng / 1) 2 μ \

Ultrapure water 13.26 1

Total 20 1

It was.

[0099] The thermal cycle was as follows, and PTC-200 manufactured by Bio-Rad was used for the thermal cycler.

[0100] 1. Preheating 94 ° C 3 minutes

2. Denaturation 94 ° C 15 seconds

3.Annealing elongation 73 ° C 1 min

(3. Reduce the temperature by 0.1 ° C per cycle and extend the extension time by 5 seconds per cycle) [2 and 3 are 50 cycles]

4.Storage 10 ° C temperature fixed

It was.

[0101] The encoding reaction conditions are slightly different from those of 10SNP. The query uses ED and ED 'sequences depending on the alleles, so that they are labeled with different dyes at the detection stage so that each allele is detected with a different color fluorescence intensity on the same spot in the microarray. Table 11 shows the common probe sequences and Table 12 shows the query probe sequences.

[Table 11A]

[Table 11B]

[Table 11C] Table 1 1 96 SNP common probe 5 'end phosphorylated, 3 end biotin modified

[Table 12A] Table 12 Query probe for 96 SNP

(Continue)

Table 12 Query probe for 96 SNP

<)

Table 1 2 96 SNP Query Probe

(Knead)

Table 12 Query probe for 96 SNP

(Continue)

Table 1 2 Query for 96 SNP

(Continue)

Table 1 2 96 SNP Query Probe

(Continue

^ s [12

Table 12 Query for 96 SNP

(Continue)

Table 12 Query probe for 96 SNP

〔Continue)

As a query common mix solution,

Query probe sequence ΙΟΟηΜ

Common probe each array ΙΟΟηΜ

Tris-HCl (pH8.0) lOmM

EDTA 100

A liquid having the following composition was prepared.

[0102] New England Biolab Taq DNA ligase was used as the ligase,

Taq ligase buffer (10x concentration) 3 μ 1

Taq DNA ligase (40U / μ 1) 0.5 μ 1

Query common mix 0.1 ^ 1

Genomic PCR product 4 μ 1

Ultrapure water 22.4 1

Total 30 1

It was.

[0103] The reaction conditions were

1. Denaturation 95 ° C 1 min

2.Ligase reaction 58 ° C 60 minutes

3.Storage 10 ° C temperature fixed

It was.

[0104] The conditions for the amplification reaction were changed as follows. Instead of using SD as a primer, Cy3-rED and Cy5-rED 'as shown in Table 13 and the tag sequence assigned to each SNP in place of SD were directly used as primers for amplification.

[Table 13A]

Table 1 3 Tag amplification primers

(Continue) Table 1 3 Tag amplification primers

Name Modification Array (5 '-> 3')

SNP # 67 CGATCACGGATTAATGTCACCCC

SNP # 68 AAGAGATTTAACTTGAGCTCGCC

SNP # 69 TTTGTTGTTCGATATCAGGCGTG

SNP # 70 GCCCGGGAATAGATTATAACGCA

SNP # 71 GCATTTTTAGTAATCCGAGCGCC

SNP # 72 CAT GGATAAGT TTT CAAGC TGCG

SNP # 73 GAGACAGGTAAACCCTCAGAGCA

SNP # 74 TAGCACCCGTTAAAACGGAAATG

SNP # 75 TATGTTTAGTTGTTGAACCGGCG

SNP # 76 CGATCAGCTCTATTTCCCTCCCA

SNP # 77 AG T CAG T TAAT CAGACGT GAGCA

SNP # 78 TGGCAATACAATAACGTATCGCG

SNP # 79 CGCAGT T TGCAAGAACGAACAAA

SNP # 80 CGCGATAATTGATACCTACGGGC

SNP # 81 GGGGTGTGAGAGCTTTTTAGACG

SNP # 82 GGGATCCGTAACAAGTGTGTTAG

SNP # 83 ACCACTATGATTGAGGAAACGCG

SNP # 84 CGTCTTTAGTATCAACCCTCCGC

SNP # 85 GCATACGAACTTCTATATCGGCG

SNP # 86 CCGTGTG TAT GAGTAT GACAGCA

SNP # 87 TGCTGTCTTCGTGTTTTACCTAG

SNP # 88 CGATCATGTAAAGCTAACTCGCG

SNP # 89 TGCCGTCATTTAAACGTAAGGGT

SNP # 90 TGGCAAT TACAGT TGT TAACGCA

SNP # 91 GAGTCGAAGACCTCCTCCTACTC

SNP # 92 ATGCCAATATGTACTCGTGACTC

SNP # 93 GCATATAGTGACGGTAAGGCGAA

SNP # 94 GCCT CAC T TGTAATAAGCGGGAC

SNP # 95 GTCCCAAAAGCTTCTTACGGACG

SNP # 96 CTAGGTACAACACCAACTGTCTC

SNP # 97 TGCCGGTTATACCTTTAAGGACG

SNP # 98 GGCTGGTTAAA.TGTAAATCCGCG As primer mix solution

Cy3-rED each sequence 25 μΜ

Cy5-rED 'each sequence 25 μΜ

Tag array Each array 25ηΜ

Tris-HCl (pH8.0) 10mM

EDTA 100

A liquid having the following composition was prepared.

[0105] The reaction solution is

Primer mix

Ex Taq Knaffa (10x concentration) 5 1

Ex Taq polymerase 0.5 μ 1

dNTP 4 μ 1

Ultrapure water 39.5 μ 1

Total 50 1

Then, magnetic beads were mixed and reacted.

[0106] Thermal cycle is

1.Modification 94 ° C

2.Modification 94 ° C

3.Annealing 55 ° C

4. Elongation 72 ° C 4 cycles 40] 4. Storage 10 ° C

_C

[0107] Unlike 10SNP, 96 probes in Table 14 were spotted on a microarray and used for detection.

[Table 14A]

Detective y;

SSI The hybridization solution should have a final concentration of So.5 X SSC, 0.1% SDS, 15% formamide, and lm M EDTA. The solution obtained in the amplification reaction was combined with 101 to prepare 201, and hybridized with a hybrid array at 37 ° C for 60 minutes. When the hybridization was completed, the silicon rubber groove was removed from the slide glass and washed with 0.1 SSC, 0.1% SDS washing solution for 5 minutes with shaking. Thereafter, the surface was quickly washed with ultrapure water, and the slide glass was dried and detected with GenePix 4000 of Molecular Devices.

In the analysis of the experimental results, an evaluation value called QV (Quality Value) was used in order to evaluate the separation of detection. This QV value means that when a scatter diagram as shown in Fig. 11 is obtained for a measurement result of a certain SNP, the measurement result of a sample that constitutes the cluster to the measurement point of a sample that belongs to the same cluster. This is a value obtained by dividing the average of the angle difference D1 in the polar coordinate system as the denominator and dividing the angle difference D2 up to the nearest sample measurement point belonging to a different cluster as the numerator (Equation 1). This is the QV value at the sample measurement point. This QV value was calculated for all the measurement points that make up the entire scatter plot, and the average value was taken as the QV value of the scatter plot (Equation 2). The QV value is larger as the cluster to which the measurement point belongs is denser, the farther away the other cluster is closer, the larger the value, so the larger the QV value is, the better the scatter plot is, the better the SNP. It is thought that detection has been performed. The scatter plot has a QV value of 44.74, and the vertical axis represents the fluorescence intensity value of the microarray. The scatter diagram in Fig. 11 shows the detection result for SN P65, and the QV value was 44.74.

[0109] Table 15 shows the typing results of 96SNP.

[Table 15]

To determine the SNP locus for which multiplex PCR was successful, a scatter plot with a QV value of 3 or higher was obtained. And that SNP typing is accurate. The QV value was calculated using Dell OptiPlexl50, in-house software, and Microsoft Access 2002 was used to organize the data. Of the 96 SNPs, there were no more than two types of alleles by the Sanger method, or 30 SNPs that did not produce results by the Sanger method and were excluded from the scope of consideration. In addition, there were 53 SNPs that were able to separate clusters with a QV value of ¾ or more. Referring to the results of the Sanger method, 19 out of 848 measurement points of 53 SNP were considered to be wrong, and the correct answer rate was 97.8%. In other words, it was considered that 53 SNPs were used for accurate typing. The multiplex PCR method of the present invention accurately amplifies the target sequence with the SNP that was determined, and in the amplification of 66 SNP excluding 30 SNP from 96 SNP, PCR was performed with at least 53 of the 66 primers. It was a success. Some of the 13SNPs with poor scatter plot separation and inaccurate correct answers could be presumed to be successful in multiplex PCR, and the amplification success rate was considered to be even higher.

Claims

The scope of the claims

[1] Multiplex PCR method,

Using primers with a length of 30 bases or more,

A multiplex PCR method characterized by

[2] The method of claim 1, wherein

Mixing the primer and target DNA strand and heat denaturing;

Annealing the primer to a template;

A PCR amplification method comprising the steps of:

[3] The method of claim 1, wherein

The primer is 30 to 60 bases in length.

[4] The method of claim 1, wherein

The primer is 32 to 50 bases in length.

[5] The method of claim 1, comprising:

The primer has a length of 35 to 45 bases.

[6] The method of claim 1, wherein

The annealing / extension reaction is carried out to include at least one or more annealing for 4 minutes or more during the thermal cycle.

[7] The method of claim 1, wherein The annealing / extension reaction is carried out so as to include at least one annealing cycle of 6 minutes to 10 minutes in the thermal cycle.

The method of claim 1, comprising:

The annealing temperature is based on the evaluation value (Q-Score) predicted by Visual OMP (DNA Software)! /, And the hybridization efficiency and prediction of an evaluation value (Q-Score) of 850 or more That is below the Tm of the primer to be prepared.