RU2582216C2 - Biological microchip with primer set for analysis of polymorphism in ab0, hla-dqa1, amel, darc, nat2 genes - Google Patents

Abstract

FIELD: biochemistry.

SUBSTANCE: invention relates to the field of biochemistry. Disclosed is set of differentiating oligonucleotides for analysis of polymorphism in genes AB0, HLA-DQA1, AMEL, DARC, NAT2 using hydrogel DNA-microchips (biochips). Biochip enables detecting nucleotide composition in fourteen polymorphous positions that in turn enables to establish genotype in said genes. Also disclosed is set of PCR primers for amplifying said loci.

EFFECT: invention increases discriminatory potential of biochip (36,450 genotype groups).

3 cl, 3 dwg, 3 tbl, 4 ex

Description

FIELD OF THE INVENTION

The invention relates to the field of genetics, molecular biology, forensic science and forensics and relates to a tool for the analysis of polymorphism in the genes ABO, HLA-DQA1, AMEL, DARC, NAT2 using the technology of hydrogel DNA microarrays (biochips).

State of the art

A number of genetic identification methods are known that use various tools to analyze the uniqueness of the nucleotide sequence of each person’s DNA.

1. Analysis of polymorphism of the length of amplified fragments PDAF analysis. Based on the determination of the length of polymorphic DNA loci containing tandem repeats. The number of repetitions within such a locus varies in different people. Analysis of 12-16 such loci allows one to obtain a genetic characteristic that is unique within the population of the planet. The method requires amplification of DNA in a polymerase chain reaction, followed by gel electrophoresis. The advantage of the method is the high discriminatory ability, and the disadvantages are the laboriousness, high requirements for staff qualifications, expensive equipment for capillary gel electrophoresis (DNA sequencers), due to the significant length of STR loci (STR - short tandem repeats; loci containing short tandem repeats) the degree of genomic DNA degradation has a great influence on the result (highly degraded DNA is often found in forensic science work).

2. Analysis of polymorphism of the length of restriction enzyme fragments of DNA (RFLP analysis). As a result of mutations in the genomic DNA, new or previously existing restriction sites arise - the sites of restriction enzymes that break down the DNA chain. This, in turn, causes a change in the length of the resulting restriction enzyme fragments of DNA. The length distribution of fragments is detected using blot hybridization. However, most polymorphic loci have only two options: wild type / mutation, i.e. are diallelic. The value of dimorphic markers is small, because many people may have the same option. This feature, along with high demands on the quantity and preservation of the studied DNA, are the main drawbacks of the method that led to its disappearance from forensic practice [Joseph T, Kusumakumary P, Chacko P, Abraham A, Radhakrishna Pillai M. Genetic polymorphism of CYP1A1, CYP2D6, GSTM1 and GSTT1 and susceptibility to acute lymphoblastic leukaemia in Indian children. Pediatr Blood Cancer. 2004 Oct; 43 (5): 539-41].

3. Sequencing of amplified DNA fragments, i.e. determination of an individual genetic code in a given DNA fragment. The most accurate and evidence-based method for analyzing individual genetic variations. The advantage is the high accuracy and sensitivity of the method, and the disadvantage is the extremely high cost of equipment and analysis, which excludes the widespread introduction of the method into expert practice at least in the next decade.

4. Detection of single nucleotide polymorphism by allele-specific PCR (polymerase chain reaction). Allelic variants differ due to the fact that the 3 ′ terminal nucleotide of one of the primers in the PCR hybridizes directly with the SNP position (i.e., if this primer is complementary to the DNA sequence, the product is used up), the method is rather complicated, because to a large extent depends on the reaction conditions and the correct primer sequence. A large number of false positive results. In addition, it is impossible with this method to analyze more than 3-5 mutations in one analysis. Despite all the above disadvantages, under well-chosen conditions, SNP analysis takes only 3-4 hours [Murata M, Shiraishi T, Fukutome K, Watanabe M, Nagao M, Kubota Y, Ito H, Kawamura J, Yatani R. Cytochrome P4501A1 and glutathione S-transferase M1 genotypes as risk factors for prostate cancer in Japan. Jpn J Clin Oncol. 1998 Nov; 28 (11): 657-60].

5. Detection of single nucleotide polymorphism by hybridization of an amplified test sample with an oligonucleotide matrix. This method involves preliminary multiplex amplification of the studied DNA fragments using fluorescently labeled primers. The addition of excess labeled PCR primer results in the formation of a large amount of a predominantly labeled single chain product. This product is hybridized with oligonucleotide probes immobilized at a specific location on a solid substrate, or in gel microdrops attached to a substrate (such a matrix of DNA probes is called a biological microchip or biochip). If the sequence of the analyzed DNA is completely complementary to the probe sequence, then a stable duplex is formed (a fluorescent signal is recorded), if the desired fragment is not found, or if there is an incomplete base in it, then a stable duplex is not formed (signal is not observed). The simplicity of the method, low cost and the possibility of using a fluorescent label makes it easy to automate the process. However, this method is tightly coupled to multiplex PCR, and its capabilities are limited. Namely, in the course of one reaction, only 4-5 DNA loci can be amplified. With such restrictions, the SNP systems currently used for forensic purposes, due to their dialect, will not have sufficient discriminatory power when used on a biochip platform [Wen SY, Wang H, Sun OJ, Wang SQ. Rapid detection of the known SNPs of CYP2C9 using oligonucleotide microarray. World J Gastroenterol. 2003 Jun; 9 (6): 1342-6]. An example of the implementation of this approach is described in the following work [Nasedkina T.V., Fesenko D.O., Mityaeva O.N., Lysoe Yu.P., Barsky V.E., Zasedatelev A.S. (2007). A method of genetic identification of a person based on the analysis of a single nucleotide polymorphism of the human genome using an oligonucleotide biological microchip. Patent PCT / RU / 2007/000016, international application No. WO 2008088236], which proposes a tool that performs selective analysis of three genes and allows you to divide the entire population into 1350 groups.

The closest analogue of the present invention is the tool described in paragraph 5. Significant disadvantages of the method include its low discriminatory power (1/1350), due to the small number of analyzed loci. The practical drawback of low discriminatory power is the reduction in the possibility of identifying a suspect, especially when analyzing relatively closed settlements, where the genotypes of residents are very homologous, or during very large-scale search operations. The solution to this problem is to create a tool with an expanded number of analyzed markers that can increase the discriminatory power to 1/36450, which is proposed in this invention.

Disclosure of invention

The essence of the invention is to create a biochip (under the code name "IL-5") in the cells of which the original differentiating oligonucleotides are immobilized, as well as to create a set of PCR primers for amplification of DNA of five loci: DARC (Duffy blood group gene), ABO, NAT2, HLA-DQA1 and AMEL. Differentiating oligonucleotides are selected in such a way as to specifically bind to the target allele, and primers for multiplex PCR are selected in such a way as to uniformly produce all the studied loci. The use of the biochip IL-5 will allow us to divide the human population into 36,450 groups.

Differentiating oligonucleotides (SEQ ID NO: 1-31) are immobilized in the cells of a hydrogel microchip, as described in the patent [Mirzabekov AD, Rubina A.Yu., Pankov SV, Perov AN, Chupeeva V.V. . A composition for immobilizing biological macromolecules in hydrogels, a method for preparing a composition, a biochip, a method for performing PCR on a biochip. RU 2206575 C2] at a concentration of 100-10000 pmol per 1 μl of gel, depending on the tasks of the researcher. The cell layout may be arbitrary; we used the circuit shown in Fig. 1. The analysis using the invention is carried out similarly to the method described in [Nasedkina T.V., Fesenko D.O., Mityaeva ON, Lysoe Yu.P., Barsky V.E., Zasedatelev A.S. (2007). A method for genetic identification of a person based on the analysis of a single nucleotide polymorphism of the human genome using an oligonucleotide biological microchip. Patent PCT / RU / 2007/000016, international application No. WO 2008088236]. Based on the results of hybridization and washing, the obtained fluorescence pattern is analyzed, on the basis of which a conclusion is made about the genotype in the test sample. An example of a hybridization pattern is shown in Fig.2.

Characteristics of the analyzed loci: the highly polymorphic loci ABO and HLA-DQA1 in total provide the division of the population into 675 groups, the NAT2 locus by 9 more, DARC by 3, AMEL by 2. In total, 5 loci provide division into 36450 groups. In other words, there are 36,450 individual glow profiles of biochip cells. The data obtained using the present invention can be used to obtain search information (gender, blood type), narrowing the circle of suspected persons and as a preliminary stage of verification of the belonging of the studied DNA to a suspected person.

As an expert sample, DNA samples isolated from blood, saliva, hair follicle, a fingerprint containing particles of epithelium and other DNA-containing materials can be used.

The main aspect of this invention is a biochip containing a set of immobilized differentiating oligonucleotides, the sequence of which is shown in Table 1 and the List of sequences (SEQ ID NO: 1-31).

Another aspect of the invention is a set of primers for amplification of gene fragments, used to obtain the studied fluorescently labeled loci in the required quantity. The sequence of primers is shown in Table 2 and the List of sequences (SEQ ID NO: 31-56).

The implementation of the invention

The objective of the present invention is to create a biological microchip that allows you to determine the genotype in five loci of the human genome: DARC, ABO, NAT2, HLA-DQA1 and AMEL. The most important task in the implementation of this invention is the provision of such a structure of differentiating oligonucleotide probes that they only bind to fully complementary targets, providing a bright fluorescent signal in their corresponding biochip cells. At the same time, nonspecific binding should be minimized to eliminate false positive “triggering” of the cells. Due to the fact that the region of the polymorphic site is conservative (with the exception of the polymorphic nucleotide), paired probes (analyzing one single nucleotide polymorphic site) differ only in the central nucleotide and are identical in flanks. In such a situation, it is necessary to vary the length of the flanking regions in order to ensure high specific and low non-specific binding of the studied target. Because At present, there are no exact thermodynamic methods for calculating the structure of the probe; the structure is selected empirically, by consistent selection and experimental verification. In the course of this work, such structures were chosen, and they are shown in Table 1 and the List of sequences (SEQ ID NO: 1-31).

Table 1 List of differentiating oligonucleotides immobilized on biochip IL-5 GENE SEQID NO: polymorphism sequence 5′-3 ′ title HLA-DQA one Multiple SNPs within each oligonucleotide probe TGGCCTGAGTTCAGCAA D1 2 AAGTTGCCTCTGTTCCACAGA D2 3 GCCTCTGTTCCGCAGATT D3 four TCTGGTGTTTGCCTGTTCTCAGAC D4 5 TGGCCAGTACACCCATG D5 6 GCCAGTTCACCCATGAA D6 7 AGATGAGGAGTTCTACG D7 8 AGATGAGCAGTTCTAC D8 9 GGAGACGAGCAGTTCTA D9 10 GGAAGGAGACTGCCT D10 eleven AGGAGGCTGCCTGG D11 12 CCTGGAGAGGAAGGA D12 13 CTGGAGAAGAAGGAGA D13 ABO fourteen 261w TCGTGGTGACCCCTT A14 fifteen 261m CTCGTGGTACCCCTT A15 16 297w GAGGGCACATTCAACA A16 17 297m GAGGGCACGTTCAA A17 eighteen 646w ACATGGAGTTCCGC A18 19 646m ATGGAGATCCGCG A19 twenty 657w CGACCACGTGGGCG A20 21 657m GCGACCATGTGGG A21 22 681w CTGACTCCGCTGTTCG A22 23 681m TGACTCCACTGTTCGG A23 Darc 24 125A GAGACTATGATGCCAAC DA24 25 125g AGACTATGGTGCCAAC DA25 AMEL 26 Wt CCAGAGCATGATAAGACCAC AM26 27 del_3 CCAGAGCATAAGGCCA AM27 NAT2 28 481C TCTGGTACCTGGACC N28 29th 481T TCTGGTACTTGGACC N29 thirty 590g TGAACCTCGAACAATT N30 31 590A TGAACCTCAAACAATTGA N31

To ensure balanced effective amplification of the studied samples, it is necessary to select the structure of primers for multiplex PCR. Primers should be selected so that their annealing on the target occurs at the same temperature for all (60-65 ° C), there should be no high-energy internal studs and duplexes between all primers. Amplicons of all loci should vary in length within 250-600 bp. for the first round. The solution to these problems requires not only accurate calculations, but also lengthy experimental verification and correction. As a result of the work, the optimal composition and structure of PCR primers was chosen.

The following is the sequence of analysis using this invention. A DNA sample is used as a template in a multiplex “nested” two-stage PCR. In a second step, PCR produces a fluorescently labeled amplified fragment. Labeled PCR product is used for further hybridization on a biochip containing immobilized oligonucleotides, which are portions of gene sequences that are complementary to both the wild-type sequence and the variable sequence. The analyzed DNA fragment forms perfect hybridization duplexes only with the corresponding oligonucleotides fully complementary to it. With all other oligonucleotides, the analyzed DNA fragment will form imperfect duplexes, the stability of which is significantly lower than the stability of perfect duplexes. Discrimination of perfect and imperfect duplexes is carried out after washing the biochip, comparing the fluorescence intensities of the corresponding cells of the biochip. The signal intensity in the case of the formation of a perfect duplex is higher than in the case of an imperfect one. Using the arrangement of oligonucleotides on the biochip, determine which options are present in a particular sample.

The polymerase chain reaction can be carried out using any type of thermostable polymerase (Taq polymerase, Stoffel fragment, Tth polymerase, Tfl polymerase, Pfu polymerase, Vent polymerase, DeepVent polymerase and the like, without limitation, which are commercially available from a large number of manufacturers) working in the corresponding buffer. To build a new chain, a mixture of dNTPs (dATP, dGTP, dCTP, dTTP) at the accepted concentrations is added to the buffer, but dUTP can be used instead of dTTP. For PCR, ready-made commercially available kits containing all the necessary components except primers can be used.

As primers for conducting the multiplex “nested” two-stage polymerase chain reaction, primers SEQ ID NO: 32-56 are used, which are listed in the Sequence Listing, as well as in Table 2. There are various chemical approaches to the synthesis of oligonucleotide primers, for example, the phosphodiester method, the hydrophosphoryl method, etc. but the most common is currently the phosphoramidite method. Primer synthesis is carried out using automated DNA / RNA synthesizers, for example, manufactured by Applied Biosystems (USA).

table 2 The sequence of primers involved in multiplex PCR SEQ ID NO: Title The sequence 5′-3 ′ 32 DU1 CTTGTCATCTTCACTCATCAG 33 DL1 GATCTGGGGACCTCTTGG 34 A6U1 TGGAAGGGTGGTCAGAG 35 A6L1 TACTTCTTGATGGCAAACAC 36 A7U1 GCCTTGCAGATACGTGG 37 A7l1 AGCACCTTGGTGGGTTT 38 AMU1 AGTCTATATTTCCTACTGCATCA 39 AML1 AGGTGACTCCAACCAGAG 40 DAU1 CAGGAGACTCTTCCGGTGTA 41 DAL1 ACCCAGGACACTGGTGAG 42 NU1 TGAGCACCAGATCCGGGCT 43 Nl1 AGGGTAGAGAGGATATCTG 44 DU2 CTTGTCATCTTCACTCATCAGCTGACCA 45 DL2 CATACCATTGGTAGCAGCGGTAGAG 46 A6U2 GTGCGTGGACGTGGACATG 47 A6L2 CCGGCGCTCGTAGGTGAA 48 A7U2 GAGTGGAGTTTCCAGGTGGG 49 A7l2 GGAGCCTGAACTGCTCGTTG fifty AMU2 ACCCCTTTGAAGTGGTACCAGAGCA 51 AMU′2 CCATTAATGTCTGCATGTGGAGTAGACATG 52 AML2 CCATTAGTGTCTGTATGTGGAGTACACATG 53 DAU2 CCTCCTCTGGGTATGTCCTCC 54 Dal2 ATCCAGCAGGTTACAGGAGTG 55 Nu2 GGGAAGGATCAGCCTCAGGTG 56 Nl2 GACGTCTGCAGGTATGTATTCATAGACTC

Labeling of the PCR product in the second stage of PCR is carried out using primers carrying a fluorescent label at the 5′-end, or by incorporation of labeled triphosphates into the growing amplicon chain. Any fluorochrome can be used as a fluorescent label (for example, without limitation, FITC, Texas red, Cy-3, Cy-5, etc.), as well as biotin.

At the second stage of the multiplex "nested" two-stage PCR primers that are part of the same pair are used in unequal amounts. This makes it possible to obtain a predominantly single-chain amplicon capable of hybridization with DCN probes. Before setting the hybridization, the amplicon is denatured by heating the finished hybridization mixture at 95 ° C for 5 minutes, followed by rapid cooling in ice. Hybridization can be carried out in any hybridization buffer known to those skilled in the art, for example in an SSPE buffer or guanidine buffer. A typical hybridization time is 8-12 hours at 37 ° C. Washing can be carried out in any buffer known in the art with added salt (SSC, SSPE, etc.) or in deionized water, but for a shorter time (JF Sambrook and DW Russell, 2001, "Molecular cloning: a laboratory manual "Cold Spring Harbor Laboratory Press).

The hybridization pattern can be recorded using any detection system that recognizes a fluorescent signal (a fluorescence microscope with a CCD camera, a laser scanner or a portable biochip analyzer, available commercially from a large number of manufacturers, for example, a portable biochip analyzer manufactured by Biochip-IMB LLC , and equipped with a recording device (CCD camera, video camera, camera)). Image analysis can be done both visually and automatically using a special program.

In the manufacture of a microchip, oligonucleotides that carry an active group that provides immobilization at the 5 ′ or 3 ′ end can be used. There are various chemical approaches to the synthesis of oligonucleotides, for example, the phosphodiester method, the hydrophosphoryl method, etc., but the phosphoramidite method is currently the most widely used. The synthesis of oligonucleotides is carried out using automatic DNA / RNA synthesizers, for example, manufactured by Applied Biosystems (USA). A wide range of groups can be used to modify immobilized oligonucleotides, such as an amino group, thiol, hydrazide, acrylamide group, benzaldehyde, thiophosphate, and the like. (Seliger H., Hinz M., Narr E. "Arrays of immobilized oligonucleotides - contributions to nucleic acids technology" Current Pharmaceutical Biotechnology, 2003, 4, 379-395). Modification of the oligonucleotide, with the aim of introducing an active group suitable for subsequent immobilization of the oligonucleotide on a biochip, can be carried out both automatically in the synthesis using a wide range of modifiers that are commercially available, for example, from Glen Research (USA), and postsynthetically in manual mode.

Biochips can be made by creating on the glass substrate surface a matrix of polyacrylamide gel cells, activating the cells and covalently immobilizing the modified oligonucleotides in the cells carrying active groups (Mirzabekov A. & Kolchinsky A. MAGIChip: Properties and applications in genomic studies. (2002) In Genomic Technologies: Present and Future. Eds. Galas DJ, SJ McCormack. Caister Academic Press, pp. 163-196). Biochips can also be made by chemically-induced or photo-induced copolymerization of an oligonucleotide in an acrylamide gel, as previously described (Vasiliskov, V., Timofeev E., Surzhikov S., Drobyshev, A., Shick, V. & Mirzabekov, A. 1999. Fabrication of microarray of gel-immobilized compounds on a chip by copolymerization. BioTechnique, 27, 592-606; Mirzabekov A.D., Rubina A.Yu., Pankov S.V., Chernov B.K. Patent for invention No. 2175972 " A method for immobilizing oligonucleotides containing unsaturated groups in polymer hydrogels during microchip formation. ”Priority dated 12/28/1999). Biochips can also be made by any other methods known to a person skilled in the art (Seliger H., Hinz M., Narr E. "Arrays of immobilized oligonucleotides - contributions to nucleic acids technology" Current Pharmaceutical Biotechnology, 2003, 4, 379-395), and as a substrate, in addition to glass, another material can be used (plastic, metal, flexible membranes, etc.). Also, for the manufacture of microchips, activated substrates commercially available from various manufacturers can be used (see, for example, Ramakrishnan R, Domanus D, Lublinsky A, Nguyen A, Domanus M, Prokhorova A, Gieser L, Touma E, Lockner R, Tata M , Zhu X, Patterson M, Shippy R, Sendera TJ, Mazumder A. 2002. An assessment of Motorola CodeLink microarray performance for gene expression profiling applications. Nucleic Acids Res. 30: e30).

For the manufacture of the biochip of the present invention using a set of oligonucleotides SEQ ID NO: 1-31, shown in the List of sequences, as well as Table 1. As a control of hybridization, a control DNA sample is used in the present invention. The location of specific oligonucleotide probes on the biochip can vary and is determined only by the convenience for interpreting the results of hybridization.

Using the biochip, 9 groups of HLA-DQA1 gene alleles can be analyzed: group 101 combines the alleles 0101XX, 0104XX, 0105, 0107; group 102-0102XX; group 103-0103; group 106-0106; group 02-0201; group 03 - 03XXXX, group 04 - 04XXXX; group 05 - 05XXXX; Group 06 - 06XXXX. For simplicity, hereinafter, the groups of alleles 101, 102, 103, 106, 02, 03, 04, 05, 06 will be called simply alleles. The biochip allows the analysis of four polymorphic regions in the second exon of the HLA-DQA1 gene. On a chip, each polymorphic region is represented by a column of pairs of cells. The first pair of columns has 4 rows, the second pair of columns - 2 rows, the third pair of columns - 3 rows, the fourth pair of columns - 2 rows, the fifth pair of columns - 2 rows. The first polymorphic region is located between 203 and 234 positions. The first variant of the first segment (the first row of the first pair of columns) is responsible for 101, 102, 103, 106, alleles, the second variant of the first polymorphic segment (second row of the first pair of columns) is responsible for 02 allele, the third variant of the first polymorphic segment (third row of the first pair of columns ) is responsible for the 03 allele, the fourth variant of the first polymorphic region (the fourth row of the first pair of columns) is responsible for 04, 05, 06 alleles. The second polymorphic region is located between 134 and 152 positions. The first variant of the second polymorphic region (the first row of the second pair of columns) is responsible for 101, 102, 106, 04, 05 alleles, the second variant of the second polymorphic region (the second row of the second pair of columns) is responsible for 103, 02, 06 alleles. The third polymorphic region is located between 161 and 188 positions. The first variant of the third polymorphic region (the first row of the third pair of columns) is responsible for 101 alleles, the second variant of the third polymorphic region (the second row of the third pair of columns) is responsible for 102, 103, 106, 04, 05 alleles, the third variant of the third polymorphic region (the third row third pair of columns) is responsible for 04 and 06 alleles. The fourth polymorphic region is located between 191 and 207 positions. The first variant of the fourth polymorphic region (the first row of the fourth pair of columns) is responsible for 101, 102, 103 alleles, the second variant of the fourth polymorphic region (the second row of the fourth column) is responsible for 106 alleles. By analyzing the totality of the four polymorphic regions, one can determine the genotype. The first variant of the fifth polymorphic region (the top row of the fifth pair of columns) is responsible for 101, 102, 106, 02, and 03 alleles. The second variant of this section (the bottom row of the fifth pair of columns) is for the allele 103. Thus, by analyzing the profile of the luminous cells, we can uniquely determine the genotype of the sample.

In the AB0 gene, 5 polymorphic variants of the AB0 gene can be detected, the combination of which gives 15 groups. Locus AB0 is highly polymorphic and to date, according to our estimates, about one and a half hundred of its alleles have been published. The vast majority of them are extremely rare. Therefore, when choosing alleles, we were guided, first of all, by the frequency of their occurrence in white Europeans, genetically closest to the Russian population. For analysis, the following groups of alleles were selected: A, B, O ^l , O ^lv and O ² , which determine the serological blood group in the vast majority of white Europeans. The combination of analyzed SNPs allows us to determine the alleles of the ABO gene present in the sample (Table 3). In each of the selected groups of alleles, alleles that differ in other SNPs can be isolated, but these variants are rare and in the vast majority of cases are serologically equivalent to each other.

Table 3 Single nucleotide variations among alleles of the AB0 gene. Allele A is considered to be wild type. SNP Position 6 exon 7 exon 261 297 646 657 681 Allele A (w) G A T FROM G AT G T O ^l del Q ^lv del G A BUT About ² G

The amelogenin gene is located on the sex chromosome and allows you to determine the gender of the individual. AMELX is characterized by a three letter deletion (positions 5878-5880). Two oligonucleotides (AMELX and AMELY) are immobilized on a biochip, which allow the analysis of the presence or absence of a deletion.

In the DARC gene, the position 125G / A is analyzed, which determines the FyA and FyB alleles of the Duffy blood group, respectively. Analysis of this gene gives a division into 3 groups.

Two SNPs are analyzed in the NAT2 gene: 481C / T and 590G / A. The analysis of these points gives a division into 9 groups.

In total, the developed biochip allows us to analyze 28 groups of alleles in five genes (Fig. 3).

The invention is further illustrated by examples that show the application of the rapid analysis method of genetic polymorphism. However, it should be understood that the examples provided are for illustration only and are not intended to limit the scope of the claims expressed in the claims. Based on the present description, a person skilled in the art will be able to easily suggest their options and modifications of the invention without departing from the general concept of the present invention and without involving their own inventive activity, so it should be clear that such options and modifications will also be included in the scope of the claims of this inventions.

Example 1. Oligonucleotide biochip for determination of genetic polymorphism in the DARC, ABO, NAT2, HLA-DQA1 and AMEL genes.

Microchip immobilizing oligonucleotides are synthesized on a 394 DNA / RNA Synthesizer (Applied Biosystems, USA) using a standard phosphoamidite procedure. The 5 ′ or 3 ′ end of the oligonucleotides contains a free amino group spacer, which is introduced into the oligonucleotide by synthesis using the 3′-Amino-Modifier C7 CPG 500 (Glen Research, USA). The addition of a fluorescent label to the free amino group oligonucleotides is carried out in accordance with the manufacturer's recommendations. Oligonucleotides labeled with cyanine dye Su-3 purified HPLC from oligonucleotides that did not include a fluorescent dye on a Hypersil ODS 5 μm, 4.6 × 250 mm column (SypeIco Int, USA).

The biochip is made by copolymerization of an oligonucleotide in an acrylamide gel, as described previously (Patent for invention No. 2175972 "Method for immobilizing oligonucleotides containing unsaturated groups in polymer hydrogels during microchip formation" Mirzabekov AD, Rubina A.Yu., Pankov S.V. ., Chernov B.K. Priority dated 12/28/1999). The biochip contains 31 types of immobilized oligonucleotides (SEQ ID NO: 1-31), a list of which is also presented in Table 1. The cells are applied according to the scheme in Figure 1.

Example 2. Amplification of ABO gene fragments by the method of two-stage "nested" multiplex PCR in order to generate a fluorescently labeled gene fragment.

DNA was isolated from the test saliva using a Qiagen kit. For multiplex production of all analyzed genes, PCR primers SEQ ID NO: 32-56 were used. PCR was performed on a MiniCycler instrument (MJ Research, Inc., USA) in a volume of 25 μl of the reaction mixture, composition: for the 1st stage: 1x buffer (67 mm Tris-HCl, pH 8.6, 166 mm (NH ₄ ) ₂ SO ₄ , 0.01% Triton X-100), 1.5 mM MgCl ₂ 0.2 mM each of dNTP (Sileks, Russia), 5 pM each of 4 primers (SEQ ID NO: 32-43), 1 μl of genomic DNA and 1.5 units Act. Taq polymerase (Sileks, Russia). DNA was denatured for 5 min at 94 ° C and 35 amplification cycles were performed in the first stage (94 ° C for 30 s, 60 ° C for 30 s, 72 ° C for 1 min), then 7 min at 72 ° C. The mixture of the second PCR stage differed in the composition and concentration of primers: the upper primers (SEQ ID NO: 44, 46, 48, 50, 51, 53, 55) were taken at a concentration of 5 pmol / μl, and the lower ones (SEQ ID NO: 45, 47, 49, 52, 54, 56) - 50 pmol / μl. 2 μl of the product from the first stage was added to the mixture and amplified according to the scheme: 3.5 min 94 ° С, 34 cycles (94 ° С - 30 s, 62 ° С - 30 s, 72 ° С - 1 min), 7 min at 72 ° C. The lower primers of the 2nd stage were preliminarily labeled at the 5 ′ end with a Cy5 fluorescent dye (exc. / Use: 640/657 nm).

Example 3. Hybridization of a labeled product on a biochip.

The contents of all the tubes obtained in the second step of Example 2 are used for hybridization on a biochip in a buffer of the following composition: 25% formamide (Gibco BRL), 5 × SSPE. Before hybridization, the prepared hybridization mixture was denatured at 95 ° C for 5 min, cooled in ice, 2 min, and applied to the biochip in a hybridization chamber with a volume of 20-40 μl (Sigma, USA). Hybridization is carried out for 10-14 hours at a temperature of 37 ° C. Washing is carried out in 1 × SSPE buffer at room temperature for 10 minutes.

Example 4. Registration and interpretation of the results of hybridization.

The hybridization pattern is recorded using a portable biochip analyzer equipped with a CCD camera manufactured by Biochip-IMB LLC. When visual analysis of the image, the interpretation of the results is carried out, as in example 2. The description of the algorithm for automatic image analysis using the ImageWare ™ program is beyond the scope of the present invention.

We will determine the genotype from the hybridization pattern shown in Figure 2. The first polymorphic region of HLA-DQA1: a positive signal is observed in the first and second lines, therefore, one allele from group 101, 102, 103, 106, and the second allele 201. Next, the second polymorphic region : a positive signal is observed in both lines, therefore, the presence of 103 alleles is excluded. Third polymorphic region: a positive signal is observed in the second row, therefore, exclude the allele 101. Fourth polymorphic region: a positive signal is observed in the first row, therefore, exclude the 106 allele. As a result, for the sample under consideration, we obtain the HLA-DQA1: 102/201 genotype.

Consider the biochip region responsible for the genotyping of the ABO gene. Compare the results of hybridization with the data from table 3: The absence of a signal in the lower pair of the first column excludes the alleles O ^l and O ^lv . Because the sample is heterozygous at 297 positions, therefore, it definitely contains the allele A and one of two: B or 02. The third column does not allow a conclusion about the second allele, and the fourth column excludes the allele B (since the lower pair does not fluoresce) . Alleles A and 02 remain.

The amelogenin gene is represented by one allele (Figure 2): AMELX, from which we can conclude that the sample belongs to a woman.

The DARC gene is represented by a heterozygote: FyA / FyB.

NAT2 gene: 481 C / T, 590G / G.

Claims (3)

1. A set of differentiating oligonucleotides, the sequence of which is defined in the List of sequences, for analysis of gene polymorphism: AB0 (SEQ ID NO: 14-23), HLA-DQA1 (SEQ ID NO: 1-13), AMEL (SEQ ID NO: 26- 27), DARC (SEQ ID NO: 24-25) and NAT2 (SEQ ID NO: 28-31), which allows the identification of alleles A, B, O ¹ , O ^1v and O ² of the AB0 gene, allele groups 101, 102, 103 , 106, 02, 03, 04, 05, and 06 of the HLA-DQA1 gene, AMELX and AMELY alleles of the AMEL gene, FyA and FyB alleles of the DARC gene, and alleles determined by polymorphisms in 481C / T and 590G / A of NAT2 gene. 2. A set of primers for amplification of the AB0, HLA-DQA1, AMEL, DARC, and NAT2 loci, the sequence of which is defined in the Sequence Listing (SEQ ID NO: 32-56). 3. A biochip for analysis of gene polymorphism AB0, HLA-DQA1, AMEL, DARC and NAT2, containing the set of oligonucleotides according to claim 1 and a substrate on which these oligonucleotides are immobilized.

Images