RU2600874C2 - Set of oligonucleotide primers and probes for genetic typing of polymorphous dna loci associated with a risk of progression of sporadic form of alzheimer's disease in russian populations - Google Patents

Set of oligonucleotide primers and probes for genetic typing of polymorphous dna loci associated with a risk of progression of sporadic form of alzheimer's disease in russian populations Download PDF

Info

Publication number
RU2600874C2
RU2600874C2 RU2014113962/10A RU2014113962A RU2600874C2 RU 2600874 C2 RU2600874 C2 RU 2600874C2 RU 2014113962/10 A RU2014113962/10 A RU 2014113962/10A RU 2014113962 A RU2014113962 A RU 2014113962A RU 2600874 C2 RU2600874 C2 RU 2600874C2
Authority
RU
Russia
Prior art keywords
pcr
seq
primers
gab2
dna
Prior art date
Application number
RU2014113962/10A
Other languages
Russian (ru)
Other versions
RU2014113962A (en
Inventor
Татьяна Васильевна Наседкина
Ольга Алексеевна Гра
Игорь Игоревич Низамутдинов
Александр Сергеевич Заседателев
Original Assignee
Федеральное государственное бюджетное учреждение науки Российской академии наук Институт молекулярной биологии им. В.А. Энгельгардта Российской академии наук (ИМБ РАН)
Российская Федерация, От Имени Которой Выступает Министерство Образования И Науки Российской Федерации
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Федеральное государственное бюджетное учреждение науки Российской академии наук Институт молекулярной биологии им. В.А. Энгельгардта Российской академии наук (ИМБ РАН), Российская Федерация, От Имени Которой Выступает Министерство Образования И Науки Российской Федерации filed Critical Федеральное государственное бюджетное учреждение науки Российской академии наук Институт молекулярной биологии им. В.А. Энгельгардта Российской академии наук (ИМБ РАН)
Priority to RU2014113962/10A priority Critical patent/RU2600874C2/en
Publication of RU2014113962A publication Critical patent/RU2014113962A/en
Application granted granted Critical
Publication of RU2600874C2 publication Critical patent/RU2600874C2/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
    • C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material

Abstract

FIELD: genetics; molecular biology; medicine.
SUBSTANCE: invention relates to a method for analysis of genetic polymorphism in DNA of ApoE, ApoJ and GAB2 and a set of oligonucleotide primers and probes. Described method includes the steps of: (a) amplification of polymorphic gene fragments of ApoE, ApoJ and GAB2 by multiplex "circular" two-step polymerase chain reaction, wherein DNA sample is used as the matrix for amplification; during I step of PCR a set of primers with sequences given in SEQ ID NO: 9, 10, 13, 14, 17, 18 is used; during II step of PCR a set of primers with sequences given in SEQ ID NO: 11, 12, 15, 16, 19, 20 is used, and deoxyuridine triphosphate, marked with Su-5 fluorescent dye, resulting in formation of fluorescent marked PCR-product; (b) immobilization of oligonucleotide probes, sequence of which are presented in SEQ ID NO: 1-8, on a solid substrate; (c) hybridization of the marked PCR-product with immobilized oligonucleotides presented in SEQ ID NO: 1-8; (d) registration and interpretation of hybridization results.
EFFECT: inventions provide the possibility of determining nucleotide composition in four polymorphous positions: ApoE (rs429358, rs7412), ApoJ (rs11136000) and GAB2 (rs2373115), that, in its turn, enables to determine predisposition to sporadic form of Alzheimer's disease in the population of Russia.
2 cl, 2 dwg, 3 tbl, 4 ex

Description

Область техники, к которой относится изобретениеFIELD OF THE INVENTION

Изобретение относится к области генетики, молекулярной биологии и медицины, и может быть использовано для определения генетической предрасположенности к болезни Альцгеймера посредством анализа полиморфизма в генах АроЕ, ApoJ и GAB2 в российских популяциях.The invention relates to the field of genetics, molecular biology and medicine, and can be used to determine the genetic predisposition to Alzheimer's disease by analyzing polymorphism in the ApoE, ApoJ and GAB2 genes in Russian populations.

Уровень техникиState of the art

Известно большое количество способов определения генетического полиморфизма в которых используются различные инструменты для анализа уникальной нуклеотидной последовательности ДНК человека. Условно среди них можно выделить шесть групп:A large number of methods for determining genetic polymorphism are known in which various tools are used to analyze the unique nucleotide sequence of human DNA. Conventionally, among them, six groups can be distinguished:

1) Ферментативные подходы:1) Enzymatic approaches:

полиморфизм длин амплифицированных фрагментов (AFLP);amplified fragment length polymorphism (AFLP);

полиморфизм длин рестрикционных фрагментов (RFLP);restriction fragment length polymorphism (RFLP);

расщепление клевазой (CFLP);Cleavage Cleavage (CFLP);

расщепление резольвазой (EMD);resolvase cleavage (EMD);

анализ, основанный на лигазной реакции (LDR, LCR);analysis based on ligase reaction (LDR, LCR);

инвазивное расщепление олигонуклеотидов;invasive cleavage of oligonucleotides;

случайная амплификация полиморфной ДНК (RAPD, AP-PCR);random amplification of polymorphic DNA (RAPD, AP-PCR);

ПЦР с прямой терминацией синтеза (DT-PCR);PCR with direct synthesis termination (DT-PCR);

аллель-специфическая ПЦР (AS-PCR, PCR-SSP).allele-specific PCR (AS-PCR, PCR-SSP).

2) Химические методы:2) Chemical methods:

химическое расщепление гетеродуплексов;chemical splitting of heteroduplexes;

химическое лигирование.chemical ligation.

3) Методы, основанные на различной электрофоретической подвижности полиморфных участков ДНК:3) Methods based on different electrophoretic mobility of polymorphic DNA sections:

анализ конформации одноцепочечных фрагментов (SSCP);single chain fragment conformation analysis (SSCP);

гетеродуплексный анализ (НА);heteroduplex analysis (HA);

секвенирование.sequencing.

4) Детекция на твердой фазе:4) Solid phase detection:

гибридизация на олигонуклеотидных матрицах;hybridization on oligonucleotide matrices;

оптико-волоконный ДНК-гибридизационный анализ;fiber optic DNA hybridization analysis;

элонгация иммобилизованных праймеров (минисеквенирование);elongation of immobilized primers (minisequencing);

пиросеквенирование.pyrosequencing.

5) Хроматографические методы:5) Chromatographic methods:

высокоэффективная жидкостная хроматография (HPLC).high performance liquid chromatography (HPLC).

6) Физические методы:6) Physical methods:

масс-спектрометрия;mass spectrometry;

резонансное тушение флуоресценции (FRET);resonance fluorescence quenching (FRET);

люминесценция, зависящая от локального окружения.luminescence, depending on the local environment.

Наиболее распространенными из представленных методов являются:The most common methods presented are:

1. Анализ полиморфизма длин рестрикционных фрагментов ДНК (RFLP-анализ).1. Analysis of polymorphism of the lengths of restriction DNA fragments (RFLP analysis).

Определение полиморфного сайта рестрикции методом RFLP (restriction fragment length polymorphism) заключается в ПЦР-амплификации интересующего фрагмента и его последующем расщеплении соответствующим ферментом рестрикции. Далее проводится визуализация результатов рестрикции для оценки распределения фрагментов по длине различными методами, в том числе с помощью блот-гибридизации. Преимуществами метода являются простота и надежность, недостатками -длительность проведения анализа, трудоемкость, а также возможность детекции только известных полиморфных замен, при этом одновременно можно выявлять не более двух SNPs.Determination of the polymorphic restriction site by RFLP (restriction fragment length polymorphism) consists in the PCR amplification of the fragment of interest and its subsequent cleavage with the corresponding restriction enzyme. Next, visualization of the restriction results is carried out to assess the distribution of fragments along the length by various methods, including using blot hybridization. The advantages of the method are simplicity and reliability, the disadvantages are the duration of the analysis, the complexity, and the ability to detect only known polymorphic substitutions, while at the same time no more than two SNPs can be detected.

[Garcia AN, Silva HA, Silva RC, Leal EM, Rodrigues L, Silva VC, Dellalibera E, Freitas EM, Ataide L Jr, Muniz MT. APOE-epsilon4 polymorphism and cognitive deficit among the elderly population of Fernando de Noronha. Arq Neuropsiquiatr. 2008 Jun; 66(2B):298-302][Garcia AN, Silva HA, Silva RC, Leal EM, Rodrigues L, Silva VC, Dellalibera E, Freitas EM, Ataide L Jr, Muniz MT. APOE-epsilon4 polymorphism and cognitive deficit among the elderly population of Fernando de Noronha. Arq Neuropsiquiatr. 2008 Jun; 66 (2B): 298-302]

[Rihn BH, Berrahmoune S, Jouma M, Chamaa S, Marcocci L, Le Faou A. APOE genotyping: comparison of three methods. Clin Exp Med. 2009 Mar; 9(J):61-5][Rihn BH, Berrahmoune S, Jouma M, Chamaa S, Marcocci L, Le Faou A. APOE genotyping: comparison of three methods. Clin Exp Med. 2009 Mar; 9 (J): 61-5]

2. Секвенирование амплифицированных фрагментов ДНК.2. Sequencing of amplified DNA fragments.

Секвенирование является самым точным методом анализа генетических вариаций. Преимуществами метода являются высокая точность и чувствительность, недостатками - высокая стоимость оборудования, что исключает широкое внедрение метода в клиническую практику. Существует несколько модификаций реакции сиквенса, снижающих ее стоимость. Например, можно секвенировать сразу обе цепи в одной реакции используя два различно меченых праймера. Другой способ - использование SSR (single sequencing reaction), когда для терминации синтеза используется только один из четырех ddNTP. Активно разрабатываются способы совмещения ПЦР-амплификации и секвенирования в одной пробирке сразу для нескольких локусов.Sequencing is the most accurate method for analyzing genetic variations. The advantages of the method are high accuracy and sensitivity, the disadvantages are the high cost of equipment, which excludes the widespread introduction of the method in clinical practice. There are several modifications of the sequence reaction that reduce its cost. For example, both chains can be sequenced at once in the same reaction using two differently labeled primers. Another way is to use SSR (single sequencing reaction) when only one of the four ddNTPs is used to terminate the synthesis. Actively developing methods for combining PCR amplification and sequencing in a single tube for several loci at once.

[Rihn ВН, Berrahmoune S, Jouma М, Chamaa S, Marcocci L, Le Faou A. APOE genotyping: comparison of three methods. Clin Exp Med. 2009 Mar; 9(l):61-5][Rihn BH, Berrahmoune S, Jouma M, Chamaa S, Marcocci L, Le Faou A. APOE genotyping: comparison of three methods. Clin Exp Med. 2009 Mar; 9 (l): 61-5]

[Yang L, Lu R, Jiang L, Liu Z, Peng Y. Expression and genetic analysis of tumor necrosis factor-alpha (TNF-alpha) G-308A polymorphism in sporadic Alzheimer's disease in a Southern China population. Brain Res. 2009 Jan 9; 1247:178-81}[Yang L, Lu R, Jiang L, Liu Z, Peng Y. Expression and genetic analysis of tumor necrosis factor-alpha (TNF-alpha) G-308A polymorphism in sporadic Alzheimer's disease in a Southern China population. Brain Res. 2009 Jan 9; 1247: 178-81}

3. Аллель-специфичная ПЦР (AS-PCR).3. Allele-specific PCR (AS-PCR).

Для проведения ПЦР с высокой эффективностью 3′-концевой нуклеотид праймера должен быть комплементарен соответствующему нуклеотиду матричной ДНК. В противном случае эффективность удлинения праймера во время ПЦР резко снижается и при определенных сочетаниях ошибочно спаренных нуклеотидов может отсутствовать вообще. Именно эта особенность ПЦР и лежит в основе метода обнаружения мутаций и однонуклеотидного полиморфизма с помощью аллель-специфичной ПЦР, иначе называемой аллель-специфической элонгацией праймера. Преимуществом метода является высокая скорость, так как при правильно подобранных условиях анализ SNPs занимает всего 3-4 часа. К недостаткам метода можно отнести точность (большое количество ложноположительных результатов), трудоемкость (для каждого нового SNP необходимо корректировать условия реакции и тщательно подбирать последовательности праймеров), а также невозможность одновременной детекции большого числа SNP в одном анализе.For high-performance PCR, the 3′-terminal primer nucleotide must be complementary to the corresponding template DNA nucleotide. Otherwise, the efficiency of primer extension during PCR decreases sharply and may be absent altogether with certain combinations of mismatched nucleotides. It is this feature of PCR that underlies the method for detecting mutations and single nucleotide polymorphism using allele-specific PCR, otherwise called allele-specific elongation of the primer. The advantage of the method is its high speed, since under the right conditions SNPs analysis takes only 3-4 hours. The disadvantages of the method include accuracy (a large number of false-positive results), complexity (for each new SNP, it is necessary to adjust the reaction conditions and carefully select the sequence of primers), as well as the inability to simultaneously detect a large number of SNPs in one analysis.

[Lin GF, Ma QW, Zhang DS, Zha YL, Lou KJ, Shen JH. Polymorphism of alpha-estrogen receptor and aryl hydrocarbon receptor genes in dementia patients in Shanghai suburb. Acta Pharmacol Sin. 2003 Jul; 24(7):651-6][Lin GF, Ma QW, Zhang DS, Zha YL, Lou KJ, Shen JH. Polymorphism of alpha-estrogen receptor and aryl hydrocarbon receptor genes in dementia patients in Shanghai suburb. Acta Pharmacol Sin. 2003 Jul; 24 (7): 651-6]

4. Анализ конформации одноцепочечных фрагментов ДНК (SSCP). SSCP-анализ включает денатурацию ПЦР-продуктов и разделение их в неденатурирующем геле. Электрофоретическая подвижность одноцепочечных фрагментов ДНК зависит от их нуклеотидной последовательности, определяющей характер вторичных и третичных структур, и меняется даже при отличии в один нуклеотид. Преимуществами метода являются простота, чувствительность, относительно невысокая стоимость, возможность использования флуоресцентной метки и капиллярного электрофореза, что позволяет легко автоматизировать процесс и анализировать одновременно большое количество локусов. К недостаткам метода можно отнести низкую воспроизводимость результатов, особенно при обнаружении de novo мутаций, и невозможность анализа ряда SNP, особенно групп полиморфных замен, расположенных на близком расстоянии друг от друга.4. Conformational analysis of single-stranded DNA fragments (SSCP). SSCP analysis involves denaturing PCR products and separating them in a non-denaturing gel. The electrophoretic mobility of single-stranded DNA fragments depends on their nucleotide sequence, which determines the nature of secondary and tertiary structures, and changes even with a difference of one nucleotide. The advantages of the method are simplicity, sensitivity, relatively low cost, the possibility of using a fluorescent label and capillary electrophoresis, which makes it easy to automate the process and analyze at the same time a large number of loci. The disadvantages of the method include the low reproducibility of the results, especially when de novo mutations are detected, and the inability to analyze a number of SNPs, especially groups of polymorphic substitutions located at close distances from each other.

[Kamruecha W, Chansirikarnjana S, Nimkulrat E, Udommongkol C, Wongmek W, Thangnipon W. Rapid detection of apolipoprotein E genotypes in Alzheimer′s disease using polymerase chain reaction-single strand conformation polymorphism. Southeast Asian J Trop Med Public Health. 2006 Jul; 3 7(4): 793-7][Kamruecha W, Chansirikarnjana S, Nimkulrat E, Udommongkol C, Wongmek W, Thangnipon W. Rapid detection of apolipoprotein E genotypes in Alzheimer’s disease using polymerase chain reaction-single strand conformation polymorphism. Southeast Asian J Trop Med Public Health. 2006 Jul; 3 7 (4): 793-7]

[Ezquerra M, Carnero C, Blesa R, Oliva R. A novel presenilin 1 mutation (Leu166Arg) associated with early-onset Alzheimer disease. Arch Neurol. 2000 Apr;57(4):485-8][Ezquerra M, Carnero C, Blesa R, Oliva R. A novel presenilin 1 mutation (Leu166Arg) associated with early-onset Alzheimer disease. Arch Neurol. 2000 Apr; 57 (4): 485-8]

5. Гетеродуплексный анализ (НА).5. Heteroduplex analysis (HA).

При использовании данного метода денатурированные контрольный и анализируемый ПЦР-продукты не разделяют в геле, а сначала позволяют им ренатурировать. Одноцепочечные фрагменты образуют дуплексы. Если последовательности двух цепей полностью комплементарны, то будут образовываться гомодуплексы, если они отличаются хотя бы на один нуклеотид - гетеродуплексы. Гомо- и гетеродуплексы имеют разную электрофоретическую подвижность и могут быть разделены в неденатурирующем геле. В лабораторных исследованиях меченые Су5 красителем ПЦР-продукты с известным нуклеотидом в исследуемой позиции SNP смешивают с анализируемыми ПЦР-продуктами, после чего проводят детекцию. Преимуществом метода является простота визуализации результатов в обычном полиакриламидном геле. Недостатками метода являются низкая чувствительность (~80%), при этом для более эффективного разделения гомо- и гетеродуплексов требуется использование дорогостоящих вариантов гелей, а также невозможность определения точной локализации SNP внутри исследуемого фрагмента.When using this method, the denatured control and analyzed PCR products are not separated in the gel, but first allow them to renature. Single chain fragments form duplexes. If the sequences of two chains are completely complementary, then homoduplexes will form if they differ by at least one nucleotide — heteroduplexes. Homo- and heteroduplexes have different electrophoretic mobility and can be separated in a non-denaturing gel. In laboratory studies, dye-labeled Cy5 PCR products with a known nucleotide at the studied SNP position are mixed with the PCR products to be analyzed, after which detection is carried out. The advantage of the method is the simplicity of visualization of the results in a conventional polyacrylamide gel. The disadvantages of the method are low sensitivity (~ 80%), and more efficient separation of homo and heteroduplexes requires the use of expensive gel variants, as well as the impossibility of determining the exact localization of SNP inside the fragment under study.

[Ezquerra M, Carnero С, Blesa R, Oliva R. A novel presenilin 1 mutation (Leu166Arg) associated with early-onset Alzheimer disease. Arch Neurol. 2000 Apr; 57(4):485-8][Ezquerra M, Carnero C, Blesa R, Oliva R. A novel presenilin 1 mutation (Leu166Arg) associated with early-onset Alzheimer disease. Arch Neurol. 2000 Apr; 57 (4): 485-8]

[Ben-Avi L, Durst R, Shpitzen S, Leitersdorf E, Meiner V. Apolipoprotein E genotyping: accurate, simple, high throughput method using ABI Prism SNaPshot Multiplex System. J Alzheimers Dis. 2004 Oct; 6(5):497-501][Ben-Avi L, Durst R, Shpitzen S, Leitersdorf E, Meiner V. Apolipoprotein E genotyping: accurate, simple, high throughput method using ABI Prism SNaPshot Multiplex System. J Alzheimers Dis. 2004 Oct; 6 (5): 497-501]

6. Масс-спектрометрия.6. Mass spectrometry.

Метод заключается в том, что ионизированные молекулы ДНК (чаще всего специально подготовленные продукты ПЦР) отрываются от подложки методами MALDI (matrix-assisted laser desorption/ionisation) и ESI (electrospray ionisation). Они разгоняются в электрическом поле и направляются через вакуумную камеру к детектору. Время движения регистрируется. Время обратно пропорционально скорости молекулы, которая, в свою очередь, прямо пропорциональна отношению массы летящей молекулы к ее заряду. Поскольку отношение массы к заряду является уникальной величиной для каждой молекулы, основными преимуществами метода являются чувствительность и специфичность, а также минимально необходимое количество образца для проведения анализа. Недостатками метода являются трудоемкость, высокая стоимость оборудования, необходимость высококвалифицированных сотрудников и сложность использования вне крупных медицинских центров мегаполисов.The method consists in the fact that ionized DNA molecules (most often specially prepared PCR products) are detached from the substrate by the methods of MALDI (matrix-assisted laser desorption / ionization) and ESI (electrospray ionization). They are accelerated in an electric field and sent through a vacuum chamber to the detector. Motion time is recorded. Time is inversely proportional to the speed of the molecule, which, in turn, is directly proportional to the ratio of the mass of the flying molecule to its charge. Since the ratio of mass to charge is a unique value for each molecule, the main advantages of the method are sensitivity and specificity, as well as the minimum required amount of sample for analysis. The disadvantages of the method are the complexity, the high cost of equipment, the need for highly qualified employees and the difficulty of using megacities outside large medical centers.

[Yu JT, Мао СХ, Zhang HW, Zhang Q, Wu ZC, Yu NN, Zhang N, Li Y, Tan L. Genetic association of rs11610206 SNP on chromosome 12q13 with late-onset Alzheimer's disease in a Han Chinese population. Clin Chim Acta. 2011 Jan 14; 412(1-2):148-51][Yu JT, Mao SH, Zhang HW, Zhang Q, Wu ZC, Yu NN, Zhang N, Li Y, Tan L. Genetic association of rs11610206 SNP on chromosome 12q13 with late-onset Alzheimer's disease in a Han Chinese population. Clin Chim Acta. 2011 Jan 14; 412 (1-2): 148-51]

7. Анализ, основанный на лигазной реакции (LDR).7. Analysis based on ligase reaction (LDR).

Метод основан на высокой чувствительности к субстрату лигаз из термофильных организмов: они не способны делать сшивку в случае, если фланкирующие нуклеотиды некомплементарны матрице. Как правило, 3′-концевые мисматчи лучше дискриминируются, чем 5′-концевые. В реакции лигазной детекции (LDR, Ligase detection Reaction) используются три олигонуклеотида, два из которых флуоресцентно меченые аллель-специфичные (различаются только меткой и 3′-нуклеотидом, соответствующим позиции SNP), а третий располагается с 5′-конца от SNP и непосредственно примыкает к аллель-специфичному праймеру. Полученные лигированные фрагменты детектируются с помощью электрофореза. Преимуществом метода является возможность одновременного проведения большого числа параллельных реакций и, следовательно, параллельной детекции большого количества возможных SNP. К недостаткам метода можно отнести трудоемкость ввиду необходимости синтеза индивидуальных проб для каждого анализируемого SNP.The method is based on a high sensitivity to the substrate of ligases from thermophilic organisms: they are not able to cross-link if flanking nucleotides are not complementary to the matrix. As a rule, 3′-terminal mismatches are better discriminated than 5′-terminal mismatches. In the ligase detection reaction (LDR, Ligase detection Reaction), three oligonucleotides are used, two of which are fluorescently labeled allele-specific (differ only in label and 3′-nucleotide corresponding to the SNP position), and the third is located at the 5′-end from SNP and directly adjacent to the allele-specific primer. The resulting ligated fragments are detected by electrophoresis. The advantage of the method is the possibility of simultaneously carrying out a large number of parallel reactions and, therefore, parallel detection of a large number of possible SNPs. The disadvantages of the method include the complexity because of the need to synthesize individual samples for each analyzed SNP.

[Kay DM, Stevens CF, Hamza TH, Montimurro JS, Zabetian CP, Factor SA, Samii A, Griffith A, Roberts JW, Molho ES, Higgins DS, Gancher S, Moses L, Zareparsi S, Poorkaj P, Bird T, Nutt J, Schellenberg GD, Payami H. A comprehensive analysis of deletions, multiplications, and copy number variations in PARK2. Neurology. 2010 Sep 28; 75(13):1189-94][Kay DM, Stevens CF, Hamza TH, Montimurro JS, Zabetian CP, Factor SA, Samii A, Griffith A, Roberts JW, Molho ES, Higgins DS, Gancher S, Moses L, Zareparsi S, Poorkaj P, Bird T, Nutt J, Schellenberg GD, Payami H. A comprehensive analysis of deletions, multiplications, and copy number variations in PARK2. Neurology. 2010 Sep 28; 75 (13): 1189-94]

8. Гибридизация на олигонуклеотидных матрицах (биочипы или микроматрицы).8. Hybridization on oligonucleotide matrices (biochips or microarrays).

Микроматрица - это твердый носитель небольшого размера (например, стекло, нейлон или металлическая пластина) с прикрепленными к нему в определенном порядке короткими олигонуклеотидами (8-80 нуклеотидов) или фрагментами ДНК (размером более 100 нуклеотидов). Прикрепление одного из компонентов реакции к подложке позволяет проводить множество реакций одновременно посредством детекции пространственно разделенных отдельных однонуклеотидных замен (SNPs). Иммобилизованной может быть как контрольная ДНК с известной последовательностью, так и анализируемая ДНК с неизвестным нуклеотидом в вариабельной позиции. Микроматрицы могут применяться как для мутационного скрининга, так и для детекции известных аллелей. Иммобилизованная ДНК может непосредственно гибридизоваться с неизвестной последовательностью, и тогда эффективность гибридизации служит сигналом наличия/отсутствия мутации либо присутствующая в растворе ДНК может являться матрицей для синтеза ДНК с иммобилизованного праймера для определения прилежащего к нему нуклеотида. Преимуществами метода являются простота, низкая стоимость и возможность использования флуоресцентной метки, что позволяет легко автоматизировать процесс. К недостаткам метода можно отнести невозможность анализа тандемных повторов, а также высокую стоимость оборудования в некоторых модификациях метода.A microarray is a small solid carrier (for example, glass, nylon or a metal plate) with short oligonucleotides (8-80 nucleotides) or DNA fragments (larger than 100 nucleotides) attached to it in a certain order. Attaching one of the components of the reaction to the substrate allows multiple reactions to be carried out simultaneously by detecting spatially separated individual single nucleotide substitutions (SNPs). Both control DNA with a known sequence and an analyzed DNA with an unknown nucleotide in a variable position can be immobilized. Microarrays can be used both for mutational screening and for the detection of known alleles. Immobilized DNA can directly hybridize with an unknown sequence, and then the hybridization efficiency serves as a signal of the presence / absence of a mutation, or the DNA present in the solution can be a matrix for the synthesis of DNA from the immobilized primer to determine the nucleotide adjacent to it. The advantages of the method are simplicity, low cost and the possibility of using a fluorescent label, which makes it easy to automate the process. The disadvantages of the method include the impossibility of analyzing tandem repeats, as well as the high cost of equipment in some modifications of the method.

[Ducray F, Honnorat J, Lachuer J. DNA microarray technology: principles and applications to the study of neurological disorder. Rev Neurol (Paris). 2007 Apr; 163(4):409-20}[Ducray F, Honnorat J, Lachuer J. DNA microarray technology: principles and applications to the study of neurological disorder. Rev Neurol (Paris). 2007 Apr; 163 (4): 409-20}

[Lemos RR, Castelletti CH, Lima Filho JL, Marques ET Oliveira JR In silico identification of new genetic variations as potential risk factors for Alzheimer's disease in a microarray-oriented simulation. J Mol Neurosci. 2009 Sep; 39(l-2):242-7}[Lemos RR, Castelletti CH, Lima Filho JL, Marques ET Oliveira JR In silico identification of new genetic variations as potential risk factors for Alzheimer's disease in a microarray-oriented simulation. J Mol Neurosci. 2009 Sep; 39 (l-2): 242-7}

9. Минисеквенирование на олигонуклеотидном микрочипе.9. Mini-sequencing on an oligonucleotide microchip.

Гибридизующийся зонд используют в качестве матрицы для синтеза ДНК с иммобилизованного олигонуклеотида. Вместо dNTP можно добавлять в реакцию меченые ddNTP одновременно для терминации реакции синтеза и мечения получающегося продукта. Таким образом, можно получить информацию о следующем за праймером нуклеотиде, соответствующем позиции SNP. В отличие от чипов, используемых для гибридизационного анализа (the Affymetrix «Gene Chip»; «Affymetrix», США, в этом случае олигонуклеотиды иммобилизуются на поверхности за 5′-конец, оставляя 3′-конец свободным для элонгации. Существует множество вариаций этой методики и сама реакция может заключаться как в непосредственной элонгации праймера (если праймер располагается вплотную к SNP), так и в элонгации, определяемой праймером (если 3′-концевой нуклеотид праймера соответствует одному из аллельных состояний гена и эффективность элонгации праймера зависит от того, комплементарен этот нуклеотид матрице или нет). Метод позволяет с высокой точностью определять генотипы и проводить одновременный анализ более 20 SNPs, однако является достаточно дорогостоящим и не подходит для анализа повторов и некартированных делеций и дупликаций.A hybridizing probe is used as a template for the synthesis of DNA from an immobilized oligonucleotide. Instead of dNTP, labeled ddNTP can be added to the reaction at the same time to terminate the synthesis reaction and label the resulting product. Thus, it is possible to obtain information about the nucleotide following the primer corresponding to the SNP position. Unlike the chips used for hybridization analysis (the Affymetrix “Gene Chip”; “Affymetrix”, USA, in this case the oligonucleotides are immobilized on the surface at the 5′-end, leaving the 3′-end free for elongation. There are many variations of this technique and the reaction itself can consist in both direct primer elongation (if the primer is adjacent to the SNP) and elongation determined by the primer (if the 3′-terminal nucleotide of the primer corresponds to one of the allelic states of the gene and the primer elongation efficiency depends it depends on whether this nucleotide is complementary to the matrix or not.) The method allows one to determine genotypes with high accuracy and conduct simultaneous analysis of more than 20 SNPs, but it is quite expensive and not suitable for analysis of repeats and unmapped deletions and duplications.

[Ben-Avi L, Durst R, Shpitzen S, Leitersdorf E, Meiner V. Apolipoprotein E genotyping: accurate, simple, high throughput method using ABI Prism SNaPshot Multiplex System. J Alzheimers Dis. 2004 Oct; 6(5):497-501][Ben-Avi L, Durst R, Shpitzen S, Leitersdorf E, Meiner V. Apolipoprotein E genotyping: accurate, simple, high throughput method using ABI Prism SNaPshot Multiplex System. J Alzheimers Dis. 2004 Oct; 6 (5): 497-501]

[Podder M, Welch WJ, Zamar RH, Tebbutt SJ. Dynamic variable selection in SNP genotype autocalling from APEX microarray data. BMC Bioinformatics. 2006 Nov 30; 7:521][Podder M, Welch WJ, Zamar RH, Tebbutt SJ. Dynamic variable selection in SNP genotype autocalling from APEX microarray data. BMC Bioinformatics. 2006 Nov 30; 7: 521]

Таким образом, в настоящее время существует множество подходов для определения аллелей генов-кандидатов, ассоциированных с нейродегенеративными заболеваниями, в том числе с развитием болезни Альцгеймера. Данные подходы различаются набором маркеров (генотипируемые полиморфные локусы) и методами их определения. Так, например, в патенте US 2010035266 представлен способ определения генетической предрасположенности к болезни Альцгеймера путем определения однонуклеотидных замен в генах, продукты которых участвуют в биосинтезе стероидов. Анализ проводится с использованием метода раздельной амплификации исследуемых полиморфных локусов с помощью специфичных праймеров с дальнейшим секвенированием наработанных фрагментов на автоматическом секвенаторе «ABI 3730 XL DNA analyzer» (п. 2, метод секвенирования амплифицированных фрагментов ДНК).Thus, there are currently many approaches for determining the alleles of candidate genes associated with neurodegenerative diseases, including the development of Alzheimer's disease. These approaches differ in a set of markers (genotypic polymorphic loci) and methods for their determination. So, for example, in patent US 2010035266 a method for determining a genetic predisposition to Alzheimer's disease by determining single nucleotide substitutions in genes whose products are involved in steroid biosynthesis is presented. The analysis is carried out using the method of separate amplification of the studied polymorphic loci using specific primers with subsequent sequencing of the generated fragments on an ABI 3730 XL DNA analyzer automatic sequencer (step 2, method for sequencing amplified DNA fragments).

Следует отметить, что в полигенных заболеваниях, таких как спорадическая форма болезни Альцгеймера, зачастую наблюдается этническая гетерогенность генетических маркеров, ассоциированных с риском развития данных заболеваний. В данном патенте предлагается определять полиморфизм генов, показавших наиболее значимую ассоциацию с риском развития спорадической формы болезни Альцгеймера в российских популяциях.It should be noted that in polygenic diseases, such as the sporadic form of Alzheimer's disease, ethnic heterogeneity of genetic markers associated with the risk of developing these diseases is often observed. This patent proposes to determine the polymorphism of genes that have shown the most significant association with the risk of developing a sporadic form of Alzheimer's disease in Russian populations.

В патенте СА 2718392 предлагается определение полиморфизма 17 различных генов, ассоциированных с развитием болезни Альцгеймера, посредством ДНК-микрочипов фирмы «Affymetrix» (п. 8, метод гибридизации на олигонуклеотидных матрицах). Показано, что достоверность полученных результатов составляет около 90%. Кроме того, для многих из анализируемых генов, в частности для предшественника интегрина α2, циклина D3 и интерлейкина 3, ассоциация с заболеванием показана лишь на единичных популяциях и не подтверждена на других выборках. Кроме того, использование таких ДНК-микрочипов требует дорогостоящего оборудования и высокой квалификации персонала. Все это делает невозможным применение подобной тест-системы в клинических условиях.Patent CA 2718392 proposes the determination of polymorphism of 17 different genes associated with the development of Alzheimer's disease using Affymetrix DNA microarrays (paragraph 8, hybridization method on oligonucleotide matrices). It is shown that the reliability of the results is about 90%. In addition, for many of the analyzed genes, in particular for the precursor of integrin α2, cyclin D3 and interleukin 3, the association with the disease is shown only in single populations and is not confirmed in other samples. In addition, the use of such DNA microarrays requires expensive equipment and highly qualified personnel. All this makes it impossible to use such a test system in a clinical setting.

Ближайшим аналогом настоящего изобретения является метод, описанный в п. 8. Поскольку все имеющиеся в настоящее время методы определения полиморфизма в генах-кандидатах развития нейродегенеративных заболеваний обладают теми или иными недостатками, существует реальная потребность в создании простого, недорогого и специфичного метода для выявления функционально значимых полиморфных локусов, ассоциированных с развитием болезни Альцгеймера, с целью дальнейшего внедрения в любую стандартную клиническую лабораторию.The closest analogue of the present invention is the method described in paragraph 8. Since all currently available methods for determining polymorphism in candidate genes for the development of neurodegenerative diseases have one or another disadvantage, there is a real need for a simple, inexpensive and specific method for identifying functionally significant polymorphic loci associated with the development of Alzheimer's disease, with the goal of further introduction into any standard clinical laboratory.

Такой способ обеспечивается настоящим изобретением.Such a method is provided by the present invention.

Раскрытие изобретенияDisclosure of invention

Сущность изобретения заключается в обеспечении способа определения генетического полиморфизма, ассоциированного с риском развития спорадической формы болезни Альцгеймера в российских популяциях. Способ основан на проведении анализа полиморфизма генов, наиболее значимо ассоциированных с риском развития спорадической формы болезни Альцгеймера в российских популяциях - АроЕ, ApoJ и GAB2 (Низамутдинов, 2013).The essence of the invention is to provide a method for determining the genetic polymorphism associated with the risk of developing a sporadic form of Alzheimer's disease in Russian populations. The method is based on the analysis of polymorphism of genes most significantly associated with the risk of developing a sporadic form of Alzheimer's disease in Russian populations ApoE, ApoJ and GAB2 (Nizamutdinov, 2013).

Потенциальные механизмы влияния полиморфизма генов АроЕ (rs429358, rs7412), ApoJ (rs11136000) и GAB2 (rs2373115) на возникновение нейродегенеративных заболеваний, в том числе на развитие болезни Альцгеймера, представлены в Табл. 1.The potential mechanisms of the effect of the polymorphism of the ApoE (rs429358, rs7412), ApoJ (rs11136000) and GAB2 (rs2373115) genes on the occurrence of neurodegenerative diseases, including the development of Alzheimer's disease, are presented in Table. one.

Figure 00000001
Figure 00000001

ЛитератураLiterature

1. Низамутдинов И.И., Андреева Т.В., Степанов В.А., Марусин А.В., Рогаев Е.И., Заседателев А.С, Наседкина Т.В. Биочип для выявления генетических маркеров риска развития спорадической формы болезни Альцгеймера у славянского населения России. Молекулярная биология. 2013 47(6).949-958.1. Nizamutdinov I.I., Andreeva T.V., Stepanov V.A., Marusin A.V., Rogaev E.I., Zasedatelev A.S., Nasedkina T.V. A biochip for identifying genetic risk markers for the development of a sporadic form of Alzheimer's disease in the Slavic population of Russia. Molecular biology. 2013 47 (6) .949-958.

2. DeMattos RB. Apolipoprotein Е dose-dependent modulation of beta-amyloid deposition in a transgenic mouse model of Alzheimer's disease. J Mol Neurosci. 2004;23(3):255-62.2. DeMattos RB. Apolipoprotein E dose-dependent modulation of beta-amyloid deposition in a transgenic mouse model of Alzheimer's disease. J Mol Neurosci. 2004; 23 (3): 255-62.

3. Medh JD, Fry GL, Bowen SL, Ruben S, Wong H, Chappell DA. Lipoprotein lipase- and hepatic triglyceride lipase- promoted very low density lipoprotein degradation proceeds via an apolipoprotein E-dependent mechanism. J Lipid Res. 2000 Nov; 41(11):1858-71.3. Medh JD, Fry GL, Bowen SL, Ruben S, Wong H, Chappell DA. Lipoprotein lipase- and hepatic triglyceride lipase- promoted very low density lipoprotein degradation proceeds via an apolipoprotein E-dependent mechanism. J Lipid Res. 2000 Nov; 41 (11): 1858-71.

4. Reiman EM, Webster J A, Myers AJ, Hardy J, Dunckley T, Zismann VL, Joshipura KD, Pearson JV, Hu-Lince D, Huentelman MJ, Craig DW, Coon KD, Liang WS, Herbert RH, Beach T, Rohrer КС, Zhao AS, Leung D, Bryden L, Marlowe L, Kaleem M, Mastroeni D, Grover A, Heward CB, Ravid R, Rogers J, Hutton ML, Melquist S, Petersen RC, Alexander GE, Caselli RJ, Kukull W, Papassotiropoulos A, Stephan DA. GAB2 alleles modify Alzheimer′s risk in APOE epsilon4 carriers. Neuron. 2007 Jun 7; 54(5):713-20.4. Reiman EM, Webster JA, Myers AJ, Hardy J, Dunckley T, Zismann VL, Joshipura KD, Pearson JV, Hu-Lince D, Huentelman MJ, Craig DW, Coon KD, Liang WS, Herbert RH, Beach T, Rohrer KS, Zhao AS, Leung D, Bryden L, Marlowe L, Kaleem M, Mastroeni D, Grover A, Heward CB, Ravid R, Rogers J, Hutton ML, Melquist S, Petersen RC, Alexander GE, Caselli RJ, Kukull W, Papassotiropoulos A, Stephan DA. GAB2 alleles modify Alzheimer′s risk in APOE epsilon4 carriers. Neuron 2007 Jun 7; 54 (5): 713-20.

Основным аспектом данного изобретения является набор иммобилизованных дифференцирующих олигонуклеотидов, последовательности которых приведены в Табл. 2 и Перечне последовательностей (SEQ ID NO: 1-8). Дифференцирующие олигонуклеотиды (SEQ ID NO: 1-8) могут быть иммобилизованы в ячейках гидогелевого микрочипа, как описано в патенте [Мирзабеков А.Д., Рубина А.Ю., Паньков С. В., Перов А.Н., Чупеева В.В. (2003). Композиция для иммобилизации биологических макромолекул в гидрогелях, способ приготовления композиции, биочип, способ проведения ПЦР на биочипе. Патент RU 2206575 С2], в концентрации 2000-4000 пкмоль на 1 мкл геля. Схема расположения ячеек, содержащих олигонуклеотидные зонды для анализа генетической предрасположенности к болезни Альцгеймера, приведена на Фиг. 1. Проведение анализа с использованием предлагаемого изобретения выполняется аналогично способу, описанному в патенте [Заседателев А.С., Наседкина Т.В., Глотов А.С.(2007) Способ анализа генетического полиморфизма, определяющего предрасположенность к онкологическим заболеваниям и индивидуальную чувствительность к фармацевтическим препаратам, с использованием олигонуклеотидного биологического микрочипа (биочипа). Патент RU 2303634].The main aspect of this invention is a set of immobilized differentiating oligonucleotides, the sequences of which are given in Table. 2 and the List of sequences (SEQ ID NO: 1-8). Differentiating oligonucleotides (SEQ ID NO: 1-8) can be immobilized in the cells of a hydrogel microchip, as described in the patent [Mirzabekov AD, Rubina A.Yu., Pankov SV, Perov AN, Chupeeva V .AT. (2003). A composition for immobilizing biological macromolecules in hydrogels, a method for preparing a composition, a biochip, a method for performing PCR on a biochip. Patent RU 2206575 C2], at a concentration of 2000-4000 pmol per 1 μl of gel. An arrangement of cells containing oligonucleotide probes for analyzing a genetic predisposition to Alzheimer's disease is shown in FIG. 1. The analysis using the invention is carried out similarly to the method described in the patent [Zasedatelev AS, Nasedkina TV, Glotov AS (2007) Method for the analysis of genetic polymorphism, which determines the predisposition to cancer and individual sensitivity to pharmaceutical preparations using an oligonucleotide biological microchip (biochip). Patent RU 2303634].

Другим аспектом изобретения являются праймеры для амплификации полиморфных ДНК-локусов исследуемых генов, набор которых используется для получения изучаемых флуоресцентно меченых фрагментов ДНК в требуемом количестве. Последовательности праймеров приведены в Табл. 3 и Перечне последовательностей (SEQ ID NO: 9-20).Another aspect of the invention are primers for amplification of polymorphic DNA loci of the studied genes, a set of which is used to obtain the studied fluorescently labeled DNA fragments in the required amount. Primer sequences are given in Table. 3 and the List of sequences (SEQ ID NO: 9-20).

Набор праймеров используется на стадии предварительной амплификации полиморфных ДНК-локусов посредством проведения двухэтапной «гнездовой» ПЦР для подготовки ДНК-мишени к гибридизации на биочипе. На первом этапе проходит амплификация фрагмента геномной ДНК, на втором этапе с амплифицированного фрагмента нарабатывается одноцепочечная ДНК с одновременным введением флуоресцентной метки. Далее проводится гибридизация флуоресцентно меченых фрагментов ДНК, полученных после проведения второго этапа ПЦР, с иммобилизованными в ячейках геля олигонуклеотидами, расположенными на пластиковой подложке. После проведения гибридизации и отмывки биочипа проводится анализ полученной флуоресцентной картины, на основании которого делается вывод о генотипе в исследуемом образце. Пример гибридизационной картины приведен на Фиг. 2.A set of primers is used at the stage of preliminary amplification of polymorphic DNA loci by means of two-stage “nested” PCR for preparing the target DNA for hybridization on a biochip. At the first stage, the amplification of a fragment of genomic DNA takes place, at the second stage, single-stranded DNA is generated from the amplified fragment with the simultaneous introduction of a fluorescent label. Next, a hybridization of fluorescently labeled DNA fragments obtained after the second stage of PCR is carried out with oligonucleotides immobilized in gel cells located on a plastic substrate. After hybridization and washing of the biochip, an analysis of the obtained fluorescence pattern is carried out, based on which a conclusion is made about the genotype in the test sample. An example of a hybridization pattern is shown in FIG. 2.

Осуществление изобретенияThe implementation of the invention

Задача настоящего изобретения состоит в создании способа экспресс-анализа, позволяющего проводить генотипирование по четырем полиморфным ДНК-локусам генов АроЕ (rs429358, rs7412), ApoJ (rs11136000) и GAB2 (rs2373115).The objective of the present invention is to provide a rapid analysis method that allows genotyping of four polymorphic DNA loci of the ApoE (rs429358, rs7412), ApoJ (rs11136000) and GAB2 (rs2373115) genes.

Дифференцирующие олигонуклеотиды для определения генетической предрасположенности к болезни Альцгеймера подбираются таким образом, чтобы идентифицировать все выбранные для анализа вариабельные позиции в генах АроЕ, ApoJ, и GAB2.Differentiating oligonucleotides for determining the genetic predisposition to Alzheimer's disease are selected in such a way as to identify all the variable positions selected for analysis in the ApoE, ApoJ, and GAB2 genes.

Олигонуклеотиды должны соответствовать следующим критериям:Oligonucleotides must meet the following criteria:

1. Дискриминирующий зонд должен обладать высокой специфичностью к выбранному для анализа полиморфному локусу, который представляет собой участок гена, амплифицированный с помощью ПЦР, с включенной флуоресцентной меткой.1. The discriminating probe should have high specificity for the polymorphic locus selected for analysis, which is a region of a gene amplified by PCR with a fluorescent label on.

2. Вариабельный нуклеотид должен находиться в серединной области зонда, поскольку такое положение позволяет добиться большей дискриминации между совершенными и несовершенными дуплексами.2. The variable nucleotide should be in the middle region of the probe, since this position allows for greater discrimination between perfect and imperfect duplexes.

3. Выбранные олигонуклеотиды не должны содержать высокостабильных вторичных структур, наличие которых может приводить к снижению эффективности гибридизации.3. The selected oligonucleotides should not contain highly stable secondary structures, the presence of which can lead to a decrease in the efficiency of hybridization.

Для идентификации каждого однонуклеотидного полиморфизма используются два специфичных дискриминирующих олигонуклеотида. При гибридизации с гомозиготной пробой один из них образовывает с пробой совершенный, а другой - несовершенный дуплекс. При одновременном анализе двух полиморфных сайтов в гене АроЕ количество специфических пар олигонуклеотидов соответствует количеству анализируемых сайтов, что позволяет определять наличие аллелей ε2 (сочетание rs429358 (Т), rs7412 (Т)), ε3 (сочетание rs429358 (Т), rs7412 (С)) и ε4 (сочетание rs429358 (С), rs7412 (С)).Two specific discriminating oligonucleotides are used to identify each single nucleotide polymorphism. In hybridization with a homozygous breakdown, one of them forms a perfect one with the breakdown, and the other forms an imperfect duplex. When simultaneously analyzing two polymorphic sites in the APOE gene, the number of specific pairs of oligonucleotides corresponds to the number of sites analyzed, which allows one to determine the presence of ε2 alleles (combination of rs429358 (T), rs7412 (T)), ε3 (combination of rs429358 (T), rs7412 (C)) and ε4 (combination of rs429358 (C), rs7412 (C)).

Для определения генетической предрасположенности к болезни Альцгеймера используется 8 иммобилизованных высокоспецифичных дифференцирующих олигонуклеотидных зондов (Табл. 2 и Перечень последовательностей (SEQ ID NO: 1-8)), структура которых обеспечивает связывание только с полностью комплементарными ДНК-мишенями, что, в свою очередь, обуславливает яркий флуоресцентный сигнал и дает наиболее четкие картины распределения гибридизационных сигналов. Неспецифическое связывание сведено к минимуму, что практически исключает ложноположительное «срабатывание» ячеек.To determine the genetic predisposition to Alzheimer's disease, 8 immobilized highly specific differentiating oligonucleotide probes (Table 2 and the List of sequences (SEQ ID NO: 1-8)) are used, the structure of which ensures binding only to fully complementary DNA targets, which, in turn, causes a bright fluorescent signal and gives the most clear picture of the distribution of hybridization signals. Nonspecific binding is minimized, which virtually eliminates false positive “triggering” of cells.

Figure 00000002
Figure 00000002

Для обеспечения оптимального состава и структуры ПЦР-праймеров, используемых в протоколе мультиплексной ПЦР, необходимы такие праймеры, которые не образуют между собой высокоэнергетических внутренних структур (шпильки и дуплексы), обеспечивают специфичную амплификацию необходимого количества продукта и при этом подобраны таким образом, чтобы их отжиг на мишени происходил при одинаковой для всех температуре (60-64°С). Для обеспечения сбалансированной эффективной амплификации исследуемых образцов также должны быть оптимизированы такие параметры, как концентрация MgCl2 и ПЦР-праймеров в ПЦР-смеси, соотношение прямых и обратных праймеров, количество циклов амплификации на обоих этапах, время элонгации, денатурации и отжига праймеров, температура отжига праймеров на каждом этапе. В результате проведенной работы подобраны праймеры 1 и 2 этапа, которые позволяют осуществлять эффективную наработку фрагментов геномной ДНК, содержащих выбранные функционально значимые полиморфные локусы генов-кандидатов развития спорадической формы болезни Альцгеймера АроЕ, ApoJ и GAB2.To ensure the optimal composition and structure of the PCR primers used in the multiplex PCR protocol, primers are necessary that do not form high-energy internal structures (studs and duplexes), provide specific amplification of the required amount of product and are selected so that they are annealed on the target occurred at the same temperature for all (60-64 ° C). To ensure balanced effective amplification of the studied samples, parameters such as the concentration of MgCl 2 and PCR primers in the PCR mixture, the ratio of forward and reverse primers, the number of amplification cycles at both stages, elongation, denaturation and annealing of primers, annealing temperature should also be optimized primers at each stage. As a result of the work, stage 1 and 2 primers were selected that allow efficient production of genomic DNA fragments containing selected functionally significant polymorphic loci of candidate genes for the development of the sporadic form of Alzheimer's ApoE, ApoJ and GAB2.

Приведем последовательность анализа с использованием данного метода. Наработка ПЦР-продуктов для последующей гибридизации с олигонуклеотидными зондами, представленными в Табл. 2, проводится посредством «гнездовой» мультиплексной ПЦР в два этапа, при этом в качестве матрицы для проведения реакции используют образец ДНК. ПЦР может быть проведена с использованием любого вида термостабильной полимеразы (Taq-полимераза, Tth-полимераза, Tfl-полимераза, Pfu-полимераза, Vent-полимераза, DeepVent-полимераза и т.п. коммерчески доступные ферменты, выделенные из термофилов), работающей в соответствующем буфере. Для построения новой цепи в буфер добавляется смесь дНТФ (дАТФ, дГТФ, дЦТФ, дТТФ) в принятых концентрациях, при этом вместо дТТФ может быть использован дУТФ. Для проведения ПЦР могут быть использованы готовые коммерчески доступные наборы, содержащие все необходимые компоненты за исключением праймеров.Here is the sequence of analysis using this method. The accumulation of PCR products for subsequent hybridization with oligonucleotide probes presented in Table. 2 is carried out by means of “nested” multiplex PCR in two stages, and a DNA sample is used as a template for the reaction. PCR can be carried out using any type of thermostable polymerase (Taq polymerase, Tth polymerase, Tfl polymerase, Pfu polymerase, Vent polymerase, DeepVent polymerase, etc. commercially available enzymes isolated from thermophiles) operating in appropriate buffer. To build a new chain, a mixture of dNTPs (dATP, dGTF, dTTP, dTTP) in the accepted concentrations is added to the buffer, and dUTP can be used instead of dTTP. For PCR, ready-made commercially available kits containing all the necessary components except primers can be used.

На первом этапе проходит амплификация полиморфных ДНК-локусов генов-кандидатов развития спорадической формы болезни Альцгеймера АроЕ, ApoJ и GAB2. Продукт первого этапа ПЦР используют в качестве матрицы на втором этапе, который проводят в реакционной смеси того же состава, но добавляют избыток одного из праймеров для обеспечения избытка флуоресцентно меченого одноцепочечного ПЦР-продукта. Это позволяет получать одноцепочечный ампликон, способный к гибридизации с аллель-специфичными ДНК-зондами на биочипе. Флуоресцентное мечение проводят на втором этапе ПЦР одновременно с амплификацией одноцепочечных фрагментов ДНК посредством введения флуоресцентной метки. В качестве флуоресцентной метки используется дезоксинуклеотидтрифосфат, а именно Су5-дУТФ, встраивающийся de novo в синтезируемую ДНК-цепь. В качестве флуоресцентной метки также может быть использован любой флуорохром без ограничения (например, FITC, Texas red, Су-3 и т.д.), а также биотин.At the first stage, amplification of polymorphic DNA loci of candidate genes for the development of the sporadic form of Alzheimer's disease ApoE, ApoJ, and GAB2 takes place. The product of the first PCR step is used as a matrix in the second step, which is carried out in the reaction mixture of the same composition, but an excess of one of the primers is added to provide an excess of the fluorescently labeled single chain PCR product. This makes it possible to obtain a single-stranded amplicon capable of hybridization with allele-specific DNA probes on a biochip. Fluorescence labeling is carried out at the second stage of PCR simultaneously with amplification of single-stranded DNA fragments by introducing a fluorescent label. As a fluorescent label, deoxynucleotide triphosphate is used, namely, Su5-dUTP, which is inserted de novo into the synthesized DNA chain. Any fluorochrome without restriction (for example, FITC, Texas red, Su-3, etc.), as well as biotin, can also be used as a fluorescent label.

Праймеры и олигонуклеотидные зонды синтезируют с использованием различных химических подходов, таких как фосфодиэфирный метод, гидрофосфорильный метод и т.д., при этом наиболее распространенным в настоящее время является фосфоамидитный метод синтеза. Синтез праймеров осуществляют, используя автоматические ДНК/РНК синтезаторы, например производства фирмы «Applied Biosystems» (США).Primers and oligonucleotide probes are synthesized using various chemical approaches, such as the phosphodiester method, hydrophosphoryl method, etc., while the most common is the phosphoamidite synthesis method. The synthesis of primers is carried out using automatic DNA / RNA synthesizers, for example, manufactured by Applied Biosystems (USA).

Для иммобилизации могут быть использованы олигонуклеотиды, несущие по 5′- или 3′-концу активную группу. Модификация олигонуклеотида для введения активной группы может быть осуществлена как в автоматическом режиме при синтезе с использованием широкого спектра коммерчески доступных модификаторов, так и постсинтетически в ручном режиме. Например, при синтезе олигонуклеотидных зондов с помощью 3′-Amino-Modifier С7 CPG 500 («Glen Research)), США) на 3′-конец олигонуклеотидов вводится спейсер со свободной аминогруппой, используемый для последующей иммобилизации олигонуклеотида на подложке.For immobilization, oligonucleotides carrying an active group at the 5 ′ or 3 ′ end can be used. Modification of the oligonucleotide for the introduction of the active group can be carried out both automatically in the synthesis using a wide range of commercially available modifiers, and postsynthetically in the manual mode. For example, in the synthesis of oligonucleotide probes using the 3′-Amino-Modifier C7 CPG 500 (Glen Research), USA), a free amino group spacer is introduced at the 3′-end of the oligonucleotides, which is used for subsequent immobilization of the oligonucleotide on a substrate.

В качестве праймеров для проведения мультиплексной «гнездовой» двухэтапной ПЦР используют праймеры SEQ ID NO: 9-20, приведенные в Перечне последовательностей и в Табл. 3.As primers for conducting multiplex "nested" two-stage PCR using primers SEQ ID NO: 9-20, shown in the List of sequences and in Table. 3.

В мультиплексной реакции I этапа используют праймеры: 9, 10, 13, 14, 17, 18;In the multiplex reaction of stage I, primers are used: 9, 10, 13, 14, 17, 18;

В мультиплексной реакции II этапа используют праймеры: 11, 12, 15, 16, 19, 20;In the multiplex reaction of stage II, primers are used: 11, 12, 15, 16, 19, 20;

Далее проводится гибридизация флуоресцентно меченых фрагментов ДНК, полученных после проведения второго этапа ПЦР, с иммобилизованными в ячейках геля олигонуклеотидами, которые представляют собой полиморфные участки генов и являются комплементарными как последовательности «дикого типа» (предковый аллельный вариант), так и вариабельной последовательности (производный аллель).Next, hybridization of the fluorescently labeled DNA fragments obtained after the second PCR step is carried out with oligonucleotides immobilized in the gel cells, which are polymorphic regions of genes and are complementary to both the wild-type sequence (ancestral allelic variant) and the variable sequence (derived allele )

Figure 00000003
Figure 00000003

Перед постановкой гибридизации ампликон денатурируют путем прогрева готовой гибридизационной смеси при 95°С в течение 5 мин с последующим быстрым охлаждением на льду. Гибридизация может быть проведена в любом известном специалисту в данной области гибридизационном буфере, например в гуанидиновом или SSPE-буфере. Типичное время гибридизации составляет 12-14 ч при 37°С. Анализ генотипов и аллелей в исследуемом образце проводится с учетом расположения олигонуклеотидных зондов на биочипе, схема которого позволяет определить, какие варианты присутствуют в том или ином образце.Before setting the hybridization, the amplicon is denatured by heating the finished hybridization mixture at 95 ° C for 5 minutes, followed by rapid cooling on ice. Hybridization can be carried out in any hybridization buffer known to those skilled in the art, for example, in a guanidine or SSPE buffer. Typical hybridization times are 12-14 hours at 37 ° C. Analysis of genotypes and alleles in the test sample is carried out taking into account the location of oligonucleotide probes on the biochip, the scheme of which allows you to determine which options are present in a particular sample.

Анализируемый фрагмент ДНК образует совершенные гибридизационные дуплексы только с соответствующими полностью комплементарными ему олигонуклеотидами. Если последовательность анализируемой ДНК полностью комплементарна последовательности зонда, то образуется стабильный совершенный дуплекс (детектируется сигнал флуоресценции). В случае если искомого фрагмента нет или в нем находится некомплементарное основание, то стабильного дуплекса не образуется (сигнал флуоресценции отсутствует). Дискриминацию совершенных и несовершенных дуплексов проводят после отмывки биочипа, сравнивая интенсивности сигналов флуоресценции, соответствующих различным олигонуклеотидным зондам. Отмывка может быть проведена в любом известном в данной области техники буфере с добавлением соли (SSC, SSPE и т.п.) или в деионизованной воде, но за более короткое время [Sambrook J.F. & D.W. Russell (2001) "Molecular cloning: a laboratory manual" Cold Spring Harbor Laboratory Press].The analyzed DNA fragment forms perfect hybridization duplexes only with the corresponding oligonucleotides fully complementary to it. If the sequence of the analyzed DNA is completely complementary to the sequence of the probe, then a stable perfect duplex is formed (a fluorescence signal is detected). If the desired fragment is absent or there is an incomplete base in it, then no stable duplex is formed (there is no fluorescence signal). Discrimination of perfect and imperfect duplexes is carried out after washing the biochip, comparing the intensities of the fluorescence signals corresponding to different oligonucleotide probes. Washing can be carried out in any buffer known in the art with the addition of salt (SSC, SSPE, etc.) or in deionized water, but in a shorter time [Sambrook J.F. & D.W. Russell (2001) "Molecular cloning: a laboratory manual" Cold Spring Harbor Laboratory Press].

После проведения гибридизации и отмывки проводится визуализация результатов гибридизации с помощью возбуждения флуоресценции меченого ПЦР-продукта второго этапа ПЦР, на основании которой делается вывод о генотипе в исследуемом образце. Регистрация гибридизационной картины может быть произведена с помощью любой детектирующей системы, распознающей флуоресцентный сигнал (флуоресцентный микроскоп с ПЗС-камерой, лазерный сканер, портативный анализатор биочипов и т.п. коммерчески доступные флуоресцентные анализаторы, например портативный анализатор биочипов, снабженный ПЗС-камерой и специальным программным обеспечением, производства ООО «БИОЧИП-ИМБ» (Россия)).After hybridization and washing, the results of hybridization are visualized by excitation of fluorescence of the labeled PCR product of the second stage of PCR, based on which a conclusion is made about the genotype in the test sample. The hybridization pattern can be recorded using any detection system that recognizes a fluorescent signal (fluorescence microscope with a CCD camera, a laser scanner, a portable biochip analyzer, etc. commercially available fluorescence analyzers, for example, a portable biochip analyzer equipped with a CCD camera and a special software, manufactured by BIOCHIP-IMB LLC (Russia).

Иммобилизация олигонуклеотидных зондов осуществляется посредством нанесения на поверхность подложки матрицы из ячеек акриламидного геля, активации ячеек и ковалентной иммобилизации в ячейках модифицированных олигонуклеотидов, несущих активные группы [Kolchinsky A, Mirzabekov A. Analysis of SNPs and other genomic variations using gel-based chips. Hum Mutat. 2002 Apr; 19(4):343-60. Review]. В качестве материала подложки может быть использовано стекло, металл, гибкие мембраны и пластик [Паньков С.В., Крейндлин Э.Я., Сомова О.Г., Моисеева О.В., Барский В.Е., Заседателев А.С.(2007) Применение немодифицированных полимерных материалов для изготовления подложки биочипов, биочип на их основе и способ его изготовления, способ иммобилизации гидрогелей на немодифицированных полимерных материалах. Патент RU 2309959]. Подложки также могут быть изготовлены любыми другими известными специалисту в данной области способами [Seliger Н, Hinz М, Нарр Е. Arrays of immobilized oligonucleotides-contributions to nucleic acids technology. Curr Pharm Biotechnol. 2003 Dec; 4(6):379-95].The oligonucleotide probes are immobilized by applying a matrix of acrylamide gel cells to the substrate surface, activating the cells and covalently immobilizing the modified oligonucleotides in the cells carrying active groups [Kolchinsky A, Mirzabekov A. Analysis of SNPs and other genomic variations using gel-based chips. Hum mutat. 2002 Apr; 19 (4): 343-60. Review]. As the substrate material, glass, metal, flexible membranes, and plastic can be used [Pankov SV, Kreindlin E.Ya., Somova OG, Moiseeva OV, Barsky V.E., Zasedatelev A.S. . (2007) The use of unmodified polymeric materials for the manufacture of biochip substrates, a biochip based on them and a method for its manufacture, a method for immobilizing hydrogels on unmodified polymeric materials. Patent RU 2309959]. Substrates can also be made by any other methods known to the person skilled in the art [Seliger H, Hinz M, Narr E. Arrays of immobilized oligonucleotides-contributions to nucleic acids technology. Curr Pharm Biotechnol. 2003 Dec; 4 (6): 379-95].

Для иммобилизации в настоящем изобретении используется набор олигонуклеотидов SEQ ID NO: 1-8, приведенных в Перечне последовательностей, а также в Табл. 2. В качестве контроля прохождения гибридизации в настоящем изобретении используют образец контрольной ДНК. Расположение конкретных олигонуклеотидных зондов на биочипе может варьироваться и определяется только удобством интерпретации результатов гибридизации.For immobilization in the present invention uses a set of oligonucleotides SEQ ID NO: 1-8, shown in the List of sequences, as well as in Table. 2. As a control for hybridization, a control DNA sample is used in the present invention. The location of specific oligonucleotide probes on the biochip can vary and is determined only by the convenience of interpreting the results of hybridization.

Далее приводятся примеры, которые показывают применение способа анализа однонуклеотидного полиморфизма для определения генетической предрасположенности к спорадической форме болезни Альцгеймера. Следует понимать, что приводимые примеры служат исключительно для иллюстрации и не предназначены для ограничения объема притязаний, выраженных в формуле изобретения. На основании настоящего описания специалист в данной области сможет легко предложить свои варианты и модификации осуществления изобретения, не отходя от общей концепции настоящего изобретения и без привлечения собственной изобретательской деятельности, так что должно быть понятно, что такие варианты и модификации также будут входить в объем притязаний настоящего изобретения.The following are examples that show the application of a single nucleotide polymorphism analysis method for determining a genetic predisposition to the sporadic form of Alzheimer's disease. It should be understood that the examples provided are for illustration only and are not intended to limit the scope of the claims expressed in the claims. Based on the present description, a person skilled in the art will be able to easily suggest their options and modifications of the invention without departing from the general concept of the present invention and without involving their own inventive activity, so it should be clear that such options and modifications will also be included in the scope of the claims of this inventions.

Пример 1. Амплификация фрагментов генов АроЕ, ApoJ и GAB2 методом двухэтапной «гнездовой» мультиплексной ПЦР с целью получения флуоресцентно меченого полиморфного ДНК-локуса гена в необходимом количестве.Example 1. Amplification of fragments of ApoE, ApoJ and GAB2 genes by the method of two-stage "nested" multiplex PCR in order to obtain the necessary amount of fluorescently labeled polymorphic DNA locus of the gene.

Из слюны испытуемых была выделена ДНК набором Oragene™ DNA Self-Collection Kit («DNA Genotek», Канада). Для мультиплексной наработки всех анализируемых генов использовали ПЦР-праймеры SEQ ID NO: 9, 10, 13, 14, 17 и 18. Первый этап ПЦР проводили на приборе MiniCycler («MJ Research, Inc.», США) в объеме 25 мкл реакционной смеси, составом: 1×ПЦР-буфер (67 мМ Трис-HCl, рН 8,6, 166 мМ (NH4)2SO4), 1,5 мМ MgCl2, 0,2 мМ каждого из dNTP («Силекс», Россия), по 5 рМ каждого праймера (SEQ ID NO: 9, 10, 13, 14, 17 и 18), 1 мкл геномной ДНК и 1,5 ед. акт.Taq-полимеразы («Силекс», Россия). ДНК денатурировали 5 мин при 94°С и проводили 40 циклов амплификации (94°С - 30 с, 65°С - 30 с, 72°С - 30 с), затем 10 мин при 72°С. Смесь второго этапа ПЦР отличалась составом и концентрацией праймеров: прямые праймеры (SEQ ID NO: 11, 15 и 19) брали в концентрации 5 пкмоль/мкл, обратные праймеры (SEQ ID NO: 12, 16 и 20) - 50 пкмоль/мкл. В смесь добавляли 2 мкл продукта из первого этапа и проводили амплификацию по схеме: 5 мин 94°С, 40 циклов (94°С - 30 с, 60°С - 30 с, 72°С - 30 с), 10 мин при 72°С. Также на втором этапе одновременно с проведением преимущественной амплификации одноцепочечного фрагмента ДНК проводили флуоресцентное мечение посредством добавления в ПЦР-смесь дезоксиуридинтрифосфата, меченого флуоресцентным красителем Су-5 (Су5-дУТФ), в количестве 0,2 нмоль на реакцию.DNA was isolated from the test saliva using the Oragene ™ DNA Self-Collection Kit (DNA Genotek, Canada). For multiplex production of all analyzed genes, PCR primers SEQ ID NO: 9, 10, 13, 14, 17, and 18 were used. The first PCR step was performed on a MiniCycler instrument (MJ Research, Inc., USA) in a volume of 25 μl of the reaction mixture , composition: 1 × PCR buffer (67 mm Tris-HCl, pH 8.6, 166 mm (NH 4 ) 2 SO 4 ), 1.5 mm MgCl 2 , 0.2 mm each of dNTP ("Sileks", Russia), 5 rM of each primer (SEQ ID NO: 9, 10, 13, 14, 17 and 18), 1 μl of genomic DNA and 1.5 units. Act. Taq polymerase (Sileks, Russia). DNA was denatured for 5 min at 94 ° C and 40 amplification cycles were performed (94 ° C for 30 s, 65 ° C for 30 s, 72 ° C for 30 s), then 10 min at 72 ° C. The mixture of the second PCR step differed in the composition and concentration of primers: direct primers (SEQ ID NO: 11, 15, and 19) were taken at a concentration of 5 pmol / μl, reverse primers (SEQ ID NO: 12, 16, and 20) - 50 pmol / μl. 2 μl of the product from the first stage was added to the mixture and amplification was performed according to the scheme: 5 min 94 ° C, 40 cycles (94 ° C - 30 s, 60 ° C - 30 s, 72 ° C - 30 s), 10 min at 72 ° C. Also, at the second stage, simultaneously with the predominant amplification of a single-stranded DNA fragment, fluorescence labeling was carried out by adding 0.2-mmol per reaction to the reaction using a deoxyuridine triphosphate labeled with the fluorescent dye Su-5 (Cy5-dUTP).

Пример 2. Иммобилизация дифференцирующих олигонуклеотидных зондов для определения генетического полиморфизма в генах-кандидатах предрасположенности к спорадической форме болезни Альцгеймера АроЕ, ApoJ и GAB2.Example 2. Immobilization of differentiating oligonucleotide probes to determine genetic polymorphism in candidate genes predisposed to the sporadic form of Alzheimer's disease ApoE, ApoJ and GAB2.

Олигонуклеотиды для иммобилизации синтезируют на автоматическом синтезаторе 394 DNA/RNA Synthesizer («Applied Biosystems», США) с использованием стандартной фосфоамидитной процедуры. 5′ или 3′-конец олигонуклеотидов содержит спейсер со свободной аминогруппой, который вводят в состав олигонуклеотида при синтезе путем использования 3′-Amino-Modifier С7 CPG 500 («Glen Research)), США). Присоединение флуоресцентной метки к олигонуклеотидам по свободной аминогруппе осуществляют в соответствии с рекомендациями производителя. Олигонуклеотиды, меченые цианиновым красителем Су-3, очищают методом ВЭЖХ от олигонуклеотидов, не включивших флуоресцентный краситель, на колонке «Hypersil ODS» 5 мкм, 4,6×250 мм» («Sypelco Int», США).Immobilization oligonucleotides are synthesized on a 394 DNA / RNA Synthesizer (Applied Biosystems, USA) using a standard phosphoamidite procedure. The 5 ′ or 3 ′ end of the oligonucleotides contains a free amino group spacer, which is introduced into the oligonucleotide by synthesis using the 3′-Amino-Modifier C7 CPG 500 (Glen Research), USA). The addition of a fluorescent label to the free amino group oligonucleotides is carried out in accordance with the manufacturer's recommendations. Oligonucleotides labeled with cyanine dye Su-3 are purified by HPLC from oligonucleotides that do not include a fluorescent dye on a Hypersil ODS column 5 μm, 4.6 × 250 mm (Sypelco Int, USA).

Проводят сополимеризацию олигонуклеотидов в акриламидном геле, как описано ранее [Паньков С.В., Крейндлин Э.Я., Сомова О.Т., Моисеева О.В., Барский В.Е., Заседателев А.С. (2007) Применение немодифицированных полимерных материалов для изготовления подложки биочипов, биочип на их основе и способ его изготовления, способ иммобилизации гидрогелей на немодифицированных полимерных материалах. Патент RU 2309959], [Мирзабеков А.Д., Рубина А.Ю., Паньков СВ., Чернов Б.К. (2001) Способ иммобилизации олигонуклеотидов, содержащих непредельные группы, в полимерных гидрогелях при формировании микрочипа. Патент RU 2175972]. После нанесения на подложку проводится контроль качества нанесения, который включает в себя визуальный контроль физических размеров гелевых ячеек при помощи светового микроскопа в отраженном свете и контроль концентрации иммобилизованных олигонуклеотидов с помощью красителя Су-3 (ООО «Биочип-ИМБ», Россия). Подложка содержит 8 иммобилизованных олигонуклеотидных зондов (SEQ ID NO: 1-8), список которых представлен также в Табл. 2. Ячейки наносят согласно схеме на Фиг. 1.The oligonucleotides are copolymerized in an acrylamide gel, as described previously [Pankov S.V., Kreindlin E.Ya., Somova O.T., Moiseeva O.V., Barsky V.E., Zasedatelev A.S. (2007) The use of unmodified polymeric materials for the manufacture of a substrate for biochips, a biochip based on them and a method for its manufacture, a method for immobilizing hydrogels on unmodified polymeric materials. Patent RU 2309959], [Mirzabekov A.D., Rubina A.Yu., Pankov SV., Chernov B.K. (2001) A method for immobilizing oligonucleotides containing unsaturated groups in polymer hydrogels during microchip formation. Patent RU 2175972]. After application to the substrate, application quality control is carried out, which includes visual control of the physical sizes of gel cells using a light microscope in reflected light and monitoring the concentration of immobilized oligonucleotides using Su-3 dye (Biochip-IMB LLC, Russia). The substrate contains 8 immobilized oligonucleotide probes (SEQ ID NO: 1-8), a list of which is also presented in Table. 2. Cells are applied according to the circuit of FIG. one.

Пример 3. Гибридизация меченого продукта на биочипеExample 3. Hybridization of a labeled product on a biochip

Реакционную смесь, полученную после проведения II этапа ПЦР, описанного в Примере 1, используют для гибридизации на подложке, описанной в Примере 2, в буфере следующего состава: 25% формамид («Sigma», США), 5х SSPE («Promega», США). Готовую гибридизационную смесь перед гибридизацией денатурируют при 95°С в течение 5 мин, охлаждают во льду 2 мин и наносят в гибридизационную камеру объемом 40 мкл (ООО «Биочип-ИМБ», Россия). Гибридизацию проводят в течение 12-14 ч при температуре 37°С. После завершения инкубации гибридизационную камеру удаляют вместе с непрореагировавшей гибридизационной смесью и проводят отмывку в 1x SSPE буфере («Promega», США) при комнатной температуре в течение 10 мин.The reaction mixture obtained after stage II PCR described in Example 1 was used for hybridization on the substrate described in Example 2 in a buffer of the following composition: 25% formamide (Sigma, USA), 5x SSPE (Promega, USA ) Before hybridization, the prepared hybridization mixture was denatured at 95 ° C for 5 min, cooled in ice for 2 min, and applied to a 40 μl hybridization chamber (Biochip-IMB LLC, Russia). Hybridization is carried out for 12-14 hours at a temperature of 37 ° C. After incubation is complete, the hybridization chamber is removed along with the unreacted hybridization mixture and washed in 1x SSPE buffer (Promega, USA) at room temperature for 10 minutes.

Пример 4. Регистрация и интерпретация результатов гибридизацииExample 4. Registration and interpretation of hybridization results

Регистрацию гибридизационной картины производят с помощью портативного анализатора, снабженного ПЗС-камерой, производимого ООО «БИОЧИП-ИМБ». Описание алгоритма автоматического анализа изображения с помощью программы ImageWare™ выходит за рамки настоящего изобретения.The hybridization pattern is recorded using a portable analyzer equipped with a CCD camera manufactured by BIOCHIP-IMB LLC. A description of an automatic image analysis algorithm using ImageWare ™ is beyond the scope of the present invention.

Определим генотип по гибридизационной картине, представленной на Фиг. 2. Полиморфный участок гена АроЕ: положительный сигнал наблюдается в двух верхних ячейках первого столбца и двух нижних ячейках второго столбца, соответственно, генотип образца rs429358 (Т/Т), rs7412 (Т/Т), что соответствует аллелю ε2 в гомозиготном состоянии.We determine the genotype from the hybridization pattern shown in FIG. 2. Polymorphic region of the ApoE gene: a positive signal is observed in the two upper cells of the first column and two lower cells of the second column, respectively, the sample genotype is rs429358 (T / T), rs7412 (T / T), which corresponds to the ε2 allele in the homozygous state.

Аналогично определяем генотипы по остальным точкам: ApoJ (rs1136000 G/T) и GAB2 (rs2373115 G/G).Similarly, we determine genotypes for the remaining points: ApoJ (rs1136000 G / T) and GAB2 (rs2373115 G / G).

Последовательности олигонуклеотидных зондов, используемых для анализа генетической предрасположенности к болезни Альцгеймера.The sequence of oligonucleotide probes used to analyze the genetic predisposition to Alzheimer's disease.

ГенGene SEQ ID NO:SEQ ID NO: НазваниеTitle Последовательность 5'-3'5'-3 'sequence ApoEApoE
(rs429358 C>T)(rs429358 C> T) 1one ApE-1_TApE-1_T AGGACGTG T GCGGCCGAGGACGTG T GCGGCCG 22 ApE-1_СApE-1_C GACGTG C GCGGCCG GACGTG C GCGGCCG ApoEApoE
(rs7412 C>T)(rs7412 C> T) 33 ApE-2_CApE-2_C GCAGAAG C GCCTGGAAGCAGAAG C GCCTGGAA 4four ApE-2_TApE-2_T GCAGAAG T GCCTGGAAGCAGAAG T GCCTGGAA ApoJApoj
(rs11136000 G>A)(rs11136000 G> A) 55 ApJ_GApJ_G GTTAGAGA G TTTTGATAGTTAGAGA G TTTTGATA 66 ApJ_AApJ_A GTTAGAGA A TTTTGATAGGTTAGAGA A TTTTGATAG GAB2Gab2
(rs2373115 G>T)(rs2373115 G> T) 77 GAB2_GGAB2_G TATAGTCCG G CACTCTCTTGCTATAGTCCG G CACTCTCTTGC 88 GAB2_TGAB2_T TATAGTCCG T CACTCTCTTGCTATAGTCCG T CACTCTCTTGC

Последовательности праймеров I и II этапа для проведения мультиплексных ПЦР с последующим анализом методом гибридизации на биочипе для определения генетической предрасположенности к спорадической форме болезни Альцгеймера. The sequence of primers I and II stage for conducting multiplex PCR followed by analysis by hybridization on a biochip to determine the genetic predisposition to sporadic form of Alzheimer's disease.

ГенGene SEQ
ID NO:Seq
ID NO: НазваниеTitle Последовательность 5'-3'5'-3 'sequence Длина, п.н.Length, bp TmTm ApoEApoE 9
109
10 ApE_F1
ApE_R1ApE_F1
ApE_R1 CACTGTGCGACACCCTCCCG CCCGGCCTGGTACACTGCCACTGTGCGACACCCTCCCG CCCGGCCTGGTACACTGC 20
18twenty
eighteen 64,6
63,564.6
63.5 11
12eleven
12 ApE_F2
ApE_R2ApE_F2
ApE_R2 TGGGCGCGGACATGG
GGGCCCCGGCCTGTGGGCGCGGACATGG
GGGCCCCGGCCTG 15
13fifteen
13 60,1
58,160.1
58.1 ApoJApoj 13
1413
fourteen ApJ_F1
ApJ_R1ApJ_F1
ApJ_R1 AGCCACGCTGGTCTCAAACTCC TGCAGACTCCCTGAATCTTACCTTTAGCCACGCTGGTCTCAAACTCC TGCAGACTCCCTGAATCTTACCTTT 22
2522
25 65,3
63,165.3
63.1 15
16fifteen
16 ApJ_F2
ApJ_R2ApJ_F2
ApJ_R2 CTGGCCTGAGACAGATTCATACA CAATCAGCACCAAAGCCACACTGGCCTGAGACAGATTCATACA CAATCAGCACCAAAGCCACA 23
2023
twenty 58,7
60,258.7
60,2 GAB2Gab2 17
1817
eighteen GAB_F1
GAB_R1GAB_F1
GAB_R1 GCAGGGCAGTTATTATGTAGGCAAA
ATGCAGGGCAGTTATTATGTAGGCAGCAGGGCAGTTATTATGTAGGCAAA
ATGCAGGGCAGTTATTATGTAGGCA 25
2525
25 64,1
64,464.1
64,4 19
2019
twenty GAB_F2
GAB_R2GAB_F2
GAB_R2 CTTATTGAAAGAGTGCTTGTAGACTTAT
AAAGCTAGAATTGATTATGAAGTAGTTTTACTTATTGAAAGAGTGCTTGTAGACTTAT
AAAGCTAGAATTGATTATGAAGTAGTTTTTA 28
3028
thirty 57,6
58,557.6
58.5

Claims (2)

1. Способ для анализа генетического полиморфизма в локусах ДНК АроЕ (rs429358, rs7412), ApoJ (rs11136000) и GAB2 (rs2373115), предусматривающего следующие стадии:
а) амплификация полиморфных фрагментов генов АроЕ, ApoJ и GAB2 с помощью мультиплексной «гнездной» двухэтапной ПЦР, в которой в качестве матрицы для амплификации используется образец ДНК; при проведении I этапа ПЦР используется набор праймеров с последовательностями, представленными в SEQ ID NO: 9, 10, 13, 14, 17, 18; при проведении II этапа ПЦР используется набор праймеров с последовательностями, представленными в SEQ ID NO: 11, 12, 15, 16, 19, 20, и дезоксиуридинтрифосфат, меченый флуоресцентным красителем Су-5, в результате чего образуется флуоресцентно меченый ПЦР-продукт;
б) иммобилизация олигонуклеотидных зондов, последовательности которых представлены в SEQ ID NO: 1-8, на твердой подложке;
в) гибридизация меченого ПЦР-продукта с иммобилизованными олигонуклеотидами, представленными в SEQ ID NO: 1-8;
г) регистрация и интерпретация результатов гибридизации.1. A method for analyzing genetic polymorphism at the ApoE DNA loci (rs429358, rs7412), ApoJ (rs11136000) and GAB2 (rs2373115), comprising the following steps:
a) amplification of polymorphic fragments of the ApoE, ApoJ and GAB2 genes using multiplex "nested" two-stage PCR, in which a DNA sample is used as a matrix for amplification; when conducting stage I PCR, a set of primers is used with the sequences shown in SEQ ID NO: 9, 10, 13, 14, 17, 18; during stage II PCR, a set of primers is used with the sequences shown in SEQ ID NO: 11, 12, 15, 16, 19, 20, and deoxyuridine triphosphate labeled with Su-5 fluorescent dye, resulting in a fluorescently labeled PCR product;
b) immobilization of oligonucleotide probes, the sequences of which are presented in SEQ ID NO: 1-8, on a solid support;
c) hybridization of the labeled PCR product with the immobilized oligonucleotides shown in SEQ ID NO: 1-8;
d) registration and interpretation of hybridization results. 2. Набор олигонуклеотидных праймеров и зондов для анализа генетического полиморфизма в локусах ДНК АроЕ (rs429358, rs7412), ApoJ (rs11136000) и GAB2 (rs2373115), включающий (а) праймеры с последовательностями, представленными в SEQ ID NO: 9-20 для проведения двухэтапной «гнездовой» мультиплексной амплификации и получения флуоресцентно меченого ПЦР-продукта по п. 1, и (б) олигонуклеотидные зонды для идентификации полиморфных маркеров в указанных генах с последовательностями, представленными в SEQ ID NO: 1-8. 2. A set of oligonucleotide primers and probes for the analysis of genetic polymorphism at the ApoE (rs429358, rs7412), ApoJ (rs11136000) and GAB2 (rs23133000) and GAB2 (rs2373115) DNA loci, including (a) primers with the sequences shown in SEQ ID NO: 9-20 for two-stage "nested" multiplex amplification and obtaining a fluorescently labeled PCR product according to claim 1, and (b) oligonucleotide probes for identifying polymorphic markers in these genes with the sequences shown in SEQ ID NO: 1-8.
RU2014113962/10A 2014-04-09 2014-04-09 Set of oligonucleotide primers and probes for genetic typing of polymorphous dna loci associated with a risk of progression of sporadic form of alzheimer's disease in russian populations RU2600874C2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
RU2014113962/10A RU2600874C2 (en) 2014-04-09 2014-04-09 Set of oligonucleotide primers and probes for genetic typing of polymorphous dna loci associated with a risk of progression of sporadic form of alzheimer's disease in russian populations

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
RU2014113962/10A RU2600874C2 (en) 2014-04-09 2014-04-09 Set of oligonucleotide primers and probes for genetic typing of polymorphous dna loci associated with a risk of progression of sporadic form of alzheimer's disease in russian populations

Publications (2)

Publication Number Publication Date
RU2014113962A RU2014113962A (en) 2015-10-20
RU2600874C2 true RU2600874C2 (en) 2016-10-27

Family

ID=54326826

Family Applications (1)

Application Number Title Priority Date Filing Date
RU2014113962/10A RU2600874C2 (en) 2014-04-09 2014-04-09 Set of oligonucleotide primers and probes for genetic typing of polymorphous dna loci associated with a risk of progression of sporadic form of alzheimer's disease in russian populations

Country Status (1)

Country Link
RU (1) RU2600874C2 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108004315A (en) * 2017-12-22 2018-05-08 佰世凯（杭州）生物科技有限公司 Appraisal procedure for Alzheimer's disease risk

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2303634C2 (en) * 2005-10-11 2007-07-27 Институт Молекулярной Биологии Им. В.А. Энгельгардта Российской Академии Наук Method for analysis of genetic polymorphysm, defining predisposition to tumor diseases and individual sensitivity to pharmaceutical agents by using olygonucleotide biological microarray (bioarray)

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2303634C2 (en) * 2005-10-11 2007-07-27 Институт Молекулярной Биологии Им. В.А. Энгельгардта Российской Академии Наук Method for analysis of genetic polymorphysm, defining predisposition to tumor diseases and individual sensitivity to pharmaceutical agents by using olygonucleotide biological microarray (bioarray)

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
NIZAMUTDINOV I.I. ET AL., Biochip for Determination of Genetic Markers of Sporadic Alzheimer’?s Disease Risk in the Russian Slavic Population, Molecular Biology, 2013, v. 47, no. 6, pp. 827-;835. KAMEL A. ABD-ELSALAM, Bioinformatic tools and guideline for PCR primer design, African Journal of Biotechnology, 2003, v. 2, no. 5, p. 91-95. *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108004315A (en) * 2017-12-22 2018-05-08 佰世凯（杭州）生物科技有限公司 Appraisal procedure for Alzheimer's disease risk

Also Published As

Publication number Publication date
RU2014113962A (en) 2015-10-20

Similar Documents

Publication Publication Date Title
US10760123B2 (en) Sequential sequencing
JP3693352B2 (en) Methods for detecting genetic polymorphisms and monitoring allelic expression using probe arrays
US9133516B2 (en) Methods for identification of alleles using allele-specific primers for amplification
JP2014507164A (en) Method and system for haplotype determination
KR101157526B1 (en) Snp for diagnosing adhd, microarray and kit comprising the same, and method of diagnosing adhd using thereof
JP2011518568A (en) Materials and methods for DNA-based profiling assays
JP2007526764A (en) APOE gene marker related to age of onset of Alzheimer's disease
US20050255498A1 (en) APOC1 genetic markers associated with age of onset of Alzheimer's Disease
RU2600874C2 (en) Set of oligonucleotide primers and probes for genetic typing of polymorphous dna loci associated with a risk of progression of sporadic form of alzheimer's disease in russian populations
RU2565036C2 (en) Method for analysing genetic polymorphism for determining disposition to schizophrenia and alcoholism
RU2729360C1 (en) Method of analyzing terminal mutations in brca1, brca2, atm and palb2 genes using multiplex pcr and subsequent hybridisation with an oligonucleotide biological microchip (biochip)
KR101249635B1 (en) Novel EGR2 SNPs Related to Bipolar Disorder, Microarrays and Kits Comprising them for Diagnosing Bipolar Disorder
Shammas et al. ThalassoChip, an array mutation and single nucleotide polymorphism detection tool for the diagnosis of β-thalassaemia
Yang et al. Copy number variation
RU2549682C1 (en) Method for analysis of somatic mutations in pi3k gene using lna-blocking multiplex pcr and subsequent hybridisation with oligonucleotide biological microchip (biochip)
CN109825590B (en) Method, kit and primer for joint detection of tumor-driven gene mutation and microsatellite instability
RU2674687C1 (en) Method for analysis of somatic mutations in gnaq and gna11 genes using lna-blocking multiplex pcr and subsequent hybridization with oligonucleotide biological microchip (biochip)
JP2007510404A (en) NTRK1 gene marker associated with age of onset of Alzheimer's disease
WO2008088236A1 (en) Method for genetically identifying a person according to the analysis of the single nucleotide polymorphism of a human genom by means of a oligonucleotide biological microchip (biochip)
JPWO2005090565A1 (en) DNA array and single nucleotide polymorphism detection method
KR101167945B1 (en) Polynucleotides derived from ATG16L1 gene comprising single nucleotide polymorphisms, microarrays and diagnostic kits comprising the same, and analytic methods for autism spectrum disorders using the same
JP4406366B2 (en) Method for identifying nucleic acid having polymorphic sequence site
KR102237248B1 (en) SNP marker set for individual identification and population genetic analysis of Pinus densiflora and their use
KR101167942B1 (en) Polynucleotides derived from ALG12 gene comprising single nucleotide polymorphisms, microarrays and diagnostic kits comprising the same, and analytic methods for autism spectrum disorders using the same
KR101167934B1 (en) Polynucleotides derived from TICAM1 gene comprising single nucleotide polymorphisms, microarrays and diagnostic kits comprising the same, and analytic methods for autism spectrum disorder using the same

Legal Events

Date Code Title Description
MM4A The patent is invalid due to non-payment of fees

Effective date: 20210410