RU2408730C1 - RECOMBINANT PROTEIN Collbd-BMP-7, RECOMBINANT PLASMID pCollbd-BMP-7, STRAIN Escherichia coli-PRODUCER OF RECOMBINANT PROTEIN Collbd-BMP-7, METHOD TO PRODUCE RECOMBINANT PROTEIN Collbd-BMP-7 - Google Patents

Abstract

FIELD: medicine. ^ SUBSTANCE: recombinant protein Collbd-BMP-7 is described, consisting of collagen-binding domain Collbd (SPARC(w)), of extracellular calcium-dependent protein SPARC (VM-40 or osteonectin) of a human being and spacer sequence GGS. Method for its production is proposed, including growing of strain E. coli M15 [pREP4, pCollbd-BMP-7]. According strain and plasmid are proposed. ^ EFFECT: invention makes it possible to provide a high level of recombinant protein Collbd-BMP-7 production and simultaneously simple and efficient scheme for cleaning of this protein with its immobilisation on collagen-containing sorbent included into composition of new generation of items and materials of medical purpose - implants and coatings. ^ 4 cl, 1 dwg, 3 ex

Description

The invention relates to biotechnology, genetic engineering and medicine and can be used for the production of recombinant protein immobilized on a collagen-containing carrier, which is part of a new generation of medical products and materials - implants, coatings, etc.

It is well known that the process of bone tissue formation depends on the activity of cells involved in osteogenesis, and on the influence of growth factors, the so-called osteoinductive proteins. About 40 years ago, Marshall R. Urist discovered that the extracellular bone matrix contains a substance that stimulates bone formation (Urist MR. Bone: formation by autoinduction. Science 1965; 150: 893-9.) These compounds, later called bone morphogenetic proteins ( bone morphogenetic proteins, BMPs), have become the objects of close study and development of therapeutic drugs based on them. Further studies have led to the isolation of individual BMPs capable of stimulating bone formation by mesenchymal stem cells (Reddi AN. Bone morphogenetic proteins: from basic science to clinical applications. J. Bone Joint Surg. Am. 2001; 83-A (Suppl. 1): S1-S6).

To date, more than 20 types of human BMP have been identified. The first recombinant BMP, BMP-7, was obtained in 1990 (Sampath TK, Maliakal JC, Hauschka PV et al. Recombinant human osteogenic protein-1 (hOP-1) induces new bone formation in vivo with a specific activity comparable with natural bovine osteogenic protein and stimulates osteoblast proliferation and differentiation in vitro. J. Biol. Chem. 1992; 267: 20352-62). However, expression of recombinant BMP-7 in E. coli cells was not achieved.

The introduction of biologically active components by adding soluble forms or impregnating them with materials provides only a short-term effect. This is due to their rapid removal from the damaged area, even with the introduction of growth factors into the coating material. A longer effect is caused by the immobilization of biologically active components directly in the wound cover. Thus, a very promising approach for the development of reconstructive surgery methods is the creation of materials and coatings bearing immobilized specific growth factors on the surface, and the study of their effect on implant survival.

However, the processes of immobilization of these proteins, based, as a rule, on chemical sewing, are multi-stage, labor-consuming, expensive and unsafe from the point of view of ensuring the environmental safety of production. An important problem remains the development of methods for purifying end products from lipopolysaccharides, ballast proteins, DNA and RNA of producer strains; obtaining functionally active biological components.

Analogues of BMP-7 preparations immobilized on a collagen-containing carrier due to affinity interaction were not found in available sources of information.

The claimed group of inventions is based on the task of creating an E. coli strain that provides a high level of production of the recombinant Collbd-BMP-7 protein and at the same time a simple and effective scheme for purifying the mentioned protein, with its immobilization on a collagen-containing sorbent, which is part of a new generation of medical products and materials destination - implants and coatings.

This problem was solved by synthesizing the recombinant protein Collbd-BMP-7, in particular by introducing the collbd domain of Collbd (SPARC (w)) from the extracellular calcium-dependent protein SPARC (BM-40, or osteonectin) into the recombinant protein. And also due to the introduction of the GGS spacer sequence between the functional domains to preserve the function of activation of cell growth by fusion proteins associated with the collagen matrix. In addition, this problem was solved due to the possibility of a one-stage highly efficient purification of the recombinant Collbd-BMP-7 protein containing a collagen-binding domain and its immobilization on a collagen-containing nanocomposite coating.

The essence of the invention lies in the fact that the recombinant plasmid pCollbd-BMP-7 size 3525 bp provides the expression of the recombinant Collbd-BMP-7 protein, consisting of the collb-binding domain of Collbd from the extracellular calcium-dependent human SPARC protein, a spacer from glycine and serine residues, and BMP-7 bone morphogenetic protein, and contains:

- an artificial bacterial operon of chimeric proteins, including: the promoter region of the early promoter of the T5 bacteriophage (7-87 bp), which provides efficient transcription of controlled mRNA; a recombinant gene that provides expression of the target chimeric protein (Collbd collagen binding domain - spacer - bone morphogenetic protein BMP-7) (117-623 bp); the untranslated region of the transcription termination of the bacterial operon, which ensures the efficient termination of transcription (663-757 bp);

- the bacterial operon bla (3320-2460 bp complementary chain) encoding a beta-lactamase protein, which is a selective marker for the selection of E. coli transforming clones by counter-selection;

- a bacterial site of replication initiation type ColE1 (1630 bp), which ensures replication of the plasmid in E. coli strains.

The strain Escherichia coli M15 [pREP4, pCollbd-BMP-7] was obtained by transformation of the strain Escherichia coli M15 / pREP4 with the plasmid pCollbd-BMP-7. The resulting strain is a producer of the recombinant Collbd-BMP-7 protein, which consists of the Collbd collagen binding domain of the extracellular calcium-dependent human SPARC protein, a spacer of glycine and serine residues, and BMP-7 bone morphogenetic protein.

The recombinant Collbd-BMP-7 protein, consisting of the Collbd collagen-binding domain of the extracellular calcium-dependent human SPARC protein, the spacer of glycine and serine residues and the bone morphogenetic protein BMP-7, has the biological properties of BMP-7 protein and the ability to spontaneously bind to collagen-containing.

A method of producing a recombinant Collbd-BMP-7 protein involves growing cells of the Escherichia coli strain M15 [pREP4, pCollbd-BMP-7], inducing synthesis of Collbd-BMP-7 protein, disrupting cells, obtaining a supernatant containing protein, immobilizing the protein by adding to the supernatant suspension of collagen-containing sorbent, incubation, washing of the sorbent with the bound protein, subsequent elution of the protein from the sorbent and dialysis.

The technical result of the claimed invention is to provide a high level of production of the recombinant Collbd-BMP-7 protein and at the same time provide a simple and effective scheme for purifying this protein with its immobilization on a collagen-containing sorbent, which is part of a new generation of medical products and materials - implants and coatings.

Thus, the technical result is achieved due to the fact that the created recombinant plasmid pCollbd-BMP-7 encoding a bifunctional recombinant protein Collbd-BMP-7, on the one hand, containing the amino acid sequence BMP-7, and on the other, with the ability to independently bind collagen-containing sorbent due to the presence of the collagen-binding domain Collbd from the extracellular calcium-dependent human SPARC protein.

Also, the specified technical result is achieved by the fact that the strain Escherichia coli M15 [pREP4, pCollbd-BMP-7] is a producer of the recombinant protein Collbd-BMP-7. Moreover, the absence of collagen-binding proteins in E. coli cells ensures that the recombinant Collbd-BMP-7 protein is the only Escherichia coli M15 strain protein [pREP4, pCollbd-BMP-7] that binds strongly to the used sorbent, which provides the possibility of a single-stage production of a highly purified preparation of the indicated recombinant protein immobilized on a collagen-containing sorbent.

The strain E. coli M15 [pREP4] containing the plasmid pCollbd-BMP-7, the producer of the recombinant protein Collbd-BMP-7, is characterized by the following features.

Cultural and morphological characters. Cells are straight, rod-shaped, motionless, gram-negative. When sieving on a plate with 1.5% LB agar, growth in the form of separate colonies, sometimes in the R-form with uneven edges. It grows well in dense and liquid nutrient media (LB-broth, LB-agap, MPA, MPB).

Physiological and biochemical characteristics. Cells grow in the range of +4 - 42 ° C with an optimum pH of 6.8-7.5. Strains decompose glucose, mannitol with the formation of acid, do not decompose sucrose, arabinose, galactose, ferment maltose, xylose, sorbitol, rhamnose. Significant when using these strains is their sensitivity to nalidixic acid (25 mg / ml), streptomycin (20 mg / ml) and rifampicin (25 mg / ml). Resistant to ampicillin (up to 100 μg / ml) due to the presence of plasmid pCollbd-BMP-7 and to kanamycin (up to 25 μg / ml) due to the presence of plasmid pREP4.

The indicated technical result is also achieved by the fact that the recombinant protein pCollbd-BMP-7, which includes the amino acid sequence that determines the ability of this protein to bind to a collagen-containing sorbent, allows concentration, purification and immobilization of the Collbd-BMP-7 protein on a collagen-containing sorbent in one step .

This technical result is also achieved by the fact that the method of purification, concentration and preparation of the immobilized recombinant Collbd-BMP-7 protein consists in processing the supernatant of the cell hydrolyzate of E. coli strain M15 [pREP4, pCollbd-BMP-7] with a collagen-containing sorbent, followed by washing the sorbent with immobilized recombinant protein.

The invention is illustrated in the drawing.

The drawing shows a diagram of the plasmid pCollbd-BMP-7.

In the list of sequences: the nucleotide sequence of plasmid pCollbd-BMP-7 - sequence No. 1, the amino acid sequence of the collagen binding domain protein Collbd - sequence No. 2, the amino acid sequence of the glycine-serine spacer - sequence No. 3, the amino acid sequence of bone morphogenetic protein BMP-7 - sequence No. four.

All standard genetic engineering and microbiological manipulations, as well as amplification and DNA sequencing, were performed according to well-known methods (Maniatis T., Fritsch E., Sambrook J. Molecular cloning. M .: Mir, 1984; DNA cloning. Methods. Ed. D Glover, Translated from English, Moscow: Mir, 1988; Saiki RK, Gelfand DH, Stoffel S., Sharf SJ, Higuchi R., Horn GT, Mullis KB, Erlich HA Science, 1988. V.239, no. 4839, p. 487-491; Sanger F., Nicklen S., Coulson AR Proc. Nat. Acad. Sci. USA, 1977, V.74, p. 5463-5467).

The following are examples illustrating the invention.

Examples.

Example 1. Obtaining plasmids pQE6-BMP-7.

a) Chemical synthesis of oligodeoxyribonucleotides.

Oligodeoxyribonucleotides were synthesized by the solid-state phosphoramidite method using an AFM 100-2 synthesizer (Novosibirsk) and purified by electrophoresis in 12% SDS page.

b) Obtaining the BMP-7 gene followed by its cloning.

A copy of the BMP-7 gene was obtained by reverse transcription polymerase chain reaction (RT-PCR). For this, the total human RNA was extracted from the skeletal muscle of a person. cDNA was obtained by treating 100ng polyadenylated RNA of human skeletal muscle with ImProm-II Promega reverse transcriptase according to the manufacturer's protocol.

For subsequent PCR, primers corresponding to the beginning and end of the BMP-7 gene were selected. The BamHI site was introduced into the forward primer, and the BglII, Kpn2I, and stop codon sites were introduced into the reverse primer.

DIR: 5'-GGATCCAGATCCTCCACGGGGGAGCAAACAGCGCA-3 '

REV: 5'-TCCGGACTAAGATCTGTGGCAGCCACAGGCCCGGA-3 '

2 μl of the resulting reverse transcription mixture was added to the PCR reaction mixture, which contained 10 pcM of each primer (Dir and Rev), 67 mM Tris-HCl (pH 8.8 at 25 ° C), 15 mM ammonium sulfate, 2, 5 mM magnesium chloride, 0.01% Tween-20, a mixture of deoxynucleotide triphosphates (dATP, dCTP, dTTP, dGTP 2.5 mM each) and 1 unit. Native Pfu Polymerase polymerase (Stratagene). The amplification reaction was carried out in a volume of 25 μl under liquid paraffin: 1 cycle of 95 ° C for 3 min; 35 cycles: 95 ° C - 15 sec, 72 ° C - 1 min.

Amplification product 444 bp in size treated with chloroform, reprecipitated with ethyl alcohol and dissolved in water. To clone this product, the obtained BMP-7 DNA as well as the plasmid pQE6 DNA (Qiagene, USA) was hydrolyzed with restriction endonucleases BamHI and BspEI at 37 ° C in a buffer containing 66 mM Tris-acetate (pH 7.9 at 37 ° C ), 20 mM magnesium acetate, 132 mM potassium acetate and 0.2 mg / ml BSA for 1.5 hours

Restriction fragments isolated from the gel: a DNA fragment corresponding to the BMP-7 gene of 438 bp, a fragment of plasmid pQE6 of 3024 bp ligated using T4 bacteriophage DNA ligase. This construct was used to transform E. coli M15 [pREP4] cells by electroporation. Transformed cells were selected on LB agar medium with antibiotics ampicillin and kanamycin. Plasmid DNA was isolated by alkaline lysis, analyzed using restriction enzymes BamHI and Kpn2I, as well as restriction enzymes located inside the cloned fragments, and clones were selected whose plasmid DNA was 3462 bp in size pBMP-7. contains the sequence of the BMP-7 gene.

The primary structure of the obtained plasmid was confirmed by sequencing.

d) Obtaining a plot of the SPARC gene containing the sequence of the collagen binding domain Collbd, followed by its cloning into the plasmid construct pQE6-BMP-7.

Collagen-binding domain Collbd from extracellular protein SPARC (BM-40 or osteonectin) was synthesized using 4 oligonucleotides of the following composition:

Dir1: CATGGGATCCCTGGACTCTGAACTGACCGAATTCCCGCTGCGCATGCGT

Dir2: GACTGGCTGAAAAACCCGGGTGGTTCTA

Rev1: GATCTAGAACCACCCGGGTTTTTAGAGCCAGTCACGCATG

Rev2: CGCAGCGGGAATTCGGTCAGTTCAGAGTCCAGGGATCC.

The oligonucleotides were designed in such a way that upon hybridization they form a double-stranded DNA fragment containing sticky ends corresponding to the restriction enzyme hydrolysis sites NcoI and BglII. In the synthesis, oligonucleotides were phosphorylated at the 5 'end.

To obtain a double-stranded DNA fragment, a mixture of oligonucleotides (20 pcM each) was heated at 95 ° C (10 min) and cooled to 25 ° C for 4 hours. The resulting mixture was combined with a fragment of plasmid pQE6-BMP2 (3376 bp), hydrolyzed with restriction endonucleases NcoI and BamHI at 37 ° C in a buffer containing 66 mm Tris-acetate (pH 7.9 at 37 ° C), 20 mm acetate magnesium, 132 mm potassium acetate for 1.5 hours. Ligation was performed using T4 phage DNA ligase in a buffer containing 40 mM Tris-HCl (pH 7.8 at 25 ° C), 10 mM magnesium chloride, 10 mM DTT, and 5 mM ATP. The ligated DNA mixture was used to transform E. coli M15 [pREP4] cells by electroporation. Transformed cells were selected on LB agar medium with antibiotics kanamycin (25 μg / ml) and ampicillin (100 μg / ml). PCollbd-BMP-7 plasmid DNA was isolated from the selected recombinant clones by alkaline lysis. The selected clones were sequenced and confirmed the presence of an insert corresponding to the Collbd collagen binding domain of the extracellular protein SPARC (or BM-40, or osteonectin) of a person.

Example 2. Obtaining a strain of E. coli - producer of the recombinant protein Collbd-BMP-7, consisting of BMP-7, spacer and collagen binding domain Collbd (SPARC (w)).

To obtain the E. coli strain - producer of the recombinant protein Collbd-BMP-7 - cells of the E. coli strain M15 [pREP4] (Nals, Strs, rifs, lac ^- , ara ^- , gal ^- , mtl ^- , F ^- , recA ⁺ , uvr ⁺ ) was transformed with the plasmid pCollbd-BMP-7. Transformed cells were grown in 500 ml of LB medium at 37 ° C to an optical density corresponding to 1 unit absorbance at a wavelength of 600 nm, 150 μl of a 0.1 M solution of isopropyl-beta-D-thiogalactopyranoside was induced and grown for 8 hours.

To control the production of the recombinant Collbd-BMP-7 protein by cells of the E. coli M15 strain [pREP4, pCollbd-BMP-7], polyacrylamide gel electrophoresis in the presence of sodium dodecyl sulfate was used. Protein separation was carried out on a 12% polyacrylamide gel in a standard buffer system (electrode buffer: 25 mM Tris-HCl, 192 mM glycine, 0.1% sodium dodecyl sulfate, pH 8.3; gel buffer: 375 mM Tris-HCl, pH 8.8). At the end of electrophoresis, the gels were stained with 0.15% Coomassie G250 solution in 25% isopropanol and 10% acetic acid and washed in 10% acetic acid. When comparing the protein spectrum of strains of E. coli M15 [pREP4] and E. coli M15 [pREP4, pCollbd-BMP-7], the appearance of an additional protein band with a molecular weight of 18.8 kDa, which corresponds to the molecular weight of the recombinant protein Collbd-BMP- 7.

The level of synthesis of Collbd-BMP-7 protein was determined by comparing the staining intensity of the band of the recombinant protein with the band of the corresponding protein, the molecular weight standard.

According to the data obtained, cells of the E. coli M15 strain [pREP4, pCollbd-BMP-7] synthesize about 10% of Collbd-BMP-7 of the total cell protein.

Example 3. A method of obtaining a protein preparation Collbd-BMP-7, immobilized on a collagen-containing sorbent.

E. coli M15 [pREP4] cells transformed with pCollbd-BMP-7 plasmid were grown in 3.5 ml of LB medium with ampicillin and kanamycin at 37 ° C to an optical density corresponding to 1 unit. absorbance at a wavelength of 600 nm, 3 μl of a 0.1 M solution of isopropyl-beta-D-thiogalactopyranoside was added and grown for 4 hours. The culture was diluted to an optical density of 0.7 at 530 nm, 400 μl of the suspension was taken, cells were precipitated by centrifugation at 5000 rpm for 10 minutes Cells were resuspended in 500 μl of phosphate-citrate buffer (FCB, 50 mM, pH 6.0), sonicated, cell debris was removed by centrifugation at 16,000 rpm for 10 min.

To 100 μl of a 50% suspension of gelatin-sepharose was added 2 ml of a buffer solution containing 30 mM Tris, pH 8.0, and 0.15 M sodium chloride, as well as a cell lysate in a 7 M solution of guanidine chloride. Incubated at + 4 ° C for 2 hours, then left for 16 hours at the same temperature. The resulting suspension was centrifuged for 5 minutes at 5000 rpm. The precipitate of the sorbent with the bound protein was washed three times with a buffer solution containing 30 mM Tris, pH 8.0, and 0.15 M sodium chloride.

Protein elution was performed with a buffer solution containing 6 M urea, 30 mM Tris, pH 8.0, and 10 mM EDTA. The analysis of the results of binding and elution of Collbd-BMP-7 protein was carried out by Laemmli electrophoresis in 12% SDS page under denaturing conditions.

According to the results of SDS page electrophoresis in the presence of SDS, the protein concentration was 20 mg per 1 ml of sorbent.

Claims (4)

1. Recombinant protein Collbd-BMP-7, consisting of the collagen binding domain Collbd of the extracellular calcium dependent protein SPARC person with the sequence SEQ ID NO: 2, a spacer of glycine and serine residues with the sequence SEQ ID NO: 3 and bone morphogenetic protein BMP-7 with the sequence of SEQ ID NO: 4, having the biological properties of the protein BMP-7 and the ability to spontaneously bind to a collagen-containing sorbent. 2. Recombinant plasmid pCollbd-BMP-7 with the sequence SEQ ID NO: 1, providing expression of the recombinant protein Collbd-BMP-7 according to claim 1, containing
artificial bacterial operon of chimeric proteins, including the promoter region of the early promoter of the T5 bacteriophage, providing efficient transcription of controlled mRNA;
a recombinant gene for the expression of the target chimeric protein according to claim 1;
the untranslated region of the transcription termination of the bacterial operon, which ensures the efficient termination of transcription;
bacterial operon bla encoding beta-lactamase protein, which is a selective marker for selection of E. coli transforming clones by counter-selection;
ColEl-type bacterial replication initiation site for plasmid replication in E. coli strains. 3. The strain Escherichia coli M15 [pREP4, pCollbd-BMP-7], obtained by transformation of the strain Escherichia coli M15 / pREP4 with the plasmid pCollbd-BMP-7 according to claim 2, is a producer of the recombinant protein Collbd-BMP-7 according to claim 1. 4. The method of producing the recombinant Collbd-BMP-7 protein according to claim 1, comprising growing cells of the Escherichia coli strain M15 [pREP4, pCollbd-BMP-7], inducing the synthesis of Collbd-BMP-7 protein according to claim 1, cell destruction, obtaining protein-containing supernatant; protein immobilization by adding a collagen-containing sorbent suspension to the supernatant; incubation; washing of the sorbent with the bound protein; subsequent elution of the protein from the sorbent and dialysis.