RU2233879C1 - Recombinant plasmid dna pes1-6 encoding polypeptide somatotropin and strain escherichia coli bl21(de3)/pes1-6 as producer of recombinant somatotropin - Google Patents

Abstract

FIELD: biotechnology, genetic engineering, molecular biology.

SUBSTANCE: invention can be used for preparing recombinant human growth hormone. Recombinant plasmid DNA pES1-6 encoding polypeptide with somatotropin amino acid sequence with molecular mass 3.66 MDa (5949 pair bases) consists of: Nde I/Xho I DNA fragment of plasmid pET22b(+) comprising transcription promoter and terminator of T7 RNA-polymerase, translation enhancer of phage T7 gene 10, β-lactamase gene and Nde I/Xho I DNA fragment comprising the sequence of artificial gene for recombinant somatotropin comprising: as genetic marker β-lactamase gene determining resistance of E. coli cells transformed with plasmid pSE1-6 to ampicillin; unique recognition sites for site-specific endonuclease restriction enzymes located at the following distance to the right of site Nde I : Xba I - 38 pair bases, Hpa I - 1332 pair bases, Pst I - 4065 pair bases, Pvu I - 4190 pair bases, Xho I - 5363 pair bases. Invention provides preparing the strain Escherichia coli BL21(DE3)/pES1-6 comprising recombinant plasmid DNA pES1-6 as a producer of recombinant somatotropin. Invention provides preparing recombinant somatotropin with high yield by the simplified technology.

EFFECT: improved preparing method, valuable biological properties of plasmid DNA.

3 cl, 2 dwg, 2 ex

Description

The invention relates to biotechnology, in particular to genetic and protein engineering, and can be used to produce recombinant growth hormone.

Somatotropin (synonyms: somatropin, human growth hormone, growth hormone, growth hormone growth hormone) is among the most studied pituitary hormones and belongs to the protein family, including growth hormone, prolactin, cholesterol. Somatotropin is synthesized in the anterior pituitary gland in somatotrophs, which are a subclass of acidophilic pituitary cells and are the most numerous group in this gland. Growth hormone in all mammalian species is a single peptide with a molecular weight of about 22,000. Despite the high degree of homology of the growth hormones of various mammals, only human growth hormone or higher primates are active in human cells. The growth hormone molecule consists of 191 amino acid residues and contains two intramolecular disulfide bridges. Somatotropin is an anabolic hormone that is necessary for postnatal growth, normalization of carbohydrate, lipid, nitrogen and mineral metabolism, tissue regeneration and cell survival. Growth effects of growth hormone are mainly mediated by insulin-like growth factor 1 (IGF-1), the gene of which belongs to the family of insulin-like genes. Thus, somatotropin stimulates IGF-1 secretion, myoblast differentiation and proliferation, amino acid uptake and protein synthesis in muscles and other tissues [Roskam W.G., Rougeon F. // Molecular cloning and nucleotide sequence of the human growth hormone structural gene. Nucl. Acids Res., 1979, v. 7, p. 305-320 .; Martial J.A., Hallewell R.A., Baxter J.D., Goodman H.M. // Human growth hormone: complementary DNA cloning and expression in bacteria. Science, 1979, v. 205, No. 4406, p. 602-607].

Somatotropin, like other hormones, acts through binding to a specific receptor [Herington AC.// Identification and characterization of growth hormone receptors on isolated rat adipocytes. J Recept Res 1981-82; 2 (4): 299-316].

Dosage forms of growth hormone (synonyms - nutropin or protropin (Genentech), norditropin (Novo Nordisk), genotropin (Pharmacia Upjohn), humatrop (Eli Lilly), saisen or serostim (Serono)) are widely used in medicine for the treatment of growth hormone deficiency and Turner syndrome .

A known method of producing growth hormone, consisting in its isolation from the tissues of the human pituitary gland [Simionescu L., Dimitriu V., Zamfir-Grigorescu D., Aman E., Terbancea M. // The simultaneous isolation of human pituitary hormones. I. Human growth hormone. Endocrinologie 1982 Oct.-Dec .; 20 (4): 273-83]. The disadvantages of the method are the difficulty in obtaining the source material and the risk of infection [Rappaport E.V. // Iatrogenic Creutzfeldt-Jakob disease. Neurology, 1987, Sep .; 37 (9): 1520-2].

Currently, there are two main methods for producing recombinant growth hormone.

A method based on the production of recombinant growth hormone in transformed mouse cells of the C 127 line [Carter M.J., Facklam T.J., Long P.C., Scotland R.A. // Are continuous cell lines safe as substrates for human drugs and biologies? A case study with human growth hormone. Dev Biol Stand 1989; 70: 101-7]. With this approach, it is possible to obtain human growth hormone in the correct conformation with good physiological activity. The disadvantages of this method are the extremely low yield and the long cultivation time of the producing cells.

As well as a method of producing growth hormone, including expression in Escherichia coli cells, which consists in a sufficiently rapid biosynthesis of recombinant growth hormone in the form of insoluble “inclusion bodies” by bacterial cells [Olson KS, Fenno J., Lin N., Harkins RN, Snider C. , Kohr WH, Ross MJ, Fodge D., Prender G., Stebbing N. // Purified human growth hormone from E. coli is biologically active. Nature 1981 Oct. 1; 293 (5831): 408-11]. When using this General method of producing growth hormone, the level of biosynthesis of the target protein can vary widely.

The closest in technical essence to the present invention is a somatotropin producer based on plasmid pHGH 107 (US patent No. 5795745, MKI C 12 V 21/02), which carries under the control of two consecutive Lac promoters a somatotropin gene consisting of a synthetic part (corresponding to amino acids 1 -24) and a fragment of a natural gene (corresponding to amino acids 25-191). The use of Lac promoters, as well as almost completely (88%) of natural cDNA, including codons that are rarely found in Escherichia coli genes, leads to a significant decrease in the level of protein biosynthesis relative to the theoretically possible one.

The invention solves the problem of constructing a plasmid that determines the synthesis of recombinant protein, and create a highly productive bacterial producer strain that allows to obtain recombinant somatotropin in high yield and using simplified technology.

The problem is solved by constructing a recombinant plasmid DNA pES1-6 encoding a polypeptide with a somatotropin sequence having a molecular weight of 3.66 Mda (5949 bp); consisting of: an NdeI / XhoII DNA fragment of plasmid pet 22b (+) containing a promoter and terminator for transcription of T7 RNA polymerase, a translation enhancer of T7 phage 10 gene, β-lactamase gene, and an NdeI / XhoI DNA fragment containing an artificial recombinant somatotropin gene; containing: as a genetic marker, a β-lactamase gene that determines the resistance of ampicillin to E. coli transformed with plasmid pES1-6; unique recognition sites for restriction endonucleases located to the right of the NdeI site: XbaI - 38 bp, HraI - 1332 bp, PstI - 4065 bp, PvuI - 4190 bp, XhoI - 5363 bp, as well as the producer strain Escherichia coli BL21 (DE3) / pES1-6, containing recombinant plasmid DNA pES1-6 - producer of recombinant growth hormone, which provides the synthesis of recombinant growth hormone in the amount of 60-70% of the total protein content of cells.

The advantages of the present invention are, firstly, in the use of the somatotropin gene for chemical and enzymatic synthesis of the widest possible set of codons that are optimal for the production of protein in Escherichia coli, the location of which in the synthetic gene eliminates the possibility of the formation of extended "hairpins" on the mRNA that are synthesized, broadcast. In FIG. Figure 1 shows the amino acid sequence of somatotropin and the corresponding nucleotide sequence of the gene: the top line is the natural somatotropin cDNA, the bottom line is the synthesized artificial gene. Secondly, the use of optimal regulatory elements that control its expression for biosynthesis of the recombinant protein: the T7-lac promoter to prevent basal gene expression until induction and a high level of transcription of the corresponding mRNA during induction, a highly efficient T7 transcription terminator and a block of various stop codons excluding the biosynthesis of elongated variants of recombinant growth hormone. The advantage of the proposed E. coli strain is the use of bacteria with the Lon OmpT phenotype, which excludes the possibility of proteolytic cleavage of the synthesized de novo recombinant somatotropin and contamination of the secreted protein with the most active E. coli proteases.

The construction of a new gene encoding human growth hormone is carried out on the basis of plasmid pET22b (+). An artificial gene encoding somatotropin flanked by the restriction enzyme sites NdeI and XhoI is obtained by enzyme-chemical synthesis of a set of oligonucleotide fragments, followed by their assembly and amplification by polymerase chain reaction (PCR). Before ligation to generate sticky ends, the amplification and the vector plasmid are treated with restriction enzymes NdeI and XhoI. The ligase mixture is used to transform competent E. coli DH5α cells. The selection of positive clones is carried out by PCR using specific primers, followed by restriction analysis of the isolated plasmid DNA with restriction enzymes NaeI and XhoI. The structure of the gene encoding the recombinant growth hormone is determined by sequencing according to the Sanger method.

It should fully correspond to the nucleotide sequence of the original artificial somatotropin gene (Fig. 1).

Recombinant plasmid DNA pES1-6 encoding a somatotropin polypeptide is characterized by the following features:

- has a molecular weight of 3.66 MDa;

- encodes a somatotropin polypeptide;

- consists of: NdeI / XhoI DNA fragment of plasmid pET22b (+), containing the promoter and terminator of transcription of T7 RNA polymerase, translation enhancer of T7 phage 10 gene, β-lactamase gene and NdeI / XhoI DNA fragment, including the artificial somatotropin gene ;

- has a unique combination of features: promoter and terminator of transcription of RNA polymerase of bacteriophage T7, translation enhancer of gene 10 of bacteriophage T7; an artificial gene encoding somatotropin; a β-lactamase gene that determines the resistance of ampicillin to E. coli transformed with plasmid pES1-6; unique recognition sites for restriction endonucleases located to the right of the NdeI site: XhoI - 38 bp, HraI - 1332 bp, PstI - 4065 bp, PvuI - 4190 bp, XhoI - 5363 by.

To obtain a producer strain of recombinant somatotropin, pES1-6 plasmid DNA is used to transform competent Escherichia coli BL21 (DE3) cells and select clones that maintain the level of biosynthesis of the recombinant polypeptide at least 60-70% of the total cellular protein for at least six consecutive passings. For this, clones of E. coli BL21 (DE3) cells transformed with plasmid pES1-6 are grown in a rich medium (YT-, LB-broth, etc.) with the addition of ampicillin up to 100 μg / ml and glucose solution up to 1% for 12-14 hours, inoculate a new portion of the nutrient medium in a ratio of 1: 100, grow the culture until the optical density reaches 1 O.E., induce isopropylthio-β-D-galactoside and grow another 3-6 hours. Obtaining recombinant somatotropin from producer cells involves the following steps: separating bacteria from the culture medium, destroying them using one of the commonly used methods; washing with buffer solutions of inclusion bodies from water-soluble cell components; solubilization and restoration of the target protein, its refolding and final purification.

The resulting producer strain Escherichia coli BL21 (DE3) / pES1-6 is characterized by the following features.

Morphological signs: rod-shaped cells, gram-negative, non-spore.

Cultural traits: when growing on LB agar medium, the colonies are round, smooth, cloudy, shiny gray, the edge is even. When growing on liquid media (on a minimal medium with glucose or YT-broth) they form an intense smooth haze.

Physico-biological characteristics: cells grow at a temperature of from 4 ° C to 40 ° C with an optimum pH of 6.8 to 7.5. As a source of nitrogen, both mineral salts in the ammonium form and organic compounds in the form of peptone, tryptone, yeast extract, amino acids, etc. are used. Amino acids, glycerin, carbohydrates are used as a carbon source.

Antibiotic resistance: cells show resistance to ampicillin (up to 500 μg / ml) due to the presence of the β-lactamase (blа) gene in the plasmid.

The advantage of the proposed producer strain is the use of bacteria with the Lon OmpT phenotype, which excludes the possibility of proteolytic cleavage of the synthesized de novo recombinant growth hormone and contamination of the secreted protein with the most active E. coli proteases.

E. coli BL21 (DE3) / pES1-6 cells are superproducers. When isopropylthio-β-D-galactoside is induced, an effective biosynthesis of recombinant growth hormone occurs, which accumulates in the cells in an amount of more than 60% of the total bacterial protein.

Figure 1 shows the nucleotide sequence and its encoded amino acid sequence of the NdeI / XhoI fragment of plasmid pES1-6; figure 2 is a physical map of the plasmid pES1-6.

The invention is illustrated by examples.

Example 1

Construction of recombinant plasmid DNA pES1-6.

The nucleotide sequence corresponding to the somatotropin gene is obtained by chemical-enzymatic synthesis. To do this, the theoretically calculated DNA sequence is divided into overlapping fragments of about 50 bp in size. Chemical synthesis of oligonucleotides corresponding to these fragments is carried out by the solid-state phosphoamidite method using, for example, ASM-102U DNA synthesizer (BIOSSET, Novosibirsk) with the oligonucleotide chain being extended from the 3'-end to the 5'-end using protected phosphamidites - 5 '-dimethoxytrityl-N-acyl-2'-deoxynucleoside-3'-O- (β-cyanethyl-diisopropylamino) phosphites activated by tetrazole. The synthesis is carried out on a scale of 0.5-0.7 μmol, using porous glass (pore size 500 A) as a carrier, to which the first nucleoside unit (load 20-30 μmol / g) is connected via a 3'-succinate bond. The resulting oligonucleotides are subjected to 5'-terminal phosphorylation using T4 polynucleotide kinase (Fermentas, Lithuania). For this, oligonucleotides in an amount of 20 pmol are mixed with the enzyme in an amount of 10 units. in a buffer solution containing 50 mM Tris-HCl (pH 7.6 at 25 ° C), 10 mM MgCl ₂ , 5 mM dithiotreite, 1 mM spermidine, 0.1 mM ATP and 0.1 mM EDTA. The reaction is carried out for 30 minutes, the polynucleotide kinase is inactivated by heating to 65 ° C for 10 minutes.

Phosphorylated oligonucleotides are mixed in an equimolar ratio of 50 μl of buffer containing 20 mM Tris-HCl, pH 7.56, 10 mM MgCl ₂ , 0.2 mM rATP, 10 mM dithiothreit, heated to 65 ° C, slowly cooled to 37 ° C within an hour and add 10 units T4 DNA ligases. The DNA ligation reaction is carried out for 4 hours at 37 ° C. 0.1 μl of the resulting solution is used as a template in the polymerase chain reaction (PCR) in the presence of thermostable Pfu DNA polymerase and specific primers

TTCCCGACCATCCCACTGTC3’ и5'ATA

TTCCCGACCATCCCACTGTC3 'and

TCATTAGAAGCCACAGCTGCCC3’.5'CCG

TCATTAGAAGCCACAGCTGCCC3 '.

25 amplification cycles (95 ° C, 20 s; 62 ° C, 40 s; 72 ° C, 60 s) are carried out to synthesize a full-sized DNA fragment containing the somatotropin gene sequence flanked by the NdeI and XhoI restriction enzyme recognition sites. The amplification product is hydrolyzed with restriction enzymes NdeI and XhoI, purified by electrophoresis in 5% acrylamide gel, a DNA strip of about 600 bp. isolated from the gel by electroelution and precipitated DNA from the solution with ethanol.

To prepare the DNA vector of plasmid pET-22b (+) (3 μg, 1 pmol), it is treated with 40 μl of Y buffer (33 mM Tris-acetate, pH 7.9, 10 mM Mg-acetate, 66 mM K-acetate 1, 0 , 5 mM DTT, 0.1 mg / ml BSA) with restriction enzyme NdeI (10 units act.), DNA is precipitated with ethanol, dissolved in 40 μl of buffer R (10 mm Tris-HCl, pH 8.5, 10 mm MgCl ₂ , 100 mM KCl, 0.1 mg / ml BSA) and treated with restriction enzyme XhoI (10 units act.) For 1 h at 37 ° C. The resulting DNA fragment of 5.4 kbp after electrophoretic separation in a 1% agarose gel, it is isolated from the gel by electroelution and DNA is precipitated from the solution with ethanol.

1 μg of the obtained vector fragment is ligated with 2 pmol of a 600 bp NdeI / XhoI fragment containing the synthetic recombinant somatotropin gene in 10 μl of buffer (20 mM Tris-HCl, pH 7.56, 10 mM MgCl ₂ , 0, 2 mM rATP, 10 mM dithiothreitis) using 10 units. Act. T4 DNA ligases for 12 hours at 10 ° C.

1 μl of the obtained ligase mixture is used for electrotransformation of competent E. coli BL21 cells (DE3), which is carried out, for example, using an apparatus for electrotransformation BTX 600 with a gap between the plates of the electroporation cell 1 mm and a discharge voltage of 1.4 kV. After transformation, the bacterial suspension is mixed with SOC growth medium, grown for 1 hour at + 37 ° C and plated on Petri dishes with LB agar containing 50 μg / ml ampicillin.

The primary selection of clones containing the desired plasmid is carried out by the method of "PCR from clones" using specific primers

TTCCCGACCATCCCACTGTC3’ и5'ATA

TTCCCGACCATCCCACTGTC3 'and

TCATTAGAAGCCACAGCTGCCC3’.5'CCG

TCATTAGAAGCCACAGCTGCCC3 '.

25 amplification cycles are observed (95 ° C, 20 s; 62 ° C, 40 s; 72 ° C, 60 s), followed by electrophoretic analysis of PCR products in 1% agarose gel for the presence of a PCR product of about 600 bp in length. The selected clones are used for the adolescent in a liquid medium and plasmid DNA isolation of the plasmid, which is analyzed for the presence of insert using restriction endonucleases NdeI and XhoI, followed by separation of the hydrolysis products in 5% polyacrylamide gel. The final structure of plasmids containing an NdeI / XhoI fragment of about 600 bp is confirmed by the determination of the nucleotide sequence by Sanger sequencing. According to sequencing data, that plasmid is selected whose nucleotide and its corresponding amino acid sequence of the NdeI / XhoI fragment of which are completely identical to the originally planned (Fig. 1). E. coli BL21 (DE3) cells are transformed with the selected plasmid as described above, 5-10 colonies are transferred in a loop in 5 ml of 2xYT liquid medium containing 50 μg / ml ampicillin for 2 hours on a shaker at a speed of 190 rpm to a turbidity A ₅₅₀ 0.7-0.8, an aliquot of the culture is taken for subsequent analysis, the inducer isopropylthio-β-D-galactoside is added to a concentration of 0.2 mM, and growth is continued for another 2 hours. Equal aliquots of the cell suspension selected prior to application inducer and after growth is centrifuged, the supernatant is separated and the cell pellet is analyzed PPAG to electrophoresis as described in Example 2. The appearance of protein bands clearly visible around 20 kDa in the specimen sample collected after induction, indicates the ability of the strain to synthesize the recombinant somatotropin with IPTG induction and fully confirms the correctness of the assembly plasmid.

Example 2

Obtaining a producer strain of E. coli BL21 (DE3) / pes1-6 with recombinant growth hormone and determining its productivity.

The E. coli BL21 (DE3) / pES1-6 producer strain is obtained by transforming competent E. coli BL21 (DE3) cells with the plasmid pES1-6, as described in Example 1.

The producer strain E. coli BL21 (DE3) / pES1-6 was grown at 37 ° C in 100 ml of YT broth (pH 7.0) with 50 μg / ml ampicillin for 2 hours on a shaker at a speed of 190 rpm to turbidity A ₅₅₀ 0.7-0.8, add isopropylthio-β-D-galactoside to a concentration of 0.2 mm and continue the process for another 6 hours or continue growing in the absence of an inductor for 6 hours. Every hour, a 2 ml sample is taken, A ₅₅₀ is determined and the amount of culture corresponding to 1 ml with A ₅₅₀ 1.0, centrifuged for 5 minutes at 6000 rpm. Precipitated cells in 100 μl of lysing buffer with dye bromphenol blue are treated with 20 ultrasound, heated for 3 min at 100 ° C and samples of 1 μl are used for electrophoresis in 15% SDS-PAGE. The gel was stained with Coomassie R-250 according to standard procedures and scanned to determine the relative amount of protein in the target protein band. According to the scan, the content of recombinant growth hormone is 60-70% of all cellular proteins.

Claims (2)

1. Recombinant plasmid DNA pES1-6 encoding a polypeptide with a sequence of human growth hormone somatotropin, having a molecular weight of 3.66 Mda (5949 bp); consisting of the NdeI / XhoI DNA fragment of the plasmid pET22b (+) containing the promoter and terminator of transcription of the T7 RNA polymerase, the translation enhancer of the T7 phage 10 gene, the NdeI / XhoI DNA fragment containing the sequence of the artificial recombinant somatotropin gene containing genetic marker of the β-lactamase gene, which determines the resistance of ampicillin to E. coli cells transformed with the pESl-6 plasmid, unique recognition sites of restriction endonucleases located to the right of the NdeI site: XbaI - 38 bp, HpaI - 1332 bp , PstI - 4065 bp, PvuI - 4190 bp, XhoI - 5363 bp 2. The strain Escherichia coli BL21 (DE3) / pES1-6, containing recombinant plasmid DNA pESl-6, is a producer of recombinant growth hormone.

Images