RU2261913C1 - RECOMBINANT PLASMID DNA pES6-1 ENCODING HUMAN POLYPEPTIDE INTERFERON BETA-1b AND STRAIN Escherichia coli BDEES6 AS PRODUCER OF HUMAN RECOMBINANT INTERFERON BETA-1b - Google Patents

Abstract

FIELD: biotechnology, genetic and protein engineering.

SUBSTANCE: invention reports construction of plasmid DNA pES6-1 based on plasmid pET22b(+) and DNA fragment comprising a sequence of artificial gene encoding human interferon β-1b providing expression of human recombinant interferon β-1b. Also, the strain Escherichia coli BDEES6 (BL21(DE3)/pES6-1) as producer of human recombinant interferonβ-1b is prepared. Invention provides enhancing yield of human recombinant interferon β-1b. Invention can be used in medicine and pharmaceutical industry.

EFFECT: valuable biological and medicinal properties of strain.

2 cl, 2 dwg, 2 ex

Description

The invention relates to biotechnology, in particular to genetic and protein engineering, and can be used to obtain recombinant human interferon β-1b.

Human interferon β (IFN β, synonym: fibroblast interferon) is secreted mainly by fibroblasts. IFN β human is a glycoprotein with a molecular weight of about 20 kDa. The peptide portion of IFN β is represented by 166 amino acid residues and contains three cysteine amino acid residues and one intramolecular disulfide bridge. IFN β has immunomodulatory, antiproliferative, antiviral and antimicrobial activity. Dosage forms exist based on interferon β-1a (IFN β-1a), obtained by expression of the natural interferon β gene in mammalian cells. IFN β-1a is glycosylated and has a natural amino acid sequence, i.e. identical to natural IFN β. Since glycosylation is not necessary for the biological activity of IFN β, it becomes attractive to use convenient and cheap bacterial expression instead of expensive expression in mammalian cells. Human interferon β-1b (IFN β-1b) is an artificially created, adapted for expression in bacteria, non-glycosylated form of interferon β that carries the substitution of cysteine at position 17 for serine and a deletion of the N-terminal methionine. Replacing cysteine at position 17 with serine eliminates the cause of dimer formation due to disulfide bonds. Interferon β-1b retains all the biological properties of natural interferon β, but thanks to the changes made, the technology for producing drugs based on it is significantly simplified [Derynck R., Content J., DeClercq E., Volckaert G., Tavernier J., Devos R ., Fiers, W. // Isolation and structure of a human fibroblast interferon gene. Nature, 1980, v. 285, p. 542-547. Lin L. // Betaseron. Dev. Biol. Stand. 1998, v. 96, p. 97-104. Pat. US No. 4737462, C 12 N 1/20, 1988].

IFN β carries out its action through binding to a specific receptor [Stark G.R., Kerr I.M., Williams B.R., Silverman R.H., Schreiber R. D. // How cells respond to interferons. Annual; Review of Biochemistry, 1998, v. 67, p. 227-264].

The dosage form of IFN β-1b (Betaferon (Schering AG, Germany)) is widely used in medicine for the treatment of multiple sclerosis.

A known method for producing recombinant IFN β-1a in mammalian cells [US Pat. US No. 5795779, C 12 N 15/22, 1998]. The disadvantages of this method are the low yield (200-600 million units with 1 liter of cell culture), a long expression time (4-6 days), and high cost.

A known method of producing recombinant IFN β in yeast cells of Pichia Pastoris [US Pat. RF No. 2180687, C 12 N 1/19, 2002]. The disadvantages of this method are the low yield (120 million units with 1 liter of cell culture) and a long expression time (6 days).

A known method of producing recombinant IFN β (not IFN β-1b) in Escherichia coli cells [SU 1703692, C 12 N 15/23, 1992]. In this case, the product will differ from IFN β-1b only in one amino acid at position 17 (in IFN β-cysteine, in IFN β-1b - serine). The disadvantage of this method is the oligomerization of the obtained protein during the renaturation process, which made it impossible to use it further for the production of drugs.

Known closest to the claimed method for producing IFN β-1b, which consists in the biosynthesis of bacterial cells of Escherichia coli bacteria of recombinant IFN β-1b [US Pat. US No. 4737462, C 12 N 1/20, 1988]. Obtaining IFN β-1b in this invention is achieved by constructing the plasmid pSY2501 and the producer obtained by transformation of the Escherichia coli strain MM294 with this plasmid. Under the tryptophan promoter, the plasmid pSY2501 carries the natural IFN β gene with the replacement of T → A to replace cysteine 17 with serine. The disadvantages of the plasmid pSY2501 and the producer based on it are the mutated natural IFN β gene and the tryptophan promoter. The natural gene contains rare (minor) codons in the genes of Escherichia coli, which leads to a decrease in protein biosynthesis of 600 million units from 1 liter of cell culture (table 1, example 4, US Pat. No. 4,737,462). The use of the tryptophan promoter limits the use of nutrient media for fermentation to only tryptophan-free media and significantly increases the fermentation time (up to 15-25 hours).

The invention solves the problem of constructing a plasmid that determines the synthesis of recombinant protein, and create a highly productive bacterial producer strain that allows to obtain recombinant IFN β-1b in high yield (170-200 mg (5.3-6.4 billion units) with 1 l of culture cells) and by simplified technology by reducing the total fermentation time to 8 hours.

The problem is solved by constructing a recombinant plasmid DNA pES6-1 encoding a polypeptide with an IFN β-1b sequence having a molecular weight of 3.61 MDa (5880 bp); consisting of the NdeI / HindIII DNA fragment of the plasmid pET22b (+) containing the promoter and terminator of transcription of the T7 RNA polymerase and the translation enhancer of the T7 phage 10 gene, and the NdeI / HindIII DNA fragment containing the sequence of the artificial gene of the recombinant IFN β-1b; containing a β-lactamase gene as a genetic marker that determines the resistance of ampicillin to E. coli transformed with plasmid pES6-1; containing unique recognition sites for restriction endonucleases located to the right of the NdeI site: XbaI - 38 bp, HpaI - 1332 bp, PstI - 4065 bp, Pvul - 4190 bp, XhoI - 5363 bp, as well as due to the producer strain Escherichia coli BDEES6 containing recombinant plasmid DNA pES6-1 - producer of recombinant IFN β-1b. The proposed strain provides the synthesis of recombinant IFN β-1b in an amount of 10-12% of the total protein content of cells.

The advantages of the invention include, firstly, the use of the widest possible set of codons that are optimal for protein production in Escherichia coli during chemical-enzymatic synthesis of the IFN β-1b gene; the location of which in the synthetic gene eliminates the possibility of the formation of extended hairpins that potentially inhibit translation on the synthesized mRNA. Figure 1 shows the amino acid sequence of IFN β-1b and the corresponding nucleotide sequence of the gene, as well as the amino acid and nucleotide sequences of the natural gene of IFN β. Secondly, the use of optimal regulatory elements that control its expression for biosynthesis of the recombinant protein: the T7-lac promoter to prevent basal gene expression until induction and a high level of transcription of the corresponding mRNA during induction, a highly efficient T7 transcription terminator, and a block of stop codons, excluding the biosynthesis of elongated variants of recombinant IFN β-1b. The advantages of the proposed E. coli strain BL21 (DE3) are the use of bacteria with the Lon OmpT phenotype, which eliminates the possibility of proteolytic cleavage of the synthesized de novo recombinant IFN α-2b and contamination of the secreted protein with the most active E. coli proteases. BL21 (DE3) also carries the T7 RNA polymerase gene, which, when using the T7-lac promoter and T7 terminator in pES4-4 plasmid, leads to fast and efficient protein production by E. coli cells and, unlike pSS5 plasmid, significantly expands the choice of nutrient fermentation media.

The construction of a new gene encoding IFN β-1b person, carried out on the basis of the plasmid pET22b (+). The artificial gene encoding IFN β-1b, flanked by the restriction enzyme sites NdeI and HindIII, is obtained by enzyme-chemical synthesis of a set of oligonucleotide fragments, followed by their assembly and amplification using polymerase chain reaction (PCR). Before ligation, the amplificate and the vector plasmid are treated with restriction enzymes NdeI and HindIII to generate sticky ends. The ligase mixture is used to transform competent E. coli DH5α cells. The selection of positive clones is carried out by PCR using specific primers, followed by restriction analysis of the isolated plasmid DNA with restriction enzymes NdeI and HindIII. The structure of the gene encoding the recombinant IFN β-1b, determined by sequencing according to the Sanger method. It should fully correspond to the nucleotide sequence of the original artificial IFN gene β-1b (Fig. 1).

Recombinant plasmid DNA pES6-1 encoding an IFN β-1b polypeptide is characterized by the following features:

- has a molecular weight of 3.61 MDa;

- encodes an IFN β-1b polypeptide;

- consists of: an NdeI / HindIII DNA fragment of plasmid pET22b (+) containing a promoter and terminator for transcription of T7 RNA polymerase, a translation enhancer of T7 phage 10 gene, β-lactamase gene, and an NdeI / HindIII DNA fragment containing an artificial gene IFN β-1b;

- has a unique combination of characteristics: promoter and terminator of transcription of RNA polymerase of the bacteriophage T7, translation enhancer of gene 10 of the bacteriophage T7; artificial gene encoding IFN β-1b; a β-lactamase gene that determines the resistance of ampicillin to E. coli transformed with plasmid pES6-1; unique recognition sites for restriction endonucleases located to the right of the NdeI site: XbaI - 38 bp, HpaI - 1332 bp, PstI - 4065 bp, Pvul - 4190 bp, XhoI - 5363 by.

To obtain a producer strain of recombinant IFN β-1b, pES6-1 plasmid DNA is used to transform competent Escherichia coli BL21 (DE3) cells and select clones that maintain the level of biosynthesis of the recombinant polypeptide at least 10-12% of the total cellular protein for at least at least six consecutive passings. For this, clones of E. coli BL21 (DE3) cells transformed with plasmid pES6-1 are grown in a rich medium (YT-, LB-broth, etc.) with the addition of ampicillin up to 100 μg / ml and glucose solution up to 1% for 12-14 hours, inoculate a new portion of the nutrient medium in a ratio of 1: 100, grow the culture until the optical density reaches 1 O.E., induce isopropylthio-β-D-galactoside, and grow another 3-6 hours. Obtaining recombinant IFN β-1b from producer cells includes the following stages: separation of bacteria from the culture medium, their destruction by one of the commonly used methods; washing with buffer solutions of inclusion bodies from water-soluble cell components; solubilization and restoration of the target protein, its refolding and final purification.

The resulting producer strain Escherichia coli BDEES6 is characterized by the following features.

Morphological signs of a rod-shaped cell, gram-negative, non-spore-bearing.

Cultural traits: when growing on LB agar medium, the colonies are round, smooth, cloudy, shiny gray, the edge is even. When growing on liquid media (on a minimal medium with glucose or YT-broth) they form an intense smooth haze.

Physico-biological characteristics: cells grow at a temperature of from 4 ° C to 40 ° C with an optimum pH of 6.8 to 7.5. As a source of nitrogen, both mineral salts in the ammonium form and organic compounds in the form of peptone, tryptone, yeast extract, amino acids, etc. are used. Amino acids, glycerin, carbohydrates are used as a carbon source.

Antibiotic resistance: cells show resistance to ampicillin (up to 500 μg / ml) due to the presence of the β-lactamase (bla) gene in the plasmid.

The advantages of the proposed producer strain is the use of bacteria with the Lon OmpT phenotype, which excludes the possibility of proteolytic cleavage of the synthesized de novo recombinant IFN β-1b and contamination of the secreted protein with the most active E. coli proteases.

E. coli BDEES6 cells are superproducers. Upon induction with isopropylthio-β-D-galactoside, the effective biosynthesis of recombinant IFN β-1b occurs, which accumulates in cells in an amount of more than 10% of the total bacterial protein.

Figure 1 presents the nucleotide sequence and its encoded amino acid sequence of the NdeI / HindIII fragment of plasmid pES6-1; figure 2 is a physical map of the plasmid pES6-1.

The invention is illustrated by examples.

Example 1

Construction of recombinant plasmid DNA pES6-1.

The nucleotide sequence corresponding to the IFN β-1b gene is obtained by chemical-enzymatic synthesis. To do this, the theoretically calculated DNA sequence is divided into overlapping fragments of 45-55 bp in size. Chemical synthesis of oligonucleotides corresponding to these fragments is carried out by the solid-state phosphoamidite method using, for example, the ASM-102U DNA synthesizer (BIOSSET, Novosibirsk) with the oligonucleotide chain being extended from the 3'-end to the 5'-end using protected phosphamidites - 5 '-dimethoxytrityl-N-acyl-2'-deoxynucleoside-3'-O- (β-cyanoethyl diisopropylamino) phosphites activated by tetrazole. The synthesis is carried out on a scale of 0.5-0.7 μmol, using porous glass (pore size 500 Å) as a support, to which the first nucleoside unit (load 20-30 μmol / g) is connected via a 3'-succinate bond. The resulting oligonucleotides are subjected to 5'-terminal phosphorylation using T4 polynucleotide kinase (Fermentas, Lithuania). For this, oligonucleotides in an amount of 20 pmol are mixed with the enzyme in an amount of 10 units. in a buffer solution containing 50 mM Tris-HCl (pH 7.6 at 25 ° С), 10 mM MgCl ₂ , 5 mM dithiotreite, 1 mM spermidine, 0.1 mM ATP and 0.1 mM EDTA. The reaction is carried out for 30 minutes, polynucleotide kinase is inactivated by heating to 65 ° C for 10 minutes.

Phosphorylated oligonucleotides are mixed in an equimolar ratio in 50 μl of a buffer containing 20 mM Tris-HCl, pH 7.56, 10 mM MgCl ₂ , 0.2 mM rATP, 10 mM dithiotreite, heated to 65 ° C, slowly cooled to 37 ° C within an hour and add 10 units T4 DNA ligases. The DNA ligation reaction is carried out for 4 hours at 37 ° C. 0.1 μl of the resulting solution is used as a template in the polymerase chain reaction (PCR) in the presence of thermostable Pfu DNA polymerase and specific primers:

5 'ATAATATCATATGTCTTATAACCTGCTGGGTTTTCTGCAACGTTCTTCTAACTTTCAA 3' and 5 'TATATTAAAGCTTTCATTAGTTACGCAGATAACCAGTCAGA 3'.

25 amplification cycles (95 ° C, 20 s; 62 ° C, 40 s; 72 ° C, 60 s) are performed to synthesize a full-sized DNA fragment containing the IFN β-1b gene sequence flanked by the NdeI and HindIII restriction enzyme recognition sites. The amplification product is hydrolyzed with restriction enzymes NdeI and HindIII, purified by electrophoresis in 5% acrylamide gel, a DNA strip of about 500 bp. isolated from the gel by electroelution and precipitated DNA from the solution with ethanol.

To prepare the DNA vector of plasmid pET-22b (+) (3 μg, 1 pmol) is treated in 40 μl of buffer R (10 mm Tris-HCl, pH 8.5, 10 mm MgCl ₂ , 100 mm KCl, 0.1 mg / ml BSA) with restriction enzymes NdeI (10 units) and HindIII (10 units) for 1 h at 37 ° C. The resulting DNA fragment of 5.4 kbp after electrophoretic separation in a 1% agarose gel, it is isolated from the gel by electroelution and DNA is precipitated from the solution with ethanol.

1 μg of the obtained vector fragment is ligated with 2 pmol of a 500 bp NdeI / HindIII fragment containing the synthetic gene of recombinant IFN β-1b in 10 μl of buffer (20 mM Tris-HCl, pH 7.56, 10 mM MgCl ₂ 0.2 mM gATP, 10 mM dithiothreitis) using 10 units of T4 DNA ligase for 12 hours at 10 ° C.

1 μl of the obtained ligase mixture is used for electrotransformation of competent E. coli BL21 cells (DE3), which is carried out, for example, using a VTX600 electrotransformation apparatus with a gap between the plates of the electroporation cell 1 mm and a discharge voltage of 1.4 kV. After transformation, the bacterial suspension is mixed with SOC growth medium, grown for 1 hour at + 37 ° C and plated on Petri dishes with LB agar containing 50 μg / ml ampicillin.

The primary selection of clones containing the desired plasmid is carried out by the method of "PCR from clones" using specific primers:

5 'ATAATATCATATGTCTTATAACCTGCTGGGTTTTCTGCAACGTTCTTCTAACTTTCAA 3' and 5 'TATATTAAAGCTTTCATTAGTTACGCAGATAACCAGTCAGA 3'.

25 amplification cycles (95 ° C, 20 s; 62 ° C, 40 s; 72 ° C, 60 s) are carried out, followed by electrophoretic analysis of the PCR products in 1% agarose gel for the presence of a PCR product of about 500 bp in length. The selected clones are used for the adolescent in a liquid medium and plasmid DNA isolation of the plasmid, which is analyzed for the presence of the insert using restriction endonucleases NdeI and HindIII, followed by separation of the hydrolysis products in a 5% polyacrylamide gel. The final structure of plasmids containing an NdeI / HindIII fragment of about 500 bp is confirmed by the determination of the nucleotide sequence by Sanger sequencing. According to sequencing data, that plasmid is selected whose nucleotide and the corresponding amino acid sequence of the NdeI / HindIII fragment of which are completely identical to the originally planned (Fig. 1). E. coli BL21 (DE3) cells are transformed with the selected plasmid as described above, 5-10 colonies are transferred in a loop in 5 ml of 2xYT liquid medium containing 50 μg / ml ampicillin for 2 hours on a shaker at a speed of 190 rpm to a turbidity A ₅₅₀ 0.7-0.8, an aliquot of the culture is taken for subsequent analysis, the inducer isopropylthio-β-D-galactoside is added to a concentration of 0.2 mM, and growth is continued for another 2 hours. Equal aliquots of the cell suspension selected prior to application inducer and after growth is centrifuged, the supernatant is separated and the cell sediment is analyzed to PAGE electrophoresis as described in Example 2. The appearance of protein bands clearly visible around 20 kDa in the specimen sample collected after induction, indicates the ability of the strain to synthesize recombinant interferon β-1b induction with IPTG and fully confirms the correctness of the assembly plasmid.

Example 2

Obtaining a producer strain of E. coli BDEES6 with recombinant IFN β-1b and determining its productivity.

The E. coli BL21 (DE3) / pES6-1 producer strain was obtained by transforming competent E. coli BL21 (DE3) cells with the pES6-1 plasmid as described in Example 1.

The producer strain E. coli BDEES6 was grown at 37 ° C in 100 ml of YT-broth (pH 7.0) with 50 μg / ml ampicillin for 2 hours on a shaker at a speed of 190 rpm until turbidity A ₅₅₀ 0.7- 0.8, add isopropylthio-β-D-galactoside to a concentration of 0.2 mM and continue the process for another 6 hours. Thus, the total fermentation time is 8 hours. Each hour, a 2 ml sample is taken, A ₅₅₀ and the amount of culture are determined, corresponding to 1 ml with A ₅₅₀ 1.0, centrifuged for 5 minutes at 6000 rpm. Precipitated cells in 100 μl of lysing buffer with dye bromphenol blue are treated with ultrasound for 20 seconds, heated for 3 min at 100 ° C, and 1 μl samples are used for electrophoresis in 15% SDS-PAGE. The gel was stained with Coomassie R-250 according to standard procedures and scanned to determine the relative amount of protein in the target protein band. According to the scan data, the content of recombinant IFN β-1b is 10-12% of all cellular proteins, which allows to obtain 170-200 mg (5.3-6.4 billion units) of human interferon d-1b with 1 liter of cell culture.

Claims (2)

1. Recombinant plasmid DNA pES6-l encoding a polypeptide with a human interferon β-1b sequence, consisting of NdeI / HindIII DNA fragment of plasmid pET22b (+), containing the promoter and terminator of transcription of T7 RNA polymerase and the translation enhancer of gene 10 of phage T7, NdeI / HindIII-DNA fragment containing the sequence of artificial recombinant human interferon β-1b, shown in Fig. 1, and containing a β-lactamase gene that determines the resistance of ampicillin to E. coli transformed with plasmid pES6-1 as a genetic marker. 2. The strain Escherichia coli BDEES6 (BL21 (DE3) / pES6-1) - producer of recombinant human interferon β-1b.

Images