RU2408726C1 - RECOMBINANT PROTEIN Collbd-CBD, RECOMBINANT PLASMID pOC-Collbd, STRAIN Escherichia coli-PRODUCER OF RECOMBINANT PROTEIN Collbd-CBD, METHOD TO PRODUCE RECOMBINANT PROTEIN Collbd-CBD - Google Patents

Abstract

FIELD: medicine.

SUBSTANCE: recombinant protein Collbd-CBD is described, consisting of collagen-binding domain Collbd (SPARC(w)), of extracellular calcium-dependent protein SPARC (VM-40 or osteonectin) of a human being and spacer sequence GGS. Method for its production is proposed, including growing of strain E. coli M15 [pREP4, pOC-Collbd]. According strain and plasmid are proposed.

EFFECT: invention makes it possible to provide a high level of recombinant protein Collbd-CBD production and simultaneously simple and efficient scheme for cleaning of this protein with its immobilization on collagen-containing sorbent included into composition of new generation of items and materials of medical purpose - implants and coatings.

4 cl, 1 dwg, 4 ex

Description

The invention relates to genetic engineering, biotechnology, microbiology, as well as medicine. Recombinant chimeric proteins that can efficiently bind to collagen and have different biological activity can be used to develop a new generation of medical products and materials - implants, coatings, etc. In addition, collagen-binding domains can be used as affinity domains for one-step purification of chimeric proteins.

At present, highly purified preparations of various recombinant proteins are widely used in medicine: growth factors, adhesion, etc. The production of materials and coatings with biologically active factors is a very complex and expensive process. The immobilization of these proteins, based, as a rule, on chemical sewing, is multistage, time-consuming and expensive. An important problem remains the development of methods for purification of final products from highly toxic lipopolysaccharides, ballast proteins, DNA and RNA of producer strains, as well as the production of functionally active biological components.

An increase in the level of expression and stability of foreign proteins in the bacterial system and the development of simple and effective protein testing and purification schemes can be achieved using a number of genetic engineering approaches. One of them is the technology for creating fused (chimeric) proteins, which is based on a method based on combining two genes (the carrier protein and the gene of the product under study) in one translation framework, leading to the synthesis of a chimeric protein in the bacterial system [Terpe K. Overview of tag protein fusions: from molecular and biochemical fundamentals to commercial systems // Appi Microbiol Biotechnol. - 2003. Vol.60. - P.523-33]. The tendency to minimize carrier protein has contributed to the development of affinity domain technology based on specific molecular recognition. Small molecular weight affinity domains of various chemical nature show their specificity when using molecular interactions of various types [Terpe K. Overview of tag protein fusions: from molecular and biochemical fundamentals to commercial systems // Appi Microbiol Biotechnol. - 2003. Vol.60. - P.523-33].

Previously, a technology was developed consisting in a fundamentally new approach to the purification of recombinant proteins by affinity immobilization on cellulose-containing sorbents. The method is based on the ability of cellulose binding domains (CBDs) - autonomous protein modules - to spontaneously interact with polymeric cellulose-containing sorbents with a high binding constant [RU No. 2278160 dated June 20, 2006, RU No. 2270249 dated February 20, 2006]. The use of CBD as a carrier protein allows the process of immobilization and purification of recombinant proteins containing CBD to be single-stage and practically toolless.

However, it seems even more promising to use collagen binding peptides as affinity domains. Collagen is one of the main components of the extracellular matrix. In addition, it plays a key role in such diverse processes as morphogenesis, wound healing, inflammatory reactions, the formation of tumor metastases, hemostasis and thrombosis. It should be noted its low toxicity and antigenicity, as well as high mechanical strength. The indicated properties of collagen look extremely promising for its use as an sorbent for the purification of chimeric proteins, as well as a component of biocompatible materials and coatings.

Based on the structure, all sides of the three chains of the collagen molecule that come to the surface are accessible for various intermolecular interactions. Collagen-binding ligands include surface cell receptors such as α1β1 and α2β1 integrins and NG2 proteoglycans; several growth factors; small matrix proteoglycans and other matrix proteins such as nidogen, BM-40 and von Willebrand factor. Most bindings occur with an intact triple helix structure [T. Sasaki, E. Hohenester, W. Gohring, and R. Timpl. The EMBO Journal. 1998.17 (6): 1625-1634]. Collagen in damaged tissues may be a potential target for growth factors inducing tissue repair. In addition, collagen materials can be useful as potential carriers of growth factors when placed on a metal implant or damaged tissue.

The claimed group of inventions is based on the task of creating an E. coli strain that provides a high level of production of the recombinant Collbd-CBD protein, and, at the same time, a simple and effective scheme for the purification of this protein, with its immobilization on a collagen-containing sorbent, which is part of a new generation of products and materials medical purposes - implants and composite coatings.

This problem was solved by synthesizing the recombinant Collbd-CBD protein in E. coli cells, in particular by introducing the cellulose binding domain (CBD) from the endoglucanase Anaerocellum thermophilum into the recombinant protein, and also by introducing a spacer sequence of 19 amino acid between the functional domains residues to preserve the function of activation of cell growth by fusion proteins associated with the collagen matrix. In addition, the mentioned problem was solved due to the possibility of a one-stage highly efficient purification of the recombinant Collbd-CBD protein containing a collagen-binding domain and its immobilization on a collagen-containing nanocomposite coating. Also, the aforementioned problem was solved by using for the genetic engineering construction of the plasmid vector pOC encoding the cellulose binding domain (CBD) and the glycine-serine spacer [N.E. Sharapova, A.P. Kotnova, Z.M. Galushkina, N.N. Poletaeva, N.V. Lavrova, E.I. Aksenova, A.S. Semikhin, A.S. Karyagin, V.G. Lunin. Obtaining and characterization of collagen-binding domains from human von Willebrand factor. // Molecular Genetics, Microbiology and Virology. - 2009. - No. 4. - S.31-35], which allows to provide a high level of expression of the resulting chimeric Collbd-CBD protein. The use of technology to create chimeric proteins in this case is a prerequisite for obtaining the target protein, since Collbd itself is very small (contains only 20 amino acid residues) and can undergo proteolysis in producer cells.

The essence of the invention lies in the fact that the recombinant plasmid pOC-Collbd size 3478 bp provides the expression of the recombinant Collbd-CBD protein, consisting of the collagen-binding domain of Collbd from the extracellular calcium-dependent protein Collbd of a person, a spacer from glycine and serine residues, and the cellulose-binding domain (CBD) from Anaerocellum thermophilum endoglucanase, and contains:

- an artificial bacterial operon of chimeric proteins, including: the promoter region of the early promoter of the T5 bacteriophage (7-87 bp), which provides efficient transcription of controlled mRNA; a recombinant gene that provides expression of the target chimeric protein (Collbd collagen binding domain - spacer - CBD cellulose binding domain) (117-794 bp); the untranslated region of the transcription termination of the bacterial operon, which ensures the efficient termination of transcription (834–928 bp);

- bla bacterial operon (3263-2413 bp complementary chain) encoding a beta-lactamase protein, which is a selective marker for selection of E. coli transforming clones by counter-selection;

- a bacterial site of ColEl-type replication initiation, which provides plasmid replication in E. coli strains (1879 bp).

The strain Escherichia coli M15 [pREP4, pOC-Collbd] was obtained by transformation of the strain Escherichia coli M15 / pREP4 with the plasmid pOC-Collbd. The resulting strain is a producer of a recombinant Collbd-CBD protein consisting of the collbd binding domain of Collbd from the extracellular calcium dependent human Collbd protein, a spacer of glycine and serine residues, and a cellulose binding domain (CBD).

The recombinant Collbd-CBD protein, consisting of the collb-binding domain of Collbd from the extracellular calcium-dependent human Collbd protein, the spacer from the glycine and serine residues and the cellulose-binding domain (CBD), has the ability to bind spontaneously to a collagen-containing sorbent, as well as due to the presence of various types of cellulose protein CBD.

A method of producing a recombinant Collbd-CBD protein includes growing cells of the Escherichia coli strain M15 [pREP4, pOC-Collbd], inducing the synthesis of Collbd-CBD protein, disrupting cells, obtaining a supernatant containing protein, immobilizing the protein by adding a suspension of cellulose-containing sorbent to the supernatant, incubation, washing the sorbent with the bound protein, subsequent elution of the protein from the sorbent.

The technical result of the claimed invention is to provide a high level of production of the recombinant Collbd-CBD protein and at the same time to provide a simple and effective purification scheme for this protein, with its immobilization on a collagen-containing sorbent that is part of a new generation of medical products and materials - implants and coatings.

Thus, the technical result is achieved due to the fact that the created recombinant plasmid pOC-Collbd encoding the bifunctional recombinant protein Collbd-CBD, on the one hand, containing the amino acid sequence of the collagen-binding domain Collbd, and on the other hand, having the ability to independently bind to the cellulose-containing sorbent, thanks to the presence of CBD. When constructing this plasmid, the Collbd collagen-binding domain was synthesized from four oligonucleotides into which the restriction endonucleases NcoI and BamHI were inserted. Thanks to these sites, chimeric proteins can be obtained in which the collagen binding domain is at the N-terminus.

Also, the specified technical result is achieved by the fact that the strain Escherichia coli M15 [pREP4, pOC-Collbd] is a producer of the recombinant protein Collbd-CBD. At the same time, the absence of proteins capable of binding to collagen in E. coli cells ensures that the recombinant Collbd-CBD protein is the only protein of the Escherichia coli M15 strain [pREP4, pOC-Collbd] that binds strongly to the used sorbent, which provides the possibility of one-step obtaining a highly purified preparation of the indicated recombinant protein immobilized on a collagen-containing sorbent.

Strain E. coli M15 [pREP4] containing the plasmid pOC-Collbd, the producer of the recombinant protein Collbd-CBD, is characterized by the following features.

Cultural and morphological characters. Cells are straight, rod-shaped, motionless, gram-negative. When sieving on a plate with 1.5% LB agar, growth in the form of separate colonies, sometimes in the R-form with uneven edges. It grows well on solid and liquid nutrient media (LB-broth, LB-agar, MPA, MPB).

Physiological and biochemical characteristics. Cells grow within + 4-42 ° C with optimum pH of 6.8-7.5. Strains decompose glucose, mannitol with the formation of acid, do not decompose sucrose, arabinose, galactose, ferment maltose, xylose, sorbitol, rhamnose. Significant when using these strains is their sensitivity to nalidixic acid (25 mg / ml), streptomycin (20 mg / ml) and rifampicin (25 mg / ml). Resistant to ampicillin (up to 100 μg / ml) due to the presence of the plasmid pOC-Collbd and to kanamycin (up to 25 μg / ml) due to the presence of plasmid pREP4.

The indicated technical result is also achieved by the fact that the recombinant Collbd-CBD protein, including the CBD amino acid sequence, which determines the ability of this protein to bind to the cellulose-binding sorbent, allows concentration, purification and immobilization of Collbd-CBD protein on the cellulose sorbent in one step.

This technical result is also achieved by the fact that the method of purification, concentration and preparation of the immobilized recombinant Collbd-CBD protein consists in treating the supernatant of the cell hydrolyzate of E. coli strain M15 [pREP4, pOC-Collbd] with a cellulose-containing sorbent, followed by washing the sorbent with an immobilized recombinant recombinant Collbd-CBD protein elution with sorbent and dialysis.

Also, the indicated technical result is achieved in that the recombinant Collbd-CBD protein containing the amino acid sequence of the collagen-binding domain of Collbd is capable of interacting with a collagen-containing sorbent (gelatin).

The invention is illustrated in the drawing.

The drawing shows a diagram of the plasmid pOC-Collbd.

In the list of sequences: the nucleotide sequence of the plasmid pOC-Collbd - sequence No. 1, the amino acid sequence of the collagen binding domain protein Collbd - sequence No. 2, the amino acid sequence of the glycine-serine spacer - sequence No. 3, the amino acid sequence of the cellulose-binding domain CBD sequence No. 4.

All standard genetic engineering and microbiological manipulations, as well as amplification and DNA sequencing, were carried out according to well-known methods (Maniatis T., Fritsch E., Sambrook J., Molecular cloning, M., Mir, 1984; DNA cloning. Methods. Ed. D. Glover, Translated from English, Moscow, Mir, 1988; Saiki RK, Gelfand DH, Stoffel S., Sharf SJ, Higuchi R., Horn GT, Mullis KB, Eriich HA Science, 1988. V.239, No. 4839, p. 487-491; Sanger F., Nicklen S., Coulson AR Proc. Nat. Acad. Sci. USA, 1977, V.74, p. 5463-5467).

The following are examples illustrating the invention.

Examples.

Example 1. Obtaining plasmids pOC-Collbd.

a) Chemical synthesis of oligodeoxyribonucleotides.

Oligodeoxyribonucleotides were synthesized by the solid-state phosphoramidite method using an AFM 100-2 synthesizer (Novosibirsk) and purified by electrophoresis in 12% SDS page.

b) Obtaining the Collbd gene followed by its cloning.

The collagen-binding domain of human extracellular calcium-binding protein Collbd (BM-40 or osteonectin) was synthesized using 4 complementary oligonucleotides of the following composition (5'-3 '):

Dir1: CATGCTGGACTCTGAACTGACCGAATTCCC

Dir2: GCTGCGCATGCGTGACTGGCTGAAAACCCCGGGTGGTTCTG

Rev1: GATCCAGAACCACCCGGGTTTTTAGAGCCAGTCACGCA

Rev2: TGCGCAGCGGGAATTCGGTCAGTTCAGAGTCCAG

The oligonucleotides were designed in such a way that upon assembly they form a double-stranded DNA fragment containing sticky ends corresponding to the NcoI and BamHI restriction enzyme hydrolysis sites. In the synthesis, oligonucleotides were phosphorylated at the 5'-end.

To assemble a double-stranded DNA fragment, a mixture of oligonucleotides (20 pcM each) was heated at 95 ° C (10 min) and cooled to 25 ° C for 4 hours. The resulting mixture was combined with a fragment of the plasmid pOC (3407 bp), hydrolyzed with restriction endonucleases NcoI and BamHI at 37 ° C in a buffer solution containing 66 mM Tris-acetate (pH 7.9 at 37 ° C), 20 mM magnesium acetate , 132 mM potassium acetate for 1.5 hours. Ligation was performed using T4 phage DNA ligase in a buffer containing 40 mM Tris-HCl (pH 7.8 at 25 ° C), 10 mM magnesium chloride, 10 mM DTT, and 5 mM ATP. The ligated DNA mixture was used to transform E. coli cells of strain M15 [pREP4] by electroporation. Transformed cells were selected on LB agar medium with antibiotics kanamycin (25 μg / ml) and ampicillin (100 μg / ml). Plasmid DNA was isolated from the selected recombinant clones by alkaline lysis. The selected clones were sequenced and confirmed the presence of an insert corresponding to the collagen binding domain from the extracellular calcium binding protein SPARC (BM-40 or osteonectin) of a person.

Example 2. Obtaining a strain of E. coli - producer of the recombinant protein Collbd-CBD, consisting of collagen binding domain Collbd, glycine-serine spacer and cellulose-binding domain CBD.

To obtain E. coli strain - producer of the recombinant protein Collbd-CBD, cells of the E. coli strain M15 [pREP4] (Nal ^s , Str ^s , rif ^s , lac-, ara-, gal-, mtl-, F-, recA +, uvr +) was transformed with the plasmid pOC-Collbd. Transformed cells were grown in 500 ml of LB medium at 37 ° C to an optical density corresponding to 1 unit. absorbance at a wavelength of 600 nm, 150 μl of a 0.1 M solution of isopropyl-beta-D-thiogalactopyranoside was induced and grown for 8 hours.

To control the production of the recombinant Collbd-CBD protein by cells of the E. coli M15 strain [pREP4, pOC-Collbd], the PAGE method was used in the presence of sodium dodecyl sulfate. Protein separation was carried out in 12% PAGE in a standard buffer system (electrode buffer: 25 mM Tris-HCl, 192 mM glycine, 0.1% sodium dodecyl sulfate, pH 8.3; gel buffer: 375 mm Tris-HCl, pH 8.8). At the end of electrophoresis, the gels were stained with 0.15% Coomassie G250 solution in 25% isopropanol and 10% acetic acid and washed in 10% acetic acid. When comparing the protein spectrum of strains of E. coli M15 [pREP4] and E. coli M15 [pREP4, pOC-Collbd], the appearance of an additional protein band with a molecular weight of 25 kDa, which corresponds to the molecular weight of the recombinant Collbd-CBD protein. The level of synthesis of Collbd-CBD protein was determined by comparing the color intensity of the band of the recombinant protein with the band of the corresponding protein — molecular weight standard. According to the data obtained, cells of the E. coli M15 strain [pREP4, pOC-Collbd] synthesize about 20% Collbd-CBD of the total cell protein.

Example 3. A method for isolating a Collbd-CBD protein preparation in a cellulose-containing sorbent.

E. coli M15 [pREP4] cells transformed with pOC-Collbd plasmid were grown in 3.5 ml of LB medium with ampicillin and kanamycin at 37 ° C to an optical density corresponding to 1 unit. absorbance at a wavelength of 600 nm, 3 μl of a 0.1 M solution of isopropyl-beta-D-thiogalactopyranoside was added and grown for 4 hours. The culture was diluted to an optical density of 0.7 at 530 nm, 400 μl of the suspension was taken, cells were precipitated by centrifugation at 5000 rpm for 10 minutes Cells were resuspended in 500 μl of phosphate-citrate buffer (FCB, 50 mM, pH 6.0), sonicated, cell debris was removed by centrifugation at 16,000 rpm for 10 min.

To 100 μl of a 50% suspension of microcrystalline cellulose was added 2 ml of a buffer solution containing 30 mM Tris, pH 8.0, and 0.15 M sodium chloride, as well as a cell lysate in a 7 M solution of guanidine chloride. Incubated at + 4 ° C for 2 hours, then left for 16 hours at the same temperature. The resulting suspension was centrifuged for 5 minutes at 5000 rpm. The precipitate of the sorbent with the bound protein was washed three times with a buffer solution containing 30 mM Tris, pH 8.0, and 0.15 M sodium chloride.

Protein elution was carried out with a buffer solution containing 7 M guanidine hydrochloride in a volume ratio of 1: 1 to the obtained sorbent precipitate with immobilized protein for 10 min at room temperature. The analysis of the results of binding and elution of Collbd-CBD protein was carried out by Laemmli electrophoresis in 12% SDS page under denaturing conditions.

According to the results of SDS page electrophoresis in the presence of particleboard, the concentration of Collbd-CBD protein was 15 mg per 1 ml of sorbent.

Example 4. The binding of the recombinant protein Collbd-CBD with a collagen-containing sorbent.

To 100 μl of a 50% suspension of gelatin-sepharose, 2 ml of a buffer solution containing 30 mM Tris pH 8.0 and 0.15 M sodium chloride, as well as 200 μl of a solution of the eluted protein in a 7 M solution of guanidine chloride were added. They were incubated with stirring in ice for 18 hours. The resulting suspension was centrifuged for 5 minutes at 5000 rpm. The precipitate of the sorbent with the bound protein was washed three times with a buffer solution containing 30 mM Tris pH 8.0 and 0.15 M sodium chloride.

Protein elution was performed with a buffer solution containing 6 M urea, 30 mM Tris pH 8.0 and 10 mM EDTA. The analysis of the results of binding and elution of Collbd-CBD protein with a collagen-containing sorbent of the domains was carried out by Laemmli electrophoresis in 12% PAG under denaturing conditions.

According to the results of SDS page electrophoresis in the presence of SDS, almost 100% binding of the recombinant Collbd-CBD protein to gelatin-sepharose was shown.

Claims (4)

1. Recombinant Collbd-CBD protein, consisting of the collb-binding domain of Collbd from the extracellular calcium-dependent human SPARC protein with the sequence SEQ ID NO: 2, a spacer of glycine and serine residues with the sequence SEQ ID NO: 3 and bone morphogenetic protein CBD with the sequence SEQ ID NO : 4, which has the biological properties of the CBD protein and the ability to spontaneously bind to a collagen-containing sorbent. 2. Recombinant plasmid pOC-Collbd with the sequence of SEQ ID NO: 1, providing expression of the recombinant protein CollbdD-CBD according to claim 1, containing
artificial bacterial operon of chimeric proteins, including the promoter region of the early promoter of the T5 bacteriophage, providing efficient transcription of controlled mRNA;
a recombinant gene for the expression of the target chimeric protein according to claim 1;
the untranslated region of the transcription termination of the bacterial operon, which ensures the efficient termination of transcription;
bacterial operon bla encoding beta-lactamase protein, which is a selective marker for selection of E. coli transforming clones by counter-selection;
ColEl-type bacterial replication initiation site for plasmid replication in E. coli strains. 3. The strain Escherichia coli M15 [pREP4, pCollbd-BMP-2], obtained by transforming the strain of Escherichia coli M15 / pREP4 with the plasmid pCollbd-BMP-2 according to n.2, is a producer of the recombinant protein Collbd-BMP-2 according to claim 1. 4. The method of producing the recombinant Collbd-CBD protein according to claim 1, comprising growing cells of the Escherichia coli strain M15 [pREP4, pOC-Collbd], inducing the synthesis of Collbd-CBD protein according to claim 1, cell disruption, obtaining a supernatant containing protein, immobilization protein by adding a suspension of a collagen-containing sorbent to the supernatant, incubating, washing the sorbent with the bound protein, subsequent elution of the protein from the sorbent and dialysis.

Images