JPH02501706A - biological adhesive - Google Patents

Abstract

(57) [Summary] This bulletin contains application data before electronic filing, so abstract data is not recorded.

Description

[Detailed description of the invention] biological adhesive Cross-reference of related applications This application is a partially pending application No. 650,128 filed on September 13, 1984. No. 933,945, filed November 24, 1986, is a pending application.

The present invention describes a biological system that can be used to bind substances for use in a humid environment. The present invention relates to a method for producing bioadhesives. Biological of the present invention Adhesive substances are typically used as marine adhesives, biomedical adhesives, or dental adhesives. It will be done. Additionally, the present invention provides a method for attaching biological adhesives to bioadhesive materials by chemical or enzymatic treatment. Concerning the microbial production of bioadhesive precursor proteins that can be transformed into do.

A brief explanation of Tonagi technology In general, the properties of adhesive materials are tailored to meet the requirements of the particular environment in which they are used. have to adjust. Ideally, the adhesive should cure and It maintains both adhesion and cohesion under conditions of use. cure is a change in the physical properties of an adhesive substance by chemical or enzymatic means. Book In the case of bioadhesive materials prepared by the method described in the specification, curing is accomplished by a catalyst or It is thought to be based on cross-linking of mutually non-curing adhesive molecules by chemicals and/or chemicals. It will be done. Furthermore, curing may also be associated with adhesive crosslinking with the substrate.

Many adhesives that exhibit excellent adhesion properties in dry conditions exhibit poor adhesion in wet environments. There is a substantial or major loss of quality. Furthermore, traditional adhesives are not suitable for wet environments. It cannot be cured below. Therefore, marine adhesives can be used in humid environments. , or adhesives that can be applied in medical and dental applications, are particularly difficult to develop. Met.

Marine bivalves (musse) Vertebrates can secrete adhesive substances, which allow them to adhere to underwater objects. do. For example, Mytilus edulis (~Iytilus edulis) and Mytilus californianus ) species deposit a hardening adhesive substance from their feet, forming a substrate. permanently attached to. Adhesive puller deposited from Mytilus nibnis The main component of the protein is a hydroxylated protein of approximately 130,000 daltons. [Waite, J, H,), J, Biol, Cem, 258:2911-2915 (1983)]. If this substance is wet Although it would be possible to make an excellent adhesive that can be used in a humid environment, the adhesive substance 1k In practice, approximately 5 to 10 million shellfish would be required to extract g. It is not possible to commercially isolate uncured adhesive materials from species. In the unlikely event that this adhesive substance If used for medical purposes, other shellfish proteins and contaminants should be removed before use. can be removed from physical adhesives to eliminate antigenic or anaphylactic reactions. In addition to being a very troublesome process, great care must be taken to prevent this from happening. If there is, it will not be.

U.S. Pat. No. 4,585,585 discloses isolated bivalve adhesive proteins. By chemically linking decabebutide units prepared by enzymatic digestion, A procedure for preparing bioadhesive polymers is disclosed. How to disclose this patent According to [Science, 212:1038 (1981)] Biological access was obtained from the phenolic glands of shellfish of the genus Mytilus using a protein purification method developed using Isolate the adherent protein. Molecular weight 120,000 to 140,000 Daltons The isolated biological adhesive material with It is reduced to about 10°000 Daltons. This processed protein is then The resulting digested protein was subjected to gel filtration dialysis, and the formula: %formula% The decapeptide shown is isolated. Then, the decapeptidate prepared by this method glutaraldehyde, oligopeptides, amino acids or other bifunctional linking groups. Polymerize using chemical linking groups such as decapeptide units such as A bioadhesive material containing approximately 1,000 is prepared.

The method of U.S. Pat. No. 4,585,585 is also not practical on a commercial scale, as mentioned above. There is a need for isolation of bioadhesive proteins from non-indigenous shellfish. moreover, In addition to the tedious purification procedures, this method requires enzymatic digestion and single generation of decapeptide fragments. addition of detachment and chemical reassembly of this fragment into a bioadhesive polymer. A process is required. This difficult procedure is not suitable for commercial production. Sara The polymers prepared by this method are obtained by tryptic digestion of the original molecule. This is a chemically polymerized decapeptide that is suitable for shellfish contact. This is completely different from the adhering material. Analyzing the natural genes disclosed herein This suggests that the shellfish adhesive from Mytilus edenilis has other important sequence factors. It has been proven that they have a child.

Thus, the superior properties associated with biological adhesives on shellfish feet under humid environments. Efficient means and methods for producing biological adhesives with properties continue to be required. There is.

In addition, the properties of adhesive substances on shellfish feet eliminate the need to handle and process large quantities of shellfish. There continues to be a need for means and methods of producing biological adhesives that exhibit high quality. do not have.

R plate 9ri shun The present invention relates to bivalves (mussels) [diplomats such as mussels], Barnac (1es) ], and types produced from marine animals such as oysters. It relates to the application of recombinant DNA technology techniques to the production of biological adhesives. Details Specifically, the present inventors have discovered that the bivalve Mytilus nibunis edulis) natural biological adhesive precursor protein (polyphenolic We clone the genes that govern these proteins (also called proteins) and grow these precursor proteins in microorganisms. We constructed an expression vector that can be expressed in a host. Biological adhesive precursor protein Hydroxylation is carried out chemically or enzymatically to mimic the reactions that occur in the body of bivalves. When cured, an adhesive protein is obtained which, when cured, forms a wet ring. It becomes an adhesive substance that exhibits excellent properties under environmental conditions.

These studies by the present inventors have revealed that natural M. edenilis is a biological adhesive precursor. Various cDNA clones encoding the protein have been isolated. coded data Two of the proteins (encoded proteins) (cDNA isolate 14-1 and 52) have in common a hexapepeptide followed by 12 decapeptides. It has a C-terminal sequence of 134 amino acids, including 10 is homologous to the decapeptide sequence described in U.S. Pat. No. 4,585,585. is not shown.

Other encoded proteins obtained from cDNA isolate 55 are cDNA14-1 and 53 and 110 amino acids in the protein encoded by and within another region, cDNA isolated 56 and Homology to 34 and 57 amino acids in the protein encoded by have. This coding homology is maintained at the DNA level. these What can be explained from observations is that M. edulis polyphenolic protein Genes can be spliced together in different combinations at the mRNA level. This means that it may contain several exons. or , the existence of several closely related genes is conceivable.

As explained above, this applies to a certain combination of exons or to an organism. The disclosure is not intended to be limited to the chemical adhesion precursor protein; The law requires the isolation and use of any gene or combination of genes that exist. This makes it possible to

Unique decapeptides observed in the four cDNA clones described herein In all of the segments encoding decapeptides, 2 of the 39 decapeptides Four of them show homology to the decapeptide described in U.S. Pat. No. 4,585,585. I haven't.

Furthermore, the encoding protein obtained from cDNA isolate N1 (2,1 kb clone) The protein consists of 76 consecutive tandem repeats of decapeptides and hexapeptides ( tandem repeat). 63 molecules in N1 protein Of the capeptides, 32 are decapeptides described in U.S. Pat. No. 4,585,585. It shows no homology with de.

The present invention relates to biological studies of marine animals, such as shellfish of the genus Mytilus such as M. edulis. Contains codons encoding the natural amino acid sequence of adhesive precursor protein It provides a DNA segment that

Another aspect of the invention provides for expressing a biological adhesive precursor protein. A vector of (a) Biological adhesives for shellfish such as bivalves of the genus Mytilus; A code encoding the natural amino acid sequence of a precursor protein, or a fragment thereof. and (b) a microorganism of the biological adhesive precursor protein. functionally linked to the DNA segment to enable expression by the organism. Promoters and transcription initiation signals An object of the present invention is to provide a vector containing the following.

Additionally, one embodiment of the invention provides for chemically or enzymatically converting the bioadhesive into a bioadhesive. Transformation capable of expressing a biological adhesive precursor protein that can be The objective is to provide anabolic microorganisms. This transformant is derived from Escherichia coli (E. coli) or or Saccharomyces cere By transforming a host microorganism such as S. visiae) with the above expression vector. It is prepared as follows.

Yet another aspect of the invention provides a method for producing bioadhesive proteins. It's about doing. Expression vector for expressing biological adhesive precursor protein The transformed microorganism containing the and collect the precursor protein. Precursor proteins, as detailed below contains subunits of amino acid sequences with tyrosine and proline residues. IL. , -) The precursor protein is produced by chemical or enzymatic hydroxylation. is converted into a biologically adhesive protein, and this conversion is caused by at least some tyrosine The residue part is replaced with 3,4-dihydroxyphenylalanine (DOPA) residue. If necessary, at least some proline residues can be replaced with hydroxyproline residues. Convert further to the base.

In a preferred embodiment of the invention, the bioadhesive precursor protein is subjected to enzymatic treatment, e.g. For example, it is hydroxylated by treatment with mushroom tyrosinase.

Furthermore, the present invention provides the use of bioadhesive proteins as adhesives themselves and It is used as a primer coating for some adhesives and is bonded to It also provides a method for bonding surfaces, consisting of applying It is.

The invention also provides bioadhesive proteins and other polymers and/or Provides a method for bonding or wetting surfaces with composite materials containing adhesives, etc. It is something.

Brief description of the drawing Figure 1 shows the cD encoding the bioadhesive precursor protein of M. edenilis. DNA sequence and translated protein of the gene identified as NA clone 14-1 Represents a amino acid sequence.

Figure 2 shows the cD containing the bioadhesin precursor protein of M. edenilis DNA sequence and translated amino acid of the gene identified as NA clone 52 Represents an acid sequence.

Figure 3 shows the cD encoding the bioadhesive precursor protein of M. edulis. DNA sequence and translated amino acid of the gene identified as NA clone 55 Represents an acid sequence.

Figure 4 shows the cD encoding the bioadhesive precursor protein of M. edulis. DNA sequence and translated amino acid of the gene identified as NA clone 56 Represents an acid sequence.

Figure 5(a) shows the sequence of the multiple restriction site region of plasmid pGX2627. vinegar. Figure 5(b) shows plasmid pGX2287 to plasmid pGX2346. The DNA sequence and translated segment of the synthetic RNA used to construct the represents the amino acid sequence obtained.

Figure 6 shows plasmids pGX2346, pGX2368, pGX2377, pG A schematic diagram showing the construction method of X2380, pGX2381, and pGX2383 is shown below. vinegar. Plasmid pGX2383 is an expression vector for biological adhesive precursor protein. - is.

FIG. 7 is the DNA sequence of plasmid pGX2627.

Figure 8 shows GAL4 binding site, MF-α1 transcription start site, PH05 signal ligated sequence, GAPDH terminator sequence, E. coli ampicillin resistance sex markers and LE used for selection of plasmids in S. cerevisiae YT)GX showing the location and orientation of major functional factors such as U2 marker Represents a restriction map of the 265GAL4 shuttle vector.

Figure 9 encodes the bioadhesive precursor protein of M, Nibs, IJs. c DNA sequence and translation of the gene identified as DN A clone N1 represents the amino acid sequence obtained.

FIG. 10 shows amino acid variations in the decapeptide of clone N1. Quote The individual amino acids at the positions indicated are shown. The variation in each position is represented by a subscript number. This number is used for each clone in which the amino acid occurs at the cited position. The number of decapeptides in sample N1 is shown.

Figure 11 shows the restricted regions of ypcx283 showing the location and orientation of major functional factors. represent a diagram

Figure 12 shows the location and orientation of major functional factors in ypcx405 yeast E. , col i represents the restriction map of Torvector.

Detailed Description of Preferred Embodiments of the Invention The method for preparing the expression vector of the invention generally includes and includes the following series of steps: (a) mRNA is isolated from the phenolic glands of the feet of N-producing animals, such as M. edulis. let go, (b) Synthesize complementary DNA (cDNA) and transform the resulting cDNA into bacteriophage insert into the page, (C) Transfect E, col i with the recombinant bacteriophage and culture the obtained transfected E, col i, (d) the obtained Biological adhesion by hybridization of transformants with radiolabeled probes selecting clones containing the substance precursor protein gene; (e) a DNA segment hooding a bioadhesive precursor protein; Generated in the 3° portion of the gene encoding the hybrid fusion protein. Insert into current vector. In some cases, methionine residues are used as biological adhesive precursors. It is located at the amino terminal side ζ4 of the amino acid sequence of the protein. (rDNA segment The term "total" refers to a portion of a marine animal that is smaller than its entire genome. )a+R NA can be isolated from M. edulis as follows: two living pieces The foot organs containing phenolic glands were isolated from shellfish shells; the tissue was placed in liquid nitrogen. Homogenize with; Dissolve the obtained frozen tissue in guanidine thiocyanate [ Mesosenzymology of MaCandliss, R. et al. -(Methods Enzymol, ), 79:5l-57 (1981) or the frozen tissue thereof as ribonucleoside-vanadyl complex. Cells were lysed in the presence of gas, and the lysed tissue was extracted with phenol [Berga - (Berger, S.) et al., J. Biol.

Chem, 255:2955-2961 (1980)]; and Ori. Purify polyA-containing RNA by binding to GodT cellulose [Avive ( Bronding of Aviv, H,) and Leder, P, ・Of National Academy of Sciences USA, 69:1 408-1412 (1972)].

Similar methods have been applied to the genetics of other marine animals encoding biological adhesive proteins. It can be used to isolate offspring mRNA transcripts.

Extraction, that is, using mRNA extracted from phenol glands as a template, The presence of reverse transcriptase, dATP, dCTP, dGTP, and dTTP is determined by cDNA is prepared in the presence of For monitoring the synthesis, [α-”P]dCTP etc. Conveniently, radioactive markers are used. Next, the mRNA portion is extracted by a conventional method. Remove E, c.

]1 DNA polymerase ■ (Klenow frag The first in the presence of mentino, dATP, dCTP, dGTP, and dTTP The cDNA strand is used as a template to synthesize a second cDNA strand.

Those skilled in the art will understand that the double-stranded (ds-cDNA) prepared by this method You should know that DNA contains hairpin loops. This one Strand loops can be easily removed by digestion with S1 nuclease.

Next, use the methods described herein to prepare a library of clones. Insert the prepared ds-cDNA into a cloning vector and insert it in front of a biological adhesive. Screen for the presence of proprotein gene. The inventor Roha, Clough The batataeri phage λgtl○ was used as a vector. However, this As a trader, you should be aware that many other vectors can be easily used for this same purpose. You probably recognize it. ds-cDNA to EcoR’I site of λgtlo In order to insert DNA polymerase 1 (Klenow fragment), we first ds- cD　N　, After blunt-ending both ends of A, a synthetic 8-base pair EeoRI linker was added. - was added to both ends of the obtained ds-cDNA. Eco of ds-cDNA To prevent cleavage by RI, it was first methylated with EcoR1 methylase. . The linker is phosphorylated in polynucleotide kinase buffer and Tl gauze was ligated to both ends of the blunt-ended ds-cDNA in the presence of . Then, Ec Various linkers were removed from the ends by oRI digestion. EcoRT linker The ds-cDNA with the DNA was inserted into the EcoRr-cleaved λgtlo.

The cloning vector containing the cDNA is propagated in a suitable host. Recombinant In the case of λgtlo, we used the recombinant phage DNA as E, co λgtl of li strain BNN1o2 E finif (Huynh, T, V,) et al. Construction and screening of cDNA libraries in o and λgt 11 In: D, M, Glover (ed.) DNA Cloning, Volume 1 .

TRL Breath, Oxford (1985), pp. 49-78]. Enquist and Sternber g) Methods Enzymol, 68:281-298 (197 Packaging into the henode of batataeriophage λ by the method disclosed in 9) did. This host strain carries the λgtlO bacteriophage at the EcoRI site. Only those inserts that do will form plaques. Transfected hosts are subjected to appropriate conditions. cultured under conditions and examined for plaque.

The ds-c DN A library prepared by the method described above was added to the radiolabeled synthetic Biological adhesives by hybridization with oligonucleotide probes Screen for the presence of the protein precursor protein gene. biological adhesive One predominant decapeptide within the precursor protein decapepitide) ζ, ala-1ys-pr.

-ser -tyr -pro -pro -thr -tyr -1ys It is known that (to do)

Screening recombinant phage libraries for precursor protein selection genes In order to Although oligonucleotide probes were constructed and radiolabeled, these two probes is randomly selected from among 98,304 possible encoding combinations. It was.

The two selected sequences are shown below: GCG AAA CCA AGT TA CCCA CCG ACCTACAAA.

and GCG AAA CCT TCT TAT CCG CCT ACCTAT A The reduced stringency already established in the AG0 Southern plot experiment Under hybridization wash conditions (details described in the Examples below), irradiation was performed. Labeled probes were used to immobilize two nitrocellulose filter replicates. The established plaques were then annotated. To the best of our knowledge, this This is why 30-base probes are successful in this type of screening. This is the shortest synthetic probe available. Autoradiography of two filters Plaques showing a positive signal were purified by fi, screened again, and D Grow in plate lysates for NA preparation. [Molecular cloning by Maniatis, T. Molecular Cloning): Laboratory Manual ”, Cold Spring Harbor Laboratory, pp. 371-372 (19 82)]. The DNA sequence of the isolated clone can be determined by well-known methods. Can be done.

By the previously described method (which is explained in more detail in the examples below), several A clone was isolated. Five clones were characterized in detail and are described herein. These contain a DNA sequence encoding a bioadhesive precursor protein. clone 14-1.52.55.56, and N1. 1st The figure shows the DN, A sequence of the insert in clone 14-1 and its translated sequence. This figure shows the amino acid sequence obtained. DNA sequence consisting of insert of clone 14-1 The segment contains a group of codons with a 203-amino acid sequence. In Figure 1, this The sequence was divided into 19 thecapeptides and 1 hexapeptide (subunit 20 subunits including cut number 8) have been identified.

Figure 2 shows the DN A sequence derived from the insert in eDNA clone 52 and its This shows the translated amino acid sequence of . Inside the insert of cDNA clone 52 This DNA segment contains a 334-amino acid sequence of codons.

In Figure 2, this sequence is divided into 23 decapeptides and 3 hexapepeptides. 26 subunits including tide and an amine-terminated proline-rich clarified the segment. This cDNA clone and the other two analyzed Two clones (55 and 56) were thought to be derived from intronic sequences. Contains certain non-coding DNA sequences (not specified) that can be used. this The fact is that some clones contain nuclear RN that is not fully processed. This suggests that it is derived from A.

The DNA sequences of cDNA clones 14-1 and 52 have extensive similarities at their 3′ ends. have the same sex. In detail, the last 138 codons of the translated region are identical. is a group of codons that command a hexapeptide followed by a 12-decapeptide (the first From codon 75 in clones 14-1 in the figure, and from clone 52 in Figure 2. (starting from codon 205). Clone 52 is the end of that 5. A segment encoding a proline-rich segment of 82 amino acids at the end. Contains components. Clone 52 further contains a co-directed repeat of the DNA sequence ( direct repeat). Specifically, the DNA that directs codons 92-147 is repeated exactly at codons 148-203.

The DNA sequences of cDNA clones 55 and 56 are shown in Figures 3 and 4. . Codons 19-129 of cDNA clone 55 are codons of cDNA clone 52. 148-259, with one exception. Codon 65 of clone 55 is alanine, while the corresponding codon 195 of clone 52 is isoleucine. be.

Both the cDNA of clone 55 (Fig. 3) and the cDNA of clone 56 (Fig. 4) There is homology. Codons 1-33 of clone 55 are codons 54-8 of clone 56 It is coded 6. Certain sequences show that clone 55 is also partially identical to clone 52. It is within the overlapping region and contains the same direction repeat segment of clone 52. within the

The DNA sequence of clone N1 is shown in FIG. Clone N1 is clone 14-1. 52. Does not have a complete overlap with either 55 or 56 . Clone N1 also does not have the characteristic 5° terminal sequence, so nine out of ten It does not contain the N-terminus in the natural gene. However, this is a natural polype Molecular weight, which is the substantial part of peptide (molecular weight 110,000-130,000) It encodes the polypeptide 8o, o o o o.

We thus determine that these cDNA clones are related in a complex manner. be able to. Although there are common areas, they are generally different, and this is the presence of multiple genes or mRNA splices involving one or two genes. This is indicative of Thing's miscellaneous patterns.

As mentioned above, the present invention provides methods for microbial expression of biological adhesive precursor proteins. The present invention provides an expression vector for. The expression vector of the present invention is derived from Mytilus sp. Proteins such as shellfish bioadhesive precursor proteins or their fragments A DNA segment that feeds the host and allows microbial expression. contains a DNA segment operably linked to a transcription initiation signal and a transcription initiation signal. Ru. In some embodiments, the DNA segment comprises at least 14-1 subunits. amino acid sequence containing subunits 8-20 and 14-21 of clone 52. sequence, i.e. amino acids 72-197 of clone 14-1 and amino acids 72-197 of clone 52. Contains portions of 201-326 amino acids.

Figures 6 and 7 show one procedure for preparing the expression vector of the present invention. This is a schematic diagram. These expression vectors contain biological adhesive precursor proteins. quality, in some cases containing a methionine residue immediately upstream of the protein of interest. It can be expressed as a hybrid fusion protein. Except for clone N1 The biological adhesive precursor protein encoded by all the clones described is Since it does not contain methionine residues, the fusion protein can be attached to methionine residues. These can be conveniently separated from the fused sequence by treatment with cyanogen bromide, which is cleaved by can be released. In the protein encoded by the N1 clone, cybromide The unprocessing still leaves the entire polypeptide virtually intact and the second It can be cleaved at the methionine residue found in the eye decapeptide. Ru. This amine-terminated non-biological adhesive precursor protein amino acid contains all At most approximately 15% of adhesive protein precursors, often less. Because it does not contain a high percentage of chloride, these amino acids due to the cleavage of cyanogen bromide are No acid removal is not required for all applications.

The λgt10 cloning vector was digested with EcoRI as described in FIG. By subcloning into the EcoR1 site of plasmid pGX2627. Biological adhesive precursor protein coding region of clones 14-1 and 52 A DN A segment containing the following was obtained. The obtained plasmid was transformed into pGX23. 68 and pGX2377.

Plasmids pGX2368 and pGX2377 were incubated with oligonucleotides. oligonucleotide-directed mutagen esis.

ODM) [Methods E of Schiller (M, J,) et al. nzymol, Volume 100B, Woo (R, Woo), Gras (L, Gras sa) and L Moldave g, Academic Press, 2nd. York, 46g-500 (1983)] to determine the translation terminator of each gene. A Be11 site located at - was created (see Figures 1 and 2). pGX26 27 is pcx1066 containing the M13 origin of replication (ATCC No. 3995 5), so culture with IRl or M13 bacteriophage For oligonucleotide directed mutagenesis experiments based on infection of pGX262 pGX2368 and pGX2377 derivatives of 7 were isolated in single-chain form. Be The resulting new plasmids containing 11 sites were called pGX2380 and pGX2380, respectively. It was named pGX2381.

Next, DNA containing the hooded region of the bioadhesive precursor protein segment E, col i and the appropriate reading frame of the yeast expression vector. inserted inside. In the examples related to E. coli described below, in pGX2380 The cDNA derived from phage 14-1 located in The trpB gene starting from an expression vector identified as pGX2287 Cloned as a fusion. This vector construction method is described in pending U.S. patent application no. No. 671.976. Plasmid pGX2287 is U SDA Northern Regional Research Laboratory Regional Research Laboratory, Peoria, IL No. NRRL-B 15788. It is Leftward operation of the archage λ (see co-pending U.S. patent application Ser. No. 534,982). promoter region and a properly positioned transcription initiation signal. It contains the trpB bovine chymosin gene under the control of the null. Also, It also contains an ampicillin resistance gene.

Plasmid pGX2287 was cut with C1al and the 5' end of the chymosin food sequence was cut with C1al. Cleavage was made within 24 base pairs of trpB upstream of the end. Then, the 116 base pair C1al-Sph1 synthetic NA was ligated into the linearized plasmid. linearization The sequence of the synthetic NA fragment ligated to the lasmid is shown in Figure 5(b). . Next, the ligated DNA is digested with SphI to generate large fragments. isolated, resulting in the removal of a substantial portion of the chymosin-encoding region. next Then, the obtained plasmid was circularized again using T4 ligase. Obtained plasmid (identified as pGX2346) is an NA fragment synthesized in the central part of the chymosin gene. It contained .

Those skilled in the art will be aware of the specific vectors for expressing bioadhesive precursor proteins. Other constructs will be apparent based on the description herein. deer and, in general, other genes under the control of efficient promoters. Biology by in-4 raffle fusion, etc. It is convenient to construct the vector by inserting the target adhesin precursor protein. stomach. Preferably, the hooded fusion protein is a biological adhesive precursor protein. A fusion containing a methionine residue immediately upstream, e.g., within about 10 residues thereof. Build a compound. The particular construct described herein, pGX2383, There is a methionine residue seven amino acids upstream from the physical adhesive precursor sequence. collect The bioadhesive precursor protein obtained is treated with cyanogen bromide by methods well known in the art. Treatment can remove extraneous amino acid sequences. A person skilled in the art would recognize the odor. We know that cyanide cleaves proteins at methionine residues. Living There are no internal methionine residues within the physical adhesive precursor protein itself. so the resulting protein remains intact.

Construction of this vector involves adding all of the bioadhesive precursor proteins to the expression vector. The entire coding region or the coding region of a fragment thereof may be It will be clear to those skilled in the art which modifications are possible. This fragment contains at least about 5-2 in marine animals, such as shellfish such as bivalves of the genus Mytilus; Preferably, it contains 0% hooded sequences. removed by cyanogen bromide cleavage not fused to the N-terminus or C-terminus of the encoded biological adhesive precursor. The encoded amino acids are thought not to interfere with the function of biological adhesive proteins. It will be done.

The expression vector provided by the present invention can be transformed into a suitable host microorganism by conventional methods. It is used for transformation to obtain transformants. Suitable host microorganisms include, for example, E. coli (Escherichia coli) or other similar Gram-positive microorganisms, such as monkeys. Salmonel la, Klebsiella, Examples include Erwinia. Plasmi similar to pcX2383 In this case, the λc1857 gene, which encodes a temperature-sensitive presser (repressor), Preferably, it contains children. In the case of pGX2383, use it as a host. E. coli strain GX3015 was selected. The reason is that pGX2383 , in GX3015, the trpED region is deleted in the trpED102 chromosome deletion region. This is because it contains Therefore, this plasmid lacks tryptophan. Stabilization is achieved by growing transformants in poor medium.

In another embodiment, transforming yeast, such as S. cerevisiae, Expression vectors can be used for A typical vector of this type is 1 No. 918,147, filed October 14, 1986. [Title: Composite Yeast Vectors ), incorporated herein by reference. Biological adhesive precursor in yeast A preferred vector for expressing proteins is a yeast shuttle vector. Yl) GX265GAL4 (ATCC: f67233). this vector is induced from S. cerevisiae GAL 1 and MF-α1 (α factor) fromomotor. It is characterized by a promoter that is a derived hybrid. This promoter system , a galactose-regulated expression system. This regulatory gene is S. cerepica GALI-MF-αl/% hybrid promoter positive leg derived from E. GAL4, which encodes the GAL4 protein, is a positive regulator Contains genes. Terminal in YpGX265GAL4 vector system The transcription protein S. cerevisiae GAPDH is derived from the synthetic protein NA. It is based on the Minator. Signal coding sequence (also synthetic NA) ) is based on the S. serepiciae PH05 signal. Ru. Codons are designed according to the virtually preferred codon usage of S. cerevisiae. do.

The YpGX265GAL4 vector is used for plasmid selection in S. cerevisiae. Contains the marker LEU2 gene. Also, this is S. cerevisiae S. cerevisiae 2-micron plasmid providing an origin of plasmid replication for S. cerevisiae Contains DNA derived from. Furthermore, this vector is derived from pAT]53. The original E. coli replication origin, and the ampicillary origin, also derived from pAT+53. It is characterized by the phosphorus-resistant E, col i selection marker. Heterologous genes (biology PH05 Sidanal Co., Ltd. Insert between the coded sequence and the GAPDH terminator.

A typical shuttle vector preparation method is as follows. YpGX265GAL 4 was digested with restriction endonuclease HindII ['large DNA and small DNA]. The DNA fragments are then gel purified. Restricting relatively large fragments Digest with DNA nuclease SmaI to prepare two DNA fragments. . M13mp9 (commercial product) was digested with Smal and HindIII, and calf alkaline Treat with calyphosphatase. Relatively large YT) GX265C; H of Al1 DNA fragment generated by SmaI digestion of indII [fragment and M1'3mp9 digests were ligated, These are used to transform E. coli. Yeast promoter terminus identifying a transformant containing phage double-stranded DNA having a data cassette; This DNA is treated with restriction endonucleases (EcoRV and BamHI). Digest and gel purify the large fragment (approximately 8 kilobases). biological adhesion Plasmid containing precursor protein cDNA (i.e. pGX2380) was digested with restriction endonuclease XbaI to generate a single-stranded overhang (ov erhang) with Klenow fragment of DNA polymerase. pG DNA fraction obtained by Xbal and DNA polymerase treatment of X2380 Digest the offspring with BclI. The approximately 625 bp DNA fragment obtained was purified by gel purification. make Anneal the oligonucleotide linker sequence and add this to the phage DNA fragments prepared by restriction treatment of double-stranded DNA and modified X 3 wayr with cDNA derivatized DNA with bal and Bcll ends Used for three-vayligation.

E, col 5 transformants containing the desired phage DNA molecules were subjected to restriction Identification by endonuclease digestion. This phage DNA is a restriction endonuclease. The resulting small The small fragment (approximately 1,300 bp) is gel purified. YT) GX265GA Digest L4 with SmaI and HindlI and gel the large fragment. refine. The DNA molecules generated by Smal-H1ndIIl digestion were igate and use for transformation of E'coli. Restrict the desired plasmid linearized with Hind nuclease (Hind■) and treated with calf alkaline phosphatase. can be managed. 3.65 kb of GAL4 obtained by the first restriction digest. The containing fragment is ligated with this linearized DNA and used to generate E,co li can be transformed.

Satucharomyces strains with mutations in the LEU2 structural gene (e.g. AH22 (ATCC #38626)) is transformed with this plasmid by conventional methods. fermentation The mother plant was grown in a suitable medium (YNBDSO, 7% yeast nitrogen substrate, 2% glucose, 20% The plasmid can be maintained by growing it in I can do it.

This is an example of one construction approach for yeast expression, but this approach generally includes Those skilled in the art will readily appreciate that improvements and modifications may be included. Already For the vectors described, the entire coding region of the bioadhesive precursor protein or the coding region of a fragment thereof.

To produce the biological adhesive precursor protein, the transformed yeast described above The strain may be grown in an appropriate medium. One suitable medium is yeast extract, 2% There is a medium containing 1% glucose, and 1% galactose.

Growth and expression of the biological adhesive precursor protein gene in transformed microorganisms Culture under suitable conditions. After expressing the protein, it can be mechanically or chemically Cells are recovered from transformants by conventional methods such as chemical cell lysis. collect. The resulting protein can be processed using well-known chromatography methods such as those known in the art. It can be purified by conventional methods. Preferably a biological adhesive The precursor protein is purified to homogeneity or to the equivalent of homogeneity. pGX2383? For fusion proteins such as those expressed from can be subjected to cleavage to remove foreign peptide sequences.

The recovered bioadhesive precursor protein is converted to bioadhesive by hydroxylation. Converts into a deposited substance. In detail, such as the events occurring inside the body of shellfish, (both require hydroxylation of tyrosine or tyrosine and proline residues) It's good. Hydroxylation converts tyrosine residues to DOPA residues, resulting in the required If so, proline residues are converted to hydroxyproline residues. DOPA hydroxy group is believed to remove water at the bonding surface, thus contributing to the superior wet strength of the adhesive material. The DOP A residues that are further oxidized to quinones harden the adhesive substance and improve the adhesive. Involved in intramolecular cross-linking that imparts properties.

Any suitable chemical or enzymatic means can be used to effect the hydroxylation. can. However, mushroom tyrosinase (mushroom tyrosinase) e) or Streptomyces antibiotici cus) is preferably hydroxylated enzymatically using an enzyme such as tyrosinase. Delicious. Enzymatic hydroxylation techniques using these enzymes are generally - (Ito) et al. Biochem, J, 222:407-411 (1984 ) and Marumo and Waite's Bioche m, Biohys, Acta 872:98-10: (as described in (1986) It can be done like this.

Preferably, at least 10% of the tyrosine residues are hydroxylated. Kinokochi Rosinase was bound to an LH-Sephadex 60 column and then treated with 0.2M acetic acid. or Menplan i! ! filtra It is removed from the protein by a conventional method such as tion). bioadhesive tongue If the protein is freeze-dried into an adhesive preparation, it can be reconstituted and used at a later date. can.

Adhesive proteins can be any suitable protein with or without other adhesive substances. It can be used in the form of a solution in a suitable solvent.

Suitable solvents for biological adhesives include water, or methanol or ethanol. , alcohols such as propatool, acetone, DMSO1 dimethylformamide There are aqueous solutions such as

The degree of bioadhesive protein in solution may vary depending on the intended application. It can always vary from low to very high.

Bioadhesive proteins or solutions containing bioadhesive proteins may The formulation is a primer, a preform that improves all adhesive bonding to the surface. Can be used as an adhesive film or coating. Furthermore, water- A component in certain adhesive systems for imparting or enhancing durable adhesion It can also be used as Other forms of use falling within the scope of the invention include, inter alia: the desired permeability and/or moisture resistance for such films or membranes. For application as a thin film membrane or as a component of a thin film or membrane It is to be used as. Another use is to prevent moisture penetration. It is used as a sealant or a component thereof.

Uniform coating of the surface with a solution of bioadhesive proteins as a primer can do. Under normal air environment, the primer coating will cure and crosslink. This is caused by a brown or tan color when used in high concentrations. You can check it because it changes color. Then regular adhesive such as epoxy glue Apply the agent over the entire primer coat and gather the surfaces to be bonded.

Other embodiments of the invention provide hydroxylated bioadhesive proteins with other adhesive properties. An object of the present invention is to provide an adhesive composition containing a substance in a solution. Main departure Typical materials that can be used with light bioadhesive proteins are charcoal and Hydrate adhesives and synthetic resin adhesives, such as polyacrylates, polymers, etc. These include epoxides and resols. Known carbohydrate adhesives that can be used include , chitosan, starch, pectin, glucan, dextran, etc.

A preferred carbohydrate adhesive is Scring (S) from the chitin of crab or shrimp shells. Chitosan purified by the method of Kujins, J, J, et al. [Arch, Biochem, Biophys, 11↓:359(1 965) Ko. The free amino groups of chitosan are oxidized and bioadhesive proteins reacts with DOPA-derivatized quinones to create a covalent crosslink between the two polymers. Jiru.

With appropriate concentration of chitosan, biological adhesive with high viscosity and excellent adhesive strength An adhesive protein mixture is obtained. High viscosity occurs before the adhesive material undergoes curing. is particularly useful for underwater applications where material may be lost by diffusion. .

A preferred adhesive mixture contains 0.1% hydroxylated biological adhesive polymer. and 1% to 7% chitosan, with the remainder being solvent. Ru. The pH of this composition is about 5.5 to 7.0°. DOPA-derivatized quinones Addition of catechol oxidase or tyrosinase, which catalyzes the formation of This composition can be cured by (pH 6.0).

Another aspect of the invention is to use bioadhesive proteins.

Adhesive compositions mixed with other proteins that improve physical properties, e.g. viscosity Our goal is to provide the following. The preferred protein for this protein is collagen. It is. Preferred compositions contain from 1% to 50% bioadhesive protein and Contains 0.1% to 7o% solids in solution containing 50% to 99% collagen It consists of a solution.

The bioadhesive protein of the present invention may or may not be endowed with other proteins. Biomedical adhesives or adhesives that can be applied in a variety of medical applications, such as wound treatment, regardless of It is particularly useful as a sealant. biological adhesive proteins are Being a biological material, the risk of toxic breakdown products is greatly reduced compared to synthetic adhesives. I'm being teased.

The bioadhesive proteins of the present invention are suitable for biomedical sealing, just like fibrin. can be used as runts [e.g. Redl, A and Shlag (C) Facial Plastic Surgery y, 24:315-321 (1985).

The implementation of the present invention will be explained in further detail by giving examples below, but this is not an example. It is not intended to limit the scope of the disclosure.

Example 1 Preparation of antibodies against biological adhesive precursor proteins Merryfield solid state By the Merrifield 5tate method The predominant sequence of the bioadhesive precursor protein of M. edulis (a la -lys -pro -ser -tyr -pro -pro -th phosphate-buffered synthetic decapeptide (1.5 mg), which is Combined with 2.0+ g bovine serum albumin (BS, A) in 1.8 HQ saline solution . 1% glutaraldehyde (0.2 m) was added and the resulting solution was incubated at 22 °C for 30 Incubate for minutes. Sodium borohydride at a final concentration of 0.5 mg/x ( 1 and incubated for 1 hour at 22°C. The resulting solution is then phosphorized. Dialyzed against acid buffered saline. Amino acid analysis of the obtained protein revealed that It was confirmed that 35 moles of peptide were bound per mole of B5Al.

100 μg of peptide (BSA-conjugated) Freund's incomplete adjuvant was given to rabbits. Injected intramuscularly. Then booster using incomplete Freund's adjuvant. - Cynic injections were given at two week intervals. By this method, the above decapeptide, and M. edulis organisms isolated from bivalves or produced by microorganisms. An antiserum containing a high titer of antibodies that reacts with both the chemical adhesion precursor protein and Cut the closed shell muscles of living blue mussels and The foot organs containing the phenol glands are separated, quickly cut into small pieces and placed in liquid nitrogen. It was frozen in Frozen tissue in liquid nitrogen using a commercially available Waring tube equipped with a metal container. Grind to powder in a Waring blender at maximum speed.

The pulverized tissue was stored at -80°C until use.

RNA isolation procedure [McCandliss, R. et al.'s Me The thod fabric was dissolved in 4x4 guanidine thiocyanate solution. wet weight 22 ．． From 1 g of tissue, 28.3+g total RN, A was obtained. Oligo-dT cellulose Purify polyA-containing RNA by selecting RNA that will bind to [Aviv, H., and P. Leder, Proceedings of None National Academy of Sciences U.S.A., 69:1408-141 2 (1972)]. ] By performing oligo-dT cellulose selection twice, total R Polyadenylated mRNA-containing portion corresponding to 0.6% (approximately 170 Jig) of NA I got it.

Instead of this guanidine isolation procedure, Berger (S.) et al. j.

Manipulation of Biol, Chem, 255:2955-2961 (+980) An improved method was developed. 5g of the above frozen bivalve tissue after freeze-drying was added to 10mM S-HC1 pH 7,5), 10mM NaC12, ], v mM MgC i2t, 0.2% NP-40, and 10mM ribonucleoside vanadyl. Complex (VRC, Bethesda Research Laboratories) da Re5search Laboratories)) 100 xrl Phenol 1001 (!) was added, and the resulting solution was homogenized with Vertis homogenizer. Mix for 2 minutes at maximum speed on a Virtis homogenizer.

This suspension was centrifuged to separate the layers, and the aqueous layer was taken out. The tangential layer was treated with 0.2M sodium acetate. Extract with 50M1 of thorium (pH5,5) and combine this aqueous layer with the layer collected earlier. I made it. The resulting aqueous layer was treated with phenol containing 0.1% 8-quinolitool. Extracted three times. Precipitate RNA (including some genomic DNA) with ethanol Ta. PolyA-containing RNA was purified as described above. Approximately 150 μg of polyA was extracted from 5 g of tissue. Lee-A RNA was isolated.

First strand cDNA, stock solution for A synthesis (stock 5ol) ution) and materials 0.5M t')-HC(!, pH8,30, 25M MgCl2t 0.05M dATPSp87.0 0.05M dGTP, pH 7.0 0.05M dCTPSp87.0 0.05M dTTP, pH 7.0 [a s t p co d CT P, 400 Ci/mtnol, l mci/x ρ (Amersham, Stable 7D solution 0.1M dithiotre Itol (DDT) oligo (dT) +, -+s 1. OOOμg/z ([Cola f Collaborative Research, Waltham arch, Waltham, Mass, )] 0.1M sodium birophosphate Umu 0.2M disodium ethylenediaminetetraacetic acid (EDTA)% pH 8.0 Promega B1otec] Avian myeloblastosis Viral (AMV) reverse transcriptase, approximately 10,000 units/μ0! E-life service Life Sciences, Inc. ), Street Beterburg (St, P eterburg), Flo [obtained from F1orida] All buffers and saline solutions were Rave treated. Other solutions were prepared using sterile glass-distilled water and stored in sterile containers. did. All stock solutions were stored frozen. All enzymes used were commercially available products. Unless otherwise specified, it was used according to the instruction manual.

m prepared by the guanidine method described in Example 2 as a template for cDNA synthesis. RNA was used. To track the synthesis, a radioactive marker ([α-”P]dC TP) was used. This allows Cerenkov radiation to be removed without sample loss. All processes can be monitored by counting. per 1μg of mRNA and specific activity 400ttCi/mmol [α3pcodCTP 2μCi It was used. This radioactive substance was added to 0. IM) Lis-HCC (pH 8,3), 2 0mMgcfft, 1mM dATP, 1mM dCTP, 1mM dGTP , 1mM dTTP, 20mM DDT, and 5mM sodium birophosphate was added to a 2X reaction mixture consisting of This solution was left on water.

To this solution, mRNA (final concentration 50t, tg/xQ), oligo (dT), x-, 5 (100 μg/x, RNasin (600 units/zff), AM V reverse transcriptase (800 units/X), and 2X mixes can be diluted to IX Add enough water. After standing on ice for 5 minutes, the reaction mixture was heated to 46°C. and incubated for 10 minutes. After incubation, add EDTA to a final concentration of 25 Added up to mM. The resulting solution was mixed with equal amounts of phenol:chloroform (1/1 (v/v)) and the aqueous layer was extracted once with IQmM) Lis/HC (l pH 8, o, Sephadex G-100 equilibrated with 1mM EDTA, O, IM NaCQ Chromatography was performed on a (0,7×20cx) column. 3M sodium acetate Add 0.1 volume and 2 volumes of 95% ethanol (-20 °C to -80 °C). , the mRNA:cDNA hybrid in the effluent was precipitated. Remove the mRNA part To remove the pelletized hybrid, add 300μ of 0.1M sodium hydroxide. and incubated at 70°C for 20 minutes. Place the resulting solution on ice. Cooled and neutralized with 30 μa of IN hydrochloric acid. cDNA was thus precipitated.

Stock solution for second strand cDNA synthesis n) and materials 0.5hq Potassium phosphate, PH7, 40, 25M MgC (t O, IM Dithiothreitol (DTT) 0.05M dATP, pH 7.0 0.05M dGTP, pH 7.0 0.05M dCTP, pH 7.0 0.05M dTTP, pH 7.0 E. coli DNA polymerase I (Klenow fragment), approximately 5°00 0 units/zρ (Herlinker Mannheim) 10X SI nuclease buffer: 0 , 5M sodium acetate, pH 4,5: 10a+M Zn5O, 2M NaC L 5% glycerol.

Since the first strand was labeled, the second strand was radioactively labeled. do not have to. 0.2M potassium phosphate (pH 7°4), 20mM MgC ff-12mM DTT, 0.4mM dATP, 0.4mM dCT P, 0. 2x reaction mixture consisting of 4mM dGT P, 0.4mM dTTP was prepared and left on ice. Add E. coli DNA polymerase I to this mixture. An aqueous solution of cDNA containing the Klenow fragment (final concentration 100 units/h) and then water was added to dilute the reaction mixture 1×. Store this solution overnight at 15°C. Incubated with After incubation, add EDTA to 25mM; The obtained solution was diluted with an equal volume of phenol:chloroform (1/1 (v/v)). Extract twice and extract the aqueous layer with 10a+M) Lis/HC+2 pH 8, 0, 1mM EDTA and 0. Sephadex G-100 column (0 , 7X 20ct). As mentioned above, ethanol The effluent fragment, DNA, was precipitated using a filter.

At this point, the ds-cDNA was in hairpin form. Eliminated by S1 nuclease to remove single-stranded loops. Dissolve ds-cDNA in water and incubate at 10xsl. 1 volume of buffer solution was added. Add an appropriate amount of S1 nuclease and dilute the resulting solution with 37 Incubated at ℃ for 20 minutes.

The activity of this enzyme varies from preparation to preparation, so the amount of enzyme added should be determined empirically. Ta. This measures the decrease in TCA-precipitated counts from ds-eDNA. I went by doing. Generally, a 20-40% reduction was observed. S1 digestion The cDNA was extracted once with phenol:chloroform, and the cDNA in the aqueous layer was extracted as described above. It was precipitated with ethanol as follows.

Addition of linker to cDNA To insert the cDNA into the EcoR1 site of the λgtlo vector, use the EcoRI A linker was added to the end of the cDNA molecule. Internal EcoR1 by EcoRT The eDNA was first methylated with EcoRI methylase to prevent site cleavage. I kept it.

Storage solutions and materials 5X EcoRI methylase buffer: 0.5M) Lis-HC (!5pH8゜0.0 ．． 05M EDTA 8mMS-adenosylmethionine (SAM): O, OIM H, SO, pH 2, 10% solution in ethanol lag/xQ bovine serum albumin (BSA): Aqueous solution, sterile filtered.

8-base pair EcoRI linker: 10 Atea/ffL collaborative ・Research (Collaborative Re5earch), Waltham ( W　a　　t　h　a　m　)、Masachiko Sesotsu ts) 1001M ATP, pH 7.0 10XT4 polynucleotide kinase buffer: 0.7M) Lis-HCL pH 7, 6,0,1M MgCQt, 50mM dithiothreitol 7[”P]-ATP : 10m Ci/x6, 2,000 Ci/mmol, stable aqueous solution (stab ilized aqueous 5 solution) 10XT4 ligase buffer :0.5M Tris-HCρ, pH7,8,0.1M MgCh, 0.2M dithio Threatol 10X DN A polymerase buffer: 0.5M)! Js -HCt), pH7.2, Q, IM Mg50° 2mM dATP, dCTP, dGTP, dTTP mixture, pH 7, 01mM di Thiothreitol 1QXEcoRI buffer: 1. QM Tris-H (J!, pH 7.5, 0°5M NaCl2.0.05M MgCj.

The cDNA fragment prepared as above was digested with 5X EcoRI methylase. Dissolve in 20 μa of buffer, add SAM to 80 μM, and add BSA to 0.4 x g/ xρ, then add water to make a volume of 99μQ, (20, OOO units/11Q, 2nd England Biolapse) I got it. The resulting reaction mixture was incubated at 37°C for 60 minutes. Next, this The reaction product was extracted twice with phenol and subjected to ethanol precipitation. Methylation c D N A was collected by centrifugation and dried.

Before adding the linker, the cDNA was prepared in the presence of deoxynucleoside triphosphates. Treat with DNA polymerase I (Klenow fragment) to cut the ends of the cDNA. The ends were made blunt. This cDNA was added to clATPSdCTP, dG at 80 μM each. TP, and dTTP in 24 μρ of 1x DNA polymerase buffer. I understand. Add 2 units of DNA polymerase (Klenow fragment) and obtain The reaction mixture was incubated at 23°C for 10 minutes. 20. EDTA. m Add to M, extract cDNA twice with phenol and once with CHCns. and ethanol precipitation. EcoRI methylated and blunt-ended cDNA A was collected by centrifugation, washed once with 70% cold ethanol, and dried.

To prepare a linker for addition to cDNA, first phosphorylate the linker. I kept it. An 8 base pair EcoRI linker was added to 400 μCi of [γ Contains (gamma)-”P]-ATP and 5 units of polynucleotide kinase IX polynucleotide kinase buffer. This reaction product is 37 Incubate for 15 minutes at °C. Next, add unlabeled ATP to 1 m\1 and the resulting reaction was incubated at 37°C for 30 minutes. This reactant was heated to 65°C for 10 minutes to inactivate the enzyme. Then, phosphorylated linker-1 60 pmoles were ligated to the above cDNA. Methylated c with blunt ends Dissolve the DNA in 10 μC of water, add 160 pmol of linker, and add 1. O,XT4 Add ligase buffer to 1x, add ATP to 1mM, then T4-DNA Two units of ligase (Boehringer-Mannheim) were added. The resulting reaction mixture ( A total volume of 20μ was incubated at 15°C for 16 hours. The obtained reaction product was 65 The ligase was inactivated by heating to °C for 10 minutes.

At this point, the cDNA had multiple linkers at its ends. EcoRI Excess linker was removed by digestion.

The ligation reaction was mixed with 5 μg of 10X EcoRI buffer and 5 μQ of lxg/xjBsA. 1 and diluted with 19 μQ of water. Mi before adding EcoRI.

One μg of squirrel was removed and subjected to gel electrophoresis analysis. EcoRI (Ninnie Inn) Grand Biolabs (New England Biolabs), 10 units Add 10 units of position/μ(2) and incubate the resulting reaction at 37°C for 1 hour. I did it. The reaction was extracted once with phenol and diluted with 10mM Tris/HCQ pH Sephadec equilibrated with 8,0, 1mM EDTA, and 0.1M NaCQ. It was applied to a Kusu G-100 column. The DNA in the ejected fraction is Centricon 30 micro concentrator unit (Centricon 30 m1croco centration unit, Amic.

n)) was concentrated using according to instructions. cDNA, 50mM) Lis/HCl2 pH 8.0, 5-25% sucrose gradient in lnMEDTA This gradient was centrifuged at 5°C, 38,00Q rpm, for 17 hours. (Beckman SW410-tar). Collect fractions and Cherenkov radiation Analyzed by line counts. Similar gradients using molecular weight markers I did it. cDNAs of approximately 1°000 base pairs and larger cDNAs The containing fractions were combined and cD NA was concentrated. The obtained eDNA was washed 4 times with 1 ffC of water to remove sucrose. , dried under reduced pressure.

Preparation of recombinant bacteriophage DNA Standard methods [Maniatis et al. Calculated by Peter Kroening, Cold Spring Harbor, 1982]. The produced bacteriophage λgtlO DNA (Glover (D, M, Glo ver) it'tiHD N A Cloning, Volume 1, IRL Breath Oxford Huynh, T. V.] 985. pp. 49-78.

“Construction and script of cDNA in λgtlo and λgtll” ) was linearized by EcoRI digestion, extracted with phenol, and extracted with ethanol. It was precipitated with a filtrate. 50mM) Squirrel/HCQ pH 7, 10mM MgC (b, 2 50 ng of cDNA was incubated with E in 0 mM dithiothreitol and 1 mM ATP. Mixed with coRI cut λgtlo in a molar ratio of 2:1), T4 DNA ligase (Boehringer-Mannheim) 1 unit was added. Add this ligate mixture to 15° The cells were incubated at C for 166 hours. Pour a small amount of this reaction mix onto an agarose gel. It was subjected to aerophoresis analysis. The desired product at this point is an empty batataeriophage λ High molecular weight chains DN in the form required for efficient packaging into the head It was A.

Enquist and Sternberg [Meth.

ds Enzymol, 68:21111-298 (1979)] Therefore, in order to introduce the recombinant DNA into E. coli, it is It was packaged in Jishead. packaging extract extracts) are commercially available (Promega a) Bitec), Madison, Rice Consin, and other suppliers). It was used according to the instruction manual. Pancaging extract of ligated DNA (mixed with 50μ of phage and incubated for 2 hours at 23°C, the resulting phages were ．． 5x (l OmM Mg5O,, 10mM) Lis/HCQ pH 7,5, It was diluted with 0.01% gelatin and a few drops of chloroform were added to the resulting mixture. child The packaged 1-page was stored at 4°C.

As a host for titration and propagation of this phage, E. coli strain B NN 102 (Huynn, T., V. et al., supra) was used. In this host strain , only λgtlo bacteriophages with inserts in the EcoR1 site are plagiarized. form a group. This host strain was grown in LB-gloss containing 0.2% maltose. The cells were grown (overnight at 37°C) to induce phage receptor synthesis in the host.

The cells were harvested by centrifugation and resuspended in 1°5 volumes of 10+ nM MgSO4. did. The cells thus prepared were used for 1-2 days.

The obtained phages were sequentially incubated with 10 mM MgS O4, 10 mM) Lis/HC ff pH 7.5, and diluted to 0.01% gelatin. diluted phage 5 E 0 μQ, col i cells 0. Add to 1ff of carcass and heat the resulting mixture at 37° The cells were incubated at C for 15 minutes to absorb the phages.

Infected cells were thawed (47°C) in L containing 0.7% phthalate. Mixed with B-broth and poured onto LB-agar plates. After the top agar becomes hard , incubating the plates at 37°C for 5-6 hours will clear up the plaque in the bacterial flora. I was able to recognize that. Obtained a library of approximately 500゜000 recombinant phages. Ta.

Example 4 M. edenilis c D N A bioadhesive from a phage library Selection of proprotein cDNA clones from λgtlo phage library 15c Twenty Petri dishes were plated at a density of approximately 25,000 phages/plate.

For hybridization screening, two nitrocellulose fibres: Luther's replicates were prepared by [Benton, L.D.] and David's Science, 196: [ 0 (1977) Ko. Two 30-base synthetic oligonucleotides (GCG AA A CCA AGT TACCCA CCG ACCTACAAA and GC GAAA CCT TCT TAT CCG CCT ACCTAT AAG) , Applied Biosystems DNA Synthesizer Systems DNA 5ynthesizer). this The sequence of et al. r-pro-pr.

-thr　-tyr　-1ys), a possible 98.304 These are two arrays of . These oligonucleotides were combined with gamma-[”Pl -ATP (New England Nuclear) and T4 polynucleotide Using Kinase (Boehringer-Mannheim), specific activity is approximately 10 @cpm/μ g was radiolabeled and then used as a hybridization probe.

The obtained radioactive oligonucleotide (approximately 3.0 μg) was dissolved in 20% formamide. , 6XSSC15X Denhardt's solution (Denhardt's 5 solution ), 50mM phosphate buffer (pH 6,8), 100μg/mQ sonicated A hybrid containing heat-denatured salmon sperm DNA and 10% sulfate-derived beef tran. Diization solution 250x was added to the above filter at 30°C for 14 hours. After hybridization, briefly test 5 times in 6xSSC300xc at 22°C. C (7) IXSSC300xgt’1 time, 42 in the next iteration IlXSSC500j1 Washed at °C for 30 minutes. The obtained filter was air-dried, and Kodasoku XARX-ray The film was subjected to autoradiography (-80°C for 112 hours).

These hybridization and washing conditions were Already established in the hybridization of soot DNA with the same probe as above. has been done. Washing at 42°C with 1xssc showed clear specific hybridization to fragment i of Squirrel DNA. This is the highest temperature reached. DNA for Southern plot experiments is provided in Example 2. From the frozen tissue described, B11n and Starford (Blin, N., Andori, W.

5tafford, Nuc, Ac1ds Res, 3:2303-2 308 (1976)).

Plaques showing signal on two filters by autoradiography Scrape, dilute, brate, and hybridize as described above. Purified by repeated cleaning. Isolated individual plaques showing signal scrape the plate and plate lysate for DNA preparation as described above. [Molecular claw of Maniatis et al. Ningnia Laboratory Annual, Cold Spring) 1-Bar Laboratory, 1982, pp. 371-372.

Example 5 2. gtl○ clone 14-1 and putative biological adhesive precursor protein Restriction endonuclease DNA from other clones with a quality cDNA insert Digested with EcoRI. EcoRI cDNA, A fragment was cloned into M13mpH. Loaned [Norrander, J. et al. Gene, 26:10 1-106 (1983)]. Batateriophage M13 derivative is a metamp. [Menossing, J. , Methods Enzymol, 101:2O-78 (1983) ] o Two orientations of the insert were demonstrated in independent clones. Dale [Dale et al. plasmid.

13:3l-40 (1985)], some relatively large insertions The body gradually became shorter. Dideoxy method [Blggin, M, D, ) et al.'s Proceedings of the National Academy of Sciences U S.A., Chen: 3963-3965 (1983)]. The row has been decided. The recorded DNA sequences were separated using a VAX780 computer. analyzed. The DNA sequence and translated amino acid sequence of clone 14-1 are shown in Figure 1. Shown below. Clone 14-1 has 19 decapeptides and 1 hexapeptide It hoods a polypeptide containing a direct repeat sequence of . The claw shown in Figure 2 52 is a 2-amino acid segment preceded by an 82-amino acid segment that is proline-rich. Mix of 2 decapeptide repeats and 4 hexapeptide repeats encodes a polypeptide with Proline-rich segments such as This has not been previously disclosed in polyphenolic proteins of M. edenilis. . Clones 14-1 and 52 each have considerable homology at their 3' ends. Ru. A short untranslated trailing sequence (trailer 5) in both clones sequence) is followed by a polyadenyl located immediately before the series of A residues. It has a conversion signal AATAAA. These features are similar to the standard 3 mRNA It is present at the terminal end.

Example 6 Isolation of full-length M, edenilis bioadhesin precursor protein A, mRNA A part of the biological adhesive precursor protein cDNA shown in Figures 1 to 4 was produced. Isolated and characterized as described in Examples 1-5 and used to generate full-length biological The adhesion precursor protein cDNA was isolated. This is a more carefully prepared cD The first clone was used as a hybridization probe in the NA clone bank. It is done by using.

The mRNA used in Example 3 actively produces byssus and adhesive plaques. It was prepared from bipods purchased at a general store. This is a low-level However, only a meager amount of adhesion protein mRNA can be obtained. too In order to obtain an even larger amount of mRNA, the blue gold seawater culture in Rhode Island is used. Fresh bipods were obtained directly from the breeding farm by air. After these bipods are captured, No treatment was applied other than tamping to clean the outer shell. Approximately 1 Artificial seawater (Instant Ocean) heated to 2-15°C ocean), Aquarium System s), John Tall, Ohio) into a 20 gallon aquarium containing 10 gallons.

Stir the water in the aquarium and adjust the temperature using a Precision 87B heater (Precision 87B heater). n H7B Heater). In addition, the writing series 30 series Kisser (lighting 5eries 30 m1xer) [Mixing/ Equipment, Co, (Mixing Equipment, Co, , Inc.), o Kester.

14603] and stirred rapidly. Individual bipods will actively adhere to each other. Once they have grown, remove them, quickly cut off the distal ends of the legs, and place them in liquid nitrogen. It was thrown and immediately frozen. The obtained tissue was placed in a Waring blender in liquid nitrogen. It was ground into powder and then lyophilized. Ribonucleoside vanadyl comp mRNA was isolated by the procedure described in Example 2 using Lenox.

B. cDNA synthesis and selection of cDNA clones as described in Example 3. The obtained mRNA is used for cDNA synthesis. However, when double-stranded cDNA is In this experiment, fractionating with a 25% sucrose gradient, approximately s, ooo base pairs or If only cDNAs larger than this size are to be pooled for cloning, Make strict size selections.

The EcoRI insert fragment of clone 14-1 was isolated and [α-”P]-d cTPl knowledgeable nick transresin [Rigby, P, W , J.) et al., J. Molec, Biol., 113:237]. Label.

6X containing 5X Denhart's solution and 100 μg/mQ denatured salmon sperm DNA. Hybridization is performed in SSC250% formamide at 42°C. profit Wash the filter with Q, 1X SSC containing 0.1% SDS (50 ℃). Purify the hybridization-positive plaques identified in the replicates. , DNA is prepared according to Example 4. Select the clone with the largest insert. selected and subjected to DNA sequence analysis. Characteristic 5' terminal sequence and approximately 120°Oo ○ Has an oven reading frame that encodes the molecular weight of the protein. the clone is a full-length biological adhesive precursor protein cDNA clone .

By the steps outlined below and schematically illustrated in FIG.

Edecolis biological adhesive precursor protein as a hybrid fusion protein I got it. Methionine is located near the amino terminal side of the biological adhesive precursor protein. exists, so after cyanogen bromide cleavage it is essentially a pure biological adhesive precursor. The protein is isolated [Gross, E., Methods Enzymol, 11:23g (1967)], expressing bovine chymosin The plasmid pGX is part of a vector/host system that is very suitable for 2287 (NRRL-B1578g) was used as the starting vector [continue No. 671,967 and 644,998].

The EcoRI fragment obtained from λgtlo clone 14-1 was added to plasmid pG. Subcloned into the EcoR1 site of X2627. Plasmid pGX2627 is pGX1066 (American Type Culture Collection, Rock Bi Derived from Maryland % Ti No. A TCC 39955 Deposit) It will be done. Wild type phage with M13 reproducing origin to derive pGX2627 The 514 base pair Rsal fragment from M13 was added to EcoR of pGX1066. It was inserted into the V site (the DNA sequence of pGX2627 is shown in Figure 7). this plus Mido contains multiple restriction site sequences as shown in Figure 5(a). plasmid 0 μg of DNA of pGX2627 and 20 μg of DNA of λ clone 14-1 was cleaved with EcoRI (New England Biolabs). an instruction manual This enzymatic reaction and all reactions described below were performed according to the instructions. Then I ) GX2627 DNA was treated with alkaline phosphatase. People who are well-known in this industry After phenol-chloroform extraction and ethanol precipitation according to the method, in 20 url, pG cut with EcoRI and treated with phosphatase using T4 DNA ligase 1 μg of X2627 DNA, and 12.1 μg of λ14-1 DNA treated with EcoRI. A 5 μg ligation reaction was started at 15°C. After 30 minutes, the reaction mixture was It was diluted to 0 μQ, and the ligation reaction was continued for 9 hours. This ligate mix Using: 154.1970 Co, E, coli DH11 Hanahan (D, Ha nahan), J, Mo1. B101. .

166:557-580.1983 was transformed. Most of the transformants are desired It contained an insert of One recombinant plasmid was named pGX2368, This is shown in Figure 6.

A synthetic oligonucleotide was inserted between C1al and Sph1 sites of plasmid pGX2287. plasmid from pGX2287 by inserting the cleotide (Figure 5b). pGX2346 was constructed. Cut plasmid pGX2287 DNA with C1aI and ligated with a high molar concentration of synthetic NA. Then this ligated The DNA is cut with Sph I and ligated again, this time at a lower concentration, to form a ring. I set it. Plasmid pGX2346 was identified based on its reduced size and D Evaluated by NA sequence analysis.

The trpB part of pGX2346 and the biological adhesive precursor part of pGX2'368 In-frame gene fusions with protein cDNA are constructed as follows.

First, oligonucleotide-directed mutagenesis [Zol Ier, M., J. and M, Sm1th, Methods Enzymol, 10 0:457-500. P By changing the two bases shown in Fig. 1 by 983 molecules, An enzyme recognition site was placed at the translation stop codon site of pGX2368, and the plasmid pG Build X2380. Both plasmids pcx2380 and pGX2346 dam mutation (DNA adenine methylase) that can be digested with Be1l E, c.

11 to produce DNAI in a host. Unmethylated pGX2346 DNA is cut with Notl, and pGX2380 DNA is cut with Xbal. Next, this Both DNA and E. coli DNA polymerase (Klenow fragment ) to fill in the 5′ single-stranded DNA overhang. Then, using T4 ligase Then, these DNAs were ligated at high DNA concentration (approximately 2 μg of each DNA in 20 μQ). Gate. The resulting ligate preparation was cut with Ba1l and then the low DNA Ligate again at a temperature (approximately 1 μg total DNA in a 150 μg volume) and use E. coli. Transform GX3015. Transformants carrying the desired construct (see Figure 6) ) is named pGX2383. GX301 with plasmid pGX2383 5 cells were hybridized by shifting the growth temperature from 32°C to 37°C. A bioadhesive precursor with a molecular weight of approximately 24,000 is generated by induction of the deλ promoter. Produces protein.

The EcoRI insert fragment from λgtll clone 52 (see Figure 2) was cloned. Cloned into the EcoRI site of lasmid pGX2627.

Plasmid pGX2627 is an American type culture collectilan. It is derived from pGX1066 deposited at (ATCC 39955). plastic Wild-type phage with M13 origin of replication to induce smid pGX2627. The 514-base pair Rsal fragment from M13 was transformed into EeoR of pGX1066. It was inserted into the V site.

The DNA sequence of plasmid pGX2627 is shown in FIG.

10 μg of plasmid pGX2627 DNA and 20 μg of λ clone 52 DNA was cut with EcoRI. Next, pGX2627 DNA was treated with alkaline phosphatase. treated with Phenol-chloroform extraction is carried out by a common method in the art, After ethanol precipitation, 1 μg of phosphatase-treated pGX2627 DNA and and 12 μg of EcoRI-cut λ clone 52 DNA was added to the T4 polynucleotide ligator. The cells were ligated at 15° C. in a 20 μQ volume using 100 μl enzyme. After 30 minutes, this lie The gating mixture was diluted to 50 μQ with ligate buffer and the reaction was continued for 9 hours. . Using the obtained ligate mix, form the conventional method 557-580.1983. It was transformed. Most of the transformants contained the desired insert. Shown in Figure 6 One recombinant plasmid with cDNA inserted in the orientation pGX2377 I named it.

Oligonucleotide-directed mutagenesis [Zoller, M, J, and M, Sm 1th, Methods Enzymol, 100:457-500.1 983], the two bases shown in Figure 2 were changed, and Be11 engineered nucleic acid An enzyme site was placed at the translation stop codon of pGX2368, and plasmid pGX238 1 was constructed.

Mutagenic oligonucleotides have DNA sequences: AC, AIGAT, AITTG It had ATCACAATATTA.

YpGX265GAL4, Roekville, Maryland (Maryland) American Type Culture Collection (Am erican Type Curture Co11ection) with accession number Deposited under ATCC 67233.

YPGX265GAL4 vector contains the following functional units A hybrid derived from Romotor. This allows galactose-regulated expression.

Regulatory gene (GAL4); this is a GALI-MF-α1 hybrid promoter GAL4 protein, a positive regulator of It's coded. Derived from S. cerevisiae.

Terminator: This is based on the S2 cerevisiae GAPDH transcription terminator. It is derived from the synthetic NA that is the basis.

Shifnal coding sequence: This is based on the S. cerevisiae PH05 signal. It is derived from synthetic NA. S. cerepiciae seems to be inherently easier to use. Design codons.

LEU2-d gene; marker for plasmid selection in S. cerevisiae -. Derived from plasmid pJDB207.

2-micron DNA; derived from plasmid pJDB207.

This provides a plasmid origin of replication for S. cerevisiae.

Derived from pJDB207.

E. coli selection marker (ampicillin resistance); derived from pJDB207.

The foreign gene consists of the PH05 signal coding sequence and the GAPDH terminator. Insert between.

1. YpGX265GAL4 was digested with restriction endonuclease HindI[I. The large and small DNA fragments obtained were subjected to gel purification. make The small (3,65 Kb) fragment was saved for later steps ( .

2. The large HindIII fragment was deleted using the restriction endonuclease Sma. to generate two DNA fragments.

3. Digest M13mp9 (commercial product) with SmaI and HindI[I, then digest Treat with bovine alkaline phosphatase.

4. The DNA molecules generated in steps 2 and 3 are separated into T, E, and coli forms. Used for transformation. Fur with yeast promoter-terminator cassette Transformants containing di-double-stranded DNA are identified.

5. Recombinant phage double-stranded DNA was treated with restriction endonuclease Ec.

Digest with RV and BamHI and gel purify the large fragment (approximately 8 kb) do.

6, plasmid pcx2380 (prepared according to Example 7, bioadhesive containing the precursor protein cDNA) with the restriction endonuclease Xbal. The Klenow fragment of DNA polymerase digests the generated single-stranded overhangs. Fill with.

7. Digest the DNA fragment generated in step 5 with BclI.

Gel purify the small DNA fragment (approximately 625 bp).

8. Array: 5'ATCAAATCGATGGCGGCC and Two ground nucleotides indicated by 5°GGCCGCCATCGATTTGAT Anneal the code and 3-way mix with the DNA fragments generated in steps 5 and 7. Used for irrigation.

9. E. coli transformants containing the desired phage DNA molecules are subjected to restriction extraction. Identification by endonuclease digestion.

10. Treat the phage DNA generated in step 9 with restriction endonuclease Smal or and HindI[I, resulting in a small fragment (approximately 1300 bp) Gel purify.

11. YpGX265GAL4 was digested with SmaI and Hindll, The large fragments obtained are gel purified.

12. Ligate the DNA molecules generated in steps 1o and 11, E, c Transform oli. Restrict the desired plasmid, YpGX285. Identification by nuclease digestion.

13. YpGX285 was linearized with restriction endonuclease HindIIl and repaired. Treat with live alkaline phosphatase.

14. The 3,65 kb GAL4-containing fragment obtained in step 1 was obtained in step 13. ligate with linearized YpGX285.

15. Transform E. coli and transform the desired plasmid YpGX235GA. L4 is identified by restriction endonuclease analysis.

16. A Satucharomyces strain having a mutation in the LEU2 structural gene was prepared using a conventional method. Transform with YpGX265GAL4. A suitable strain is AH22 (ATCC #38 626).

17. Grow this yeast strain in YNBD medium to maintain the plasmid. YNB D medium contains 0.7% yeast nitrogen base, 2% glucose and 20 gg/CL-His. Contains thidine.

18. To produce bioadhesive precursor protein, the above strain was incubated with 1% yeast yeast. Kiss, in medium containing 2% peptone, 1% glucose and 1% galactose. , grown with shaking at 30°C.

19. The productivity of bioadhesive precursor proteins was determined using yeast samples according to well-known methods. Western plot of protein (Western B 1ot) and 5DS -Analyzed by polyacrylamide gel electrophoresis.

Cultures were treated with ampicillin to maintain nutrient selectivity at a growth temperature of 30°C. Store in 100 ug/zQ medium and/or tryptophan-deficient medium . Plasmid pGX2383 contains a β-lactamer that confers ampicillin resistance. bla gene, which encodes GX3, and GX3 in tryptophan-deficient medium. trpE in chromosome 015 D trpE that repairs (complements) the 102 deletion Contains D.

Before scraping a single colony of GX3015 (pGX2383), LB medium supplemented with 0.4% casamino acids and 0.4% glucose at 100% Minimal salts medium inoculated with ug/xQ ampicillin [Miller (Mi ller, J., H.), “Experiments in Molecular Genetics. ts in Mo1ecular Genetics)j, Cold Spring Cold Spring Harbor Lab oratory), 1972, p. 432. Optical density (A Ilo. ) became 1.0 or more, 0.4ff12 of the culture was added at 100 ug/ x (250j 112 volumes containing LB gloss 5oxc with ampicillin) Two baffled flasks are each inoculated. child The two flasks were incubated at 30°C and 6.5~25°C at 25°C. Shake for 9 hours.

Fermentation was carried out using the following initial medium 8Q. U: (NH,), SO,: 30g KHtPO,; 15g K, HPO4; 5g Biotin (O, 5mg/+1II2 in 95% ethanol); 12xI2 Tap water: 812, high pressure sterilizer (autoclave) After autoclaving, Prepare the additives below to obtain the initial medium: CaCl22.2H,O; 10% (w/v) sterile solution 10jlff glucose 50% (v/v) sterile solution 360x (1 niacin; 0 ．． 5% (W/V) Sterile Solution 18Fff Trace Solution 1; 90th Q Trace solution 2; 18 villages Trace solution 3; 1.8iQ Maintain the following fermentation conditions: pH 7,0 (adjusted with 5N NH,OH and IN HsPO4) Spreading rate (spa rge rate); l vvm temperature; 32℃ Stirring speed: 800rpm Prior to inducing expression, apply a nutrient supplementation system to increase cell density. . The feed solution is prepared as follows: Autoclave 1000g of glucose with deionized water to a final volume of 1700xC. process. After autoclaving, add: Trace solution 1; 500. w12 Trace solution 2:100112 Trace solution 3; 10 villages CaCQ-・2 H! O; 50 good trace solution l H,O;900112 Concentrated HCQ: 13.1iQ FeCQs・6H-0; 5.4g Z　n　S　O-・7　Ht　O; 1, 44　gMn(J-・4H,O; 1. Og CLISO4-sH,o; 0.25gCoCQ, 6H-○; 0.24g H, BO,; 0.062g The total volume is 1000 m12 and sterilized and filtered.

Trace solution 2 H, O; 900 sake HCl2:44.81+12 Mg5O,-7H,O; 61.6g The mixture is heated to 1000 RC and sterilized and filtered.

Trace solution 3 H, O; 100c100c ) 112Nat''2HtO; 24.1g Sterile filter.

The feed solution was first added to 18 Or, e volume of broth and then added to 10 g/(l) Maintain glucose levels. Feed addition is A6°. Continues until reaches 20 At that point, the cells are transfected with a bioadhesive by the hybrid λ promoter. Induce the precursor protein to be expressed. Induction is in the GX3015 chromosome Temperature-sensitive λc1857 repressor protein produced by impaired lysogens The temperature is increased to 37°C to inactivate. Fermentation was maintained at 37°C. Continue for another 6-8 hours.

Example 11 Purification of biological adhesive precursor protein E. coli GX3015 (pGX 2383) cells (32g wet weight) in 20IIM Tris/H(J, 2+oM EDTA (pH 7,5), 1mM phenylmethylsulfonyl fluoride, Suspend in 201g of 25mM iodoacetic acid and press into a French press. ress) and sonicate to ensure complete disintegration. the resulting cell debris; and protein-containing inclusion bodies containing bioadhesive precursor proteins (in fusion body) at 27.500 g for 30 minutes at 4°C. Pelletize by The obtained pellet was mixed with 10mM IJ/HC (!, Wash extensively by suspending in 1mM EDTA (pH 7.5) and centrifuging.

Continue washing until the supernatant is clear. The pellet was then treated with 6M guanidine hydrochloride. , 5% β-mercaptoethanol, 25mM Iodoacetic acid, dissolved in 15% ．． Centrifuge at OOO9 for 30 minutes (4°C).

The resulting supernatant was added to 4 liters of 0.2+nM EDTA and 10mM iodoacetic acid. The protein is precipitated by dialysis and 3 exchanges. Approximately 0.5g of protein The precipitate contained is dissolved in 70% formic acid 40xQ. Add cyanogen bromide (1.3g) and allow the resulting solution to react overnight at room temperature. After evaporation in a rotary evaporator , the residue is extracted with 20 lQ of water (pH 4.0 due to residual formic acid). water soluble When the pH of the sex fraction was adjusted to 7.0 with 5N KOH, some precipitation occurred. Next Then, transfer the supernatant to 0M serum equilibrated with 50mM potassium phosphate (pH 7.0). Apply to Lulose or S-Sepharose column (1,5X26cx). this After washing the column with 50mM potassium phosphate for 14 hours, a salt gradient ( 0-0,5M potassium chloride) or a change in the pH of the buffer (from pH 8 to 10). The biological adhesive precursor protein is eluted by either of the following methods. Absorption at 280nm Coomassie blue protein staining (coomassie blue) e protein 5tain) and a specific antibody (Example 1). For SDS polyacrylamide gel electrophoresis using turn plot assay Therefore, analyze the fractions. A film containing bioadhesive precursor protein Combine the filtration and dialyze twice overnight against 2 liters of deionized water. obtained The resulting suspension is lyophilized to obtain 1 x g of purified substance.

Optionally, this material can be purified by Sephadex G-75 column chromatography (0 , 3M ammonium acetate pH 4.0). first The polyphenolic proteins eluting at the protein peak were dialyzed against water. , lyophilized and recovered in salt-free form.

The purified protein was fermented for 24 hours at 105°C under reduced pressure in 6M constant boiling hydrochloric acid. Hydrolyze using nol crystals. The amino acids in the acid hydrolyzate are id (○PA) derivative, which was applied to a C88 reverse-phase HPLC column [Freuri - et al. (Fleury, M, O, and D.

V, Ashley), Anal, Biochem, 133:330 −335 (1!1183)]. Biological adhesive precursor protein Since only a subset of amino acids are present, this amino acid composition can be evaluated for purity. used for.

E, col i cells (GX3015 (pGX23 83)) or yeast cells (AH22(YpGX285GAL4)) were obtained. Westphalia centrifuge (frestphalia centrifuge) Wash with saline, add 10mM EDTAS, 1.0mM phenylmethylsulfate. Honyl fluoride (FMSF), 10mM iodoacetic acid (TAA) [pH 8,0], 30% solids suspension (solids 5 us suspension) and resuspended in a Manton-Galin homogenizer (Manton-Galin homogenizer). Destroy it with ullin homogenizer). in the insoluble fraction The biological adhesive precursor proteins present are removed by Westphalian centrifugation (Westphalian centrifugation). phalia centrifugation) along with cell debris. Ru. The resulting centrifuged pellet was incubated in acetic acid or formic acid (pH2,2 to 2°5) for 2 hours. Make a 0% solid @ suspension and mix for several hours to stabilize the biological adhesive precursor protein. to be established. After removing solids from the extract by centrifugation or filtration, the obtained The pH of the clear filtrate was adjusted to 10mM EDTA, 10mM IAA and 1. Adjust to 4 with 5NKOH in the presence of 0mM PMSF. by filtration or centrifugation. to remove impurities as a precipitate. The polyphenolic compounds in the cleared supernatant are then The protein is ultrafiltered (LO, OOO molecular weight cut-off membrane) and then Freeze dry. The resulting residue (approx. 5050-100) was mixed with 1.2 liters of 70% formic acid cyanogen bromide (100 g) was added and the resulting solution was stirred at room temperature for 24 hours. do. The reaction mixture was then evaporated on a rotary evaporator and the residue was dissolved in 6M hydrochloric acid solution. Dissolved in 50-100πg of anidine (pH 8,0) and heated at 130,000g at 4°C. Centrifuge for 20 minutes. The resulting supernatant was equilibrated with the same solution as above. Chromatograph on S-300 column. Biological adhesive precursor protein The fraction containing protein was collected, adjusted to pH 4.0 with acetic acid, and then added to water. Dialyzed and regenerated in salt-free form, hydroxylated enzymes of primary adhesion precursor protein Rosinase can catalyze the hydroxylation of tyrosine and the oxidation of DOPA. is known [ItoraBiochem, 222:407-411 (1984); Marmo et al. Biochem, Biophys, Anta, 892:9g-103 (1986), mushroom tyrosinase or strain E, col i using Ptomyces antibiotyphostyrosinase or by enzymatically modifying yeast-produced biological adhesive precursor proteins. can. 25 μl of ascorbic acid to mixture 11f2 containing 2 mg of protein. 1lO1 and 0°05M sodium phosphate (pH 5 to 7.5), mushroom chili Add 0.1 gg of Rosinase (Sigma Chemical Company). the resulting mixture are allowed to react at room temperature for 3 hours. The kinetics of the hydroxylation reaction is PA-derivatized quinone [Waite, J, H, and M, L, Tanzer, An al.

Biochem, 111: 131-136 (1981) Can be monitored by colorimetry. Acid hydrolyzed (actually) as described above. Example 9) The obtained product is further analyzed for amino acids. Losses during this recovery process Amino acid analysis after correcting for tyrosine residues showed a 40% decrease in tyrosine residues.

It was shown that it was converted to PA.

After hydroxylation, the pH of the solution was adjusted to 4 with acetic acid and the solution was diluted with 5% acetic acid. Dialyze against 100 volumes. The sample is subjected to a rotary evaporator to reduce the volume. let LH-Sephadex 60 column eluted with 0.2M acetic acid or membrane filtration (Amicon PM30, 3o, o o o o o molecular weight cutoff) to remove tyrosinase.

An alternative purification method following the hydroxylation reaction is shown below. After CNBr cleavage, pH 7 , 0 supernatant (see Example 11) was treated with ascorbic acid and tropolone. one) [Kahn, V. and A., Andrawis, Fitke Phytochemistry, 24:905-908 (1 985) to acidify to pH 5-7. by adding tyrosinase Initiate hydroxylation. At the end of this reaction, test on the sE Sephadex column. Refining materials. The fractions containing DOPA were combined and added to 2.5% acetic acid. Dialyze and lyophilize. Purification of the resulting hydroxylated protein Polyacrylamide gel electrophoresis method [Panyium S, and R, Cha lkley, Arch, Biohem, Biophys, 130 :337-346 (1969)] and by amino acid analysis.

The DOPA-containing bioadhesive protein is then provided for formulation as an adhesive. Ru.

Surfaces such as metals or plastics should not be oxidized with acids, flame treated, or plasma bombarded. Pretreatment, such as bombardment, to make the surface more susceptible to wetting or interaction with adhesives.

Microbially produced hydroxylated bishell biological adhesive with surface coating The protein can be used as a pretreatment and preparation material for ordinary adhesives. Can be done. As an example, a grain bioadhesive protein is attached to two sheets of aluminum. An example of use in primer treatment for binding is shown below.

The hydroxylated bioadhesive protein prepared in Example 13 was dissolved in degassed water ( Optimally, a concentration of 10-400 mg/xI2 (10-40 %w/v). This solution was maintained under a nitrogen atmosphere and the DOPA residues were Prevents complete oxidation of adhesive primers and curing of adhesive primers.

Apply bioadhesive protein solution to oil-free aluminum under normal air environment. Spray or apply evenly wet to the surface. This surface is then placed in a low humidity environment. Let dry under the boundary. The brown or tan color is due to the oxidation and conversion of quinones. Indicates chemical crosslinking. Then use a standard substance such as epoxy glue to bond the Glue the prepared surface.

To speed up curing of bioadhesive proteins and eliminate pre-hydroxylation steps (See Example 13) As an alternative method, mushroom tyrosinase (Ito et al. Bio chemistry, 222:407-411 (1984)) or strep Tomyces tyrosinase (Lerch and Ettlinger, Eur. , J. Biochecm, 31:427-437 (1972)) etc. immediately after mixing the enzyme with the non-hydroxylated protein (Example 11). Concentration 0.01 to 1. Applied as a Ozg/xQ solution (e.g. with a spray applicator) application from the nozzle). Under these conditions, the enzyme converts tyrosine or oxidation to reactive quinone species.

Bioadhesive proteins and other polymers (examples of adhesives are outlined below) The mixture is also used as a primer for other adhesives.

The cusp and Toyoto branch Use of bioadhesive proteins The hydroxylated bioadhesive protein prepared in Example 13 was added at a concentration of 1-70. 0+tg/frag ff (0.1-70% solids) in water (or physiological for pharmaceutical applications) Dissolve in saline) and adjust the pH to 6.0 with dilute acid.

Immediately before application to the surface, add a basic solution (approx. 115o volume) and adjust the pH to 8.0. do. To speed up the oxidation reaction of DOPA residues to quinone and achieve more rapid curing. can be used instead of adding a basic solution immediately before application, or in addition to the process. Waite, J, H, J, Mar, Bi ol, As5oe, 65:359-371 (1985)). It can also be added (final concentration 0.01-1xg/zQ). For example, fibrin [Redl, H, and Schlag, Facial Plasti c Surgery, 2:315-321 (1985)]. Uni, Duploject R (Duploject) syringe spray head In some cases, the ingredients can be mixed immediately before application. Mushroom tyrosinase (It Biochemistry, 2η:4o7-4o09g<)) or stress Ptomyces tyrosinase (Lerch and Ettlinger, Eu R. J. Biochem, 31:427-437 (1972)). Any enzyme can be used instead. In the case of tyrosinase, bioadhesive proteins Since there is no need to pre-hydroxylate the protein, The substance can be used without undergoing a sludge conversion reaction. Promote hardening, In order to subsequently oxidize the DOPA residue to There must be dissolved oxygen in the bioadhesive protein solution. No way.

Example 16 Composites of bioadhesive proteins and other protein polymers Other polymers can be used to optimize and improve the properties of the nolic protein adhesives. Use a mixture of Bioadhesive proteins are naturally attached to grain byssus threads. It is associated with existing collagen. Collagen is a phenolic protein complex. A natural polymer that can be used to increase the viscous strength of composites. acid soluble collagen [Ga1lop, P, M, and S, 5eifter, Method Enzymol, 11':635-641 (1963,)] in dilute form. Dissolve in acid solution (10-70% w/v). This collagen was described in Example 15. bioadhesive protein mixture with 10% to 70% total solids. Mix at a ratio of 1%-50% of the solids containing protein. biological adhesion If you increase the percent type of a protein, it will increase the percent type of a lower percent type. A more highly cross-linked and stiffer composite than that containing bioadhesive proteins. can get. An alkaline solution may be used to neutralize the mixture immediately before application. this This allows for faster oxidation and crosslinking (curing) of the mixture. Moreover, inside At normal pH, collagen crystallizes, adding viscous strength.

Alternatively, bioadhesive proteins can be assembled with collagen preformed sheets. used together. This method uses reinforcing steel in epoxy composites. Similar to use with cement or graphite fibers. Collasta, a commercially available product, (col 1astat) [American Home Products Corporation American Home Products Corporation Helitrex product distributed by )] or other similar products described in Example 13 above. After spraying or dipping into activated bioadhesive protein as Apply to the surface to be mated.

Similarly, other types of insoluble or crystalline protein sheets are adhesive proteins It can be used as a reinforcing agent. For example, Kumite, or solubilized and reprecipitated sheet formed from α-keradose derived from wool keratin fiber [J, DeBersagbes, Curr, Probe.

Dermato+, j2:34-86 (1976)], or purified Brinogen, thrombin and factor ~l [Redl, Hl and G, Sch lag, Facial Plastie Surgery, 2:315-32 1 (1985)] is used. medicine In application, the use of fibrin scenes can accelerate wound healing. [Redl, H and G, Schlag, supra].

Dissolve chitosan in 1% acetic acid (final concentration 30-1501/Rρ) (3-15% W /V). A chitosan solution with a final pH of about 6.0 was added to the bioadhesive agent described in Example 15. Mix with protein solution. Typically, the mixture contains bioadhesive proteins at a concentration 2-30%, and chitosan at a concentration of 1-7%. Chitosan still dissolves At pH 6.0, catefyl oxidase and tyrosinase additives are Reactive.

Catalyzes the formation and crosslinking of PA-derivatized quinones. p before application as in Example 15. Increasing H to 8.0 will cause chitosan to drop out of the solution, which is not desirable in some cases. Precipitates immediately.

(Margin below) Example 18 DNA encoding the biological adhesive precursor protein of M. edulis Isolation of loan N1 As described in Example 6, meso-senger RNA was purified with new M.

isolated from Edenilis. Two 18 base probes were added to the DNA sequence of clone 14. Synthesized based on. First synthetic probe (32214-GTTTGTTGGT TTATATGC) with a conserved sequence (con 5equence).

This oligonucleotide was used for priming cDNA synthesis. Second 2213-TTTATAAGTTGGCTTTGC) is the probe for cDNA Sequences encoding hexapeptides found at several sites in clones It was the complementary sequence of Probes 2213 and 2214 have the same G C/A T They were used together because they have a similar ratio and therefore approximately the same melting point. .

By using both of these probes, it is possible to , multiple hybridization points and strong signals were obtained.

The clone bank prepared in Example 6 was transferred to these 18-base oligonucleotides. Screened using. 30 hybridizations in two experiments positive clones were first identified.

Of these, 28 were brated and screened twice. These DNAs were purified and analyzed. Different decapeptide moieties that are not common A third synthetic 18-base clone (1231-GGGATATA) encoding TTGACTTGGA)'e was included in this hybridization analysis.

As expected, many clones were cloned by cDNA cloning as described in Example 4. It had a larger cDNA insert than the experimental one. Largest loan, e.g. For example, N5, N14 and N26 contain an initial insert fragment of approximately 2.6 kb. had. The DNA preparations of clones N1, N14 and N15 are the clearest. These were selected for initial DNA sequence analysis. Clone N1 is has the largest insert that hybridizes with all three probes; This probe encodes the predominant hexapeptide sequence: ;2213 and showed a strong signal.

Initial sequence analysis of two of the largest loans (N15 and N14) revealed that Both of these are likely to be false positives for polyphenolic protein sequences. It turned out that. The 2°1 kb EcoRI insert from clone N1 was inserted as follows. Sequencing was performed as in Example 6 with some modifications. N1 clone was M13 sequenced. Can be stably subcloned in only one direction in commonly used vectors, resulting in cumulative alignment Determination method (progressive 5equencir+g strategy ) [Dale et al., Plasmid, Vol. 13, pp. 31-40 (19 85)] was carried out using only 11 bottles. Make sure the array is included correctly Therefore, inserts derived from a series of overlapping subclones were collected using the Dill method. Size fractionation was performed by gel electrophoresis.

DNA sequencing revealed that clone N1 was a polyphenolic protein cDNA. It was confirmed that it contained In fact, this clone This clone, which is 2.1 kb long, seems to encode a very large middle part of the quality. Contiguous tandem repeats of 76 decapeptides and hexapepeptides throughout the cell. (Figure 9). The crack in the arrangement shown in Figure 9 is the eye (gear knob). Thus, hexapeptides can be optimally aligned with decapeptides. N1 tongue Thirty-one of the 63 decapeptides in the protein are described in U.S. Patent No. 4,585.5. It is the same as the decapeptide described in No. 85. Figure 10 shows the fluctuations in each part. Shown below. 10 of the 13 hexapeptides are Aha-Lys-Pro-T hr-Tyr-Lys, two have Set in place of Ala, and 1 One has Val instead of Ala.

Clone N1 is another CDNA clone sequenced to date. It does not completely overlap with any of the above.

N1 is thought to be located immediately upstream of clone 52 or 14 at the carboxy terminus. available, but not completely overlapping with any of these clones. is a multiphenolic protein, as found in studies of other structural proteins. It may also be the result of a proteinaceous gene or other pattern of subreitangism. . Since colander clone Nl does not have the characteristic 5° terminal sequence, it is probably does not encode the N-terminus. However, this has a molecular weight of nearly 80°000 110.000-130.0 since it encodes a phenolic protein of It constitutes the major part of 00 intact grain proteins.

With the exception of the proline-rich segment of clone 52, these sequencing results Due to the tandem deca- and hexapeptide repeats, this protein adheres It was shown that it may constitute a complete functional part related to sexuality. encoded protein The magnitude of the quality is the extent to which two or more sequenced cDNA segments align with each other. It can be easily increased by gating.

Example 19 Expression of Nl eDNA in yeast In order to express NlcDNA in yeast, NotI and BamHI Restriction endonuclease sites are located at the 5° and 3' ends of the hooded sequence, respectively. It is desirable to have it placed. To do this, vector M13+np18 is first The oligonucleotide is inserted into the Not1 site adjacent to one EcoR1 site. Mutate by directed mutagenesis. array: EcoRI hotl 5' CCGAGCTCGAATTCTCGCGGCCGCGTAATCATG The oligonucleotide designated GTCAT was used to prime this mutagenesis. used.

We named this new N413 vector MGX463, which is an EcoR1 It has unique NotI and BAMI-11 restriction sites spanning the site. MG The double-stranded DNA of X463 was digested with EcoRl and modified with alkaline phosphatase. The linearized DNA obtained was purified with 0.8% agarose gel.

Double-stranded DNA was digested with EcoRI and Nlc was extracted from the M13mplO vector. DNA coding sequences were removed. The obtained EcoRI flag of approximately 2200 base pairs ment was gel purified. This fragment was converted into Ec.

Double-stranded D of MGX463 linearized with R1 and treated with modified alkaline phosphatase Reigate with NA. E, col i strain GX1210 was transferred to this ligate was transformed with x. This also allows the Notl and BamH1 restriction sites to be A vector MGX464 containing the deleted Nl cDNA sequence was obtained. MGX4 64 was digested with NotI and BamHI, and the resulting NIC DNA fragment was gel purified.

YpGX283 (This is a concurrent continuation application with a filing date of March 12, 1987, Fully described in patent application no. 025.243 (see Figure 11) and BamHI and the large vector fragment was gel purified. this Ligate the fragment with the Notl/BamHI Nl cDNA fragment. By transforming E. col i strain GXI210, YpG Get X405. Plasmid YpGX405 (Figure 12) carries the PH05 signal. N1 cDNA located between the nucleic acid sequence and the GAPDH transcription terminator A yeast-E. coli (E, coli) shuttle vector containing the sequence.

Expression was carried out using a hive composed of yeast GALI and MF-α1 promoter elements. Receives instructions from the lid promoter. Insert GAL4 gene into YpGX405 To do this, the plasmid was linearized with Hindll and calf alkaline phosphatase treated with Tase. Vector YpGX283GAL4 (This is from March 1987 No. 025,243, a concurrent continuation application filed on the 12th. The GAL4 gene was digested with HindI and the GAL4 gene was gel purified. these The two fragments were ligated and transformed into E. coli strain GX1210. , YpGX405GAL4 was obtained.

S. cerebinae produces biological adhesive precursor proteins of expected molecular weights. Transformation with expression vector YpGX405GAL4 to determine whether or not The yeast strain D8 was first grown on YNBD solid medium (0.7% yeast nitrogen base, 10% glucose). yeast extract, 2% agar) and then YPD (1% yeast extract, 2% peptone). , 2% glucose) 10ff (initial A6° reading is 0.1). ) and then grown for 17-24 hours at 28°C under agitation. Obtained cells Collect YPGal (1% yeast extract, 2% peptone, 2% galacdose) 1 0 shuttle, resuspended in an equal volume of YPGal and induced for 6-28 hours. This culture Nutrition IJ! ρ was collected and added to TtsE+tspH8,4 buffer (25mM) Lis/H. Cρ, 125mM EDTA, pH 8,4). Then, the obtained cells Resuspend in 100 μρ of TysE+zs buffer and swirl in the presence of glass beads. and caused it to collapse. After adding 200 μg of T, EI□, cells were removed from glass beads. The lysate was removed and cell debris was pelleted in a microfuge for 5 minutes. No Soluble pellets were added to sample buffer [Laemmli, U, K, 1970. Nature 227:680-685] resuspended in 200 μg and boiled for 5 minutes. I let it happen. A 25 μa aliquot was run on a 10% 5DS-polyacrylamide gel and Examined by Massossie blue staining. The results of this analysis indicate that the molecular weight Biological adhesive precursor protein is present in yeast strains at a level of approximately 1% of total cellular protein. It was shown that it was produced from

20mM) Squirrel pH 7, 5, 2mM EDTA, 0.1mM PMSF.

French press yeast pellets as a 30% suspension in 10mM iodoacetic acid. Sonication or Manton-Gaul homogenizer It was completely mechanically disrupted using an inhomogenizer. Insolubilized flux The adhesive precursor protein present in the sample was incubated at 4°C for 30 min at 25 OOOg. It was collected along with cell debris by centrifugation. A large amount of 10m of the obtained beret The cells were washed with M Tris and 1 mM EDTA (pH 7, 8), and centrifuged in the same manner as above.

The pellets were resuspended in formic acid as a 30% suspension (70% final concentration) and mixed for several hours. It matched. Cyanogen bromide (50 g/ff) was added and the suspension was stirred at room temperature for 24 hours. Ta. The reaction mixture was then evaporated to dryness on a rotary evaporator and the residue was dissolved in water (pH Resuspend to original lysate volume at 3°0) and mix for several hours to dissolve adhesive proteins. was extracted.

After centrifugation (as above), the adhesive precursor protein was extracted from the supernatant using 10% hydrochloric acid. The quality was extracted. Next, the obtained precipitate was added with 5% 2-mercabutoethanol. before adhesion. Sephacryl S-300 or S-400 based on protein size Chromatography was performed on ram. Flaxi containing adhesive precursor protein the pH was adjusted to 4.0 with glacial acetic acid, 5.0% acetic acid, then 0.1% acetic acid. The dialysis solution was changed several times and finally freeze-dried.

Purified proteins were stained with Coomassie blue and Western blotted. Electrophoresis in 5DS-polyacrylamide gel electrophoresis using both analytical methods Electrophoretic mobility, its UV absorption spectrum, protein mass measurement and amino acid structure Characterized by analytical values.

Example 21 Yeast cells were treated up to the 10% NaCQ precipitation step in Example 20.

Instead of treatment with NaCρ, the supernatant was adjusted to p) 15.2 and centrifuged. clear The supernatant was washed with 10% formic acid, then slowly with water, then with 30ff 1M phosphate buffer (pH 7,3). After centrifugation, the resulting supernatant was purified with a weak cation exchanger. Chromatographed. This column was initially loaded with 0.2 to IM salts at pH 7.3. Elution was done with a gradient followed by 1M NaCρ in 5% acetic acid. adhesive substance Fractions containing precursor protein were combined as described in Example 20. lyophilized, dialyzed, and lyophilized, followed by identification and purity of the adhesion precursor protein. Determinations were made as described in Example 20.

Example 22 After disintegrating and centrifuging the yeast cells as in Example 20, the pellet was immersed in 6M guanidine. Either muchloride or 8M urea containing 5% 2-mercaptoethanol. Solubilized in crab. Insoluble cell components were incubated at 4°C for 30 minutes. removed by centrifugation.

The proteins in the supernatant are precipitated by dialysis with water, and the adhesive precursor protein is diluted. The mixture was extracted with a formic acid or acetic acid solution (pH 2,0) for several hours. adhesive precursor Proteins can be prepared either by adjusting the pH to neutrality or in a 10% NaCC solution. It was precipitated by chiraka. After centrifugation, the adhesive precursor protein pellet was Solubilize with 6M guanidium chloride and then add <S-30 based on protein size. 0 or S-400 columns. correct size adhesive The precursor proteins were pooled, adjusted to pH 4, Qi: with acetic acid, 5% acetic acid, then 0.1 % acetic acid and lyophilized.

Example 23 Yeast cells were disrupted and thoroughly washed as in Example 20. Add the pellets to a diluted Extraction was performed using acid or acetic acid (pH 2,0) for several hours.

The resulting solution was then adjusted to pH 3.0 and centrifuged. Adhesives present in supernatant The pre-protein was adjusted to pH 5.0-5.5 and precipitated. adhesive substance Precursor proteins were collected by centrifugation and, if necessary, further described in Examples 20 and 21. Purified by either weak cation exchanger or gel filtration columns as described did.

FIG.3 OL+00-←F L)-OL[- ～Tameku Ko Tameku C≧ku B≧ku ← ← I-F--t-t- FJ6.6 GAL4 FIG.8 Head 5 5 Yo Head 5 Mi Head 5 Yo Expansion 5 Mi Head 5 Mi 5 Yo LEU2-D FIG. 11 FIG. 12 international search report ATTACHJ', ENT To FOFLM PCT#SA/210. Pa rt Eh.

XX, Fields 5earched 5earch Terrns: app licants’ names, adhesiv@, bioadhesiv e, protein.

polyphenol, gene, DNA, RNA, cDNA, MRN included, cl one, vector.

cloning, recombinant, mytilvs, rnuss @L, mariner engineer ntronlaxon, edulis.

Claims (75)

[Claims] 1. Biological adhesion of bay animals selected from bivalves, sinews, and oysters DNA segment containing codons for the natural amino acid sequence of the precursor protein ment. 2. The DNA segment according to claim 1, wherein the marine animal is a bivalve. 3. The DNA segment according to claim 2, wherein the bivalve is a bivalve of the genus Mytilus. . 4. The bioadhesive precursor protein encoded by the bivalve species Mi 4. The DNA segment according to claim 3, which is a T. edulis protein. 5. Array formula: [I have an array] [I have an array] or a fragment thereof Codon group for biological adhesive precursor protein containing the sequence shown in 5. The DNA segment according to claim 4, comprising: 6. Amino acid sequence: [There is an array] or a fragment thereof D according to claim 4, which encodes a biological adhesive precursor protein having NA segment. 7. Amino acid sequence: [There is an array] or the fragment D according to claim 4, which encodes a biological adhesive precursor protein having NA segment. 8. Amino acid sequence: [There is an array] or the fragment D according to claim 4, which encodes a biological adhesive precursor protein having NA segment. 9. Amino acid sequence: [There is an array] or that fragment D according to claim 4, which encodes a biological adhesive precursor protein having NA segment. 10. DNA sequence: [There is an array] [There is an array] or a fragment thereof 5. The DNA segment according to claim 4, comprising: 11. DNA sequence: [There is an array] or a fragment thereof 5. The DNA segment according to claim 4, comprising: 12. DNA sequence: [There is an array] or a fragment thereof 5. The DNA segment according to claim 4, comprising: 13. DNA sequence: [There is an array] Also is that fragment 5. The DNA segment according to claim 4, comprising: 14. DNA sequence: [There is an array] or that hula ment 5. The DNA segment according to claim 4, comprising: 15. (a) Marine animal organisms selected from bivalves, sinenids, and oysters; D containing codons for the natural amino acid sequence of the chemical adhesive precursor protein. NA segment, (b) expression of biological adhesive precursor protein in microorganisms. A promoter and a promoter operably linked to the DNA segment to enable transcription. start signal A vector for expressing a biological adhesive precursor protein containing. 16. The encoded biological adhesive precursor protein is derived from bivalves. The vector according to claim 15. 17. Bioadhesive precursor proteins encoded by bivalve species The vector according to claim 16, which is a Mytilus edulis protein. 18. DNA segment (a) has an amino acid sequence: [There is a sequence] or a fragment thereof Claim 17 containing a group of codons for a biological adhesive precursor containing Vectors described in. 19. DNA segment (a) has an amino acid sequence: [There is a sequence] or a fragment thereof Claim 17 containing a group of codons for a biological adhesive precursor containing Vectors described in. 20. DNA segment (a) has an amino acid sequence: [There is a sequence] or the fragment A protein containing codons for a bioadhesive precursor protein containing The vector according to claim 17. 21. DNA segment (a) has an amino acid sequence: [There is a sequence] or a fragment thereof A protein containing codons for a bioadhesive precursor protein containing The vector according to claim 17. 22. DNA segment (a) has an amino acid sequence: [There is a sequence] or that flag ment A protein containing codons for a bioadhesive precursor protein containing The vector according to claim 17. 23. DNA segment (a) has a base sequence: [There is a sequence] or a fragment thereof The vector according to claim 17, consisting of: 24. DNA segment (a) has a base sequence: [There is a sequence] or a fragment thereof The vector according to claim 17, consisting of: 25. DNA segment (a) has a base sequence: [There is a sequence] or a fragment thereof. 26. DNA segment (a) has a base sequence: [There is a sequence] or the fragment The vector according to claim 17, containing the vector. 27. DNA segment (a) has a base sequence: [There is a sequence] or that flag ment The vector according to claim 17, containing the vector. 28. OL/PR promoter operably linked to DNA segment (a) - The vector according to claim 17, containing the operator. 29. 18. The vector according to claim 17, which is plasmid pGX2383. 30. Claim 17 containing a GAL1-MF-α1 hybrid promoter. Vectors listed. 31. The vector according to claim 17, which is plasmid YpGX285GAL4. 32. claim 15, capable of expressing a bioadhesive precursor protein; 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, A microorganism transformed with the expression vector according to 28, 29, 30, or 31. 33. Transformed microorganism E. coli GX3015 (pGX2383). 34. Transformed microorganism S. S. cerevisiae AH22 (YpGX285GAL4). 35. 1. A method for producing a bioadhesive protein, comprising: (a)(i) Biological adhesives for marine animals selected from bivalves, sinews, and oysters DNA segment containing codons for the natural amino acid sequence of a precursor protein and (ii) enable the expression of biological adhesive precursor proteins in microorganisms. a promoter operably linked to the DNA segment and a transcription promoter start signal (b) culturing a transformed microorganism transformed with an expression vector containing Express the chemical adhesive precursor protein, collect it from the transformed microorganism, and do (c) hydroxylating the obtained biological adhesive protein. how to. 36. Characterized by the fact that the biological adhesive precursor protein is derived from bivalves. 36. The method of claim 35. 37. Biological adhesive precursor proteins are present in the bivalve species Mytilus edu. 37. The method of claim 36, wherein the protein is a squirrel protein. 38. Amino acid sequence of biological adhesive precursor protein: [Sequence available] [ array] or a fragment thereof 38. The method according to claim 37, comprising: 39. Amino acid sequence of biological adhesive precursor protein: [Sequence available] or a fragment thereof 38. The method according to claim 37, comprising: 40. Amino acid sequence of biological adhesive precursor protein: [Sequence available] or the fragment 38. The method according to claim 37, comprising: 41. Amino acid sequence of biological adhesive precursor protein: [Sequence available] or the fragment 38. The method according to claim 37, comprising: 42. Amino acid sequence of biological adhesive precursor protein: [Sequence available] 38. The method according to claim 37, comprising: 43. The DNA segment encoding the biological adhesive precursor protein is D NA sequence: [I have an array] [I have an array] or a fragment thereof 38. The method according to claim 37, comprising: 44. The DNA segment encoding the biological adhesive precursor protein is D NA sequence: [There is an array] or a fragment thereof 38. The method according to claim 37, comprising: 45. The DNA segment encoding the biological adhesive precursor protein is D NA sequence: [There is an array] or a fragment thereof 38. The method according to claim 37, comprising: 46. The DNA segment encoding the biological adhesive precursor protein is D NA sequence: [There is an array] or the fragment 38. The method according to claim 37, comprising: 47. The DNA segment encoding the biological adhesive precursor protein is D NA sequence: [There is an array] or that flag ment 38. The method according to claim 37, comprising: 48. 38. The method according to claim 37, wherein the expression vector is plasmid pGX2383. . 49. 38. The expression vector is plasmid YpGX285GAL4. How to put it on. 50. 38. The method according to claim 37, wherein the transformed microorganism is a Gram-negative bacterium. 51. Claim 5, wherein the transformed microorganism is E. coli GX3015 (pGX2383). The method described in 0. 52. 38. The method according to claim 37, wherein the transformed microorganism is yeast. 53. 53. The method according to claim 52, wherein the transformed microorganism is Saccharomyces. 54. The transformed microorganism is S. 54. The method of claim 53, which is S. cerevisiae. 55. The transformed microorganism is S. S. cerevisiae AH22 (YpGX285GAL4) 55. The method of claim 54. 56. Biological Adhesive Precursor Protein Mushroom Tyrosinase or Streptococcus Enzymatically oxidize by treatment with Myces antibiotics steroidosinase. 38. A method according to claim 37, characterized in that it is droxylated. 57. Treatment of biological adhesive precursor proteins with mushroom tyrosinase 57. The method of claim 56. 58. A method for joining two surfaces, the method comprising: Natural amino acids of marine animal biological adhesive precursor proteins selected from oysters microorganism-produced biological adhesive containing a noic acid sequence or a fragment thereof Hydroxylation of precursor protein and resulting hydroxylated microorganism-producing organism Apply a chemical adhesive precursor protein to one or both surfaces, and A method characterized by contacting. 59. Claim 5 wherein the biological adhesive precursor protein is a bivalve protein. 8. The method described in 8. 60. Biological adhesive precursor proteins are present in the bivalve species Mytilus edu. 60. The method of claim 59, wherein the protein is a squirrel protein. 61. Amino acid sequence of biological adhesive precursor protein [Sequence available] or a fragment thereof 61. The method according to claim 60, comprising: 62. Amino acid sequence of biological adhesive precursor protein: [Sequence available] or that flag ment 61. The method of claim 60. 63. Amino acid sequence of biological adhesive precursor protein: [Sequence available] or the fragment 61. The method of claim 60. 64. Amino acid sequence of biological adhesive precursor protein: [Sequence available] [ There is an array] or the fragment 61. The method of claim 60. 65. Amino acid sequence of biological adhesive precursor protein: [Sequence available] or that flag ment 61. The method of claim 60. 66. Hydroxylate the biological adhesive precursor protein and use it as a primer Apply it as a coating to one or both surfaces, then apply the other adhesive to the surface. 59. A method according to claim 58, characterized in that it is applied over a limer coating. . 67. Make sure the adhesive applied over the primer coating is an epoxy adhesive. The method according to claim 66. 68. Hydroxylating the biological adhesive precursor protein and attaching it to carbohydrate Dissolved in a solvent as a mixture with adhesive and applied to one or both surfaces to be bonded 59. The method of claim 58. 69. 69. The method of claim 68, wherein the carbohydrate adhesive is chitosan. 70. A method for producing a biological adhesive precursor protein, the method comprising: Bioadhesive precursors of marine animals selected from the genus, sinenoids, and oysters. Contains the natural amino acid sequence of a protein or a fragment thereof, and one of them or a fusion protein containing additional amino acid sequence(s) fused to both termini. protein, wherein the additional amino acid sequence(s) is a biological adhesive precursor protein. Amino acid sequence (group) having a methionine residue within about 10 residues from the protein sequence A fusion protein is expressed in a microorganism, and the fusion protein is brominated. Process with cyan to remove all or part of the additional amino acid sequence(s) A method characterized by: 71. (a) Marine animal organisms selected from bivalves, sinenids, and oysters; has the natural amino acid sequence of a chemical adhesive precursor protein or a fragment thereof. to hydroxylate at least about 10% of the tyrosine residues of the protein a bioadhesive protein prepared thereby; (b) a carbohydrate adhesive, and (c) Solvent An adhesive composition consisting of. 72. 72. The adhesive composition of claim 71, wherein the carbohydrate is chitosan. 73. about 2%-30% adhesive protein by weight, and about 1%-7% by weight 72. The adhesive composition of claim 71, containing % chitosan. 74. An adhesive composition containing a solution containing 10%-70% solids content. This means that the solid matter is made of marine animals selected from bivalves, oysters, and oysters. The natural amino acid sequence of one shellfish bioadhesive precursor protein or its At least about one of the tyrosine residues in the recombinant protein with the fragment Bioadhesive proteins prepared by hydroxylating 0% about 1%-50% by weight and about 50%-99% collagen. A composition comprising: 75. Biological adhesion of marine animals selected from bivalves, sinews and oysters A protein having the natural amino acid sequence of a substance precursor protein or a fragment thereof by hydroxylating at least about 10% of the tyrosine residues in the protein. Collagen sheets with adhesive recombinant proteins on their surface prepared by adhesive consisting of.