RU2371474C2 - Method of producing carbohydrate ester, protein ester, ester of protein subunits or hydroxyacid ester using lipidacyltransferase - Google Patents

Abstract

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology and can be used for producing esters of such compounds as carbohydrates, proteins, protein subunits and hydroxyacids. The method involves mixing an acyl group donor, acyl group acceptor and water with formation of a medium with high water content, containing 5 to 98% water. The acyl group donor used is a lipid substrate, chosen from phospolipid, lysophospholipid, triacylglyceride, diglyceride, glycolipid or lysoglycolipid, and the acyl group acceptor used is carbohydrate, protein, protein subunitor hydroxyacid. The mixture is brought into contact with lipidacyltransferase, which catalyses alcoholysis and/or re-esterification and is an enzyme which has acyltransferase activity, containing a GDSX fragment of amino acid sequence, where X stands for one or more of the following amino acid residues L, A, V, I, F, Y, H, Q, T, N, M or S.

EFFECT: invention allows for obtaining one or more carbohydrate esters, protein esters, esters of protein subunits or hydroxyacid esters using lipidacyltransferase.

18 cl, 51 dwg, 10 tbl, 13 ex

Description

Link to related applications

In this description of the invention, reference is made to the following applications: application for US patent No. 09/750990, filed July 20, 1999, and application for US patent No. 10/409391. The above applications, all documents cited in these applications (“documents cited in applications”), and all documents cited or referenced in documents cited in applications, both in the text and during the conduct of business on applications , as well as all arguments in support of patentability presented during the consideration of applications, are incorporated into this description by reference. This document also describes various documents (referred to as “documents referred to in the application materials”). All documents referred to in the application materials, and all documents cited in such documents, are incorporated into this description by reference.

FIELD OF THE INVENTION

The present invention relates to a method for lipid bioconversion using lipid acyltransferase to produce a carbohydrate ester and / or protein ester and / or protein subunit ester and / or hydroxy acid ester.

The present invention also relates to the use of lipid acyltransferase for bioconversion of a lipid into one or more of the following products: carbohydrate ester and / or protein ester and / or protein subunit ester and / or hydroxy acid ester.

The present invention further relates to the use of the above immobilized lipid acyltransferase for lipid bioconversion in a high water medium to produce one or more carbohydrate esters and / or protein esters and / or protein subunit esters and / or esters esters of hydroxyacids.

The present invention also relates to immobilized lipid acyltransferase.

State of the art

Lipases are widely used for lipid bioconversion to produce valuable products, such as sugar esters, for use in a variety of industries, including the food and / or feed industries, cosmetics and / or perfumes, oleochemicals, and pharmaceuticals.

If bioconversion processes require hydrolysis of lipid substrates, then lipolytic enzymes can be used in environments with a high water content. However, when bioconversion processes require transesterification reactions, such as alcoholysis, the use of lipases in high-water environments may be unacceptable due to undesirable hydrolysis reactions causing undesirable biological products and / or due to a lower yield of the bioconversion product.

When performing bioconversion processes requiring transesterification, lipases are usually used in anhydrous environments such as oil systems and / or organic solvent systems such as butanol, methanol or hexane. Such systems form an environment in which at least partially a polar acceptor molecule can be solubilized, and the donor lipid and lipase molecule possesses sufficient enzymatic activity. Although a small amount of water is needed to ensure any enzymatic activity, its amount is strictly controlled at a low level to avoid hydrolytic activity of the enzyme.

Sugar esters, protein esters or hydroxyacid esters are obtained by chemical synthesis using inorganic catalysts. When performing bioconversion processes aimed at producing sugar esters or hydroxyacid esters, lipases are used in organic solvents or supercritical fluids in which only a small amount of water is present (if at all).

In Lecointe et al., Biotechnology Letters, Vol. 28, No. 8 (August), pp. 869-874, describes the study of a number of lipase enzymes and their activity in aqueous media in the preparation of methyl ester or butyl ester from methanol and butanol, respectively. In a publication by Lecointe et al. it is indicated that lipase / acyltransferase from Candida parapsilosis with increasing concentrations of methanol or butanol shows a reduced hydrolysis activity and increased ability of the enzyme to produce methyl ester and butyl ester. The use of lipase / acyltransferase from C. parapsilosis in the preparation of fatty hydroxamic acid is discussed in Vaysse et al., J. of Biotechnology 53 (1997) 41-46.

Lipase has been known for some time: cholesterol acyltransferase (see, for example, Buckley, Biochemistry 1983, 22, 5490-5493). In particular, it was found that glycerophospholipid: cholesterol acyltransferase (often referred to as GCAT), which, like lecithin: cholesterol acyltransferase (LCAT) of plants and / or mammals, catalyze the transfer of fatty acids between phosphatidylcholine and cholesterol.

Upron and Buckley (TIBS 20, May 1995 p. 178-179) and Brumlik and Buckley (J. of Bacteriology Apr. 1996 p. 2060-2064) disclose a lipase / acyltransferase from Aeromonas hydrophila that is capable of transferring an acyl group to alcohol acceptors in aqueous media.

SUMMARY OF THE INVENTION

The first object of the present invention is a method for producing one or more carbohydrate esters, protein esters, protein subunit esters or hydroxy acid esters, which comprises mixing an acyl donor, an acyl acceptor and water to form a high water medium containing 5- 98% of water, while the aforementioned acyl donor is a lipid substrate selected from one or more members of the group including phospholipid, lysophospholipid, triacylglyce id, a diglyceride, a glycolipid or a lyso-glycolipids, and said acyl acceptor is selected from one or more members of the group consisting of carbohydrate, protein, protein subunit or hydroxy; and contacting said mixture with a lipid acyltransferase, such that the lipid acyltransferase catalyzes one or both of the following reactions: alcoholysis or transesterification.

Another object of the present invention is the use of lipid acyltransferase to produce one or more carbohydrate esters, protein esters, protein subunit esters or hydroxy acid esters by catalysis of alcoholysis or transesterification, or both of these reactions in a mixture of an acyl donor, an acyl acceptor and water containing 5-98% of water in the mixture, while the above-mentioned donor of the acyl group is a lipid substrate selected from one or more members of the group, including a phospholipid, lysophospholipid, triacylglyceride, diglyceride, glycolipid or lysoglycolipid, and the aforementioned acyl acceptor is selected from one or more members of the group comprising a carbohydrate, protein, protein subunit or hydroxy acid.

Another object of the present invention is a carbohydrate ester, protein ester, protein subunit ester or hydroxy acid ester obtained by the method of the present invention.

Another object of the present invention is a pharmaceutical preparation, cosmetic preparation, food product, feed product and paint containing carbohydrate ester, protein ester, protein subunit ester or hydroxy acid ester obtained by the method of the present invention.

Another object of the present invention is the immobilized enzyme lipid acyltransferase described in this application.

Detailed description of the present invention

The term “lipid acyltransferase” as used herein means an enzyme which, in addition to possessing lipase activity (usually classified as ES 3.1.1.x, in accordance with the recommendations on the nomenclature of enzymes (1992) of the Committee on the Nomenclature of the International Union for Biochemistry molecular biology) also has acyltransferase activity (usually classified as ES 2.3.1.x), due to which the enzyme is able to transfer the acyl group from lipid to one or more of the following acceptor substrates: carbohydrate d, protein, protein subunit or hydroxy acid.

The “acyl group acceptor” of the present invention is preferably not water.

In accordance with one aspect of the invention, the enzyme is preferably capable of transferring an acyl group from a lipid substrate to a carbohydrate.

One or more of the following substances can be a carbohydrate acyl accentor: monosaccharide, disaccharide, oligosaccharide or polysaccharide. The carbohydrate is preferably one or more of the following substances: glucose, fructose, anhydro-fructose, maltose, lactose, sucrose, galactose, xylose, xylo-oligosaccharides, arabinose, maltooligosaccharides, tagatose, microthecin, ascopyron P, ascopyron T, or cortal.

Carbohydrate esters can be valuable emulsifiers, for example, in foods.

In accordance with one aspect of the invention, an enzyme is preferably capable of transferring an acyl group from a lipid substrate to a protein and / or protein subunit.

The protein subunit is preferably one or more of the following substances: amino acid, protein hydrolyzate, peptide, dipeptide, oligopeptide, polypeptide.

Suitable proteins may be one or more of the following: proteins present in foods, for example, dairy and / or meat products. As an example, proteins found in clotted milk or serum, such as lactoglobulin, can be cited. Other suitable proteins include ovalbumin (from an egg), gliadin, glutenin, puroindoline, wheat protein, lipid-transporting proteins from grain, meat myosin or the following milk proteins: caseins, lactoalbumins and lactoferrins.

The acceptor of the acyl group in a protein or protein subunit may be one or more of the following components of the protein or protein subunit: serine, threonine, tyrosine or cysteine.

When the protein subunit is an amino acid, then such an amino acid can be any amino acid. The amino acid is preferably, for example, serine, threonine, tyrosine or cysteine.

In accordance with one aspect of the invention, an enzyme is capable of transferring an acyl group from a lipid substrate to a hydroxy acid.

A suitable hydroxy acid may be one or more of the following acids: citric acid, tartaric acid, lactic acid, ascorbic acid, glycolic acid, malic acid, alpha hydroxyethanoic acid, alpha hydroxyoctanoic acid, alpha hydroxycaprylic acid, hydroxycaprylic acid, gluconic acid, lactobionic acid acid or maltobionic acid.

A suitable hydroxy acid may be fruit acid, for example one or more acids such as malic acid, lactic acid, tartaric acid, citric acid or glycolic acid.

In one embodiment, a preferred hydroxy acid is one or more of the following acids: citric acid, lactic acid, tartaric acid, or malic acid.

The term “hydroxy acid” as used herein means a carboxylic acid in which one or more hydrogen atoms of an alkyl group are replaced by a hydroxyl group.

According to one aspect of the invention, lipid acyltransferase, in addition to being able to transfer an acyl group from a lipid substrate to one or more carbohydrates, proteins, protein subunits or hydroxy acids, can also transfer an acyl group from a lipid to one or more of the following substances, which are sterol and / or stanol, in in particular phytosterol and / or phytostanol.

When the phospholipid is the lipid substrate, it may be lecithin, for example phosphatidylcholine. The term “lecithin” as used herein means phosphatidylcholine, phosphatidylethanolamine, phosphatidylinositol, phosphatidylserine and phosphatidylglycerol.

When the lipid substrate is a lysophospholipid, it may be a lysolecithin, for example a lysophosphatidylcholine. The term “lysophosphatidylcholine” as used here is synonymous with the term “lysolecithin”, therefore, these terms can be used interchangeably.

When the lipid substrate is glycolipid, it can be, for example, digalactosyl diglyceride (DGDG).

A lipid substrate may be referred to herein as a “lipid acyl donor” or “acyl donor”. These terms are used interchangeably in this application.

In accordance with some aspects of the invention, the lipid substrate in which the lipid acyltransferase acts is preferably a phospholipid, such as lecithin, for example phosphatidylcholine.

In accordance with some aspects of the invention, the lipid substrate is preferably a glycolipid, such as, for example, DGDG.

In accordance with some aspects of the invention, the lipid substrate may be a food lipid, that is, a lipid component of a food product.

In accordance with some aspects of the invention, the lipid acyltransferase of the present invention may be unable or substantially unable to act on triglyceride, 1-monoglyceride and / or 2-monoglyceride.

The lipid substrate or the lipid donor of the acyl group may be one or more lipids present in one or more of the following substrates, such as fats, including lard, lard and milk fat; oils, including oils extracted or extracted from palm oil, sunflower oil, soybean oil, safflower oil, cottonseed oil, peanut oil, corn oil, olive oil, coconut oil and rapeseed oil. Lecithin from soy, rapeseed or egg yolk is also an acceptable lipid substrate. The lipid substrate may be a lipid of oats or another plant containing galactolipids.

In accordance with some objects of the present invention, the lipid can be selected from lipids having a chain of fatty acids with a length of from 8 to 22 carbon atoms.

In accordance with some objects of the present invention, the lipid may be selected from lipids having a chain of fatty acids with a length of from 16 to 22 carbon atoms, more preferably from 16 to 20 carbon atoms.

In accordance with some objects of the present invention, the lipid can be selected from lipids having a chain of fatty acids with a length of not more than 14 carbon atoms, in particular from lipids having a chain of fatty acids with a length of 4 to 14 carbon atoms, in particular from 4 to 10 carbon atoms , in particular from 4 to 8 carbon atoms.

The acyl donor is preferably not a free fatty acid.

The acyl donor is preferably not a carbohydrate (sugar) ester.

The lipid acyltransferase of the present invention may have one or more of the following lipase activities: glycolipase activity (E.C. 3.1.1.26), triacylglycerol lipase (E.C. 3.1.1.3), phospholipase A2 (E.C. 3.1.1.4) or phospholipase A1 (E.C. 3.1.1.32). The term “glycolipase activity” as used herein also means “galactolipase activity”.

The lipid acyltransferase of the present invention may have at least one or more of the following activities: glycolipase activity (E.C. 3.1.1.26) and / or phospholipase A1 (E.C. 3.1.1.32) and / or phospholipase A2 (E. S. 3.1.1.4).

In accordance with certain aspects of the invention, the lipid acyltransferase of the present invention may have at least glycolipase activity (EC 3.1.1.26).

In accordance with certain aspects of the invention, the lipid acyltransferase of the present invention may be capable of transferring an acyl group from a glycolipid and / or phospholipid to one or more of the following acceptor substrates: carbohydrate, protein, protein subunit, hydroxy acid.

In accordance with some aspects of the invention, the lipid acyltransferase of the present invention is preferably capable of transferring an acyl group from a glycolipid and / or phospholipid to a carbohydrate to form at least a carbohydrate ester.

In accordance with some aspects of the invention, the lipid acyltransferase of the present invention is preferably capable of transferring an acyl group from a glycolipid and / or phospholipid to a protein or protein subunit to form at least a protein ester (or protein fatty acid condensate) or protein subunit ester.

The term “protein subunit ester” as used herein means an ester formed from any protein subunit, such as, for example, dipeptide ester, oligopeptide ester, polypeptide ester or protein hydrolyzate ester.

In accordance with certain aspects of the invention, the lipid acyltransferase of the present invention preferably does not have triacyl glycerol lipase activity (EC 3.1.1.3).

The lipid acyltransferase enzyme of the present invention can preferably be characterized based on the following criteria:

(i) this enzyme has acyltransferase activity, which can be defined as the activity of ester transfer, as a result of which the acyl part of the initial ester linkage of the lipid donor of the acyl group is transferred to one or more acceptors of the acyl group, which are a carbohydrate, protein, protein subunit or hydroxy acid, to form a new ester, i.e. a carbohydrate ester, protein ester, protein subunit ester and / or hydroxy acid ester; and

(ii) the enzyme contains a GDSX fragment in the amino acid sequence, where X is one or more of the following amino acid residues: L, A, V, I, F, Y, H, Q, T, N, M, or S.

X in the GDSX fragment is L. Thus, the enzyme of the present invention preferably contains a GSDL fragment in the amino acid sequence.

The GDSX fragment consists of four conserved amino acids. The serine in this fragment is preferably a catalytic serine of the lipid acyltransferase enzyme. The serine of the GDSX fragment may be in the position corresponding to the position of Ser-16 in the Aeromonas hydrophila lipolytic enzyme, as described in Brumlik & Buckley (Journal of Bacteriology Apr. 1996, Vol. 178, No. 7, pp. 2060-2064).

To determine the presence of a GDSX fragment of the present invention in a protein, the sequence is preferably compared with hidden Markov model profiles (HMM profiles) in the Pfam database.

Pfam is a protein domain family database. The Pfam database contains several verified sequences for each family, as well as models of hidden Markov profiles (HMM profiles) to identify these domains in new sequences. The Pfam database can be found in Bateman A. et al., (2002) Nucleic Acids Res. thirty; 276-280. Markov's hidden profile models have been used in a number of databases for protein classification, and can be found in the publication by Bateman A. and Haft D.H. (2002) Brief Bioinform 3; 236-245.

http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list _{_} uids = 12230032 & dopt = Abstract

http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list _{_} uids = 11752314 & dopt = Abstract

For a detailed review of Markov's hidden profile models and their use in the Pfam database, see Durbin R., Eddy S., and Krogh A. (1998) Biological sequence analysis; probabilistic models of proteins and nucleic acids. Cambridge University Press, ISBN 0-521-62041-4. Hammer's software package is available at the University of Washington, St. Louis, USA.

Alternatively, the GDSX fragment can be identified using the Hammer software package, instructions for use of which are given in Durbin R., Eddy S., and Krogh A. (1998) Biological sequence analysis; probabilistic models of proteins and nucleic acids. Cambridge University Press, ISBN 0-521-62041-4, the references cited in the publication, and in the HMMER2 profile discussed in this specification.

Access to the PFAM database can be obtained, for example, through several servers, which are currently located on the following websites.

http: //www.sanger.ac.uc/Software/Pfam/index.shtml

http://pfam.wustl.edu/

http://pfam.jouy.inra.fr/

http://pfam.cgb.ki.se/

This database provides the ability to search with access to the protein sequence. Using the default settings of the database, it is possible to analyze the protein sequence for the presence of Pfam domains. The GDSX domain is a stable domain, so its presence will be detected in any requested sequence. The specified database compares the agreed sequence Pfam00657 with the requested sequence.

A comparative analysis of several sequences, including Aeromonas salmonicida or Aeromonas hydrophila , can be performed:

a) manually

why it is necessary to compare the protein of interest with the coordinated sequence of Pfam00657 and compare P10480 with the coordinated sequence of Pfam00657 as described above;

or

b) using the database

after identifying the matched sequence Pfam00657, the database offers an option to compare the requested sequence with the selected matched sequence Pfam00657. P10480 is part of the comparison of selected sequences and is named GCAT_AERHY. The requested sequence and P10480 will be displayed in one window.

Aeromonas hydrophila reference sequence:

the GDSX Aeromonas hydrophila lipase residues are numbered in the P10480 NCBI file, and the numbers in the description of the invention refer to the numbers indicated in this file, which in the present invention was used to determine the specific amino acid residues present in the preferred embodiment of the invention in the lipid acyltransferase enzymes of this invention.

Comparison of sequences was performed using the Pfam database (figures 33 and 34).

The following conserved residues that may be present in enzymes intended for use in the compositions and methods of this invention in accordance with a preferred embodiment are recognized.

where “hid" means a hydrophobic residue selected from Met, Ile, Leu, Val, Ala, Gly, Cys, His, Lys, Trp, Tyr, Phe.

Comparison of the lipid acyltransferase enzyme for use in the compositions and methods of this invention can preferably be done using the consistent sequence Pfam00657.

A positive match for the hidden Markov model profile (HMM profile) of the pfam00657 domain family preferably indicates the presence of the GDSL or GDSX domain of the present invention.

In accordance with the agreed sequence Pfam00657, a lipid acyltransferase for use in the compositions and methods of this invention preferably contains at least one, preferably more than one, preferably more than the following two blocks: GDSX block, GANDY block, HPT block. Lipid transferase may accordingly comprise a GDSX block and a GANDY block. Alternatively, the enzyme may comprise a GDSX block and an HPT block. The enzyme preferably contains at least a GDSX block.

In accordance with the agreed sequence Pfam00657, the enzyme for use in the compositions and methods of this invention preferably contains at least one, preferably more than one, preferably more than two, preferably more than three, preferably more than four, preferably more than five, preferably more than six, preferably more than seven, preferably more than eight, preferably more than nine, preferably more than ten, preferably more than eleven, preferred but more than twelve, preferably more than thirteen, preferably more than fourteen of the following amino acid residues when compared with the reference polypeptide sequence of A. hydrophilia , in particular SEQ ID NO: 32: 28hid, 29hid, 30hid, 31hid, 32gly, 33Asp, 34Ser, 35hid, 130hid, 131 Gly, 132hid, 133Asn, 134Asp, 135hid, 309His.

The GDSX domain pfam00657 is a unique identifier that distinguishes proteins containing the specified domain from other enzymes.

The agreed sequence pfam00657 is shown in FIG. 1 as SEQ ID NO: 1. This sequence was obtained by identifying the family pfam 00657, database version 6, which can also be defined in this description of the invention as pfam00657.6.

The consistent sequence may be updated in subsequent releases of the pfam database.

For example, Figures 33 and 34 show a comparison of the pfam sequence of the 00657 family from the database, version 11, which can also be defined in this description of the invention as pfam00657.11.

The GDSX, GANDY, and HPT blocks were found in the pfam 00657 family in both database releases. Subsequent releases of the pfam database can be used to identify the pfam 00657 family.

The lipid acyltransferase enzyme of the present invention can be characterized based on the following criteria:

(i) this enzyme has an acyltransferase activity, which can be defined as the activity of ester transfer, as a result of which the acyl part of the initial ester linkage of the lipid donor of the acyl group is transferred to one or more acceptors of the acyl group, which are a carbohydrate, protein, protein subunit or hydroxy acid to form a new ester, i.e. a carbohydrate ester and / or protein ester and / or protein subunit ester and / or hydroxycis ester lots;

(ii) the enzyme contains a GDSX fragment of an amino acid sequence in which X is one or more of the following amino acid residues L, A, V, I, F, Y, H, Q, T, N, M, or S;

(iii) the enzyme contains His-309 or a histidine residue at a position corresponding to His-309 in the Aeromonas hydrophila lipolytic enzyme shown in FIG. 2 (SEQ ID NO: 2 or SEQ ID NO: 32).

A preferred amino acid residue of the GDSX fragment is L.

In SEQ ID NO: 2 or SEQ ID NO: 32, the first 18 amino acid residues form a signal sequence. His-309 unprocessed sequence, that is, a protein containing the signal sequence, corresponds to the His-291 mature portion of the protein, that is, a sequence without a signal sequence.

The lipid acyltransferase enzyme of the present invention preferably contains the following catalytic triad: Ser-34, Asp-134 and His-309 or a serine residue, aspartic acid residue and histidine residue at the positions corresponding to Ser-34, Asp-134 and His-309 in the lipolytic a fragment of Aeromonas hydrophila shown in figure 2 (SEQ ID NO: 2) or figure 28 (SEQ ID NO: 32). As indicated above, in the sequence shown in SEQ ID NO: 2 or SEQ ID NO: 32, the first 18 amino acid residues form a signal sequence. Ser-34, Asp-134 and His-309 of the unprocessed sequence, i.e., a protein containing the signal sequence, correspond to the Ser-16, Asp-116 and His-291 of the mature portion of the protein, i.e., a sequence without a signal sequence. In the consistent sequence pfam00657 shown in FIG. 1 (SEQ ID NO: 1), the remains of the active site correspond to Ser-7, Asp-157 and His-348.

The lipid acyltransferase enzyme of the present invention can preferably be characterized based on the following criteria:

(i) this enzyme has acyltransferase activity, which can be defined as the activity of ester transfer, as a result of which the acyl part of the initial ester bond of the first lipid donor of the acyl group is transferred to one or more acceptors of the acyl group, which are a carbohydrate, protein, protein subunit, or hydroxy acid, to form a new ester, i.e. a carbohydrate ester, protein ester, protein subunit ester and / or hydroxy acid ester you; and

(ii) this enzyme contains at least Gly-32, Asp-33, Ser-34, Asp-134 and His-309 or the remains of glycine, aspartic acid, serine, aspartic acid and histidine at positions corresponding to Gly-32, Asp -33, Ser-34, Asp-134, and Gis-309 in the Aeromonas hydrophila lipolytic enzyme shown in Figure 2 (SEQ ID NO: 2) or Figure 28 (SEQ ID NO: 32).

The lipid acyltransferase enzyme of the present invention can be obtained from organisms belonging to one or more of the following genera: Aeromonas, Streptomyces, Saccharomyces, Lactocococcus, Mycobacterium, Streptococcus, Lactobacillus, Desulfitobacterium, Xulfylobacterium, Vacylobusfer, Schulphibella, Bacillus, Campylorus biblaebergibolum, Campylobusfer, Scholomida bibillus, Campylobacterium, Neisseria, Mesorhizobium, Ralstonia, Xanthomonas and Candida .

Lipid acyltransferase enzyme according to the present invention can be prepared from one or more of the following organisms: Aeromonas hydrophila, Aeromonas salmonicida, Streptomyces coelicolor, Streptomyces rimosus, Mycobacterium, Streprococcus pyogenes, Lactococcus lactis, Streptococcus pyogenes, Streptococcus thermophilus, Lactobacillus helveticus, Desulfitobacterium dehalogenans, Bacillus sp,. Campylobacter jejuni, Vibrionaceae, Xylella fastidiosa, Sulfolobus solfataricus, Saccharomyces cerevisiae, Aspergillus terreus, Schizosaccharomyces pombe, Listeria innocua, Listeria monocytogenesomissonomesomorida meoridaeomorida meorida meloha

According to one aspect of the invention, the lipid acyltransferase enzyme of the present invention is preferably obtained from one or more Aeromonas hydrophila or Aeromonas salmonicida organisms.

The lipid acyltransferase enzyme of the present invention contains one or more of the following amino acid sequences:

(i) the amino acid sequence represented by SEQ ID NO: 2 (see figure 2);

(ii) the amino acid sequence represented by SEQ ID NO: 3 (see figure 3);

(iii) the amino acid sequence represented by SEQ ID NO: 4 (see figure 4);

(iv) the amino acid sequence represented by SEQ ID NO: 5 (see figure 5);

(v) the amino acid sequence represented by SEQ ID NO: 6 (see figure 6);

(vi) the amino acid sequence represented by SEQ ID NO: 12 (see figure 14);

(vii) the amino acid sequence represented by SEQ ID NO: 20 (see figure 16);

(viii) the amino acid sequence represented by SEQ ID NO: 22 (see figure 18);

(ix) the amino acid sequence represented by SEQ ID NO: 24 (see figure 20);

(x) the amino acid sequence represented by SEQ ID NO: 26 (see figure 22);

(xi) the amino acid sequence represented by SEQ ID NO: 28 (see figure 24);

(xii) the amino acid sequence represented by SEQ ID NO: 30 (see figure 26);

(xiii) the amino acid sequence represented by SEQ ID NO: 32 (see figure 28);

(xiv) the amino acid sequence represented by SEQ ID NO: 34 (see figure 30) or

an amino acid sequence that is 75% or more identical to one of the sequences represented by SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 12 , SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32 or SEQ ID NO: 34.

The lipid acyltransferase enzyme of the present invention contains the amino acid sequence represented by SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 32 or SEQ ID NO: 34, or an amino acid sequence that is 75% or more, preferably 80% or more, preferably 85% or more, preferably 90% or more, preferably 95% or more identical to the amino acid sequence represented by SEQ ID NO: 2, the amino acid sequence represented by SEQ ID NO: 3, the amino acid sequence represented by SEQ ID NO : 32, or aminoki the slot sequence represented by SEQ ID NO: 34.

In accordance with the objectives of the present invention, the degree of identity is based on the number of identical elements of the sequence. The degree of identity of the present invention can be determined using computer programs known in the art, such as the GAP included in the GCG software package (Program Manual for the Wisconsin Package, Version 8, August 1994, Genetics Computer Group, 575 Science Drive, Madison, Wisconsin, US53711) (Needleman & Wunsch (1970), J. of Molecular Biology 48, 443-45) using the following settings for comparing polypeptide sequences: penalty points for creating a gap are 3.0 and penalty points for lengthening a gap are 0.1.

The lipid acyltransferase enzyme of the present invention contains an amino acid sequence that is 80% or more, preferably 85% or more, more preferably 90% or more, even more preferably 95% or more identical to one of the sequences represented by SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 12, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32 or SEQ ID NO: 34.

The lipid acyltransferase enzyme of the present invention contains one or more of the following amino acid sequences:

(a) the amino acid sequence represented by amino acid residues 1-100 of SEQ ID NO: 2 or SEQ ID NO: 32;

(b) the amino acid sequence represented by amino acid residues 101-200 of SEQ ID NO: 2 or SEQ ID NO: 32;

(c) the amino acid sequence represented by amino acid residues 201-300 of SEQ ID NO: 2 or SEQ ID NO: 32;

(d) an amino acid sequence that is 75% or more, preferably 85% or more, more preferably 90% or more, even more preferably 95% or more identical to one of the amino acid sequences set forth in paragraphs (a) to ( from).

The lipid acyltransferase enzyme of the present invention contains one or more of the following amino acid sequences:

(a) the amino acid sequence represented by amino acid residues 28-39 of SEQ ID NO: 2 or SEQ ID NO: 32;

(b) the amino acid sequence represented by amino acid residues 77-88 of SEQ ID NO: 2 or SEQ ID NO: 32;

(c) the amino acid sequence represented by amino acid residues 126-136 of SEQ ID NO: 2 or SEQ ID NO: 32;

(d) the amino acid sequence represented by amino acid residues 163-175 of SEQ ID NO: 2 or SEQ ID NO: 32;

(e) the amino acid sequence represented by amino acid residues 304-311 of SEQ ID NO: 2 or SEQ ID NO: 32;

(f) an amino acid sequence that is 75% or more, preferably 85% or more, more preferably 90% or more, even more preferably 95% or more, is identical to one of the amino acid sequences set forth in paragraphs (a) to ( e).

The lipid acyltransferase enzyme of the present invention may contain an amino acid sequence obtained by expression of one or more of the following nucleotide sequences:

(a) the nucleotide sequence represented by SEQ ID NO: 7 (see figure 9);

(b) the nucleotide sequence represented by SEQ ID NO: 8 (see figure 10);

(c) the nucleotide sequence represented by SEQ ID NO: 9 (see figure 11);

(d) the nucleotide sequence represented by SEQ ID NO: 10 (see figure 12);

(e) the nucleotide sequence represented by SEQ ID NO: 11 (see figure 13);

(f) the nucleotide sequence represented by SEQ ID NO: 13 (see figure 15);

(g) the nucleotide sequence represented by SEQ ID NO: 21 (see figure 17);

(h) the nucleotide sequence represented by SEQ ID NO: 23 (see figure 19);

(i) the nucleotide sequence represented by SEQ ID NO: 25 (see figure 21);

(j) the nucleotide sequence represented by SEQ ID NO: 27 (see figure 23);

(k) the nucleotide sequence represented by SEQ ID NO: 29 (see figure 25);

(l) the nucleotide sequence represented by SEQ ID NO: 31 (see figure 27);

(m) the nucleotide sequence represented by SEQ ID NO: 33 (see figure 29);

(n) the nucleotide sequence represented by SEQ ID NO: 35 (see figure 31);

(o) or a nucleotide sequence that is 75% or more identical to one of the sequences represented by SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33 or SEQ ID NO : 35.

The nucleotide sequence may be 80% or more, preferably 85% or more, more preferably 90% or more, and even more preferably 95% or more identical to one of the sequences represented by SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO : 29, SEQ ID NO: 31, SEQ ID NO: 33 or SEQ ID NO: 35.

In accordance with one aspect of the invention, the lipid acyltransferase of the present invention may be lecithin: cholesterol acyltransferases (LCAT) or variants thereof (for example, a variant resulting from molecular evolution).

Suitable LCATs are known in the art and can be obtained from one or more of the following organisms, such as mammals, rats, mice, chickens, Drosophila melanogaster , plants including Arabidopsis and Oryza sativa , nematodes, fungi and yeast.

In one embodiment, the lipid acyltransferase enzyme of the present invention may be a lipid acyltransferase derived from E. coli TOP 10 strains including pPet12aAhydro and pPet12aASalmo that were deposited by Danisko A / S, Langebrogade 1, DK-1001, Copenhagen K, Denmark according to the Budapest agreement on the international recognition of the deposit of microorganisms in accordance with the procedure for granting patents to the National collection of industrial, marine and food bacteria (NCIMB) at 23 St. Machar Street, Aberdeen Scotland, GB, December 22, 2003, respectively, with access numbers NICMB 41204 and NCIMB 41205.

The term “transferase” as used herein is used interchangeably with the term “lipid acyltransferase”.

The lipid acyltransferase described herein catalyzes one or both of the following reactions: transesterification and alcoholysis.

Thus, in accordance with the present invention, one or more of the following advantages can be achieved: lipid bioconversion with the formation of one or more carbohydrate esters, protein esters, protein subunit esters or hydroxy acid esters can occur in a high water medium that does not contain an organic solvent or contains a smaller amount of an organic solvent compared to known bioconversion processes.

The term “bioconversion” as used herein means the modification of one organic compound to form another organic compound and / or synthesis of organic compounds from other organic compounds by enzymatic catalysis.

The term “transesterification” as used herein means enzyme-catalyzed transfer of an acyl group from a lipid donor (not a free fatty acid) to an acyl acceptor (not a water). To avoid misinterpretation, it should be noted that the term “transesterification” as used here means the transfer of an acyl group from a lipid donor to an acceptor of an acyl group (not being water) containing an acceptable chemical group, which may be, for example, —OH or —SH .

As used herein, the term “alcoholysis” means the enzymatic cleavage of a covalent bond of an acid derivative as a result of interaction with an alcohol group of ROH, whereby one product binds to an atom H of the alcohol group and another product binds to the alcohol group OR.

As used herein, the term “hydrolysis” means enzyme-catalyzed transfer of an acyl group from a lipid to an OH group of a water molecule. Acyl group transfer resulting from hydrolysis requires the separation of a water molecule.

The term “mutual transesterification” means an enzyme-catalyzed transfer of acyl groups between a lipid donor and a lipid acceptor, in which the lipid donor is not a free acyl group. In other words, “mutual transesterification” means the interchange of a fatty acid between two lipid molecules.

In accordance with one aspect of the invention, the lipid acyltransferase provided herein catalyzes mutual transesterification.

The method or application of the present invention may further include one or more of the following steps: dissolving the acyl acceptor in water; adding a lipid acyl donor to the dissolved acyl acceptor to form a biphasic system or emulsion; mixing or sonication of the reaction mixture; heating the reaction mixture, for example, to denature the enzyme; separating the aqueous phase from the fat / emulsifier phase by standard separation methods, such as, for example, solvent extraction or evaporation of water; fractionation of the fatty phase by hydrophobic interaction chromatography, crystallization or distillation in high vacuum. One or more stages of heating, separation or fractionation can be performed after equilibration of the reaction mixture.

In one embodiment, a lipase acyltransferase for use in the methods of the present invention can be immobilized. In the case of enzyme immobilization, a mixture containing an acyl donor, an acyl acceptor and water is passed through a column filled with, for example, an immobilized enzyme. By immobilizing the enzyme, it can be easily reused.

The immobilized enzyme can be used in a flow reactor or a batch reactor, in which there is a reaction mixture containing an acyl acceptor dissolved in water and acyl group lipid donor in the form of a two-phase system or emulsion. The reaction mixture may optionally be mixed or sonicated. After reaching the equilibrium state of the reaction, it is possible to separate the reaction mixture and the immobilized enzyme. The reaction product can be fractionated, for example, by hydrophobic interaction chromatography, crystallization or distillation in high vacuum.

Immobilized lipid acyltransferase can be obtained by immobilization methods known in the art. There are many methods for producing immobilized enzymes that should be known to a person skilled in the art (for example, the methods described in European Patent No. 0746608 or in the publications Balcao VM, Paiva AL, Malcata FX, Enzyme Microb Technol. 1996 May 1; 18 (6) : 392-416; or Retz MT, Jaeger KE Chem Phys Lipids. 1998 Jun; 93 (l-2): 3-14; Bornscheuer UT, Bessler C, Srinivas R, Krishna SH Trends Biotechnol. 2002 Oct; 20 (10) : 433-7; Plou et al, J. Biotechnology 92 (2002) 55-66; Warmuth et al., 1992. Bio Forum 9,282-283; Ferrer et al., 2000. J. Chem. Technol. Biotechnol. 75, 1-8; or Christensen et al., 1998. Nachwachsende Rohstoff 10, 98-105; Petersen and Christenen, 2000, Applied Biocatalysis. Harwood Academic Publishers, Amsterdam (which are incorporated herein and finding as a reference). Techniques which may be employed in the practice of this invention include, for example, covalent binding eupergitom C, adsorption on polypropylene and silica-granulation.

The term “high water medium” as used herein preferably means a medium with a low content or complete absence of an organic solvent, preferably a low content or complete absence of a polar organic solvent. The definition of “organic solvent” as used herein preferably does not include edible oils used as a lipid substrate, and preferably edible oils with a high non-polar lipid content are not included. The high water medium of the present invention may include less than 50 vol.% Organic solvents, less than 30 vol.% Organic solvents, more preferably less than 15 vol.% Organic solvents, more preferably less than 5 vol.%, More preferably less than 1 vol. %, more preferably less than 0.5 vol.% organic solvent, more preferably 0 vol.% organic solvents.

In the case of producing the carbohydrate ester of the present invention, the carbohydrate ester is preferably an oligosaccharide ester, a monosaccharide ester or a disaccharide ester.

The carbohydrate ester obtained by the present invention can be one or more of the following esters: glucose ester, fructose ester, anhydrofructose ester, maltose ester, lactose ester, galactose ester, xylose ester, xyloligosaccharide ester , arabinose ester, maltooligosaccharide ester, tagatose ester, sucrose ester, microtetcin ester, ascopyron P ester, ascopyrone T ester or cortal ester Yoron.

The carbohydrate ester obtained by the present invention is preferably one or more of the following esters: carbohydrate monoester, sugar monoester, oligosaccharide monoester, trisaccharide monoester, disaccharide monoester, monosaccharide monoester, monosaccharide monoester, , anhydrofructose monoester, maltose monoester, lactose monoester, galactose monoester, xylose monoester, xyloo monoester igosaharida, monoester arabinose, maltooligosaccharides monoester, the monoester tagatose, sucrose monoester, ester mikrotetsina ester askopirona P, T askopirona ester or ester kortaltserona.

In one embodiment of the invention, the microtectin ester, the ascopyron ester P, the ascopyrone ester T and / or the cortalcerone ester may be an antimicrobial agent. Alternatively or in addition to the foregoing, the microtecin ester, the ascospiron ester P, the ascospiron ester T and / or the cortalcerone ester may be an antioxidant and / or emulsifier, or both.

The carbohydrate ester formation of the present invention is preferably independent of UDP glucose.

The food product of the present invention preferably does not contain UDP-glucose or contains minor amounts of UDP-glucose.

It has been found that lipid acyltransferases used in the compositions and methods of this invention have unique properties compared to lipolytic enzymes, which are expressed in that they preferably transfer acyl groups from lipids to non-water acceptors, even in the presence of a significant amount of water. Compared to previously known enzymes, the lipid acyltransferase used in this invention has a high relative transferase activity in the presence of 6% water, 54% water, 73% water, 89% water and about 95% water. The lipolytic enzymes studied did not actually have significant relative transferase activity at the indicated water concentrations.

The percentage value of the transferase activity (i.e., the transferase activity as a percentage of the total enzymatic activity) can be determined by the following method:

Method for determining the percentage of acyltransferase activity

The substrate to which the lipid acyltransferase of the present invention is added can be extracted after performing an enzymatic reaction using CHCl ₃ : CH ₃ OH (2: 1), while the organic phase containing the lipid is separated and analyzed by GLC and HPLC by the method described in detail below. As a result of GLC and HPLC, the amount of free fatty acids and one or more carbohydrate esters, protein esters, protein subunit esters and hydroxy acid esters are determined. In a similar manner, a control substrate was analyzed in which the enzyme of the present invention was not added.

Calculations:

Based on the results of GLC and HPLC analyzes, it is possible to calculate an increase in free fatty acids and carbohydrate esters, protein esters, protein subunit esters and / or hydroxy acid esters:

Δ% fatty acid =% fatty acid (enzyme) -% fatty acid (control); Mv fatty acid = average molecular weight of fatty acids;

A = Δ% protein ester / Mv protein ester (where Δ% protein ester =% protein ester (enzyme) -% protein ester (control) and protein Mv ester = average molecular weight of protein esters) - used in cases where the acceptor of the acyl group is a protein;

B = Δ% carbohydrate ester / Mv carbohydrate ester (where Δ% carbohydrate ester =% carbohydrate ester (enzyme) -% carbohydrate ester (control) and Mv carbohydrate ester = average molecular weight of carbohydrate ester) - used when the acceptor of the acyl group is a carbohydrate;

C = Δ% protein subunit ester / Mv protein subunit ester (where Δ% protein subunit ester =% protein subunit ester (enzyme) -% protein subunit ester (control) and protein subunit Mv Mv = molecular weight average mass of the ester of the protein subunit) - is used when the protein subunit is the acceptor of the acyl group; and

D = Δ% hydroxy acid ester / Mv hydroxy acid ester (where Δ% hydroxy acid ester =% hydroxy acid ester (enzyme) -% hydroxy acid ester (control sample) and Mv hydroxy acid ester = average molecular weight of hydroxy acid ester) used when the acyl acceptor is a hydroxy acid.

The transferase activity is calculated as a percentage of the total enzymatic activity:

* - delete if necessary

The lipase and acyltransferase activity of the enzyme can be calculated by performing the following assays. Thus, it is possible to obtain / identify a lipid acyltransferase having the characteristics of the enzyme described in this description of the invention.

Analysis of transferase in a buffered substrate (see example 6)

Enzymes intended for use as lipid acyltransferases in the compositions and methods of this invention can be identified by performing the assay described in Example 6. This assay is hereinafter referred to as “Transferase Assay in a Buffered Substrate”. In Example 6, the lipid acyltransferase enzyme isolated from the Aeromonas salmonicida of the present invention was analyzed and compared with a number of lipolytic enzymes not included in the scope of the present invention. It was found that only lipolytic enzymes LIPOPAN® F (Novozymes, Denmark) have transferase activity and only at a very low level (1.3%).

Enzymes suitable for use in the compositions and methods of this invention can be identified by performing a transferase assay in a buffered substrate. When performing this analysis in an environment with a very high water content of about 95%, the lipid acyltransferases of the present invention are enzymes having at least 2% acyltransferase activity (relative transferase activity), preferably at least 5% relative transferase activity, preferably at at least 10% relative transferase activity, preferably at least 15%, 20%, 25%, 26%, 28%, 30%, 40%, 50%, 60% or 75% relative transferase activity. The lipid acyltransferase of the present invention may have less than 28%, less than 30%, preferably less than 40%, 50%, 60%, 70%, 80%, 90% or 100% acyltransferase activity.

Analysis of transferase in a low water environment

Alternatively (or additionally) to the “Assay of transferase in a buffered substrate” lipid acyltransferases suitable for use in the present invention can be identified by “Assay of transferase in a low water environment”.

To determine whether the enzyme is a lipid acyltransferase according to the present invention, it is possible to perform “Transferase assay in a medium with a low water content”, namely in an oil medium with 6% water, as described in Example 9. This example illustrates that the lipid acyltransferase according to this invention has a high relative transferase activity in an oil medium containing 6% water, in which known lipolytic enzymes exhibit hydrolytic activity.

In one embodiment, a lipid acyltransferase suitable for use in the methods and / or applications of the present invention is an enzyme that, when tested with a “Low Water Content Transferase Assay” performed after 30, 20 or 120 minutes, has a relative transferase activity of at least 1%, preferably at least 2%, preferably at least 5%, preferably at least 10%, preferably at least 20%, preferably at least about 30%, preferably at least 40%, preferably at least 50%, preferably at least 60%, preferably at least 70%, preferably at least 75%. The lipid acyltransferase of the present invention may have less than 30%, 40%, 50%, 60%, 70%, or 80% activity when measured after 10, 20, 30, or 120 minutes using the Transferase Assay in a Low Water Medium Method.

As indicated above, the lipase acyltransferase according to this invention can be identified by the method “Analysis of transferase in a buffered substrate” or “Analysis of transferase in a medium with a low water content” using cholesterol as an acyl acceptor. The person skilled in the art will appreciate the changes that need to be made to the analytical methods “Transferase Analysis in Buffered Substrate” or “Transferase Analysis in a Low Water Medium” to determine the activity of lipid acyltransferase in relation to any lipid donor of the acyl group or any combination of acyl acceptors . If necessary, a qualified person can simply replace the substrate of the acyl group donor (e.g., phospholipid) with an alternative substrate of the acyl group donor (e.g., glycolipid, triacylglyceride) and / or replace the acyl group acceptor (e.g., cholesterol) with an alternative substrate of the acyl group acceptor (e.g., carbohydrate, protein, protein subunit or hydroxyacid) (see, for example, examples 10-13).

The term “high water medium” as used herein means any medium containing 5-98% water. The specified medium preferably contains more than 6% water, preferably more than 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90%. A medium with a high water content may contain 20-98%, in particular 50-98%, in particular 70-98%, in particular 75-98% water.

In one embodiment of the invention in said mixture, the ratio of the amount of added lipid acyltransferase to water is at least 1: 700, preferably 1: 10000 when measured on a weight basis.

The term “low water content” as used herein means any substrate or food product containing less than 5% water, preferably less than 4%, 3%, 2%, 1% or 0.5%.

The method and / or use of the present invention can preferably be carried out at a temperature of 15-60 ° C, preferably at a temperature of 20-60 ° C, preferably at 20-50 ° C, preferably at 20-45 ° C, preferably at 20-40 ° FROM.

The method or application of the present invention includes a further step of purifying and / or isolating the reaction product, namely one or more carbohydrate esters, protein esters, protein subunit esters or hydroxy acid esters. Thus, the reaction product is preferably obtained in purified and / or isolated form.

The skilled artisan knows many methods for purifying esters. As an example, it can be noted that esters obtained by the methods of the present invention can be purified by chromatography, such as hydrophobic interaction chromatography, filtration, centrifugation, solvent extraction / distillation or crystallization. Acceptable methods are discussed in Ulmann's Encyclopedia of Industrial Chemistry (2002) by Wiley-VCH Verlag GmbH & Co.KgaA.

The lipid acyltransferase of this invention can be expressed in any suitable expression host. For example, the lipid acyltransferase of this invention can be expressed in Bacillus subtilis and can be purified by ultrafiltration, ethanol precipitation and / or centrifugation, and then can be spray dried using starch (maltodextrin) as an enzyme carrier. The spray dried enzyme can be standardized according to precisely defined PLU activity by adding an additional amount of carrier in powder form. The methods used are well established and are generally accepted practice in this area.

In one embodiment, the method of the present invention is an in vitro method. The specified method may be respectively a continuous or batch process.

The enzyme of the present invention can be used in combination with one or more other enzymes. So, in the scope of the present invention in addition to the enzyme of this invention includes a mixture in contact with at least one other enzyme. Such additional enzymes include amylolytic enzymes, in particular endo- or oxoamylases, pullulanases, branching enzymes, hemicellulases, including xylanases, cellulases, oxidoreductases, for example, glucose oxidase or carbohydrate oxidase, capable of oxidizing maltose, for example, hexose oxidase, HCl. The mixture may be contacted with the enzyme of this invention and at least one additional enzyme simultaneously or sequentially.

In one embodiment, lipid acyltransferase can be used in combination with a lipase having one or more of the following lipase activities: glycolipase activity (E.C. 3.1.1.26), triacylglycerolipase (E.C. 3.1.1.3), phospholipase A2 (E. C. 3.1.1.4) or phospholipase A1 (E.C. 3.1.1.32). Suitable lipase enzymes are well known in the art and include the following lipases exemplified: LIPOPAN® F and / or LECITASE® ULTRA (Novozymes A / S, Denmark), phospholipase A2 (e.g., phospholipase A2 from LIPOMOD ™, 22L from Biocatalysts, LIPOMAX ™ from Genecor), LIPOLASE® (Novozymes A / S, Denmark), the lipases described in WO 03/97835, European Patent No. 0977869 or European Patent No. 1193314.

Applications

Thus, as a result of the methods of the present invention, one or more carbohydrate esters, protein esters, protein subunit esters, hydroxy acid esters can be obtained. Many of these esters are useful emulsifiers. As an example, it may be noted that amino acid esters, peptide esters, protein esters, carbohydrate esters and hydroxy acid esters (such as tartaric acid esters) are functionally important emulsifiers. Emulsifiers are used in a number of industries, such as the food industry, the feed industry, the cosmetics industry (for example, the basis for cosmetics), the pharmaceutical industry (for example, the synthesis and preparation of medicines) and the paint and varnish industry. Emulsifiers may be wetting agents, food ingredients, and active ingredients.

In addition, protein fatty acid condensates due to their inherent excellent physiological properties can be used, for example, in cosmetics and personal care products. For example, protein esters can be used in shower and bath products, as well as in shampoos and body cleansers. Protein fatty acid condensates can also be used in pharmaceutical compositions, for example, as a base.

Protein fatty acid condensates are widely used in the cosmetic industry. These products are usually obtained by reacting a protein hydrolyzate with a fatty acid chloride under the conditions of the Scott-Baumann reaction using water as a solvent.

( _{_} e / rawmaterials26 _{_} e _{_} .htm # 5).

In the process of obtaining protein fatty acid condensates, renewable resources of fatty acids (from vegetable oil) and protein, which can be obtained from animal waste products (skin) and many plants, can be combined to create a structure of a surfactant with hydrophobic (fatty acid) and hydrophilic (protein) part. In this process, a fatty acid chlorine anhydride is reacted with an amino group of an amino acid to form a protein fatty acid condensate (see FIG. 49). This gives products that are characterized by excellent compatibility with the skin and, in addition, have a good cleansing effect.

The fact that even small additives of the acylated protein hydrolyzate have a synergistic effect on the compatibility with the skin of other surfactants is very important from a technical point of view of obtaining the product. The indicated protective effect can be explained by the amphoteric nature of the product. An interaction occurs between the protein fatty acid condensate and the skin collagen. Due to this interaction, a protective layer is formed, which reduces the excessive effect of surfactants on the upper layers of the skin, weakens their strong degreasing effect and the direct interaction of anionic surfactants with the skin.

In the cosmetic industry, protein-based surfactants are mainly used in soft and gentle shower and bath products, soft shampoos, surfactants based face cleansers, hair styling and fixing products, or surfactant-based products -active substances for babies.

Protein hydrolyzate fatty acid condensates can also be used as bases for pharmaceutical preparations, for example, creams and ointments containing the active ingredients for topical application to the skin.

The present invention relates to a new method for producing a protein fatty acid condensate without using a fatty acid chloride. The reaction of the present invention is shown in FIG. 50. This reaction can be performed in an aqueous or buffer system at a low temperature without generating production waste.

The term “protein fatty acid condensate” as used herein means all of the following protein esters, polypeptide esters, dipeptide esters, oligopeptide esters, peptide esters and amino acid esters.

A qualified person should be aware that carbohydrate esters (in particular sugar esters) are widely used in the food industry. Other applications for these products are cosmetics, oral care products, and medications. In addition, these compounds can be used as antibiotics, antitumor agents, fungicides and insecticides. The lipid acyltransferase of the present invention can catalyze the formation of a glucose ester in a high water medium (Figure 51).

The esters of the present invention find application in the following areas.

Cosmetics: basic oil emulsions (oil in water, HLB 16-18); paraffin emulsions in oil (oil in water, HLB 10-14); stearic acid emulsions; wax emulsions (oil in water, HLB 14-16); lanolin emulsions (oil in water, HLB 12-14); silicone emulsions; toothpastes (oil in water); bath foams (oil in water, HLB 14-18); lotions for hair.

Pharmaceuticals: drug emulsions; the basis for ointments; suppositories (water in oil); encapsulated drugs; injectable drugs.

Agriculture: preparations for soil improvement; as an additive to fertilizer; as general-purpose cleaning agents; cleansers for fruits and vegetables; cleansers for churns.

Harvest protection: natural insecticides; chlorinated carbohydrates and preparation 140; phosphoric acid esters (oil in water emulsion, HLB 10-14); fungicides (oil in water emulsion); herbicides (oil in water emulsion).

Food industry: bread and pastries; margarine; chocolate; a remedy for clouding of fat (emulsion of water in oil, HLB 5-10); sugar icing (oil in water emulsion, HLB 14-16); softeners for caramel and chewing gum (water in oil emulsion, HLB 2-4); anti-stick agents (water in oil emulsion, HLB 2-4); additives in ice cream (water in oil emulsion, HLB 4-6); wetting agents for powdered milk and baking powder (water in oil emulsion, HLB 9-11); custard concentrate (water in oil emulsion, HLB 2-4); fruit and vegetable drinks; flavors (water in oil emulsion and oil in water emulsion, HLB 10-12); seasonings for meat, salad or other flavoring seasonings (oil in water emulsion); food coloring (water in oil emulsion, HLB 2-4; oil in water emulsion, HLB 8-18); defoamers.

The advantage of using protein fatty acid ester esters, hydroxy acid esters and carbohydrate esters of the present invention as emulsifiers in the food industry is that these substances are harmless food-compatible components that are much more readily biodegradable than others commonly used emulsifiers, such as, for example, ethoxylated fatty acid esters. Thus, these emulsifiers are more environmentally friendly both in the food industry and in the non-food industry.

In one embodiment of the invention, the microtecin ester, the ascopyron ester P, the ascopyrone ester T and / or the cortalcerone ester can be used as an antimicrobial agent. Alternatively or in addition to the aforementioned use, the microtecin ester, the ascospiron ester P, the ascospiron ester T and / or the cortalcerone ester may be an antioxidant and / or emulsifier or both together.

In one embodiment of the invention, the methods or applications of the present invention can be used to obtain emulsifiers intended for the preparation of drugs, in particular for the preparation of controlled release active ingredients in which the active ingredient is acylated by lipid acyltransferase. Such sustained release formulations are particularly suitable for pharmaceutical compositions for oral administration because the gradual hydrolysis of the ester in the digestive tract provides for the gradual delivery of the active ingredient. Such acylated compositions can further be used to prepare formulations intended for subcutaneous or intravenous administration.

In another embodiment, the methods or applications of the present invention can be used to produce interfacial catalysts for transferring salts to a solution of organic solvents, for example, in an organic reaction process. For example, transferring an acyl group to an appropriate cationic acceptor, such as hydroxyacid (citric acid), or alternatively to an anionic acceptor, such as hydroxyamines, provides interfacial catalysts for transferring salts to an organic solvent solution.

In another embodiment, the methods of the present invention can be used to produce ester prodrugs of pharmaceutical compounds with low bioavailability and / or poor solubility, for example, antiviral agents such as acyclovir and gangacyclovir. The specified method can be further used to obtain other medicinal compounds with a free hydroxyl group, for example with a primary, secondary or tertiary hydroxyl group.

The ester obtained by the present invention is preferably used in a pharmaceutical preparation.

The ester obtained according to the present invention is preferably used in cosmetics and / or personal care products.

The ester obtained by the present invention is preferably used in food and / or feed products.

The method of the present invention may be one step in the process of obtaining one or more pharmaceuticals, cosmetics, personal care products, food or feed products.

Benefits

One advantage of the method of the present invention is that it allows one or more carbohydrate esters, protein esters, protein subunit esters or hydroxy acid esters to be prepared without the need for organic solvents. Thus, the present invention reduces or eliminates the use of organic solvents. The consequence of this is many advantages, expressed, for example, in reducing production costs, reducing the effects of organic solvents on humans and / or the environment, and simplifying the production process.

In the production of esters for the food industry, the use of lipids instead of fatty acids is particularly effective, since in this case it is not necessary to remove excess lipids, since they can form part of the food product in which the above reaction product is used. On the other hand, excess free fatty acids must be removed, as they are harmful to most foods.

Highlighted product

In accordance with one aspect of the invention, the polypeptide or protein intended for use in the present invention is preferably an isolated product. The term “isolated” means that the sequence essentially does not contain any other component with which the sequence is naturally associated in nature and is found in nature.

According to one aspect of the invention, the bioconversion product of the present invention, for example, a carbohydrate ester, a protein ester, a protein subunit ester and / or a hydroxy acid ester, is isolated from the reaction mixture. The term “isolated” means that the bioconversion product essentially does not contain any other component with which the product is associated in the course of the bioconversion reaction.

Purified product

In accordance with one aspect of the invention, the polypeptide or protein intended for use in the present invention is preferably a purified product. The term “purified” means that the sequence is in a relatively pure state, for example, is at least about 51% pure, at least about 75% pure, at least about 80% pure, at least about 90% pure, at least about 95% or at least about 98%.

According to one aspect of the invention, the bioconversion product obtained according to the present invention, for example, carbohydrate ester, protein ester, protein subunit ester and / or hydroxy acid ester, is preferably purified from the reaction mixture and therefore is pure. The term “purified” means that the bioconversion product is in a relatively pure state, for example, is at least about 51% pure, at least about 75% pure, at least about 80% pure, at least about 90% pure at least about 95% or at least about 98%.

Pharmaceutical Compositions

The present invention also relates to a pharmaceutical composition comprising a product of the present invention and a pharmaceutically acceptable carrier, diluent or excipient (including combinations thereof).

The pharmaceutical compositions may be intended for administration to a human or animal in medicine or veterinary medicine and typically contain one or more pharmaceutically acceptable diluents, carriers or excipients. Acceptable carriers or diluents for therapeutic use are well known in the pharmaceutical field and are described, for example, in Remington's Pharmaceutical Sciences, Mack Publishing Co. (A.R. Gennaro edit. 1985). A pharmaceutical carrier, excipient or diluent may be selected depending on the intended route of administration and normal pharmaceutical practice. The pharmaceutical compositions may contain, as a carrier, excipient or diluent, or in addition to any suitable binders, lubricants, suspending agents, coating agents, solubilizing agents.

Preservatives, stabilizers, colorants and even flavoring agents may be present in the pharmaceutical composition. Examples of preservatives include sodium benzoate, sorbic acid, and p-hydroxyoxybenzoic acid esters. Antioxidants and suspending agents may also be used.

The composition / preparation may have different requirements depending on different delivery systems. As an example, it can be noted that the pharmaceutical composition of the present invention can be intended for administration by mini-pump or through the mucous membrane, for example, in the form of a solution sprayed into the nose, inhalation aerosol, oral solution or for parenteral administration, in accordance with which the composition is an injectable preparation intended for intravenous, intramuscular or subcutaneous delivery. Alternatively, the preparation may be intended for administration in several ways.

A drug intended for administration through the mucous membrane of the gastrointestinal tract must remain stable when moving along the gastrointestinal tract; for example, it must be resistant to proteolytic degradation, acid pH and the detergent action of bile.

The pharmaceutical compositions can be administered by inhalation, in the form of anal or vaginal suppositories, topically in the form of a lotion, solution, cream, ointment or fine powder, with a skin patch, orally in the form of tablets containing excipients such as starch or lactose, capsules or balls alone or in a mixture with excipients, in the form of elixirs, solutions or suspensions containing flavorings or colorings, or as parenteral injections, such as intravenous, intramuscular or subcutaneous injections. Compositions for parenteral administration can be used in the form of a sterile aqueous solution, which may contain other substances, for example salts or monosaccharides, which make the solution isotonic with respect to blood. The composition for buccal or sublingual administration may be administered in the form of tablets or lozenges, which can be prepared by known methods.

Cloning a nucleotide sequence encoding a polypeptide of the present invention

The nucleotide sequence encoding a polypeptide having the specific properties presented in this description of the invention, or a polypeptide suitable for modification, can be isolated from any cell or organism producing the specified polypeptide. Various methods for isolating nucleotide sequences are well known in the art.

For example, a library of genomic DNA and / or cDNA can be created using chromosomal DNA or messenger RNA from an organism producing the given polypeptide. If the amino acid sequence of the polypeptide is known, labeled oligonucleotide probes can be synthesized and used to identify polypeptide-coding clones from a genomic library obtained from a given organism. Alternatively, a labeled oligonucleotide probe containing sequences homologous to another known polypeptide gene can be used to identify polypeptide-encoding clones. In the latter case, less stringent hybridization and washing conditions are used.

Alternatively, polypeptide-encoding clones can be identified by inserting genomic DNA fragments into an expression vector, such as a plasmid transforming enzyme-negative bacteria using the resulting genomic DNA library, and then culturing the transformed bacteria on agar containing an enzyme inhibited by the polypeptide, so that clones expressing this polypeptide can be identified polypeptide.

According to another alternative, the nucleotide sequence encoding the polypeptide can be synthesized by known standard methods, for example, the phosphoramidite-based method described in Beucage S.L. et al (1981) Tetrahedron Letters 22, pp. 1859-1869, or by the method described in Matthes et al (1984) EMBO J. 3, pp. 801-805. When using the phosphoramidite-based method, oligonucleotides are synthesized in an automatic DNA synthesizer, purified, annealed, ligated and cloned in the corresponding vectors.

The nucleotide sequence can be of mixed genomic and synthetic origin, mixed synthetic and cDNA origin, or mixed genomic and cDNA origin and can be obtained by ligation of fragments of synthetic, genomic or cDNA origin (as required) by standard methods. Each ligated fragment corresponds to different parts of the entire nucleotide sequence. The DNA sequence can also be obtained using the polymerase chain synthesis reaction (PCR), using specific seeds, for example, described in US patent No. 4683202 or in the publication Saiki R.K. et al. (Science (1988) 239, pp. 487-491).

Nucleotide sequences

The present invention also relates to nucleotide sequences encoding polypeptides having the specific properties described herein. The term "nucleotide sequence" as used here means an oligonucleotide sequence or polynucleotide sequence, as well as its variants, homologues, fragments and their derivatives (in particular, parts thereof). The nucleotide sequence may be genomic, synthetic or recombinant, double-stranded or single-stranded, representing a sense or antisense strand.

The term “nucleotide sequence” as used in the present invention means genomic DNA, cDNA, synthetic DNA and RNA. The nucleotide sequence preferably means DNA, more preferably cDNA, for the coding sequence.

In a preferred embodiment, the definition of a nucleotide sequence per se encoding a polypeptide having the specific properties described herein does not include a native nucleotide sequence in a natural environment in which it is naturally linked to other sequences present in its natural environment. For ease of understanding, this preferred embodiment will be referred to as a “non-native nucleotide sequence”. In this regard, the term “native nucleotide sequence” means the entire nucleotide sequence in its natural environment, and the whole promoter with which this sequence is functionally linked enters the natural environment. Thus, the polypeptide of the present invention can be expressed by a nucleotide sequence in a natural organism, where the nucleotide sequence is not under the control of the promoter with which it is naturally associated in this organism.

The specified polypeptide is preferably not a native polypeptide. In this regard, the term “native polypeptide” means the entire polypeptide located in its natural environment and expressed by the native nucleotide sequence.

The nucleotide sequence encoding the polypeptides having the specific properties described herein is usually obtained by recombinant DNA methods (i.e., using recombinant DNA). However, in an alternative embodiment, the nucleotide sequence can be fully or partially synthesized by chemical methods well known in the art (see Caruthers MH et al (1980) Nuc Acids Res Symp Ser 215-23 and Horn T. et al (1980) Nuc Acids Res Symp Ser 225-232).

Molecular evolution

After isolation of the nucleotide sequence encoding the enzyme or identification of the putative nucleotide sequence encoding the enzyme, it may be desirable to modify the selected nucleotide sequence, for example, it may be desirable to mutate the sequence to obtain the enzyme of the present invention.

Mutations can be introduced using synthetic oligonucleotides. These oligonucleotides contain nucleotide sequences flanking the desired mutation sites.

A suitable method is described in Morinaga et al. (Biotechnology (1984) 2, pp. 646-649). Another method for introducing mutations into enzyme coding nucleotide sequences is described in Nelson and Long (Analytical Biochemistry (1989), 180, pp. 147-151).

Instead of site-directed mutagenesis similar to that described above, nonspecific mutation can be performed using a commercial kit, in particular Stratagene's PCR GeneMorph mutagenesis kit or Clontech's PCR Diversify mutagenesis kit. European Patent No. 0583265 describes methods for optimizing PCR-based mutagenesis, which can also be combined using mutagenic DNA analogues similar to those described in European Patent No. 0866796. Error-prone PCR-based methods are suitable for producing lipid acyltransferases with preferred characteristics. WO 0206457 discloses the molecular evolution of lipases.

A third method for generating new sequences is the fragmentation of non-identical nucleotide sequences using any number of restriction enzymes or an enzyme such as DNase I, and the reassembly of complete nucleotide sequences encoding functional proteins. Alternatively, one or more non-identical nucleotide sequences can be used and mutations introduced during reassembly of the complete nucleotide sequence. DNA or family rearrangement methods are suitable for preparing lipid acyltransferase variants with preferred characteristics. Acceptable methods for performing “permutation” are discussed in European patents Nos. 0752008, 1138763, 1103606. Permutation can be combined with other forms of DNA mutagenesis described in US Pat. No. 6,180,406 and WO 01/34835.

In this way, numerous site-directed or non-specific mutations can be introduced into the nucleotide sequence in vivo or in vitro and then screened in various ways to identify improved functional properties of the encoded polypeptide. Using methods of silicone and exo-mediated recombination (see application WO 00/58517, US patent No. 6344328, US patent No. 6361974), molecular evolution can be performed, as a result of which the resulting variant retains very weak homology with known enzymes or proteins. Such variants may be characterized by significant structural analogy with known transferase enzymes and may have very weak homology with the amino acid sequence.

In addition, mutations or natural variants of the polynucleotide sequence can be recombined with wild-type sequences, other mutations or natural variants in order to obtain new variants. Such new variants may also be screened to detect improved functional properties of the encoded polypeptide.

The use of the above and similar methods of molecular evolution allows the identification and selection of variants of the enzymes of the present invention that have preferred characteristics without any prior knowledge of the structure or function of the protein, and to obtain unpredictable, but useful mutations or variants. There are many examples in the art of using molecular evolution to optimize or alter enzyme activity, which include, but are not limited to, the following applications: optimized expression and / or activity in a host cell or in vitro , increased enzymatic activity, altered substrate and / or specificity product, increased or decreased enzymatic or structural stability, altered enzymatic activity / specificity in preferred environmental conditions, such as temperature cheers, pH, substrate.

As should be clear to a person skilled in the art, by means of molecular evolution, the enzyme can be changed to achieve the best functional properties of the enzyme.

The lipid acyltransferase of the present invention may be a variant, that is, it may contain at least one substitution, deletion or addition of an amino acid compared to the parent enzyme. Enzyme variants remain homologous to the original enzyme by at least 1%, 2%, 3%, 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90 %, 95%, 97%, 99%. Suitable starting enzymes may include any enzyme having esterase or lipase activity. The starting enzyme preferably corresponds to the agreed sequence pfam00657.

In a preferred embodiment, a variant of the lipid acyltransferase enzyme stores or comprises at least one or more amino acid residues of the coordinated sequence pfam00657 found in GDSX, GANDY and HPT blocks.

Enzymes, such as lipases, which do not have lipid acyltransferase activity or have a low activity of this enzyme in an aqueous medium, can be mutated by molecular evolution methods to communicate or enhance transferase activity, which allows one to obtain a lipid acyltransferase enzyme with significant transferase activity, which is suitable for use in compositions and methods of the present invention.

Lipid acyltransferase intended for use in this invention may be a variant with increased enzymatic activity against polar lipids, preferably phospholipids and / or glycolipids, compared to the starting enzyme. Such variants preferably have low activity or no activity against polar lysolipids. Increased activity against polar lipids, phospholipids and / or glycolipids may result from hydrolysis and / or transferase activity, or a combination thereof.

Variant lipid acyltransferases for use in the present invention may have reduced activity against triglycerides, monoglycerides and / or diglycerides compared to the parent enzyme.

A variant enzyme may not have activity against triglycerides, monoglycerides and / or diglycerides.

Alternatively, the variant enzyme for use in this invention may have increased activity against triglycerides and / or may also have increased activity against one or more of the following substances, such as polar lipids, phospholipids, lecithin, phosphatidylcholine, glycolipids, digalactosylmonoglyceride, monogaliceride .

Variants of lipid acyltransferases are known, and one or more of such variants may be suitable for use in the methods and applications of this invention. For example, lipid acyltransferase variants are described in the following references:

Hilton S, Buckley JT. Studies on the reaction mechanism of a microbial lipase / acyltransferase using chemical modification and site-directed mutagenesis J. Biol. Chem. 1991 Jan 15; 266 (2): 997-1000.

Robertson DL, Hilton S, Wong KR, Koepke A, Buckley JT. Influence of active site and tyrosine modification on the secretion and activity of the Aeromonas hydrophila lipase / acyltransferase. J Biol Chem. 1994 Jan 21; 269 (3): 2146-50.

Brumlik MJ, Buckley JT. Identification of the catalytic triad of the lipase / acyltransferase from Aeromonas hydrophila. J Bacteriol. 1996 Apr; 178 (7): 2060-4.

Peelman F, Vinaimont N, Verhee A, Vanloo B, Verschelde JL, Labeur C, Seguret-Mace S, Duverger N, Hutchinson G, Vandekerckhove J, Tavernier J, Rosseneu M. A proposed architecture for lecithin cholesterol acyl transferase (LCAT): identification of the catalytic triad and molecular modeling. Protein Sci. 1998 Mar; 7 (3): 587-99.

Amino Acid Sequences

The present invention also relates to amino acid sequences of polypeptides having the specific properties described herein.

As used herein, the term “amino acid sequence” is synonymous with the term “polypeptide” and / or the term “protein”. In some cases, the term “amino acid sequence” is synonymous with the term “peptide”.

Amino acid sequence can be obtained / isolated from an acceptable source, synthesized or obtained by recombinant DNA methods.

Amino acid sequences can be obtained by standard methods from the isolated polypeptides contemplated herein.

One acceptable method for determining amino acid sequences from isolated polypeptides is as follows.

The purified polypeptide is freeze-dried and 100 μg of the freeze-dried material is dissolved in 50 μl of a mixture of 8M urea and 0.4M ammonium bicarbonate, pH 8.4. The dissolved protein is denatured and reduced for 15 minutes at 50 ° C, then placed in a nitrogen atmosphere and 5 μl of 45 mM dithio-threitol are added. The mixture was cooled to room temperature and 5 μl of 100 mM iodoacetamide was added to replace cysteine residues for 15 minutes at room temperature in the dark under nitrogen atmosphere.

To the above reaction mixture, 135 μl of water and 5 μg of Lys-C endoproteinase are added to 5 μl of water, and the mixture is hydrolyzed at 37 ° C. under nitrogen for 24 hours.

The resulting peptides were separated by reverse phase HPLC on a VYDAC C18 column (0.46 x 15 cm; 10 μm; The Separation Group, California, USA) using solvent A: 0.1% TFA in water and solvent B: 0.1% TFA in acetonitrile. The selected peptides are rechromatographed on a Develosil C18 column using the same solvent system, and then the N-terminus is sequenced. Sequencing can be performed on an Applied Biosystems 476A sequencer using fast pulsed-labeled fluid cycles in accordance with the manufacturer's instructions (Applied Biosystems, California, USA).

Sequence identity or homology

The present invention also relates to the use of sequences with a certain degree of identity or homology to the amino acid sequences of a polypeptide having the specific properties described herein, or any nucleotide sequence encoding such a polypeptide (hereinafter referred to as “homologous sequence”). The term “homologue” as used herein means a structural unit having a defined homology with the amino acid sequences and nucleotide sequences that are the subject of this invention. The term “homology” may be similar to the term “identity”.

A homologous amino acid sequence and / or nucleotide sequence should represent and / or encode a polypeptide that retains functional activity and / or increases the activity of the enzyme.

In the context of the present invention, a homologous sequence means an amino acid sequence that may be at least 75%, 85% or 90% identical, preferably at least 95% or 98% identical to the sequence of the present invention. Homologs typically contain the same active sites, etc., as the amino acid sequence of this invention. Although homology can also be considered in terms of similarity (i.e., amino acid residues having similar chemical properties / functions), in the context of the present invention, homology is preferably expressed as sequence identity.

In the context of the present invention, a homologous sequence means a nucleotide sequence that may be at least 75%, 85% or 90% identical, preferably at least 95% or 98% identical to the nucleotide sequence encoding the polypeptide of the present invention (a sequence that is the subject of the invention). Homologs are usually sequences encoding the same active sites, etc., as the sequence that is the subject of the invention. Although homology can also be considered in terms of similarity (i.e., amino acid residues having similar chemical properties / functions), in the context of the present invention, homology is preferably expressed as sequence identity.

Homology can be compared approximately or, as a rule, using readily available sequence comparison programs. These commercially available computer programs can calculate% homology in two or more sequences.

The percentage value (%) of homology can be calculated for adjacent sequences, with one sequence being compared with another sequence and each amino acid in one sequence directly comparing residue by residue with the corresponding amino acid in another sequence. Such a comparison is called a “no space” comparison. Comparisons without spaces are usually performed only with respect to a relatively small number of residues.

Although this method is very simple and comparable, it does not take into account the fact that, for example, in an identical pair of sequences, one insertion or deletion can deduce the indicated amino acid residues from the comparison, resulting in a significant decrease in the percentage (%) of homology when performed global comparison. Therefore, most methods for comparing sequences are aimed at achieving an optimal comparison, which takes into account all possible insertions and deletions without unreasonable calculation of penalty points in determining the overall homology. This result is achieved by introducing “gaps” in the sequence being compared to achieve maximum local homology.

However, when performing these more complicated methods, “penalty points” are assigned for each gap found during the comparison, as a result of which, with the same number of identical amino acids, a sequence having as few spaces as possible reflecting a higher affinity between the two compared sequences gets a higher rating than a sequence having many spaces. Usually, “bound gap estimates” are used, based on which they assign relatively high points for the existence of a gap and lower penalty points for each subsequent remainder in this gap. This is the most widely used gap rating system. High penalty points for the gap, of course, allow you to get optimal comparisons with fewer spaces. Most comparison programs allow you to change the penalty points awarded for spaces. However, it is advisable to use the default values that exist in sequence comparison programs. For example, in the GCG Wisconsin Bestfit software package, the default penalty points awarded for a gap in amino acid sequences are -12 for a gap and -4 for each subsequent remainder.

Therefore, the calculation of the maximum% homology primarily requires an optimal comparison taking into account the penalty points for spaces. An acceptable computer program for performing such a comparison is the GCG Wisconsin Bestfit software package (Devereux et al., 1984, Nuc. Acids Research 12, p. 387). Examples of other programs that can perform sequence comparisons include, but are not limited to, the BLAST software package (see Ausubel et al., 1999, Short Protocols in Molecular Biology, 4 ^th Ed - Chapter 18), FASTA (Altschul et al. , 1990, J. Mol. Biol. 403-410) and a set of comparison programs GENEWORKS. The BLAST and FASTA programs are designed for offline and interactive searches (see Ausubel et al., 1999, pp. 7-58, 7-60). However, in some applications, it is desirable to use the GCG Bestfit program. In addition, there is a new program called BLAST 2 Sequences designed to compare protein and nucleotide sequences (see FEMS Microbiol Lett 1999, 174 (2): 247-50; FEMS Microbiol Lett, 1999 177 (1): 187-8 and mailto: tatiana@ncbi.nlm.nih.gov).

Although the final% homology can be measured in the form of identity, the comparison process is usually not based on a comparison of base pairs on an all-or-nothing basis. Instead, they usually use a scaled matrix of similarity ratings, according to which ratings are awarded for each pairwise comparison based on chemical similarity or evolutionary discrepancy. An example of a commonly used matrix is the BLOSUM62 matrix, which is the default matrix for the BLAST software suite. GCG Wisconsin programs typically use public defaults or a simple character comparison table, if available (see the user manual for more information on the programs). In some applications, it is desirable to use the public default values for the GCG software package or, in the case of other programs, a default matrix such as BLOSUM62.

Alternatively, the percent homology can be calculated using the multiple comparison function in the DNASIS ™ program (Hitachi Software), based on an algorithm similar to the CLUSTAL program (Higgins DG & Sharp PM (1988), Gene 73 (1), 237-244).

After the program performs an optimal comparison,% homology, preferably% sequence identity, can be calculated. Programs typically perform such calculations as part of a sequence comparison and produce a numerical result.

The sequences may also have deletions, insertions, or substitutions of amino acid residues that cause silent substitution and produce a functionally equivalent substance. Targeted amino acid substitutions can be made based on the similarity of polarity, charge, solubility, hydrophobicity, hydrophilicity and / or amphipathic nature of the residues while maintaining the secondary activity of binding of the substance. For example, negatively charged amino acids include aspartic acid and glutamic acid; positively charged amino acids include lysine and arginine; and amino acids with uncharged polar head groups having similar hydrophilicity values include leucine, isoleucine, valine, glycine, alanine, asparagine, glutamine, serine, threonine, phenylalanine and tyrosine.

Conservative amino acid substitutions can be made, for example, in accordance with the following table. Amino acids in one block of the second column and preferably in one row of the third column can replace each other:

Aliphatic Non-polar G a p I L V Polar - Uncharged C S T M N Q Polar - charged D e K r Aromatic H F W Y

The present invention also relates to homologous substitution (the terms “substitution” and “substitution” are used in this description to replace an existing amino acid residue with an alternative residue), which may occur, that is, to replace a similar residue with a similar, for example basic basic, acidic acid polar polar etc Non-homologous substitution can also take place, that is, substitution of the residue of one class with a residue of another class, or alternatively the introduction of non-natural amino acids such as ornithine (hereinafter referred to as Z), ornithine diaminobutyric acid (hereinafter referred to as B), ornithine norleucine (hereinafter designated O) , pyridylalanine, thienylalanine, naphthylalanine and phenyl glycine.

Substitutions may also be made by unnatural amino acids.

Variant amino acid sequences may contain acceptable spacer groups that can be inserted between any two amino acid residues of the sequence and include alkyl groups, such as methyl, ethyl or propyl groups, in addition to amino acid spacers, such as glycine or β-alanine residues. Another type of change, involving the presence of one or more amino acid residues in peptoid form, should be well known to those skilled in the art. To avoid misinterpretation, it should be noted that the term “peptoid form” means variant amino acid residues in which the α-carbon substituent group is in the position of the nitrogen atom of the residue, and not the α-carbon atom. Methods for preparing peptides in peptoid form are known in the art and are described, for example, in Simon R.J. et al., PNAS (1992) 89 (20), 9367-9371 and Horwell D.C., Trends Biotechnol. (1995) 13 (4), 132-234.

Nucleotide sequences intended for use in the present invention or encoding a polypeptide having the specific properties described herein may include synthetic or modified nucleotides. A number of different types of modification of oligonucleotides are known in the art. These modifications include methylphosphonate and phosphorothioate backbones and / or the addition of acridine or polylysine chains at the 3 ′ and / or 5 ′ ends of the molecule. In accordance with the objectives of the present invention, it should be understood that the nucleotide sequences described herein can be modified by any method existing in the art. Such modifications can be made to enhance in vivo activity or increase the life span of nucleotide sequences.

The present invention also relates to the use of nucleotide sequences that are complementary to the sequences described herein, any derivatives, fragments or derivatives thereof. If the sequence is complementary to a fragment of the sequence, then this sequence can be used as a probe to identify similar coding sequences in other organisms, etc.

Polynucleotides that are not 100% homologous to the sequences of the present invention but are within the scope of this invention can be obtained by a number of methods. Other variants of the sequences described here can be obtained by probing libraries of DNA created from a number of individuals, for example, individuals from different populations. In addition, other viral / bacterial or cellular homologs can be obtained, in particular cellular homologs found in mammalian cells (e.g., rat, mouse, cattle and primates cells), and such homologues and fragments thereof are usually capable of selectively hybridizing to sequences shown in the sequence listing here. Such sequences can be obtained by probing cDNA libraries created from genomic DNA libraries of other animal species with probes containing all or part of any sequence from the attached list of sequences under medium to high stringency conditions. The same applies to the preparation of homologues and allelic variants of the polypeptide or nucleotide sequences of this invention.

Variants and homologues of the strain / species can also be obtained by PCR degenerate sequences using seeds designed to target sequences in these variants and homologues encoding conserved amino acid sequences in the sequences of the present invention. Conservative sequences can be predicted, for example, by comparing amino acid sequences from several variants / homologs. Comparison of sequences can be made using computer programs known in the art. For example, the GCG Wisconsin PileUp program is widely used.

The seeds used in performing the PCR of a degenerate sequence contain one or more degenerate positions and are used under conditions of lower stringency compared to the conditions used for cloning sequences using seeds for one sequence against known sequences.

Alternatively, such polynucleotides can be obtained by site-directed mutagenesis of the described sequences. This method can be used, for example, in cases where it is necessary to change the sequence with a silent codon to optimize the preference of the codon for a particular host cell in which polynucleotide sequences are expressed. Other sequence changes may be desirable for introducing restriction polypeptide recognition sites or for changing the property or function of polypeptides encoded by these polynucleotides.

The polynucleotides (nucleotide sequences) of this invention can be used to obtain a seed, e.g., a seed for PCR, an seed for an alternative amplification reaction, a probe, for example, labeled with an identifiable label using conventional methods using radioactive or non-radioactive labels, or the polynucleotides can be cloned in vectors. Such seeds, probes, and other fragments have a length of at least 15, preferably at least 20, for example at least 25, 30, or 40 nucleotides, and are included in the definition of the term “polynucleotides” of the present invention.

Polynucleotides, such as the DNA polynucleotides and probes of this invention, can be obtained by recombinant, synthetic, or any other methods known to those skilled in the art. They can also be cloned by standard methods.

Seeds are usually obtained by synthesis methods, including the stepwise creation of the desired nucleotide sequence of one nucleotide each. Synthesis methods using automatic methods are well known in the art.

Longer chain polynucleotides are usually prepared by recombinant methods, for example, using cloning techniques using PCR (polymerase chain synthesis) reaction. These methods include the creation of two seeds (for example, containing approximately 15-30 nucleotides) flanking the region acting on the lipid sequence, which it is desirable to clone, introducing seeds in contact with mRNA or cDNA obtained from an animal or human cell, performing a polymerase chain synthesis reaction in conditions causing the amplification of the desired area, the selection of the amplified fragment (for example, by purification of the reaction mixture on an agarose gel) and obtaining amplified DNA. The seeds may contain acceptable restriction enzyme recognition sites, whereby the amplified DNA can be cloned into an acceptable cloning vector.

Hybridization

The present invention also relates to sequences that are complementary to sequences of the present invention or sequences capable of hybridizing with sequences of or complementary to the sequences of the present invention.

The term “hybridization” as used herein means “a process in which a nucleic acid chain is coupled to a complementary chain as a result of base pairing,” as well as an amplification process carried out by a polymerase chain reaction (PCR).

The present invention also relates to the use of nucleotide sequences capable of hybridizing with sequences that are complementary to the sequences of the present invention, their derivatives, fragments or derivatives of fragments.

The present invention also relates to sequences that are complementary to sequences capable of hybridizing to the nucleotide sequences described herein.

Hybridization conditions include the melting temperature (Tm) of the nucleotide binding complex, as described in Berger and Kimmel (1987, Guide to Molecular Cloning Techniques, Methods in Enzymology, Vol. 152, Academic Press, San Diego CA), and the established “stringency” is determined discussed below.

Maximum stringency usually corresponds to a temperature of approximately Tm-5 ° C (5 ° C below the Tm of the probe); high stringency corresponds to a temperature that is about 5-10 ° C below Tm; medium stringency corresponds to a temperature that is about 10-20 ° C below Tm; and low stringency corresponds to a temperature that is about 20-25 ° C. below Tm. As should be understood by those skilled in the art, hybridization under maximum stringency conditions can be used to identify or detect identical nucleotide sequences, while hybridization under medium (or low) stringency conditions can be used to identify or detect similar or related polynucleotide sequences.

The present invention preferably relates to sequences that are complementary to sequences capable of hybridizing with high or medium stringency conditions to nucleotide sequences encoding polypeptides having the specific properties described herein.

More preferably, the present invention relates to sequences that are complementary to sequences capable of hybridizing under high stringency conditions (eg, 65 ° C and 0.1xSSC {1xSSC = 0.15M NaCl, 0.015M sodium citrate, pH 7.0}) with nucleotide sequences encoding polypeptides having the specific properties described herein.

The present invention also relates to nucleotide sequences capable of hybridizing with the above nucleotide sequences (including sequences complementary to the considered sequences).

The present invention also relates to nucleotide sequences that are complementary to sequences capable of hybridizing to the nucleotide sequences described herein (including sequences complementary to the sequences described herein).

Polynucleotide sequences capable of hybridizing to the nucleotide sequences described herein under conditions of medium to maximum stringency are also within the scope of the present invention.

According to a preferred aspect of the invention, the present invention relates to nucleotide sequences capable of hybridizing with the nucleotide sequences described herein or with their complement under stringent conditions (e.g., 50 ° C and 0.2 x SSC).

According to a more preferred aspect of the invention, the present invention relates to nucleotide sequences capable of hybridizing with the nucleotide sequences described herein or with their complement under high stringency conditions (e.g., 65 ° C and 0.1 x SSC).

The expression of polypeptides

A nucleotide sequence for use in the present invention or for encoding a polypeptide having the specific properties described herein can be introduced into a recombinant replicable vector. The specified vector can be used for replication and expression of the nucleotide sequence in the form of a polypeptide in a compatible host cell. Expression can be controlled using regular sequences that include promoters / enhancers and other expression-regulating signals. You can use prokaryotic promoters and promoters that function in eukaryotic cells. Tissue-specific or stimulus-specific promoters may be used. In addition, you can use chimeric promoters containing sequence elements from two or more different promoters described above.

A polypeptide produced by a recombinant host cell as a result of expression of a nucleotide sequence may be secreted or may be located inside the cell depending on the sequence and / or vector used. The coding sequences may contain signal sequences directing the secretion of substance coding sequences through the membrane of a particular prokaryotic or eukaryotic cell.

Expression vector

The term “expression vector” means a construct that is capable of inducing expression in vivo or in vitro .

The expression vector is preferably introduced into the genome of the body. The term “administered” preferably means stable incorporation into the genome.

The nucleotide sequence of the present invention or the nucleotide sequence encoding a polypeptide having the specific properties described herein may be in a vector where the nucleotide sequence is operably linked to regulatory sequences so that the regulatory sequences are capable of providing expression of the nucleotide sequence by an acceptable host organism, i.e., this vector is an expression vector.

The vectors of the present invention can be introduced into an acceptable host cell as described below for expression of a polypeptide having the specific properties described herein.

The choice of a vector, for example, a plasmid, cosmid, viral or phage vector, often depends on the host cell into which the vector is introduced.

The vectors may contain one or more selectable marker genes, such as a gene that is resistant to antibiotics, for example, resistance to ampicillin, kanamycin, chloro-amphenicol or tetracycline. Alternatively, the selection may be accompanied by cotransformation (as described in WO 91/17243).

Vectors can be used in vitro , for example, for the production of RNA or for transfection or transformation of a host cell.

Another embodiment of the invention relates to a method for producing nucleotide sequences of the present invention or nucleotide sequences encoding polypeptides having the specific properties described herein, by introducing a nucleotide sequence into a replicable vector, introducing the vector into a compatible host cell, and growing the host cell under conditions causing replication vector.

The vector may further comprise a nucleotide sequence enabling replication of the vector in the host cell. Examples of such sequences are the origin of replication of plasmids pUC19, pACYC177, pUB110, pE194, pAMB1 and pIJ702.

Regulatory sequences

In some applications, a nucleotide sequence for use in the present invention, or a nucleotide sequence encoding a polypeptide having the specific properties described herein, may be operably linked to a regulatory sequence capable of expressing the nucleotide sequence of a selected host cell. As an example, it can be noted that the present invention relates to a vector containing the nucleotide sequence of the present invention, operably linked to such a regulatory sequence, that is, this vector is an expression vector.

The term "functionally connected" means an adjacent position, providing the interconnection of components, due to which these components can function as desired. A regulatory sequence “operably linked” to a coding sequence is ligated so that expression of the coding sequence is achieved under conditions compatible with the control sequences.

The definition of “regulatory sequences” includes promoters, enhancers and other signals that regulate expression.

The term “promoter” has the meaning commonly used in this field, for example, an RNA polymerase binding site.

Enhanced expression of the nucleotide sequence encoding an enzyme having the specific properties described here can also be achieved by choosing heterologous regulatory regions, for example, promoter, secretion, leader and termination regions.

The nucleotide sequence of the present invention may preferably be operably linked to at least a promoter.

Examples of suitable promoters directing the transcription of the nucleotide sequence in a bacterial, fungal, or yeast host are well known in the art.

Constructions

The term “construct”, which is synonymous with terms such as “conjugate”, “cluster” and “hybrid”, means a nucleotide sequence encoding a polypeptide having the specific properties described herein, which is intended for use in the present invention. An example of indirect attachment is an acceptable spacer group, such as an intron sequence, in particular a Sh1 intron or an ADH intron located between the promoter and the nucleotide sequence of the present invention. The same definition refers to the term “fused” in the sense used in the present invention, which includes direct or indirect connection. In some cases, these terms do not refer to a natural combination of a nucleotide sequence encoding a protein that is ordinarily linked to the promoter of a wild-type gene when they are in their natural environment.

The construct may even contain or express a marker for selection of the genetic construct.

In some applications, said construct preferably comprises at least one nucleotide sequence of the present invention or a nucleotide sequence encoding a polypeptide having the specific properties described herein that is operably linked to a promoter.

Host cells

The term “host cell” as used in the present invention means any cell that contains a nucleotide sequence encoding a polypeptide having the specific properties described herein or an expression vector described above and is used to recombinantly produce a polypeptide having the specific properties described herein.

Thus, another embodiment of the present invention relates to host cells transformed or transfected with a nucleotide sequence of the present invention, or a nucleotide sequence expressing a polypeptide having specific properties described herein. The selected cells must be compatible with the specified vector and can be, for example, prokaryotic (e.g. bacterial), fungal, yeast or plant cells. The host cells are preferably not human cells.

Examples of suitable bacterial host organisms are gram-negative or gram-positive bacteria.

Eukaryotic hosts such as yeast or other fungi may be preferred depending on the nature of the nucleotide sequence encoding the polypeptide having the specific properties described here and / or the desirability of subsequent processing of the expressed protein. Yeast cells are usually preferred over fungal cells since they are easier to manipulate. However, some proteins are poorly secreted from the yeast cell or in some cases are not subjected to the required processing (for example, hyperglycosylation in yeast). In such cases, another host fungal organism should be selected.

The use of acceptable host cells, such as yeast, fungal and plant host cells, allows for post-translational modifications (myristoylation, glycosylation, truncation, lapidation, phosphorylation of tyrosine, serine or threonine) that may be necessary to communicate optimal biological activity to the products recombinant expression of the present invention.

A host cell may refer to a strain with or without protease deficiency.

Organism

The term “organism” as used in the present invention means any organism that may contain a nucleotide sequence of the present invention or a nucleotide sequence encoding a polypeptide having the specific properties described herein and / or products derived therefrom.

Suitable organisms may include prokaryotes, fungi, yeast, or plants.

The term “transgenic organism” as used in the present invention means any organism that contains a nucleotide sequence encoding a polypeptide having the specific properties described herein and / or products derived from it, and / or in which a promoter allows the expression of a nucleotide sequence encoding a polypeptide having specific properties described here. The nucleotide sequence is preferably introduced into the genome of the body.

The term “transgenic organism” does not refer to native nucleotide coding sequences in their natural environment when they are under the control of the native promoter, which is also in its natural environment.

Therefore, the term “transgenic organism” of the present invention means an organism containing one or a combination of nucleotide sequences encoding a polypeptide having the specific properties described here, the above constructs, vectors, plasmids, cells or their products. For example, a transgenic organism may also contain a nucleotide sequence encoding a polypeptide having the specific properties described herein, which is controlled by a heterologous promoter.

Transformation of host cells / organism

As indicated above, the host organism may be a prokaryotic or eukaryotic organism. Examples of suitable prokaryotic hosts include E. coli and Bacillus subtilis .

Transformation of prokaryotic hosts is well described in the art, for example, in Sambrook et al. (Molecular Cloning: A Laboratory Manual, 2 ^nd edition, 1989, Cold Spring Harbor Laboratory Press). When using a prokaryotic host, a corresponding change in the nucleotide sequence may be required prior to transformation, for example, by removing introns.

In another embodiment, the transgenic organism may be yeast.

Filamentous fungal cells can be transformed using various methods known in the art, such as a process involving protoplast formation and protoplast transformation followed by regeneration of the cell wall in a known manner. The use of Aspergillus as a host is described in European Patent No. 0238023.

Another host organism may be a plant. An overview of common methods used to transform plants can be found in Potrykus ( Annu Rev Plant Physiol Plant Mol Biol [1991] 42: 205-225) and Christou (Agro-Food-Industry Hi-Tech March / April 1994 17-27) . Plant transformation is further described in European Patent Application No. 0449375.

The following sections provide general information on the transformation of fungi, yeast, and plants.

Transformed mushrooms

The host organism may be fungi, in particular filamentous fungi. Examples of such acceptable hosts include any organisms belonging to the genera Thermomyces, Acremonium, Aspergillus, Penicilliun, Mucor, Neurospora, Trichoderma and the like.

Transformation of filamentous fungi is described in US patent application No. 5741665, which states that standard methods for transforming filamentous fungi and cultivating fungi are well known in the art. A comprehensive review of the methods used to transform N. crassa is presented in Davis and de Serres, Methods Enzymol (1971) 17A: 79-143.

Transformation of filamentous fungi is further described in US Patent Application No. 5674707.

In accordance with one aspect of the invention, the host organism may belong to the genus Aspergillus, such as Aspergillus niger .

The transgenic host Aspergillus of the present invention can also be obtained as described, for example, in Turner G. 1994 (Vectors for genetic manipulation. In: Martinelli SD, Kinghorn JR (Editors) Aspergillus : 50 years on. Progress in industrial microbiology vol 29. Elsevier Amsterdam 1994, pp. 641-666).

Gene expression in filamentous fungi is described in Punt et al. (2002) Trends Biotechnol 2002 May; 20 (5): 200-6, Archer & Peberdy Crit Rev Biotechnol (1997) 17 (4): 273-306.

Transformed yeast

In another embodiment, the transgenic organism may be yeast.

The principles of heterologous gene expression in yeast are discussed, for example, in Methods Mol Biol (1995), 49: 341-54 and Curr Opin Biotechnol (1997) Oct; 8 (5): 554-60.

In this regard, yeast, in particular Saccharomyces cerevisi or Pichia pastoris species (see FEMS Microbiol Rev (2000 24 (1): 45-66), can be used as an organism for expression of a heterologous gene.

The principles of heterologous gene expression in Saccharomyces cerevisiae and secretion of gene products are described in E. Hinchcliffe E Kenny (1993, “Yeast as a vehicle for the expression of heterologous genes”, Yeasts , Vol 5, Anthony H. Rose and J. Stuart Harrison, eds, 2 ^nd edition, Academic Press Ltd.).

Several methods for transforming yeast have been developed. For example, the Saccharomyces transgenic yeast of the present invention can be prepared as described in Hinnen et al., (1978, Proceedings of the National Academy of Sciences of the USA 75, 1929); Beggs, J.D. (1978, Nature, London, 275, 104); and Ito, H. et al. (1983, J. Bacteriology 153, 163-168).

An acceptable host yeast may be selected from biotechnologically suitable yeast species, which include, but are not limited to, Pichia sp., Hansenula sp. or Kluyveromyces , Yarrowinia, a species of Saccharomyces, including Saccharomyces cerevisiae , or a species related to Schizosaccharomyce , such as, for example, S. pombe .

A strain of methylotrophic yeast of the species Pichia pastoris can be used as the host organism.

In one embodiment, the host organism is a Hansenula species, such as Hansenula polymorpha (described in WO 01/38544).

Transformed yeast cells can be selected using a variety of selectable markers, such as auxotrophic markers, which are the main markers of antibiotic resistance.

Transformed Plants / Plant Cells

A host organism suitable for use in the present invention may be a plant. A review of general methods can be found in Potrykus ( Annu Rev Plant Physiol Plant Mol Biol [1991] 42: 205-225) and Christou (Agro-Food-Industry Hi-Tech March / April 1994 17-27) or in WO 01 / 16308. A transgenic plant can produce phytosterol esters and phytostanol esters in large quantities.

Therefore, the present invention also relates to a method for producing a transgenic plant with increased levels of production of phytosterol esters and phytostanol esters, which comprises the steps of transforming a plant cell with a lipid acyltransferase described herein (in particular, an expression vector or construct containing a lipid acyltransferase), and growing the plant from a transformed plant cells.

Secretion

It is often desirable to secrete a polypeptide from an expression host into a culture medium from which the enzyme is much easier to remove. In accordance with the present invention, the secreting leader sequence can be selected depending on the desired expression host. Hybrid signal sequences may also be used in the context of the present invention.

Typical examples of heterologous secreting leader sequences are sequences derived from fungal amyloglucosidase (AG) gene (glaA - variants containing 18 and 24 amino acids isolated from, for example, Aspergillus species), a-factor gene (yeast, for example, Saccharomyces , Kluyveromyces and Hansenula ) or the α-amylase gene ( Bacillus ).

Detection

There are a number of methods in the art for detecting and measuring the expression of an amino acid sequence. Examples include enzyme-linked immunosorbent assay (ELISA) radioimmunoassay (RIA) and fluorescence stimulated cell sorting (FACS).

Specialists in this field should be aware of a number of labels and conjugation methods that can be used in various analyzes of nucleic acids and amino acids.

A number of companies, such as Pharmacia Biotech (Piscataway, NJ), Promega (Madison, WI) and US Biochemical Corp (Cleveland, OH) supply commercial kits and instructions for implementing these methods.

Suitable reporter molecules or labels include radioactive isotopes, enzymes, fluorescent, chemiluminescent or chromogenic agents, as well as substrates, cofactors, inhibitors, magnetic particles and the like. Patents that describe the use of such labels include US-A-3817837, US-A-3850752, US-A-3939350, US-A-3996345, US-A-4277437, US-A-4275149 and US-A- 4,366,241.

In addition, recombinant immunoglobulins can be prepared as described in US-A-4816567.

Fusion proteins

A polypeptide having the specific properties described herein can be prepared as a fusion protein, for example, to facilitate extraction and purification of the polypeptide. Examples of fusion protein partners include glutathione S-transferase (GST), 6xHis, GAL4 (DNA binding and / or transcription activation domains) and β-galactosidase. In addition, it is very convenient to introduce a proteolytic cleavage site between the fusion protein partner and the protein sequence of interest, which allows removal of the fusion protein sequences. The fusion protein preferably does not inhibit the activity of the protein sequence.

Gene fusion protein expression systems in E. coli are described in Curr. Opin. Biotechnol. (1995) 6 (5): 501-6.

In another embodiment, the amino acid sequence of a polypeptide having the specific properties described herein may be ligated to a heterologous sequence to encode a fusion protein. For example, for screening peptide libraries to identify agents that can affect the activity of a substance, it may be useful to encode a chimeric substance expressing a heterologous epitope recognized by a commercially available antibody.

The invention will now be described by way of example with reference to the following figures and examples.

The figure 1 shows the consistent sequence pfam00657 from the database, version 6 (SEQ ID NO: 1).

The figure 2 shows the amino acid sequence (SEQ ID NO: 2) obtained from the body of Aeromonas hydrophila (P10480; GI: 121051).

The figure 3 shows the amino acid sequence (SEQ ID NO: 3) obtained from the body of Aeromonas salmonicida (AAG098404; GI: 9964017).

The figure 4 shows the amino acid sequence (SEQ ID NO: 4) obtained from the organism Streptomyces coelicolor A3 (2) (access number in the genebank Genbank NP_631558).

The figure 5 shows the amino acid sequence (SEQ ID NO: 5) obtained from the organism Streptomyces coelicolor A3 (2) (access number in the genebank of Genbank CAC42140).

The figure 6 shows the amino acid sequence (SEQ ID NO: 6) obtained from the body of Saccharomyces cerevisiae (access number in the genebank of Genbank P41734).

Figure 7 shows a comparison of the selected sequences with the coordinated sequence pfam00657.

Figure 8 shows a pairwise comparison of SEQ ID NO: 3 with SEQ ID NO: 2, indicating 93% identity of amino acid sequences. The signal sequence is underlined. The “+” symbol means differences. A GDSX fragment containing the active site of serine 16 and the active sites of aspartic acid 116 and histidine 291 is highlighted (see shaded areas). The numbers after the amino acid mean the length of the amino acid without a signal sequence.

Figure 9 shows the nucleotide sequence (SEQ ID NO: 7) encoding the lipid acyltransferase of the present invention obtained from Aeromonas hydrophila .

Figure 10 shows the nucleotide sequence (SEQ ID NO: 8) encoding the lipid acyltransferase of the present invention, obtained from the body of Aeromonas salmonicida .

Figure 11 shows the nucleotide sequence (SEQ ID NO: 9) encoding the lipid acyltransferase of the present invention, obtained from Streptomyces coelicolor A3 (2) (Genbank accession number NC_003888.1: 8327480..8328367).

Figure 12 shows the nucleotide sequence (SEQ ID NO: 10) encoding the lipid acyltransferase of the present invention, obtained from Streptomyces coelicolor A3 (2) (access number in the genebank Genbank AL939131.1: 265480..266367).

Figure 13 shows the nucleotide sequence (SEQ ID NO: 11) encoding the lipid acyltransferase of the present invention, obtained from Saccharomyces cerevisiae (access number in the Genbank genebank Z75034).

The figure 14 shows the amino acid sequence (SEQ ID NO: 12) obtained from the body of Ralstonia (access number in the genebank of Genbank AL646052).

Figure 15 shows the nucleotide sequence (SEQ ID NO: 13) encoding the lipid acyltransferase of the present invention, obtained from the organism of Ralstonia .

The figure 16 shows SEQ ID NO: 20. Protein Scoe1 NCBI with access code CAB39707.1. GI: 4539178 defines a conservative hypothetical protein [Streptomyces coelicolor A3 (2)].

Figure 17 shows the nucleotide sequence represented by SEQ ID NO: 21 encoding an NCBI protein with access code CAB39707.1. GI: 4539178 defines a conservative hypothetical protein [Streptomyces coelicolor A3 (2)].

Figure 18 shows the amino acid sequence represented by SEQ ID NO: 22 encoding the Scoe2 NCBI protein with access code CAC01477.1. GI: 9716139 defines a conservative hypothetical protein [Streptomyces coelicolor A3 (2)].

Figure 19 shows the nucleotide sequence represented by SEQ ID NO: 23 encoding the Scoe2 NCBI protein with access code CAC01477.1. GI: 9716139 defines a conservative hypothetical protein [Streptomyces coelicolor A3 (2)].

The figure 20 shows the amino acid sequence (SEQ ID NO: 24). Protein Scoe3 NCBI with access code CAB88833.1. GI: 7635996 defines the putative secreted protein [Streptomyces coelicolor A3 (2)].

The figure 21 shows the nucleotide sequence represented by SEQ ID NO: 25 encoding a Scoe3 NCBI protein with access code CAB88833.1. GI: 7635996 determines the putative secreted protein. [Streptomyces coelicolor A3 (2)].

The figure 22 shows the amino acid sequence (SEQ ID NO: 26). Protein Scoe4 NCBI with access code САВ89450.1. GI: 7672261 defines the putative secreted protein. [Streptomyces coelicolor A3 (2)].

Figure 23 shows the nucleotide sequence represented by SEQ ID NO: 27 encoding a Scoe4 NCBI protein with access code CAB89450.1. GI: 7672261 defines the putative secreted protein [Streptomyces coelicolor A3 (2)].

The figure 24 shows the amino acid sequence (SEQ ID NO: 28). Protein Scoe5 NCBI with access code САВ62724.1. GI: 6562793 determines the putative lipoprotein [Streptomyces coelicolor A3 (2)].

Figure 25 shows the nucleotide sequence represented by SEQ ID NO: 29 encoding a Scoe5 NCBI protein with access code CAB62724.1. GI: 6562793 determines the putative lipoprotein [Streptomyces coelicolor A3 (2)].

Figure 26 shows the amino acid sequence (SEQ ID NO: 30. Srim1 NCBI protein with access code AAK84028.1. GI: 15082088 determines GDSL lipase [Streptomyces rimosus].

Figure 27 shows the nucleotide sequence represented by SEQ ID NO: 31 encoding the Srim1 NCBI protein with access code AAK84028.1. GI: 15082088 determines GDSL lipase [Streptomyces rimosus].

Figure 28 shows the amino acid sequence (SEQ ID NO: 32) of a lipid acyltransferase from Aeromonas hydrophila (ATCC No. 7965).

Figure 29 shows the nucleotide sequence (SEQ ID NO: 33) encoding a lipid acyltransferase from Aeromonas hydrophila (ATCC No. 7965).

Figure 30 shows the amino acid sequence (SEQ ID NO: 34) of a lipid acyltransferase from Aeromonas salmonicida , a subspecies of Salmonicida (ATCC No. 14174).

Figure 31 shows the nucleotide sequence (SEQ ID NO: 35) encoding a lipid acyltransferase from Aeromonas salmonicida , a subspecies of Salmonicida (ATCC No. 14174).

Figure 32 shows that Aeromonas gene homologues can be identified using the base local search comparison service at the National Center for Biotechnology Information, NIH, MD, USA, and complete genome databases. A GDSX fragment was used to search the database, and a number of sequences / genes were identified that potentially encoded enzymes with lipolytic activity. Genes from the genus Streptomyces, Xanthomonas, and Ralstonia have been identified. As an example, the Ralstonia solanacearum gene was compared with the Aeromonas salmonicida (satA) gene. Pairwise comparisons showed a 23% identity. The active site of serine is located at the amino terminus, and catalytic residues of histidine and aspartic acid can be identified.

Figure 33 shows the matched sequence Pfam00657.11 [family 00657, database variant 11] (hereinafter referred to as the matched Pfam sequence) and the comparison of different sequences with the matched Pfam sequence. The arrows indicate the remains of the active site, underlined frames indicate three areas of homology described in the publication [Upton C. and Buckley J.T. (1995) Trends Biochem Sci 20; 179-179]. Capital letters in the consistent Pfam sequence indicate conservative residues in many members of the family. The symbol “-“ means a position in which, using the Markov model of hidden profiles of the consistent Pfam sequence, it was supposed to detect a residue that was not present in this position, so a space was entered. The symbol “.” Means a residue that does not have a corresponding residue in the agreed upon Pfam sequence. These sequences are the amino acid sequences shown in figures 16, 18, 20, 22, 24, 26, 28 and 30.

Figure 34 shows the matched sequence Pfam00657.11 [family 00657, database version 11] (hereinafter referred to as the matched sequence Pfam) and the comparison of different sequences with the matched sequence Pfam. The arrows indicate the remains of the active site, underlined frames indicate three areas of homology described in the publication [Upton C. and Buckley J.T. (1995) Trends Biochem Sci 20; 179-179]. Capital letters in the consistent Pfam sequence indicate conservative residues in many members of the family. The symbol “-“ means a position in which, using the Markov model of hidden profiles of the consistent Pfam sequence, it was supposed to detect a residue that was not present in this position, so a space was entered. The symbol “.” Means a residue that does not have a corresponding residue in the agreed upon Pfam sequence. These sequences are the amino acid sequences shown in figures 2, 16, 18, 20, 26, 28 and 30. It was found that all these proteins are active against lipid substrates.

Figure 35 shows the expression vector pet12-AsalGCAT = pSM containing the C-terminal His-labeled Aeromonas salmonicida lipid acyltransferase gene.

The figure 36 shows the results of a study of cell extracts using analysis using a set of NEFA, which indicate the activity of the recombinant lipid acyltransferase A. salmonicida in relation to lycithin.

In the wells from left to right are located: a positive control sample, a negative control sample (i.e. extracts from an empty plasmid) and samples collected after cultivation for 0, 1, 2 and 3 hours after IPTG induction.

The figure 37 shows the results of the optimization of the growth of BL21 (DE3) pLysS cells containing the expression vector pet12-AsalGCAT = pSM, which show that cultivation at 30 ° C provides an enzyme with high activity against lecithin. Cell extracts were examined for phospholipase activity by performing analysis using the NEFA kit. In the wells from left to right are located: positive control sample, negative control sample, 20 ° C, 30 ° C.

38 shows crude cell extracts from BL21 (DE3) pLysS cells expressing active lipid acyltransferase incubated with lecithin substrate, the reaction mixture being analyzed by thin layer chromatography, the results of which indicated the presence of decomposition products. Rows: 1. Lack of enzyme; 2. + A.sal-10 μl, 37 ° C; 3. + A.sal-20 μl, 37 ° C; 4. + A.sal-10 μl, 24 ° C; 5. + A.sal-20mkm, 24 ° C.

Figure 39 shows the results of partial purification of the Aeromonas salmonicida acyltransferase, indicating the presence of phospholipase activity in relation to purified His-labeled protein. SE = sonicated extracts; His = purified using Qiagen Ni-NTA Centrifugation Kit.

Figure 40 shows the expression vector pet12-Ah GCAT = pSMa containing the C-terminal His-labeled Aeromonas hydrophila glycerolipid acyltransferase (GCAT) gene that was used to transform E. coli strain BL21 (DE3) pLysS.

The figure 41 shows the results of the activity of crude extracts (5 and 10 μl) containing the recombinant enzyme GCAT Aeromonas hydrophila , which was investigated against lecithin using a set of non-esterified fatty acids (NEFA) (Roche, Switzerland); The results obtained indicate the presence of an enzyme with activity against phospholipid, lecithin.

The figure 42 shows the results of the optimization of the growth of BL21 (DE3) pLysS cells containing the expression vector pet12-AsalGCAT = pSM, which show that cultivation at 30 ° C allows to obtain an enzyme with high activity against lecithin. Cell extracts were analyzed for phospholipase activity using an NEFA kit.

The figure 43 shows the results of partial purification of acyltransferases of Aeromonas hydrophila and A. salmonicida , indicating the presence of phospholipase activity in relation to purified His-labeled protein. SE = sonicated extracts; His = purified using Qiagen Ni-NTA Centrifugation Kit.

The figure 44 shows the results of the expression of the Aeromonas genes in Bacillus subtilis 163, indicating the production of a secreted enzyme with activity against lecithin and DGDG. pUB-AH = construct containing the A. hydrophila gene, and pUB-AS = construct containing the A. salmonicida gene. The filtrate cultures were incubated with substrates for 60 minutes.

Figure 45 and Figure 46 are graphs showing the effects of fatty acid and cholesterol ester versus time. These graphs show the results obtained by performing GLC analysis in the process of measuring acyltransferase activity in a food product using lecithin and cholesterol in a buffer used as a substrate.

Figure 47 shows the amino acid sequence (SEQ ID NO: 36) of the fusion construct used for mutagenesis of the Aeromonas hysrophila lipid acyltransferase gene in Example 17. The underlined amino acids form the xylanase signal peptide.

48 shows the nucleotide sequence (SEQ ID NO: 54) encoding an enzyme from Aeromonas hydrophila , including the xylanase signal peptide.

Figure 49 shows the structure of the fatty acid condensates of an amino acid protein.

The figure 50 shows the interaction diagram of a fatty acid isolated from phosphatidylcholine when transferred to a free hydroxyl group of amino acids containing a free hydroxyl group suitable for esterification, for example tyrosine or serine.

The figure 51 shows a diagram of the interaction of DGDG and glucose catalyzed by lipid acyltransferase.

Examples

Example 1. Cloning, sequencing and heterologous expression of transferase from Aeromonas salmonicida , subspecies Salmonicida

Used strains

Aeromonas salmonicida, a subspecies of Salmonicida (ATCC 14174), obtained from the American Type Culture Collection (ATCC), was grown overnight at 30 ° C in Luria-Bertani (LB) medium. Cells were centrifuged and genomic DNA was isolated by the methods used to isolate genomic DNA from Qiagen Ltd. Genomic DNA buffer (catalog number 19060), protease K (catalog number 19131) and RNase A (catalog number 19101) were purchased from Qiagen Ltd. (Boundary court Gatwick Court, West Sussex, RH10 2AX).

The bacterial host strain BL21 (DE3) pLysS (Novagen) was used to produce Aeromonas recombinant enzymes. Competent BL21 (DE3) pLysS cells were used as a host for transformation with the expression vector pet12-AsalGCAT = pSM. Transformants containing the corresponding plasmid were grown at 37 ° C on LB agar medium containing 100 μg ampicillin / ml.

The creation of the expression vector pet12-AsalGCAT-pSM

Genomic DNA (0.2-1 μl) was used as a template for amplification of DNA transferase genes from Aeromonas and pfu DNA polymerase (2.5 units) was used with 10 μl of 10-fold pfu buffer, 1 μl of each seed (50 pmol / μl), 200 μm dNTP in the total volume of the reaction mixture, equal to 100 μl. PCR reactions were performed in a programmable fuser under the following conditions: at 95 ° C for 30 seconds, 30 cycles at 95 ° C for 30 seconds, at 60 ° C for 1 minute, and at 68 ° C for 2 minutes. Additional chain elongation was performed at 72 ° C for 5 minutes.

The transferase gene from A. salmonicida was amplified by PCR by performing 2 separate PCR reactions. The first PCR reaction was performed using two primers, 1USNEW (5'AGCATATGAAAA AATGGTTTGT TTGTTTATTG GGG3 '[SEQ ID NO: 36] and asls950new (5' GTG ATG GTG GGC GAG GAA CTC GTA CTG3 '[SEQ ID NO: 37]. PCR was performed to introduce the C-terminal histidine tag using the PCR product from the first reaction and seed: 1USNEW (5'AGCATATGAAAA AATGGTTTTT TTGTTTATTG GGG 3 '[SEQ ID NO: 38] and AHLS1001 (5'TTTGGATG GAATTC ATG GTG ATG GTG GGC3 '[SEQ ID NO: 39]). The second reaction PCR product was purified and digested with restriction enzymes Ndel and BamHI. 2 μg of pET 12a vector DNA was also digested with restriction enzymes. rmentami Ndel and BamHI and treated with phosphatase. restriction enzyme treated vector pet12a and PCR product obtained by performing the second reaction was purified and ligated using the kit for rapid ligation (Roche, Switzerland). The ligation mixture was used to transform TOP10 E.coli cells . Transformants were cultured on LB agar medium containing 100 μg / ml ampicillin.

The T7 promoter seed (5'TAATACGACTCACTATAG3 '[SEQ ID NO: 40]) and the T7 terminator seed (5'CTAGTTATTGCTCAGCGG3' [SEQ ID NO: 41]) were used to verify the sequences and orientation of the cloned transferase genes in the pET12a vector. DNA was sequenced using the ABI Prism® BigDye ™ Terminators Cycle Sequencing Kit using 500 ng of plasmid DNA as template and 3.2 pM T7 promoter and terminator seeds.

The construct shown in FIG. 35 was used to transform the competent bacterial host strain BL21 (DE3) pLysS (Novagen), after which ampicillin-resistant transformants were harvested and used for expression analysis.

Expression of Recombinant Lipid Acyltransferase from Aeromonas salmonicida

The activity of the enzyme against lecithin was determined quantitatively on cell extracts using a set of unesterified fatty acids (NEFA) (Roche, Switzerland).

As shown in FIG. 36, BL21 (DE3) pLysS cells containing the expression vector pet12-AsalGCAT = pSM were grown on LB medium with 100 μg / ml ampicillin and incubated by shaking at 37 ° C until an optical density of OD ₆₀₀ = 0 was reached. 6-1.0. Cultures were then induced using IPTG (0.4 mM) and incubation continued for the next 3 hours. Samples were taken at 0, 1, 2, and 3 hours after IPTG induction. The enzyme activity was investigated using a set of NEFA and lecithin as a substrate.

Growth Optimization for More Active Enzymes

BL21 (DE3) pLysS cells containing the expression vector pet12-AsalGCAT = pSM were grown on LB medium with 100 μg / ml ampicillin and incubated, shaking, at different growth temperatures (37 ° C, 30 ° C, and 20 ° C). The optimal conditions for the production of the active enzyme lipid acyltransferase corresponded to the cultivation of cultures at 30 ° C, as shown in figure 37.

Partial purification of recombinant transferase from Aeromonas salmonicida

The strain of BL21 (DE3) pLysS cells containing the expression vector pet12-AsalGCAT = pSM was grown at 37 ° C and the crude cell extracts were obtained by sonication. The recombinant enzyme was then purified from sonicated crude cell extracts using a Qiagen Ni-NTA centrifugation kit. Phospholipase activity was determined using a set of NEFA and lecithin as a substrate. The crude cell extracts from BL21 (DE3) pLysS cells expressing active transferase were incubated with the lecithin used as a substrate, and the reaction mixture was analyzed by thin layer chromatography, the results of which indicated the presence of decomposition products (see figure 38).

Partial purification of recombinant transferase from Aeromonas salmonicidae

The strain of BL21 (DE3) pLysS cells containing the expression vector pet12-AsalGCAT = pSM was grown at 37 ° C and the crude cell extracts were obtained by sonication. The recombinant enzyme was then purified from the sonicated crude cell extract using a Qiagen Ni-NTA centrifugation kit. Phospholipase activity was determined using a set of NEFA and lecithin as a substrate (see figure 39).

Example 2. Cloning and expression of transferase from Aeromonas hydrophila in E. coli

Aeromonas hydrophila (ATCC No. 7965), obtained from the American Type Culture Collection, was grown overnight at 30 ° C. in Luria-Bertani (LB) medium. Cells were centrifuged and genomic DNA was isolated by Qiagen Ltd. genomic DNA extraction methods. Genomic DNA buffer (catalog number 19060), protease K (catalog number 19131) and RNase A (catalog number 19101) were purchased from Quigen Ltd. (Boundary court Gatwick Court, West Sussex, RH10 2AX).

The bacterial host strain BL21 (DE3) pLysS (Novagen) was used to produce Aeromonas recombinant enzymes. Competent BL21 (DE3) pLysS cells were used as the host for transformation with the expression vector pet12-AhGCAT = pSMa. Transformants containing the corresponding plasmid were grown at 37 ° C on LB agar medium containing 100 μg ampicillin / ml.

The creation of the expression vector pet12a-A.h.GCAT-pSMa

Genomic DNA (0.2-1 μl) was used as a template for amplification of the transferase gene DNA from Aeromonas and pfu DNA polymerase (2.5 units) was used with 10 μl of 10-fold pfu buffer, 1 μl of each seed (50 pmol / μl), 200 μm dNTP in the total volume of the reaction mixture, equal to 100 μl. PCR reactions were performed in a programmable fuser under the following conditions: at 95 ° C for 30 seconds, 30 cycles at 95 ° C for 30 seconds, at 60 ° C for 1 minute, and at 68 ° C for 2 minutes. Additional chain elongation was performed at 72 ° C for 5 minutes.

The transferase gene from A. hydrophila (ATCC No. 7965) was amplified by PCR by performing two separate PCR reactions.

The first PCR reaction was performed using two primers, AHUS1 (5'GTCATATGAAAAAATGGTTTGTGTGTTTATTGGGATTGGTC 3 ', SEQ ID NO: 42) and ahls950 (5'ATGGTGATGGTGGGCGAGGAACTCGTACTG 3').

A second PCR reaction was performed to introduce a C-terminal histidine tag using the PCR product obtained from the first reaction and two seeds:

AHUS1 (5'GTCATATGAAAAAATGGTTTGTGTGTTTATTGGGATTGGTC3 ', SEQ ID NO: 44) and AHLS1001 (5'TTGGATCCGAATTCATCAATGGTGATGGTGATGGTGGGC3', SEQ ID NO: 45).

The PCR product resulting from the second reaction was purified and digested with restriction enzymes Ndel and BamHI. 2 μg of pET12a vector DNA was also digested with restriction enzymes Ndel and BamHI and treated with phosphatase. The restriction enzyme-treated vector pet12a and the PCR product from the second reaction were purified and ligated using an express ligation kit (Roche, Switzerland). The ligation mixture was used to transform E. coli TOP10 cells. Transformants were cultured on LB agar medium containing 100 μg / ml ampicillin.

The T7 promoter seed (5'TAATACGACTCACTATAG3 ') and the T7 terminator seed (5'CTAGTTATTGCTCAGCGG3') were used to check the sequences and orientation of the cloned GCAT genes in pET12a vector. DNA was sequenced using the ABI Prism® BigDye ™ Terminators Cycle Sequencing Kit using 500 ng of plasmid DNA as template and 3.2 pM T7 promoter and terminator seeds.

The construct shown in FIG. 40 was used to transform the competent bacterial host strain BL21 (DE3) pLysS (Novagen), after which ampicillin-resistant transformants were harvested and used for expression analysis.

Transferase expression from Aeromonas hydrophila in BL21 (DE3) pLysS cells

The strain of BL21 (DE3) pLysS E. coli cells containing the expression vector pet12a-AhGCAT = pSMa was grown on LB medium with 100 μg / ml ampicillin and incubated, shaking, at 37 ° C until the optical density OD ₆₀₀ = 0.6- 1,0. Cultures were then induced using IPTG (0.4 mM) and incubation continued for the next 3 hours. Samples were taken at 0, 1, 2, and 3 hours after IPTG induction. The enzyme activity was investigated using a set of NEFA and lecithin as a substrate (figure 41).

Growth Optimization for More Active Enzymes

BL21 (DE3) pLysS cells containing the expression vector pet12a-A.h.GCAT = pSMa were grown on LB medium with 100 μg / ml ampicillin and incubated, shaking, at different growth temperatures (37 ° C, 30 ° C, and 20 ° C). The optimal conditions for the production of the active GCAT enzyme corresponded to the cultivation of cultures at 30 ° C, as shown in figure 42.

Partial Purification of Recombinant Transferase from A.hydrophila (GCAT)

The strain of BL21 (DE3) pLysS cells containing the expression vector pet12a-A.h.GCAT = pSMa was grown at 37 ° C and the crude cell extracts were obtained by sonication. The recombinant enzyme was then purified from sonicated crude cell extracts using a Qiagen Ni-NTA centrifugation kit. Phospholipase activity was analyzed using a set of NEFA and lecithin as a substrate. (figure 43).

Example 3. Expression of transferases from Aeromonas to Bacillus subtilis 163

Creation of a plasmid

For heterologous expression of Aeromonas genes in Bacillus subtilis , two different Bacillus subtilis expression vectors (pUB110 and pBE5) were used. The pUB110 vector contains the alpha-amylase promoter, while the pBE vector contains the P32 promoter as a regulatory region for the expression of Aeromonas fusion genes. In vector pUB110, the first amino acid of the mature GCAT Aeromonas genes was fused to the last amino acid of the sequence of the Bacillus subtilis xylanase signal peptide at the Nhe1 restriction site, creating two additional amino acids ahead of the mature proteins. The PBE5 vector contains the cgtase signal sequence fused at the Ncol site for secretion of recombinant proteins into the culture filtrate.

PCR reactions were performed to fuse Aeromonas genes in the reading frame with the signal sequences of the vectors pUB110 and pBE5. PCR reactions were performed using the two following primers for the A. hydrophila gene.

First PCR reaction: usAHncol (5'ATGCCATGGCCGACAGCCGTCCCGCC3 ', SEQ ID NO: 46) and 1sAH (5'TTGGATCCGAATTCATCAATGGTGATG3', SEQ ID NO: 47).

Second PCR reaction: US-AhnheI (5'TTGCTAGCGCCGACAGCCGTCCCGCC3 ', SEQ ID NO: 48) and lsAH (5'TTGGATCCGAATTCATCAATGGTGATG3', SEQ ID NO: 49).

PCR reactions were performed using the two following primers for the A. salmonicida gene.

Third PCR reaction: US-Asncol (5'TTGCCATGGCCGACACTCGCCCCGCC3 ', SEQ ID NO: 50) and lsAH (5'TTGGATCCGAATTCATCAATGGTGATG3', SEQ ID NO: 51).

Fourth PCR Reaction: US-ASnhel (5'TTGCTAGCGCCGACACTCGCCCCGCC3 ', SEQ ID NO: 52) and lsAH (5'TTGGATCCGAATTCATCAATGGTGATG3', SEQ ID NO: 53).

All PCR products were cloned at the blunt end of PCR II (TOPO vector) and sequenced using the lower and upper primers for sequencing.

Clones obtained by performing PCR reactions 1 and 3 were cut with Ncol and BamHI and used as ligation inserts with the pBE5 vector cut with Ncol / BamHI / phosphatase. Clones obtained from PCR reactions 2 and 4 were cut with Nhel and BamHI and used as ligation inserts with the pUB vector cut with Nhel / BamHl / phosphatase.

The expression of transferase genes from Aeromonas in Bacillus subtilis and the study of enzymatic activity

Acyltransferases obtained from two Aeromonas species were successfully expressed in E. coli (results are given above). Gene fusions in vectors pUB110 rVE5 Bacillus and used to transform Bacillus subtilis and transformants were selected by culturing the cells on plates with kanamycin. Kanamycin-resistant transformants isolated and grown in a 2-fold volume of YT are able to heterologously express Aeromonas genes in Bacillus . Culture filtrates possess galactolipase activity of digalactosyldiacylglycerol (DGDG) in addition to acyltransferase and phospholipase activities. Digalactosyldiacyl-glycerol (DGDG) activity and lecithin activity were measured after incubating the culture supernatant with DGDG substrate from wheat flour (purchased from Sigma) for 60 minutes, as shown in Figure 44. Bacillus produced the enzyme as a secreted protein when cultivation in a culture medium for a period from 20-24 hours to 48 hours. In some cases, it was found that the expression of Aeromonas genes affects cell viability and growth in Bacillus and E. coli , therefore, it is necessary to carefully select expressing strains and optimize the growth conditions to guarantee expression. For example, several Bacillus host strains (Bs 163, DB104, and OS21) were transformed with expression vectors to compare growth. The B.s163 strain is transformed with two Aeromonas genes and is able to express the active protein. Strain DB104 is transformed by all constructs, but is able to express only transferase from A. salmonicida .

Example 4. Fermentation and purification of lipid acyltransferases from Aeromonas produced in E. coli

Fermentation of E. coli

Microorganisms

Two strains of Eschericia coli were used in this study, one of which contained a lipid acyltransferase from Aeromonas hydrophila (Example 2) and the second one contained a lipid acyltransferase from Aeromonas salmonicida (Example 1).

The E. coli strain containing the A. hydrophila gene was named DIDK0124, and the E. coli strain containing the A. salmonicida gene was called DIDK0125. Fermentation DIDK0124 was named HYDRO0303, and fermentation DIDK0125 was called SAL0302. The purified protein obtained by HYDRO025 was named REF # 138. The purified protein obtained by HYDRO0303 was named REF # 135.

Culture media and cultivation conditions

Agar medium LB

The LB agar plate tablets used for culturing the strains contained: 10 g / L tryptone, 5 g / L yeast extract, 5 g / L NaCl, 15 g / L agar, 100 mg / L ampicillin and 35 mg / L chloramphenicol. Agar plate plates were incubated at 30 ° C.

Shake flask with LB medium

LB medium (50 ml in one shake flask) used to produce an inoculum for cultivation in a bioreactor contained: 10 g / L tryptone, 5 g / L yeast extract, 5 g / L NaCl, 100 mg / L ampicillin and 35 mg / l chloramphenicol. Shake flasks were inoculated with culture from LB agar plates and incubated at 30 ° C. and 200 rpm.

Cultivation in a bioreactor

For cultivation in a bioreactor used bioreactors with a capacity of 6 l, created in our own laboratory, which filled 4 l of medium containing: 10 g / l of tryptone, 5 g / l of yeast extract, 5 g / l of NaCl, 8 g / l of KH ₂ PO ₄ , 0.9 g / l MgSO ₄ · 7H ₂ O, 40 g / l glucose monohydrate, 0.4 ml / l ADD APT® Foamstop Sin 260 (ADD APT Chemicals AG, Helmond, The Netherlands), 10 mg / l ( NH ₄ ) ₂ Fe (SO ₄ ) ₂ · 6H ₂ O, 0.7 mg / L CuSO ₄ · 5H ₂ O, 3 mg / L ZnSO ₄ · 7H ₂ O, 3 mg / L MnSO ₄ · H ₂ O, 10 mg / L EDTA, 0.1 mg / L NiSO ₄ · 6H ₂ O, 0.1 mg / L CoCl ₂ , 0.1 mg / L H ₃ BO ₄ , 0.1 mg / L KI, 0.1 mg / l Na ₂ MoO ₄ · 2H ₂ O, 1 g / l of ampicillin and 35 mg / l of chloramphenicol.

The bioreactors were inoculated with LB culture in an amount guaranteeing the completion of growth after cultivation for about 20 hours (calculated taking into account the maximum specific growth rate of 0.6 h ^-1 , OD ₆₀₀ in a shake flask with LB medium and the final value of OD ₆₀₀ in the bioreactor after about 20 hours).

Fermenter SAL0302 was inoculated with 10 ml of LB culture and fermenter HYDRO0303 was inoculated with 4 ml of LB culture.

Bioreactors operated under the following conditions: temperature 30 ° C, stirring at a speed of 800-1000 rpm / min (depending on the experiment), aeration at a speed of 5 l / min, pH 6.9, control pH 8.75% (wt. / vol.) when adding a mixture of NH ₃ water and 2M solution of H ₂ SO ₄ . Induction was achieved by adding isopropyl-β-D-thiogalactoside to a final concentration of 0.6 mM, at which 0.4 mol (HUDRO0303) and 0.7 mol of CO ₂ were produced, respectively.

Biomass harvesting

The collection and homogenization of biomass was performed as follows.

1) The fermentation broth obtained by fermentation was centrifuged with an acceleration of 5000g at 4 ° C for 10 minutes and the supernatant was removed. Biomass was stored at -20 ° C until use. The biomass was then thawed and resuspended in 500 ml of 20 mM NaH ₂ PO ₄ , pH 7.4, 500 mM NaCl, 10 mM imidazole and a complete protease inhibitor (without EDTA) (Roche, Germany).

2) The suspended biomass was homogenized under a pressure of 2 kbar and 4 ° C in a cell disintegrator from Constant Systems Ltd (Warwick, UK).

3) Cell debris was removed by centrifugation with an acceleration of 10,000 g at 4 ° C for 30 minutes, after which the supernatant was collected.

4) The supernatant was purified by centrifugation with acceleration of 13700g at 4 ° C for 60 minutes, after which the supernatant was collected.

5) The supernatant was filtered through 0.2 μm vacuum cap filters (Pall Life Science, UK) and the filtrate was collected for immediate chromatographic purification.

Chromatographic purification of transferases

The column (2.5 × 10 cm) was filled with 50 ml of a gel, which is a chelating Sepharose (Sapharose ff.), And Nickel sulfate was introduced (by the method described by the manufacturer, Amersham Biosciences). The column was balanced with 200 ml of 20 mm

NaH ₂ PO ₄ , pH 7.4, 500 mM NaCl, 10 mM imidazole. 400 ml of crude transferase was injected into the column at a flow rate of 5 ml / min. The column was then washed with 20 mM NaH ₂ PO ₄ , pH 7.4, 500 mM NaCl, 10 mM imidazole until the UV ₂₈₀ value reached a baseline. GCAT was then eluted with 40 ml of 20 mM NaH ₂ PO ₄ , pH 7.4, 500 mM NaCl and 500 mM imidazole.

Example 5. Fermentation and purification of lipid acyltransferases from Aeromonas produced in Bacillus subtilis

Fermentation

BAC0318-19, BAC0323-24

Microorganism

The microorganisms used in this study were obtained by transforming the Bacillus subtilis host strain No. 163 with a plasmid containing the gene encoding Aeromonas salmonicida transferase, which was introduced into the vector pUB1210OIS. The expression of this gene was controlled by the alpha-amylase promoter, and transferase secretion was mediated by the B. subtilis xylanase signal sequence (Example 3). These strains were named DIDK0138 (fermentation BAC0318-10) and DIDK0153 (fermentation BAC0323-24).

Culture media and cultivation conditions

Precultural environment

In a shake flask (total volume of 500 ml with partitions) was added 100 ml of medium containing:

NaCl 5 g / l K ₂ NRA ₄ 10 g / l Soya flour 20 g / l Yeast Extract, BioSpringer 106 20 g / l Defoamer, SIN260 5 ml / l

The pH was adjusted to 7.0 before autoclaving.

After autoclaving, 6 ml of 50% (w / w) nutriose were added to each flask. Kanamycin was added at a concentration of 50 mg / L after autoclaving.

Inoculation

A shaken flask with precultural medium was inoculated with a frozen culture directly from 25% (w / v) stock solution in glycerol. The shaken flask was incubated at 33 ° C at a speed of 175 rpm for about 16 hours, after which 50 ml was used to inoculate the fermenter.

Fermentation

Fermentations were performed in 6 L fermenters manufactured in our own laboratory.

A portion of the medium (3 l) contained:

Liquid for soaking corn (50% own weight) 40 g / l BioSpringer 153 Yeast Extract (50% Net Weight) 10 g / l NaCl 5 g / l CaCl ₂ , 2H ₂ O 0.25 g / l Mn (NO ₃ ) ₂ , H ₂ O 0.2 g / l Defoamer SIN260 1 ml / l Kanamycin (sterilized through a filter when added to the fermenter after autoclaving) 50 mg / l

The feed mixture contained:

Glucose monohydrate 540 g / kg MgSO ₄ · 7H ₂ O 4.8 g / kg Defoamer SIN260 4 ml / kg BioSpringer 153 Yeast Extract (50% Net Weight) 150 g / kg

The feed in the fermentation process BAC0318 and BAC0323 was started taking into account the accumulated CO ₂ calculated from the following equations:

Flow rate [g / h] = 0, AcCO ₂ <0.15

Flow rate [g / h] = 2.85 + t · 1.54, AcCO ₂ ≥0.15 and t <12

Flow rate [g / h] = 21.3, t> 12

t: time (hours) from the moment accumulated CO ₂ (AcCO ₂ ) reaches 0.15 mol.

The feed in the fermentation process BAC0319 and BAC0324 was started taking into account the accumulated CO ₂ calculated from the following equations:

Flow rate [g / h] = 0, AcCO ₂ <0.15

Flow rate [g / h] = 2.0 + t · 1.08, AcCO ₂ ≥0.15 and t <12

Flow rate [g / h] = 15, t> 12

t: time (hours) from the moment accumulated CO ₂ (AcCO ₂ ) reaches 0.15 mol.

The pH was adjusted to 7.0 by adding 12.5% (w / v) of a mixture of NH ₃ water or a 2M solution of phosphoric acid.

Aeration was carried out at a speed of 3 l / min, corresponding to 1 vvm.

The temperature was 33 ° C.

The fermenter was equipped with two Rushton impellers with a diameter of 8 cm, located at a distance of 10 cm.

Biomass harvesting

Biomass was removed by centrifugation at an acceleration of 16000g for 10 minutes at room temperature. The supernatant was sterilized by filtration and the filtrate was used for purification and application studies.

Example 6. “Analysis of transferase in a buffered substrate” to measure the acyltransferase activity of the enzyme

Lipid acyltransferase was isolated from Aeromonas salmonicida and expressed in Bacillus subtilis. This enzyme very effectively transfers fatty acid from lecithin to cholesterol during the formation of cholesterol esters. In addition, it was found that this enzyme has some hydrolytic activity, which manifests itself in the formation of free fatty acid. Conventional phospholipases (EC3.1.1.4 and EC3.1.1.32) have the ability to hydrolyze lecithin during the formation of free fatty acids and lysolecithin, and no transferase reaction of these enzymes has been reported.

In this description of the invention, an analysis is described in detail to measure the transferase and hydrolytic activity of enzymes and thus identify the lipid acyltransferases of the present invention; when performing this analysis, a substrate containing lecithin and cholesterol is used. In this work, we used a substrate based on phosphatidylcholine and cholesterol dispersed in a buffer. Quantification of reaction products was carried out by extraction of lipids from the substrate and subsequent analysis of lipid components by GLC.

Measuring method

Substances

L-alpha-phosphatidylcholine 95% (plant) Avanti No. 441601

Cholesterol: Sigma, Catalog No. C 8503

Cholesteryl palmitate, Sigma C6072

Cholesteryl stearate, Sigma C 3549

HEPES buffer, Sigma, catalog No. H 3375

Chloroform, analytical purity

Enzymes

Purified GCAT from A. salmonicida No. 178-9

TLC analysis

Thin layer chromatography plates (TLC) were activated in a thermostat (110 ° C) for 1/2 hour.

100 ml of working buffer was poured into a chromatographic chamber with a lid. The walls of the chamber were covered with filter paper (Whatman 2) to saturate the chamber with solvent vapor.

TLC plates were placed in a frame and a sample was applied to the TLC plate at a distance of 2 cm from the base. Then the plate for TLC was placed in a chamber for TLC with a working buffer. When the working buffer reached 14 cm from the base of the plate, the TLC plate was removed, dried in a fume hood, and then placed in a thermostat at 110 ° C for 10 minutes.

Then, the TLC plate was immersed in a developing reagent and dried in a thermostat at 110 ° C for 15 minutes.

Working buffer

No. IV: chloroform: methanol: H ₂ O (65: 25: 4)

No. I: petroleum ether: MTBE: acetic acid (60: 40: 1)

Developing buffer (vanadate buffer)

32 g of Na ₂ CO ₃ and 300 ml of H ₂ O (1M)

Add 18.2 vanadium pentoxide (V ₂ O ₅ ) and dissolve with gentle heating.

The solution was cooled to room temperature.

Carefully add 460 ml of a 2.5M solution of H ₂ SO ₄ (460 ml of H ₂ O + 61 ml of H ₂ SO ₄ ).

Water is added up to 1000 ml.

GLC analysis

Perkin Elmer Autosystem 9000 capillary gas chromatograph equipped with a 12.5 m WCOT quartz glass column × 0.25 mm inner diameter × 0.1 μm film thickness 5% phenylmethyl silicone (Chrompack CP Sil 8 CB).

Carrier gas: helium.

Injector: separate cold-injected PSSI (initial temperature 50 ° C, increased to 385 ° C), volume 1.0 μl

FID detector: 395 ° C

Thermostat program: one 2 3 Thermostat temperature, ° С 90 280 350 Isotherm, time, minutes one 0 10 The rate of temperature change, ° C / min fifteen four

Sample preparation: 30 mg of the sample was dissolved in 9 ml of a heptane: pyridine (2: 1) mixture containing heptadecane (0.5 mg / ml) in accordance with the internal standard. 300 μl of the sample solution was transferred into a curved tube, 300 μl of MSTFA (N-methyl-N-trimethylsilyl trifluoroacetamide) was added and reacted for 20 minutes at 60 ° C.

Calculation: reaction coefficients for monoditriglycerides and free fatty acid were determined using reference 2 (monoditriglyceride). The reaction coefficients for cholesterol, cholesteryl palmitate and cholesteryl stearate were determined using pure reference substances.

Results: transferase assay using phosphatidylcholine and cholesterol as a substrate.

The transferase activity of the transferase was tested in a substrate based on phosphatidylcholine and cholesterol using the following method.

450 mg of phosphatidylcholine (> 95% PC Avanti, No. 441601) and 50 mg of cholesterol were dissolved in chloroform and evaporated to dryness in vacuo. 300 mg of a cholesterol / phosphatidylcholine mixture was transferred to a Viton glass and 15 ml of 50 mM HEPES buffer, pH 7, was added. The lipid was dispersed in the buffer with stirring.

The substrate was heated to 35 ° C, stirring with a magnetic stirrer, and 0.25 ml of the enzyme solution was added. This substrate is a medium with a very high water content of approximately 95%.

Samples of 2 ml were taken after 0, 5, 10, 15, 25, 40, and 60 minutes of reaction time. Immediately 25 μl of a 4M HCl solution was added to acidify the free fatty acid and the enzymatic reaction was stopped. 3.00 ml of chloroform was added and the sample was vigorously shaken in a vortex shaker for 30 seconds. The sample was centrifuged, 2 ml of the chloroform phase was separated and filtered through 0.45 μm filters in a 10 ml graduated Dram glass. Chloroform was evaporated in a stream of nitrogen at 60 ° C and the samples were again measured. The extracted lipid was analyzed by GLC.

The results of the analysis by GLC are shown in table 1. The results are expressed in% calculated based on the extracted lipid. The amount of fatty acid and cholesterol ester formed as a function of time is shown in FIG. 45. Based on FIG. 45, it can be concluded that the enzymatic reaction is not linear as a function of time, since strong hydrolytic activity and transferase activity are observed at the beginning of the reaction. activity. After about 10 minutes and before about 60 minutes, an almost linear reaction was observed for the formation of fatty acid and cholesterol ester versus time. Therefore, it was decided to analyze the enzymatic reaction in the specified time period.

Table 1 Minutes 0 5 10 fifteen 25 40 60 Cholesterol% 10,064 8,943 8.577 8,656 8,102 7,856 7,809 Cholesterol ester,% 0,000 1,571 2,030 2,058 2,282 2,659 3,081 The total content of free fatty acids,% 0.260 1,197 1,239 1,466 2,445 2,943 3,940

Knowing the amount of lipid in the reaction mixture and the amount of enzyme added, the amount of formed fatty acid and cholesterol ester expressed in μmol / ml of the enzyme can be calculated (table 2 and figure 46).

table 2 Minutes 10 fifteen 25 40 60 μmol / ml μmol / ml μmol / ml μmol / ml μmol / ml Total Free Fatty Acids 58.1 68.7 114.6 138.0 184.7 Cholesterol ester 88.8 90.0 99.3 115.6 133.8

Based on the results shown in table 2 and the slope of the curves shown in figure 46, the amount of fatty acid and cholesterol ester can be calculated as a function of time, expressed in μmol / min per ml of enzyme.

The calculation of hydrophilic and transferase activity is presented in table 3. The relative transferase activity was determined by measuring% acyltransferase activity in accordance with the above description.

Table 3 Hydrolytic activity (fatty acid) 2.25 μmol / min per ml of enzyme Transferase activity (cholesterol ester) 0.94 μmol / min per ml of enzyme Total activity 3.45 μmol / min per ml of enzyme Relative transferase activity 27.1 % Relative hydrolytic activity 72.9 %

Screening for other enzymes for transferase activity

The above method was used to screen different lipolytic enzymes for transferase and hydrolytic activity. Enzymes were tested in accordance with table 4.

Table 4 one 2 3 four 5 Substrate ml fifteen fifteen fifteen fifteen fifteen Transferase No. 178-9 from A. salmonicida 32 PLU-7 / ml ml 0.25 5% No. 3016, LIPOPAN® F (F. oxysporum) ml 0.25 5% Thermomyces lanuginosus ml 0.25 5% Candida rugosa No. 2983 ml 0.25 5% Candida cylindracea No. 3076 0.25

A substrate containing 300 mg of a phosphatidylcholine / cholesterol mixture dispersed in 50 mM HEPES buffer, pH 7.0, was heated to 35 ° C. with stirring. An enzyme solution was added and the sample was kept stirring at 35 ° C. Samples were taken at specific time intervals and extracted with chloroform. The isolated lipids were analyzed by GLC, the results of which are shown in table 5.

Table 5 Sample one Transferase 178-9 Minutes 0 5 10 fifteen 25 40 60 Free Fatty Acid (FFA) 1,216 2,516 2,983 2.62 2,894 3,448 3,911 Cholesterol 7,547 6,438 6,365 6.15 6,136 5,936 5,662 Cholesterol ester 0 1,835 2,177 2.44 2,58 2,851 3,331 2 Fusarium oxysporum (LIPOPAN® F) 0 5 10 fifteen 25 40 60 Free Fatty Acid (FFA) 1,216 1,345 1,796 1.95 2,487 2,424 2,977 Cholesterol 7,547 7,309 7,366 7.33 7,429 7,341 7,326 Cholesterol ester 0 0.26 0.386 0.35 0.267 0.36 0.394 3 Thermomyces lanuginosus 0 5 10 fifteen 25 40 60 Free Fatty Acid (FFA) 1,216 0.853 0.875 one 0.896 1.105 1.009 Cholesterol 7,547 7,384 7,639 7.63 7,675 7,603 7,529 Cholesterol ester 0 0 0 0 0 0 0 four Candida rugosa (No. 2938) 0 5 10 fifteen 25 40 60 Free Fatty Acid (FFA) 1,216 0.982 0.987 1,02 1,135 1,131 1.15 Cholesterol 7,547 7.438 7,656 7.66 7,638 7,575 7,585 Cholesterol ester 0 0 0 0 0 0 0 5 Candida cylandracea (No. 3076) 0 5 10 fifteen 25 40 60 Free Fatty Acid (FFA) 1,216 1,032 1,097 1,07 1,203 1,131 1.43 Cholesterol 7,547 7,502 7,425 7.65 7,619 7,502 7,411 Cholesterol ester 0 0 0 0 0 0 0

GLC analysis showed that only lipid acyltransferase (178-9) produced a significant amount of cholesterol ester and fatty acids. Phospholipase from Fusarium oxysporum was also characterized by a steady increase in free fatty acid, but cholesterol ester was formed in small quantities only at the initial stage of the reaction, and there was no increase in the yield of cholesterol ester depending on time.

Knowing the amount of lipid substrate and the results of GLC analyzes, the relative transferase activity and relative hydrolytic activity can be calculated based on the results obtained during the reaction from 10 to 60 minutes. The results obtained for transferase 178-9 and Fusariun oxysporum lipase are shown in Table 6. Other enzymes tested did not show activity.

Table 6 Transferase 178-9 Fusarium oxysporum Hydrolytic activity, micromol / min per ml of enzyme 1,03 0.96 Transferase activity, micromol / min per ml of enzyme 0.40 0.01 Total activity, micromol / min per ml of enzyme 1.43 0.98 Relative hydrolytic activity 71.8 98.7 Relative transferase activity 28,2 1.3

The results shown in table 6 confirm the significant transferase activity of lipid acyltransferase (sample 178-9). In addition, it was found that the relative transferase activity is in good agreement with the experimental results shown in table 3.

In this case, a very low transferase activity of Fusarium oxysporum phospholipase was found. The indicated level of transferase activity is so low that it falls into the category of indefinite analysis result. As expected, Fusarium oxysporum phospholipase has significant hydrolytic activity.

Conclusion

An artificial substrate based on purified phosphatidylcholine and cholesterol was used as a substrate for measuring transferase activity from Aeromonas salmonicida . Between 10 and 60 minutes of the reaction time, analysis showed an almost linear formation of free fatty acids and cholesterol ester versus time. Taking into account the activity between 10 and 60 minutes of the reaction time, the values of hydrolytic and transferase activity were calculated.

Based on the results of the analysis of lipid acyltransferase (in this case GCAT) from Aeromonas salmonicida in an artificial substrate, which is a mixture of phosphatidylcholine / cholesterol in a buffer, it was concluded that this enzyme also has very good transferase activity in a system with a very high water content.

Analysis using a substrate based on a phosphatidylcholine / cholesterol mixture in a buffer can be used to measure the transferase and hydrolytic activity of the enzyme. The results of the analysis using a substrate based on a mixture of phosphatidylcholine / cholesterol in the buffer are linear only in a certain time interval.

Example 7. Immobilization of lipid acyltransferase from Aeromonas salmonicida

Lipid acyltransferase (in this case GCAT) from A. salmonicida was immobilized on Celite 535 535 (Fluka) by precipitation with acetone. 10 ml of the enzyme solution in 20 mM TEM buffer, pH 7, was slowly mixed with 0.1 g of Celite 535 535 (Fluka) for 2 hours at room temperature.

With continuous stirring, 50 ml of cold acetone was added.

The precipitate was separated by centrifugation with an acceleration of 5000g for 1 minute.

The precipitate was washed twice with 20 ml of cold acetone.

Celite was checked at room temperature for about 1 hour.

In addition, it was found that this enzyme has high activity in environments with a high water content (6-89%), therefore, this transferase and other transferases can be used in applications with the immobilized enzyme according to this invention with a sufficiently high water content. This allows you to replace the solvents used with currently used immobilized lipases in the process of lipid bioconversion using transferases.

Example 8. Variants of lipid acyltransferase from Aeromonas hydrophila (Ahyd2) (SEQ ID NO: 36 (see figure 47))

Mutations were introduced using the QuikChange® Multisite Directional Mutagenesis Kit from Stratagene, La Jolla, CA 92037, USA, in accordance with the instructions provided by Stratagene.

Options at position Tyr256 were characterized by increased activity against phospholipids.

Variants at position Tyr256 and Tyr260 were characterized by increased activity against galactolipids.

Variants at position Tyr265 were characterized by increased transferase activity using galactolipids as an acyl donor.

The numbers indicate the positions in the following sequence: an enzyme from Aeromonas hydrophila , the amino acid sequence of which is represented by SEQ ID NO: 36 in figure 47 (underlined amino acids form the xylanase signal peptide). The nucleotide sequence corresponds to SEQ ID NO: 54 in figure 48.

Example 9. “Analysis in a low water environment”

Transferase reactions of lipolytic enzymes in a low water medium.

Execution method

Substances

Cholesterol, Sigma, Cat. No. 8503

L-alpha-phosphatidylcholine 95% (plant) Avanti No. 441601

Soybean Oil, Aarhus United, DK

Chloroform, analytical purity

Enzymes

No. 179, GCAT from A. salmonicida

No. 2427, phospholipase A1 from Fusarium oxysporum . LIPOPAN® F by Novozymes, Denmark

No. 1991, pancreatic phospholipase A2, LIPOMOD 22L from Biocatalysts, UK

No. 2373, a lipase from Candida Antarctica , Novozyme 525 L company Novozymes, Denmark

Enzymatic analysis

13.1% lecithin and 6.6% cholesterol were dissolved in soybean oil, heating to 60 ° C with stirring.

The substrate was placed in a 20 ml Viton glass and heated to 46 ° C.

Water and an enzyme solution were added and the stopwatch turned on.

At certain intervals of 50 mg, the samples were transferred to a 10 ml Dram glass and frozen.

The isolated lipids were analyzed by GLC.

GLC analysis

For a description of the analysis by GLC, see Example 6.

results

The experimental results are shown in table 8.

A soybean oil based substrate containing 13.1% lecithin and 6.6% cholesterol was heated to 46 ° C. The enzyme solution was added and the stopwatch turned on. After 30, 60 and 120 minutes of the reaction time, samples were taken for analysis by GLC.

Table 8 one 2 3 four 5 Substrate g 5 5 5 5 5 Transferase No. 179-C72, 56 PLU-7 / ml ml 0.3 No. 2427,200 PLU-7 / ml ml 0.3 Pancreas PLA 2, No. 1991 6300 PLU / ml ml 0.3 Novozyme 525 L, No. 2373, 200 LIPU / ml ml 0.3 Water ml 0.3 % water 6 6 6 6 6

The results of the analysis by GLC are shown in table 9. The results are expressed as a percentage of the total composition of the sample. Based on the results of GLC, the amount of fatty acid and cholesterol ester produced as a result of the enzymatic reaction can be calculated in comparison with the control sample without the addition of the enzyme. Under these experimental conditions, the total enzymatic activity was determined as hydrolytic activity, measured taking into account the formation of free fatty acid, and the transferase activity was determined taking into account the formation of cholesterol ester. Based on the above results and information on the molecular weight of the fatty acid and cholesterol ester, relative molar hydrolytic activity and relative molar transferase activity can be calculated, the values of which are given in table 10.

Table 9 Enzyme Reaction time, minutes Fatty acid% Cholesterol% Cholesterol ester,% Control 120 0.533 7,094 0,000 # 179 thirty 0.770 5,761 2,229 # 179 60 0.852 5,369 2,883 # 179 120 0.876 4,900 3,667 # 2427 thirty 3,269 7,094 0,000 # 2427 60 3,420 7,094 0,000 # 2427 120 3,710 7,094 0,000 # 1991 thirty 2,871 7,094 0,000 # 1991 60 3,578 7,094 0,000 # 1991 120 3,928 7,094 0,000 # 2373 thirty 1,418 7,094 0,000 # 2373 60 1,421 7,094 0,000 # 2373 120 1,915 7,094 0,000

Table 10 Enzyme Reaction time, minutes The resulting fatty acid Used cholesterol Cholesterol ester obtained Hydrolytic activity,% Transferase activity,% # 179 thirty 0.238 1,334 2,229 twenty 80 # 179 60 0.319 1,725 2,883 21 79 # 179 120 0.343 2,195 3,667 eighteen 82 # 2427 thirty 2,737 0,000 0,000 one hundred 0 # 2427 60 2,887 0,000 0,000 one hundred 0 # 2427 120 3,177 0,000 0,000 one hundred 0 # 1991 thirty 2,338 0,000 0,000 one hundred 0 # 1991 60 3,046 0,000 0,000 one hundred 0 # 1991 120 3,395 0,000 0,000 one hundred 0 # 2373 thirty 0.885 0,000 0,000 one hundred 0 # 2373 60 0.888 0,000 0,000 one hundred 0 # 2373 120 1,383 0,000 0,000 one hundred 0

Conclusion

When performing the above experiments, it was found that all tested enzymes had hydrolytic activity, as evidenced by an increase in the amount of fatty acid. The only enzyme exhibiting transferase activity was GCAT from A.salmonicida . Therefore, it was concluded that in the oil system with lecithin and cholesterol containing 6% water, only phospholipase A1 from Fusarium oxysporum , phospholipase A2 from the pancreas and lipase from Candida antarctica exhibit hydrolytic activity.

Example 10. Obtaining a carbohydrate ester using the immobilized lipid acyltransferase of the present invention

Fatty acid carbohydrate esters, such as sucrose esters and glucose esters, are usually prepared by reacting a fatty acid or fatty acid soap with a carbohydrate at high temperature (Journal of the American Oil Chemists' Society (1978) 55; 4; 398- 401). However, the disadvantage of this method is adverse reactions and the formation of colored by-products.

In accordance with the present invention, fatty acid carbohydrate esters are obtained by performing a transferase reaction using lecithin as a donor of a fatty acid and a carbohydrate such as glucose as an acceptor molecule.

The reaction is carried out in a flow reactor in which the lipid acyltransferase is immobilized on a solid support.

Execution method

100 g of glucose is dissolved in 1000 ml of water with stirring, then 200 g of phosphatidylcholine is dispersed in the aqueous phase with stirring and heated to 40 ° C.

The pH is adjusted to pH 6.5.

100 g of lipid acyltransferase from A. salmonicida immobilized on a solid support is introduced into the flow reactor.

The flow reactor is installed in a heat chamber at 40 ° C.

The reaction mixture is pumped into the column at a rate of 2 ml / min.

The reaction product is collected.

Water is removed from the reaction product in a thin-film vacuum evaporator and lipids are isolated.

The glucose ester is separated from other lipids by solvent fractionation.

Carbohydrate esters can be used in many applications, such as effective emulsifiers in the food and non-food industries.

Example 11. Obtaining a protein ester using the lipid acyltransferase of the present invention

In accordance with the present invention, fatty acid condensates of amino acids, peptides or proteins are obtained by performing a transferase reaction. In carrying out this reaction, phosphatidylcholine is used as a donor to transfer fatty acids to the free hydroxyl group of amino acids (such as tyrosine, verine or threonine) having a free hydroxyl group suitable for esterification.

Execution Method 1

50 g of 1-tyrosine (serine or threonine) is dissolved in 1000 ml of water with stirring, then 200 g of phosphatidylcholine is dispersed in the aqueous phase with stirring and heated to 40 ° C.

The pH is adjusted to pH 7 and the pH is maintained with NaOH or HCl.

Add 50 ml of the lipid acyltransferase enzyme from A. salmonicida and continue to interact with stirring at 40 ° C.

Samples are taken at specific time periods and analyzed by TLC and HPLC.

After 20 hours of reaction time, the reaction mixture reaches equilibrium, after which the reaction is stopped.

Tyrosine fatty acid condensate, lecithin and lysolecithin are isolated from the reaction medium by centrifugation using standard methods (see, for example, Centrifuges, Filtering in Ullmann's Encyclopedia of Industrial Chemistry (2002) by Wiley-VCH Verlag GmbH & Co. KgaA).

The tyrosine fatty acid condensate is further purified by hydrophobic interaction column chromatography, the fraction containing the tyrosine fatty acid condensate is separated, and the solvent is removed by evaporation. (See publication “Basic Principles of Chromatography” in Ullmann's Encyclopedia of Industrial Chemistry (2002) by Wiley-VCH Verlag GmbH & Co. KGaA).

Method 2

The transferase activity of lipid acyltransferase is tested in a substrate based on phosphatidylcholine and 1-tyrosine in accordance with the following method.

450 mg of phosphatidylcholine (> 95% PC Avanti, No. 441601) and 50 mg of 1-tyrosine are introduced into a Viton glass and 15 ml of 50 mM HEPES buffer, pH 7, are added. The lipid is dispersed in the indicated buffer with stirring.

The substrate is heated to 35 ° C, stirring with a magnetic stirrer, and 0.25 ml of transferase is added in an amount of 10 PLU / ml.

Samples of 2 ml are taken after 0, 5, 10, 15, 25, 40, and 60 minutes of the reaction time.

Immediately add 25 μl of a 4M HCl solution to acidify the free fatty acid and terminate the enzymatic reaction. 3.00 ml of chloroform is added and the sample is vigorously shaken in a vortex shaker for 30 seconds. The sample is centrifuged, 2 ml of the chloroform phase is separated and filtered through 0.45 μm filters in a 10 ml graduated Dram glass.

Chloroform was evaporated in a stream of nitrogen at 60 ° C and the sample was measured again. The extracted lipid was analyzed by TLC.

Example 12. Obtaining a hydroxy acid ester (in particular a lactic acid ester) using the lipid acyltransferase of the present invention

Fatty acid hydroxy acids are usually prepared by reacting fatty acids and hydroxy acids at high temperatures using inorganic salts or metal ions as catalysts (see, for example, Bailey's Industrial Oil and Fat Products, Fifth edition, Volume 3. Edible Oil and Fat Products: Products and Application Technology, page 502-511). However, the disadvantage of this method is adverse reactions and the formation of colored by-products.

In accordance with the present invention, fatty acid hydroxy acid esters are obtained by performing a transferase reaction using lecithin as a donor of a fatty acid and hydroxy acid (in particular lactic acid) as an acceptor molecule.

Execution method

50 g of lactic acid are dissolved in 1000 ml of water with stirring, then 200 g of phosphatidylcholine is dispersed in the aqueous phase with stirring and heated to 40 ° C.

The pH was adjusted to pH 6.5 and maintained at this pH with NaOH or HCl.

Add 50 ml of the lipid acyltransferase enzyme from A. salmonicida and continue to interact with stirring at 40 ° C.

Samples are taken at specific time periods and analyzed by TLC and GLC.

After 20 hours of reaction time, the reaction mixture reaches equilibrium, after which the reaction is stopped.

Lactic acid ester, lecithin and lysolecithin are isolated from the reaction medium by centrifugation by standard methods (see, for example, Centrifuges, Filtering in Ullmann's Encyclopedia of Industrial Chemistry (2002) by Wiley-VCH Verlag GmbH & Co. KgaA).

The lactic acid ester is further purified by molecular distillation to obtain a high purity fatty acid lactic acid ester.

Example 13. Obtaining a citric acid ester using the lipid acyltransferase of the present invention

Analysis of transferase in a substrate based on phosphatidylcholine and citric acid

The transferase activity of lipid acyltransferase from A. salmonicida was tested in a substrate based on phosphatidylcholine and citric acid in accordance with the following method.

450 mg of phosphatidylcholine (> 95% PC Avanti, No. 441601) and 50 mg of citric acid are introduced into a Viton glass and 15 ml of 50 mM HEPES buffer, pH 7, are added. The lipid is dispersed in the buffer with stirring.

The substrate is heated to 35 ° C, stirring with a magnetic stirrer, and 0.25 ml of lipid acyltransferase from A. salmonicida is added in an amount of 10 PLU / ml.

Samples of 2 ml are taken after 0, 5, 10, 15, 25, 40, and 60 minutes of the reaction time.

Immediately add 25 μl of a 4M HCl solution to acidify the free fatty acid and terminate the enzymatic reaction. 3.00 ml of chloroform is added and the sample is vigorously shaken in a vortex shaker for 30 seconds. The sample is centrifuged, 2 ml of the chloroform phase is separated and filtered through 0.45 μm filters in a 10 ml graduated Dram glass.

Chloroform was evaporated in a stream of nitrogen at 60 ° C and the sample was measured again. The extracted lipid was analyzed by TLC.

All publications cited in the above description of the invention are incorporated herein by reference. Various modifications and changes to the described methods and systems of the present invention, without departing from the scope of the present invention, should be apparent to those skilled in the art. Although the present invention has been described with specific preferred embodiments, it should be understood that the claimed invention cannot be unreasonably limited to specific embodiments. It is assumed that all possible modifications of the described embodiments of the invention, obvious to experts in the field of biochemistry, biotechnology or related fields, are included in the scope of the following claims.

Claims (18)

1. The method of obtaining one or more esters of carbohydrates, esters of proteins, esters of protein subunits, esters of hydroxyacids, which includes mixing an acyl donor, an acyl acceptor and water to form a medium with a high water content containing 5-98% water wherein said acyl donor is a lipid substrate selected from one or more representatives of the group consisting of phospholipid, lysophospholipid, triacylglyceride, diglyceride, glycolipid or lysoglyc an olipid, and said acyl acceptor is selected from one or more representatives of the group consisting of a carbohydrate, protein, protein subunit, or hydroxy acid; and contacting the mixture with a lipid acyltransferase, wherein said lipid acyltransferase catalyzes one or both of the following reactions: alcoholysis or transesterification, wherein the lipid acyltransferase is an enzyme having acyltransferase activity and containing a GDSX fragment of the amino acid sequence, where X is one or more of the following L, the following, , I, F, Y, H, Q, T, N, M, or S. 2. The method according to claim 1, where the lipid acyltransferase is immobilized. 3. The method according to claim 1, which comprises purifying the carbohydrate ester, protein ester, protein subunit ester, hydroxy acid ester. 4. The method according to any one of the preceding paragraphs, in which
the lipid acyltransferase enzyme contains H-309 or a histidine residue at the position corresponding to His-309 in the amino acid sequence of the Aeromonas hydrophila lipolytic enzyme represented as SEQ ID NO: 2 or SEQ ID NO: 32. 5. The method according to claim 1, in which the lipid acyltransferase is obtained from an organism belonging to one or more of the following genera: Aeromonas, Streptomyces, Saccharomyces, Lactococcus, Mycobacterium, Streptococcus, Lactobacillus, Desulfitobacterium, Bacillus, Campyloylbacterium, Campyloylbactae, Campyloylbacterium, Campyloylbactae, , Schizosaccharomyces, Listeria, Neisseria, Mesorhizobium, Ralstonia, Xanthomonas and Candida. 6. The method according to claim 1, in which the lipid acyltransferase contains one of the following amino acid sequences:
(i) the amino acid sequence of SEQ ID NO: 2;
(ii) the amino acid sequence of SEQ ID NO: 3;
(iii) the amino acid sequence of SEQ ID NO: 4;
(iv) the amino acid sequence of SEQ ID NO: 5;
(v) the amino acid sequence of SEQ ID NO: 6;
(vi) the amino acid sequence of SEQ ID NO: 12;
(vii) the amino acid sequence of SEQ ID NO: 20;
(viii) the amino acid sequence of SEQ ID NO: 22;
(ix) the amino acid sequence of SEQ ID NO: 24;
(x) the amino acid sequence of SEQ ID NO: 26;
(xi) the amino acid sequence of SEQ ID NO: 28;
(xii) the amino acid sequence of SEQ ID NO: 30;
(xiii) the amino acid sequence of SEQ ID NO: 32;
(xiv) the amino acid sequence of SEQ ID NO: 34, or
an amino acid sequence that is 75% or more identical to one of the sequences SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 12, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32 or SEQ ID NO: 34. 7. The method according to claim 1, where the lipid acyltransferase enzyme contains an amino acid sequence obtained by expression of one of the following nucleotide sequences:
(a) the nucleotide sequence of SEQ ID NO: 7 (see figure 9);
(b) the nucleotide sequence of SEQ ID NO: 8 (see figure 10);
(c) the nucleotide sequence of SEQ ID NO: 9 (see figure 11);
(d) the nucleotide sequence of SEQ ID No: 10 (see figure 12);
(e) the nucleotide sequence of SEQ ID NO: 11 (see figure 13);
(f) the nucleotide sequence of SEQ ID NO: 13 (see figure 15);
(g) the nucleotide sequence of SEQ ID NO: 21 (see figure 17);
(h) the nucleotide sequence of SEQ ID NO: 23 (see figure 19);
(i) the nucleotide sequence of SEQ ID NO: 25 (see figure 21);
(j) the nucleotide sequence of SEQ ID NO: 27 (see figure 23);
(k) the nucleotide sequence of SEQ ID NO: 29 (see figure 25);
(l) the nucleotide sequence of SEQ ID NO: 31 (see figure 27);
(m) the nucleotide sequence of SEQ ID NO: 33 (see figure 29);
(n) the nucleotide sequence of SEQ ID NO: 35 (see figure 31);
(o) or a nucleotide sequence that is 75% or more identical to one of the sequences SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO : 13, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33 or SEQ ID NO: 35 . 8. The method according to claim 1, in which the lipid acyltransferase is an immobilized lipid acyltransferase having acyltransferase activity and containing a fragment of the GDSX amino acid sequence, where X means one or more of the following amino acid residues L, A, V, I, F, Y, H, Q, T, N, M or S that contains H-309 or a histidine residue at a position corresponding to His-309 in the amino acid sequence of the Aeromonas hydrophila lipolytic enzyme represented by SEQ ID NO: 2 or SEQ ID NO: 32, and where the lipid acyltransferase enzyme contains about Well of the following sequences:
(i) the amino acid sequence of SEQ ID NO: 2;
(ii) the amino acid sequence of SEQ ID NO: 3;
(iii) the amino acid sequence of SEQ ID NO: 4;
(iv) the amino acid sequence of SEQ ID NO: 5;
(v) the amino acid sequence of SEQ ID NO: 6;
(vi) the amino acid sequence of SEQ ID NO: 12;
(vii) the amino acid sequence of SEQ ID NO: 20;
(viii) the amino acid sequence of SEQ ID NO: 22;
(ix) the amino acid sequence of SEQ ID NO: 24;
(x) the amino acid sequence of SEQ ID NO: 26;
(xi) the amino acid sequence of SEQ ID NO: 28;
(xii) the amino acid sequence of SEQ ID NO: 30;
(xiii) the amino acid sequence of SEQ ID NO: 32;
(xiv) the amino acid sequence of SEQ ID NO: 34 or an amino acid sequence that is 75% or more identical to one of the sequences SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 12, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32 or SEQ ID NO: 34,
or contains an amino acid sequence obtained by expression of one of the following nucleotide sequences:
(a) the nucleotide sequence of SEQ ID NO: 7 (see figure 9);
(b) the nucleotide sequence of SEQ ID NO: 8 (see figure 10);
(c) the nucleotide sequence of SEQ ID NO: 9 (see figure 11);
(d) the nucleotide sequence of SEQ ID NO: 10 (see figure 12);
(e) the nucleotide sequence of SEQ ID NO: 11 (see figure 13);
(f) the nucleotide sequence of SEQ ID NO: 13 (see figure 15);
(g) the nucleotide sequence of SEQ ID NO: 21 (see figure 17);
(h) the nucleotide sequence of SEQ ID NO: 23 (see figure 19);
(i) the nucleotide sequence of SEQ ID NO: 25 (see figure 21);
(j) the nucleotide sequence of SEQ ID NO: 27 (see figure 23);
(k) the nucleotide sequence of SEQ ID NO: 29 (see figure 25);
(1) the nucleotide sequence of SEQ ID NO: 31 (see figure 27);
(m) the nucleotide sequence of SEQ ID NO: 33 (see figure 29);
(n) the nucleotide sequence of SEQ ID NO: 35 (see figure 31); or
(o) a nucleotide sequence that is 75% or more identical to one of the sequences SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33 or SEQ ID NO: 35. 9. The method according to claim 8, where the immobilized lipid acyltransferase is obtained from an organism belonging to one or more of the following genera: Aeromonas, Streptomyces, Saccharomyces, Lactococcus, Mycobacterium, Streptococcus, Lactobacillus, Vulbillus, Campocelus bibillus, Campulus bacteria, Campus, Campanius, Campanus vulgaris, Campus , Schizosaccharomyces, Listeria, Neisseria, Mesorhizobium, Ralstonia, Xanthomonas and Candida. 10. The use of lipid acyltransferase to produce one or more carbohydrate esters, protein esters, protein subunit esters or hydroxy acid esters by catalysis of alcoholysis or transesterification or both of these reactions in a mixture of an acyl donor, an acyl acceptor and water containing 5-98 % of water, wherein said acyl donor is a lipid substrate selected from one or more representatives of the group consisting of phospholipid, lysophospholipid, triacylglycer yes, diglyceride, glycolipid or lysoglycolipid, said acyl acceptor is selected from one or more representatives of the group consisting of a carbohydrate, protein, protein subunit or hydroxy acid, and lipid acyltransferase is an enzyme having acyltransferase activity and containing a GDSX fragment of the amino acid sequence, where or several of the following amino acid residues L, A, V, I, F, Y, H, Q, T, N, M or S. 11. The use of claim 10, wherein the lipid acyltransferase is immobilized. 12. The use of claim 10, wherein the carbohydrate ester, protein ester, protein subunit ester or hydroxy acid ester is purified. 13. The use of claim 10, wherein the lipid acyltransferase enzyme contains H-309 or a histidine residue at a position corresponding to His-309 in the amino acid sequence of the Aeromonas hydrophila lipolytic enzyme represented by SEQ ID NO: 2 or SEQ ID NO: 32. 14. The use according to claim 10, where the lipid acyltransferase is obtained from an organism belonging to one or more of the following genera: Aeromonas, Streptomyces, Saccharomyces, Lactococcus, Mycobacterium, Streptococcus, Lactobacillus, Desulfitobacterium, Bacillus, Campyloylbacterium, Campyloylbacterium, Campyloylbacterae, Schizosaccharomyces, Listeria, Neisseria, Mesorhizobium, Ralstonia, Xanthomonas and Candida. 15. The use of claim 10, in which the lipid acyltransferase contains one of the following amino acid sequences:
(i) the amino acid sequence of SEQ ID NO: 2;
(ii) the amino acid sequence of SEQ ID NO: 3;
(iii) the amino acid sequence of SEQ ID NO: 4;
(iv) the amino acid sequence of SEQ ID NO: 5;
(v) the amino acid sequence of SEQ ID NO: 6;
(vi) the amino acid sequence of SEQ ID NO: 12;
(vii) the amino acid sequence of SEQ ID NO: 20;
(viii) the amino acid sequence of SEQ ID NO: 22;
(ix) the amino acid sequence of SEQ ID NO: 24;
(x) the amino acid sequence of SEQ ID NO: 26;
(xi) the amino acid sequence of SEQ ID NO: 28;
(xii) the amino acid sequence of SEQ ID NO: 30;
(xiii) the amino acid sequence of SEQ ID NO: 32;
(xiv) the amino acid sequence of SEQ ID NO: 34, or an amino acid sequence that is 75% or more identical to one of the sequences SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 12, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO : 32 or SEQ ID NO: 34. 16. The use of claim 10, where the lipid acyltransferase enzyme contains an amino acid sequence obtained by expression of one of the following nucleotide sequences:
(a) the nucleotide sequence of SEQ ID NO: 7 (see figure 9);
(b) the nucleotide sequence of SEQ ID NO: 8 (see figure 10);
(c) the nucleotide sequence of SEQ ID NO: 9 (see figure 11);
(d) the nucleotide sequence of SEQ ID NO: 10 (see figure 12);
(e) the nucleotide sequence of SEQ ID NO: 11 (see figure 13);
(f) the nucleotide sequence of SEQ ID NO: 13 (see figure 15);
(g) the nucleotide sequence of SEQ ID NO: 21 (see figure 17);
(h) the nucleotide sequence of SEQ ID NO: 23 (see figure 19);
(i) the nucleotide sequence of SEQ ID NO: 25 (see figure 21);
(j) the nucleotide sequence of SEQ ID NO: 27 (see figure 23);
(k) the nucleotide sequence of SEQ ID NO: 29 (see figure 25);
(l) the nucleotide sequence of SEQ ID NO: 31 (see figure 27);
(m) the nucleotide sequence of SEQ ID NO: 33 (see figure 29);
(n) the nucleotide sequence of SEQ ID NO: 35 (see figure 31); or
(o) a nucleotide sequence that is 75% or more identical to one of the sequences SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33 or SEQ ID NO: 35. 17. The use of claim 10, where the lipid acyltransferase is an immobilized lipid acyltransferase having acyltransferase activity and containing a GDSX fragment of the amino acid sequence, where X means one or more of the following amino acid residues L, A, V, I, F, Y, H, Q, T , N, M or S, which contains H-309 or a histidine residue at the position corresponding to His-309 in the amino acid sequence of the Aeromonas hydrophila lipolytic enzyme represented as SEQ ID NO: 2 or SEQ ID NO: 32, and where the lipid acyltransferase enzyme contains t one of the following sequences:
(i) the amino acid sequence of SEQ ID NO: 2;
(ii) the amino acid sequence of SEQ ID NO: 3;
(iii) the amino acid sequence of SEQ ID NO: 4;
(iv) the amino acid sequence of SEQ ID NO: 5;
(v) the amino acid sequence of SEQ ID NO: 6;
(vi) the amino acid sequence of SEQ ID NO: 12;
(vii) the amino acid sequence of SEQ ID NO: 20;
(viii) the amino acid sequence of SEQ ID NO: 22;
(ix) the amino acid sequence of SEQ ID NO: 24;
(x) the amino acid sequence of SEQ ID NO: 26;
(xi) the amino acid sequence of SEQ ID NO: 28;
(xii) the amino acid sequence of SEQ ID NO: 30;
(xiii) the amino acid sequence of SEQ ID NO: 32;
(xiv) the amino acid sequence of SEQ ID NO: 34, or an amino acid sequence that is 75% or more identical to one of the sequences SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 12, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO : 32 or SEQ ID NO: 34,
or containing an amino acid sequence obtained by expression of one of the following nucleotide sequences:
(a) the nucleotide sequence of SEQ ID NO: 7 (see figure 9);
(b) the nucleotide sequence of SEQ ID NO: 8 (see figure 10);
(c) the nucleotide sequence of SEQ ID NO: 9 (see figure 11);
(d) the nucleotide sequence of SEQ ID NO: 10 (see figure 12);
(e) the nucleotide sequence of SEQ ID NO: 11 (see figure 13);
(f) the nucleotide sequence of SEQ ID NO: 13 (see figure 15);
(g) the nucleotide sequence of SEQ ID NO: 21 (see figure 17);
(h) the nucleotide sequence of SEQ ID NO: 23 (see figure 19);
(i) the nucleotide sequence of SEQ ID NO: 25 (see figure 21);
(j) the nucleotide sequence of SEQ ID NO: 27 (see figure 23);
(k) the nucleotide sequence of SEQ ID NO: 29 (see figure 25);
(l) the nucleotide sequence of SEQ ID NO: 31 (see figure 27);
(m) the nucleotide sequence of SEQ ID NO: 33 (see figure 29);
(n) the nucleotide sequence of SEQ ID NO: 35 (see figure 31); or (o) a nucleotide sequence that is 75% or more identical to one of the sequences SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO : 13, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33 or SEQ ID NO: 35 . 18. The use according to claim 17, wherein the lipid acyltransferase is obtained from an organism belonging to one or more of the following genera: Aeromonas, Streptomyces, Saccharomyces, Lactococcus, Mycobacterium, Streptococcus, Lactobacillus, Desulfitobacterium, Vacillobus bollillae, Campylobolae bacillus, Campylobulus Schizosaccharomyces, Listeria, Neisseria, Mesorhizobium, Ralstonia, Xanthomonas and Candida.

Images