RU2376868C2 - Method - Google Patents

Abstract

FIELD: biotechnologies.

SUBSTANCE: invention is related to biotechnology and represents method of in situ production in food product of emulsifier, in which lipid-acyltransferase is added to food product. At the same time lipid-acyltransferase is such that is able to transfer acyl group from lipid to one or several acceptors of acyl and includes fragment of aminoacids sequence GDSX, where X represents one or several of aminoacid residues L, A, V, I, F, Y, H, Q, T, N, M or S.

EFFECT: invention makes it possible to produce emulsifier without increase of free fatty acid content in food product.

24 cl, 73 dwg, 35 tbl, 22 ex

Description

Links to related applications

References are made to the following related applications: US Application Serial Number 09/750990, filed July 20, 1999, and US Application Serial Number 10/409391. Each of these applications and each of the documents cited in these applications ("documents cited in applications"), and each document mentioned or cited in documents cited in applications, or in the text, or during the consideration of the case for these applications, as well as all arguments in support of patentability made during such a review are hereby incorporated by reference. Various documents are also cited in this text ("documents cited here"). Each of the documents cited here and each document cited or referred to in the documents cited here are hereby incorporated by reference.

Field of Invention

The present invention relates to a method for producing an in situ emulsifier inside a food product using lipid acyltransferase.

The present invention also relates to a method for producing an in situ emulsifier inside a food product using lipid acyltransferase, wherein the method is such that the emulsifier is formed without or without a substantial increase in the fatty acid content of the food product.

The present invention also relates to a method for in situ preparation of at least two emulsifiers inside a food product using lipid acyltransferase.

The present invention also relates to a method for producing an in situ carbohydrate ester and / or sterol ester and / or stanol ester and / or protein ester and / or glycerol ester and / or hydroxy acid ester inside a food product by using lipid acyltransferase.

The present invention relates to a food enzyme composition and / or to a feed enzyme composition that contains a lipid acyltransferase, and to the use of such a composition in the methods of the present invention.

The present invention also relates to a method for detecting suitable lipid acyltransferases in accordance with the present invention and to lipid acyltransferases thus identified.

The present invention also relates to immobilized lipid acyltransferase.

State of the art

The benefits of phospholipases and lipases (called lipolytic enzymes (EC.3,1.1.x) used in food and / or feed industrial applications have been known for many years.

For example, in EP 0585988 it is stated that the addition of lipase to the dough leads to an improvement in the effect of resistance to solidification. It is believed that lipase derived from Rhizopus arrhizus added to the dough can improve the quality of the resulting bread when used in combination with cooking oil / fat. WO 94/04035 indicates that improved softness can be achieved by adding lipase to the dough without adding any additional fat / oil to the dough. Castello, P. ESEGP 89-10 Dec. 1999, Helsinki shows that exogenous lipases can modify the volume of bread.

Lipolytic enzymes hydrolyze one or more fatty acids from lipids present in the food product, which can lead to the formation of strong emulsifier molecules inside the food product, which provides commercially valuable functions. The molecules that contribute to the most important characteristics of the emulsifier are products of partial hydrolysis, such as lysophospholipids, lysoglycolipids and monoglyceride molecules. Polar lipid hydrolysis products, such as lysophospholipids and lysoglycolipids, are particularly useful. In the manufacture of bread, such in situ formed emulsifiers can provide equivalent functionality to emulsifiers such as DATEM.

However, the activity of lipolytic enzymes also results in the accumulation of fatty acids, which leads to harmful functionality in the food product. Such an innate activity of lipolytic enzymes limits their effectiveness.

In practice, numerous attempts have been made to solve this problem. However, they resulted in a significant increase in the content of free fatty acids in the food product, including, in particular, but not limited to, bread dough and egg yolk.

Phospholipases, especially phospholipase A2 (E.C. 3.1.1.4), have been used for many years to process eggs or egg-based products (see, for example, US 4034124 and Dutihl & Grogert, 1981, J.Sci. Food Agric 32, 451-458). The activity of phospholipase during the processing of eggs or egg-based products results in the accumulation of polar lysolecithin, which can act as an emulsifier. Phospholipase treatment of eggs or egg-based products can improve stability, thermal stability during heat treatment, such as pasteurization, and result in significant thickening. Egg-based foods may include, but are not limited to, muffins, mayonnaise, salad dressings, sauces, ice creams, and the like. The use of phospholipases results in the accumulation of free fatty acids. The accumulation of free fatty acids can lead to a significant loss of taste. In addition, the accumulation of free fatty acids can lead to an increased susceptibility to oxidation and, consequently, leads to poor preservation, discoloration of the product and a change in other critical characteristics of the food product, such as taste and texture. Recently, lipolytic enzymes with a broader substrate specificity have been put on the market for processing egg yolk and related food products. They have the advantage that, unlike most phospholipases A2, they are not produced from raw materials derived from mammals. However, they lead to a significant accumulation of free fatty acids as a result of hydrolysis of not only phospholipids, but also triglycerides.

As mentioned above, another area in which lipases are widely used is baking. The use of phospholipases in the baking industry dates back to the early 1980s.

The substrate for lipases in wheat flour is 1.5-3% endogenous wheat lipids, which are a complex mixture of polar and non-polar lipids. Polar lipids can be divided into glycolipids and phospholipids. Such lipids are formed by glycerol esterified with two fatty acids and a polar group. The polar group imparts surface activity to such lipids. Enzymatic cleavage of one of the fatty acids in such lipids results in lipids with much greater surface activity. It is well known that emulsifiers with high surface activity, such as DATEM, are very functional when added to the dough.

However, the use of lipases (EC 3.1.1.X) in dough products can have a harmful effect on yeast activity and / or adversely affect the volume of bread. A negative effect on the volume of bread is often explained by an overdose. An overdose can lead to a decrease in gluten elasticity to produce a dough that becomes too hard, resulting in a reduced volume of bread. In addition or alternatively, such lipases can decompose cooking oil, butter or milk fat added to the dough, resulting in a loss of taste of the dough and the baked product. Overdose and loss of taste are attributed to the accumulation of fatty acids in the test.

In EP 1193314, EP 0977869, as well as in WO 01/39602 it was reported that the use of lipolytic enzymes active against glycolipids proved to be especially advantageous when used in bread baking, since it was found that the products of partial hydrolysis, lysoglycolipids have very high emulsifying functionality, clearly leading to a higher proportion of positive emulsifying functionality compared to the harmful accumulation of free fatty acids. However, it was also found that the enzymes have significant non-selective activity with respect to triglyceride, which leads to an unnecessarily high content of free fatty acid.

The same observations are reported in WO 00/32758, which describes lipolytic enzyme variants with improved activity against phospholipids and / or glycolipids in addition to variants that favor long chain fatty acids rather than short chain ones. This latter feature, also described in WO 01/39602, was considered particularly important for preventing loss of taste associated with the accumulation of short chain free fatty acids. However, a significant amount of free fatty acids was formed.

The problem of high activity with respect to triglyceride was considered in WO 02/094123, which proposes the use of lipolytic enzymes that are active against polar lipids (i.e. glycolipids and phospholipids) in the test, but are practically inactive with respect to triglycerides or 1-monoglycerides. However, a significant amount of free fatty acids was formed.

Some lipolytic enzymes have low activity or lack of activity for the lysoforms of polar lipids (i.e. glycolipids / phospholipids). The use of such enzymes was considered preferable because they guarantee the accumulation of highly polar lysolipids, resulting in optimal functionality. However, free fatty acids accumulate. Such selective functionality is characteristic of the phospholipase A2 and glycolipase enzymes described in EP 0977869, EP 1193314 and WO 01/39602. An enzyme variant was obtained with less selective lipolytic enzymes that have lower activity with respect to lysolar polar lipids compared to the parent enzyme (WO 03/060112). However, a significant amount of free fatty acids was formed.

WO 00/05396 describes a method for producing a food product containing an emulsifier, where the food material is contacted with an enzyme such that the emulsifier is formed by an enzyme from a fatty acid ester, and the second functional ingredient is formed from a second moiety. WO 00/05396 describes the use, in particular, of a lipase or esterase enzyme. Nowhere in WO 00/05396 there is no indication of the specific use of acyltransferase. In addition, in foods with a high water content, the use of esterases and lipases, as proposed in WO 00/05396, should lead to a significant accumulation of free fatty acids.

A disadvantage associated with the use of lipases, including phospholipases and glycolipases, may be due to the formation of free fatty acids released from lipids. Over the past couple of decades, the use of lipolytic enzymes in foods has been limited by the balance between the harmful accumulation of free fatty acids and the formation of lysolipids, which provides positive functionality. Although numerous strategies have been proposed in this area, some of which have provided significant improvements in functionality, none of them have solved the completely fundamental problem, i.e. significant accumulation of free fatty acids in a food product prepared using in situ lipolytic enzymes.

The presence of high concentrations of free fatty acids (FFAs) in raw materials or food products is usually considered a quality defect, and food manufacturers and customers should usually include the maximum content of FFAs in food specifications. The effects obtained with excessive levels of FFA can be organoleptic and / or functional defects.

The result of lipolysis is hydrolytic rancidity with the formation of a characteristic "soapy" taste. This “soapy” taste is especially acute with intermediate chain length fatty acids (C8-C12), which, although not present in high concentrations, can be important constituents, for example, dairy products or vegetable oils. A more common organoleptic defect is due to the combined action of lipolytic enzymes and oxidation processes. Unsaturated fatty acids are more susceptible to oxidation when they are unesterified than when they are esterified into acyl lipids.

Functional defects of the food product caused by high concentrations of FFA are detectable, but not so easily explained. Not wanting to be bound by theory, hydrolysis of unchanged lipids into carboxylic acids will increase [H ⁺ ] and give carbonyl groups that can combine with other compounds or with metal ions. Free fatty acids also attach proteins through hydrophobic interactions and can form complexes with starch during cooking. FFAs may also interfere with the action of surface active agents such as polar lipids and emulsifiers (Lipid in Cereal Technology, PJ Barnes, Academic Press 1983).

WO 03/100044 describes a class of acyltransferases known as PDAT (or ATWAX). Such enzymes use a monoglyceride or diglyceride as an acceptor molecule and phosphatidylcholine (PF) as a donor molecule to form the following products: lysophosphatidylcholine and triacylglycerol and / or diacetylglycerol.

In one embodiment, the present invention relates to improvements in the incorporation of whey proteins into a food product, providing improved yields without compromising the quality - such as texture - of food products.

Cheese compositions are usually prepared from milk liquids in a manner that includes treating the liquid with a coagulating or coagulating agent. The coagulating agent may be a curdling enzyme, an acid, or a suitable bacterial culture, or it may include such a culture. The resulting cottage cheese usually includes transformed casein, fats, including natural oil fat, and flavors that appear especially when using a bacterial culture. Cottage cheese can be separated from liquid whey, which contains soluble proteins that are not affected by coagulation and which therefore are not included in the cottage cheese.

Thus, whey is a byproduct of production in industrial processes for the production of food products, such as cheeses. Traditionally, whey is removed as waste, or used as fertilizer or as livestock feed, or processed into food ingredients.

The inability of whey proteins to be substantially retained in cottage cheese is a significant factor contributing to the insufficient efficiency of conventional production of dairy products, such as cheese curds, and to reducing the overall yield related to the inclusion of all solid proteins that are present in the original milk liquids in the resulting cheese curds .

There have been numerous attempts to incorporate whey proteins into cheese, for example by heat treatment of milk, heat treatment of whey or filtration, such as ultrafiltration.

There are also several descriptions of the use of specific proteinases in order to induce the aggregation of serum proteins. Serine proteinase derived from Bacillus licheniformis has been shown to have the ability to induce the aggregation of serum proteins (US 5523237).

However, there remain many difficulties associated with the incorporation of whey proteins into processes such as cheese production. For example, the introduction of whey protein into cheeses is associated with a deterioration in the taste of the product and the sensation in the mouth and, in addition, tends to interfere with the curd and subsequent processing of the product. Proteinases previously reported to be added to cheese milk for hydrolysis of whey proteins result in significant hydrolysis of caseins, as described by Madsen, JS & Qvist, KB (1997) Hydrolysis of milk protein by a Bacillus licheniformis protease specific for acidic amino acid residues. J. Food Sci. 62, 579-582.

Thus, there is a need for methods and compositions that are intended for improved incorporation of whey protein into food products, while maintaining organoleptic and other desirable properties. Such optimization should result in increased efficiency, higher food yields, and a reduction in overall material costs.

Lipase: cholesterol acyltransferases have been known for some time (see, for example, Buckley - Biochemistry, 1983, 22, 5490-5493). In particular, glycerophospholipid: cholesterol acyltransferase (GCAT) was found, which, like lecithin: cholesterol acyltransferase (LCAT) of plant and animal origin, can catalyze the transfer of fatty acid between phosphatidylcholine and cholesterol.

Upton and Buckley (TIBS 20, May 1975 p. 178-179) and Brumlik and Buckley (J. of Bacteriology Apr. 1996 p. 2060-2064) report a lipase / acyltransferase from Aeromonas hydrophila , which has the ability of acyl transfer to alcohol acceptors in the aquatic environment.

The essence and aspects of the present invention

According to a first aspect of the present invention, there is provided a method for producing an in situ emulsifier in a food product, wherein the method comprises the step of adding a lipid acyltransferase to the food product as defined herein.

In a further aspect, the present invention relates to a method for producing an in situ emulsifier in a food product, wherein the method is such that the emulsifier is formed without or without a substantial increase in the content of free fatty acids in the food product, and where the method comprises the step of adding a lipid acyltransferase to the food product .

In another aspect, the present invention relates to a method for producing an in situ emulsifier and / or sterol ester and / or stanol ester in a food product, wherein the method is such that the emulsifier is formed without or without a substantial increase in the content of free fatty acids in the food product, and where the method comprises the step of adding a lipid acyltransferase to the food product.

In another aspect, the present invention relates to a method for producing an in situ emulsifier and / or sterol ester and / or stanol ester in a food product, wherein the method comprises the step of adding a lipid acyltransferase to the food product.

According to another aspect of the present invention, there is provided a method for producing at least two emulsifiers in a food product in situ , wherein the method comprises the step of adding a lipid acyltransferase to the food product.

According to a further aspect of the present invention, there is provided a method for producing at least two emulsifiers and / or sterol ester and / or stanol ester in a food product in situ , wherein the method is such that the emulsifier is formed without or without a substantial increase in the content of free fatty acids in food product, and where the method includes the step of adding to the food product lipid acyltransferase.

According to a further aspect of the present invention, there is provided a method for producing at least two emulsifiers and / or sterol ester and / or stanol ester in a food product in situ , wherein the method comprises the step of adding a lipid acyltransferase to the food product.

In a further aspect, the present invention relates to a method for producing an in situ carbohydrate ester in a food product, the method comprising the step of adding a lipid acyltransferase to the food product.

In another aspect, the present invention relates to a method for producing an in situ carbohydrate ester in a food product together with an emulsifier, wherein the method comprises the step of adding a lipid acyltransferase to the food product.

In another aspect, the present invention relates to a method for producing an in situ emulsifier and one or more compounds of a carbohydrate ester, sterol ester, stanol ester, protein ester, monoglyceride or diglyceride in a food product, the method comprising the step of adding a lipid acyltransferase to the food product.

According to a further aspect of the present invention, there is provided a method for preparing a food product comprising an emulsifier, wherein the method comprises the step of adding a lipid acyltransferase to the food product as defined herein.

In a further aspect, the present invention relates to a method for producing a food product comprising an emulsifier, where the method is such that the emulsifier is formed without or without a substantial increase in the content of free fatty acids in the food product, and where the method comprises the step of adding lipid acyltransferase to the food product.

In another aspect, the present invention relates to a method for producing a food product comprising an emulsifier and / or sterol ether and / or stanol ether, wherein the method is such that the emulsifier is formed without or without a substantial increase in the content of free fatty acids in the food product, and where the method includes the step of adding to the food product lipid acyltransferase.

In another aspect, the present invention relates to a method for producing a food product comprising an emulsifier and / or sterol ether and / or stanol ether, wherein the method comprises the step of adding a lipid acyltransferase to the food product.

According to a further aspect of the present invention, there is provided a method for producing a food product comprising at least two emulsifiers, wherein the method comprises the step of adding a lipid acyltransferase to the food product.

According to a further aspect of the present invention, there is provided a method for producing a food product comprising at least two emulsifiers and / or sterol ether and / or stanol ether, wherein the method is such that the emulsifier is formed without or without a substantial increase in the content of free fatty acids in the food a product, and wherein the method comprises the step of adding a lipid acyltransferase to the food product.

According to a further aspect of the present invention, there is provided a method for producing a food product comprising at least two emulsifiers and / or sterol ether and / or stanol ether, wherein the method comprises the step of adding a lipid acyltransferase to the food product.

In a further aspect, the present invention relates to a method for producing a food product comprising a carbohydrate ester, wherein the method comprises the step of adding a lipid acyltransferase to the food product.

In a further aspect, the present invention relates to a method for producing a food product comprising a carbohydrate ester and an emulsifier, wherein the method comprises the step of adding a lipid acyltransferase to the food product.

In another aspect, the present invention relates to a method for producing a food product comprising an emulsifier and one or more compounds of a carbohydrate ester, sterol ester, stanol ester, protein ester, monoglyceride or diglyceride, wherein the method comprises the step of adding a lipid acyltransferase to the food product.

In another aspect, the present invention relates to the use of a lipid acyltransferase for the preparation of a food product from an edible material, including an emulsifier, wherein the emulsifier is formed from constituents of the edible material using lipid acyltransferase.

In a further aspect, the present invention relates to the use of a lipid acyltransferase for the preparation of a food product from an edible material, including an emulsifier, wherein the emulsifier is formed without or without a substantial increase in the content of free fatty acids in the food product and where the emulsifier is formed from the constituents of the food material using lipid acyltransferases.

In another aspect, the present invention relates to the use of a lipid acyltransferase for the preparation of a food product from an edible material, including an emulsifier and / or sterol ester and / or stanol ester, where the emulsifier is formed without or without a significant increase in the content of free fatty acids in the food product and where the emulsifier and / or sterol ester and / or stanol ester is formed from the constituents of the food material using lipid acyltransferase.

In another aspect, the present invention relates to the use of a lipid acyltransferase for the preparation of a food product from an edible material comprising an emulsifier and / or sterol ester and / or stanol ether, where the emulsifier and / or sterol ester and / or stanol ester is formed from constituents of food material using lipid acyltransferase.

In another aspect, the present invention relates to the use of a lipid acyltransferase to produce a food product from a food material comprising at least two emulsifiers, where two emulsifiers are formed from constituents of the food material using lipid acyltransferase.

According to a further aspect of the present invention, there is provided the use of a lipid acyltransferase for preparing a food product from a food material comprising at least two emulsifiers and / or sterol ether and / or stanol ether, where emulsifiers are formed without or without a significant increase in the content of free fatty acids in a food product and where one or both of the emulsifiers and / or sterol ether and / or stanol ether are formed from the constituents of the food material using lipid acyltransferase.

According to a further aspect of the present invention, there is provided the use of a lipid acyltransferase for preparing a food product from a food material comprising at least two emulsifiers and / or sterol ether and / or stanol ether, where one or both of emulsifiers and / or sterol ether, and / or stanol ether is formed from the constituents of the food material using lipid acyltransferase.

In a further aspect, the invention relates to the use of a lipid acyltransferase for preparing a food product from a food material, including a carbohydrate ester, wherein the carbohydrate ester is formed from the constituents of the food material using lipid acyltransferase.

In another aspect, the present invention relates to the use of a lipid acyltransferase to produce a food product from a food material comprising at least a carbohydrate ester and an additional emulsifier, wherein the carbohydrate ester and emulsifier are formed from the constituents of the food material using lipid acyltransferase.

In another aspect, the present invention relates to the use of a lipid acyltransferase for the preparation of a food product from an edible material, comprising an emulsifier and one or more compounds of a carbohydrate ester, sterol ester, stanol ester, protein ester, monoglyceride or diglyceride, where the emulsifier and / or ester carbohydrate, and / or sterol ether, and / or stanol ether, and / or protein ester, and / or monoglyceride, and / or diglyceride are formed from the constituents of the food material using lipid acyltransferase.

According to a further aspect of the present invention, there is provided a method for producing an in situ emulsifier, preferably lysolecithin and sterol ester, in an egg-based food product, wherein the method is such that the emulsifier is formed without or without a substantial increase in the content of free fatty acids in the food product, and where the method includes the step of adding to the food product lipid acyltransferase.

According to a further aspect of the present invention, there is provided a method for producing an in situ emulsifier, preferably lysolecithin and sterol ester, in an egg-based food product, wherein the method comprises the step of adding a lipid acyltransferase to the food product.

In another aspect, the present invention relates to a method for producing an egg-based food product comprising an emulsifier, preferably lysolecithin and sterol ester in an egg-based food product, wherein the emulsifier is formed without or without a substantial increase in the content of free fatty acids in the food product and where includes the step of adding a lipid acyltransferase to the food product.

In another aspect, the present invention relates to a method for producing an egg-based food product comprising an emulsifier, preferably lysolecithin and sterol ester in an egg-based food product, and wherein the method comprises the step of adding a lipid acyltransferase to the food product.

In a further aspect, the present invention relates to a food product that can be obtained, and preferably, which is obtained by the method according to the present invention.

In another aspect, the present invention further relates to a food enzyme composition and / or to a feed enzyme composition that contains a lipid acyltransferase, and to the use of such a composition in the methods of the present invention.

In accordance with a further aspect of the present invention, there is provided a method for identifying a suitable lipid acyltransferase for use in accordance with the present invention, comprising the steps of testing the target enzyme in one or more of the “Transferase Assay in a Low-Water Medium”, “Transferase Assay in a Highly Irrigated Egg Yolk” or "Analysis of transferase in a buffered substrate" and the choice of lipid acyltransferase, if it is one that has one or more of the following characteristics:

(a) when tested using a “Transferase Assay in a Low-Water Medium”, when measured after a period of time selected from 30, 20 or 120 minutes, has a relative transferase activity of at least 1%; (b) when tested using the “Highly watered egg yolk transferase assay” with 54% water, has a relative transferase activity of up to 100%; or (c) when tested using the “Transferase assay in buffered substrate” test, it has at least 2% acyltransferase activity .

The present invention also relates to lipid acyltransferase identified using the method of the present invention.

In accordance with a further aspect, the present invention relates to an immobilized lipid acyltransferase enzyme as defined herein.

Detailed aspects of the present invention

The term "lipid acyltransferase", as used here, means an enzyme that exhibits lipase activity (usually classified as E.C. 3.1.1.x in accordance with the Recommendations on the Enzyme Nomenclature (1992) of the Nomenclature Commission of the International Union for Biochemistry and molecular biology) and acyltransferase activity (usually classified as E.C. 2.3.1.x), due to which the enzyme is able to transfer the acyl group from a lipid to one or more acceptor substrates, such as one or more of the following: ol, stanol, carbohydrate, protein, protein subunit, glycerin.

Preferably, the lipid acyltransferase for use in the methods and / or applications of the present invention is capable of transferring an acyl group from a lipid (as defined herein) to one or more of the following acceptor substrates: sterol, stanol, carbohydrate, protein, or its subunit or glycerin .

For some aspects, the “acyl acceptor” according to the present invention can be any compound comprising a hydroxyl group (—OH), such as, for example, polyhydric alcohols, including glycerol, sterol, stanols, carbohydrates, hydroxy acids, including fruit acids, citric acid, tartaric acid acid, lactic acid and ascorbic acid, proteins or their subunits, such as, for example, amino acids, protein hydrolysates and peptides (partially hydrolyzed proteins), and mixtures and derivatives thereof. Preferably, the “acyl acceptor” according to the present invention is not water.

In one embodiment, the acyl acceptor is preferably not a monoglyceride and / or diglyceride.

In one aspect, the enzyme is preferably capable of transferring an acyl group from a lipid to sterol and / or stanol.

In one aspect, the enzyme is preferably capable of transferring an acyl group from lipid to carbohydrate.

In one aspect, the enzyme is preferably capable of transferring an acyl group from a lipid to a protein or to its subunit. Suitable protein subunits may be one or more of the following: amino acid, protein hydrolyzate, peptide, dipeptide, oligopeptide, polypeptide.

Preferably, in the protein or protein subunit, the acyl acceptor may be one or more of the following components of the protein or protein subunit: serine, threonine, tyrosine or cysteine.

When the protein subunit is an amino acid, typically the amino acid may be any suitable amino acid. A suitable amino acid may be one or more of serine, threonine, tyrosine or cysteine.

In one aspect, the enzyme is preferably capable of transferring an acyl group from lipid to glycerin.

In one aspect, the enzyme is preferably capable of transferring an acyl group from a lipid to a hydroxy acid.

In one aspect, the enzyme is preferably capable of transferring an acyl group from a lipid to a polyhydric alcohol.

In one aspect, a lipid acyltransferase can both transfer an acyl group from lipid to sterol and / or stanol, and transfer an acyl group to one or more of the following compounds: carbohydrate, protein, protein subunit, glycerol.

Preferably, the lipid substrate on which the lipid acyltransferase according to the present invention acts is one or more of the following lipids: a phospholipid, such as lecithin, for example phosphatidylcholine, triglyceride, cardiolipin, diglyceride or glycolipid, such as, for example, digalactosyldigly digly Such a lipid substrate may be referred to herein as an “acyl lipid donor". The term "lecithin", as used here, encompasses phosphatidylcholine, phosphatidylethanolamine, phosphatidylinositol, phosphatidylserine and phosphatidylglycerol.

For some aspects, preferably, the lipid substrate on which the lipid acyltransferase acts is a phospholipid, such as lecithin, for example phosphatidylcholine.

For some aspects, the lipid substrate is preferably a glycolipid, such as, for example, DGDG.

Preferably, the lipid substrate is a food lipid, in other words, the lipid component of the food product.

For some aspects, preferably, the lipid acyltransferase according to the present invention is incapable or practically incapable of acting on a triglyceride and / or 1-monoglyceride and / or 2-monoglyceride.

Typically, the lipid substrate or the acyl lipid donor may be one or more lipids present in one or more substrates: fats, including lard, tall and butter, oils, including oils extracted from or derivatives of palm oil, sunflower oil, soybean oil, safflower oil, cottonseed oil, peanut oil, corn oil, olive oil, peanut oil, coconut oil and rapeseed oil. Lecithin from soy, canola oil or egg yolk is also a suitable lipid substrate. The lipid substrate may be oat lipid or other plant-based material containing galactolipids.

In one aspect, the acyl lipid donor is preferably egg yolk lecithin (such as phosphatidylcholine).

For some aspects of the present invention, the lipid may be selected from lipids having a fatty acid chain of 8 to 22 carbon atoms in length.

For some aspects of the present invention, the lipid may be selected from lipids having a fatty acid chain of 16 to 22 carbon atoms in length, more preferably 16 to 20 carbon atoms.

For some aspects of the present invention, the lipid may be selected from lipids having a fatty acid chain of no more than 14 carbon atoms, usually from lipids having a fatty acid chain of 4 to 14 carbon atoms, preferably from 4 to 10 carbon atoms, usually from 4 to 8 carbon atoms.

Typically, the lipid acyltransferase according to the present invention may exhibit one or more of the following lipase activities: glycolipase activity (ES 3.1.1.26), triacylglycerol lipase activity (ES 3.1.1.3), phospholipase A2 activity (ES 3.1 .1.4) or phospholipase A1 activity (E.C. 3.1.1.32). The term "glycolipase activity," as used herein, encompasses galactolipase activity.

Typically, the lipid acyltransferase according to the present invention may have at least one or more of the following lipase activities: glycolipase activity (E.C. 3.1.1.26), and / or phospholipase A1 activity (E.C. 3.1.1.32), and / or phospholipase A2 activity (E.C. 3.1.1.4).

For some aspects, the lipid acyltransferase according to the present invention may have at least glycolipase activity (EC 3.1.1.26).

For some aspects, preferably, the lipid acyltransferase according to the present invention is capable of transferring an acyl group from a glycolipid and / or phospholipid to sterol and / or stanol, forming at least a sterol ester and / or stanol ester.

For some aspects, preferably, the lipid acyltransferase according to the present invention is capable of transferring an acyl group from a glycolipid and / or phospholipid to a carbohydrate, forming at least a carbohydrate ester.

For some aspects, preferably, the lipid acyltransferase according to the present invention is capable of transferring an acyl group from a glycolipid and / or phospholipid to a protein, forming at least a protein ester (or a protein and fatty acid condensate).

For some aspects, preferably, the lipid acyltransferase according to the present invention is capable of transferring an acyl group from a glycolipid and / or phospholipid to glycerol, forming at least diglyceride and / or monoglyceride.

For some aspects, preferably, the lipid acyltransferase according to the present invention does not exhibit triacetylglyceride lipase activity (EC 3.1.1.3).

In some aspects, a lipid acyltransferase may be capable of transferring an acyl group from a lipid to sterol and / or stanol. Thus, in one embodiment, the “acyl acceptor” according to the present invention can be either sterol or stanol, or a combination of both sterol and stanol.

In one embodiment, a suitable sterol and / or stanol may include one or more of the following structural elements:

i) a 3-beta hydroxy group or a 3-alpha hydroxy group; and / or

ii) A: The ring in the cis position, or A: The ring in the trans position, or C ₅ -C ₆ is unsaturated.

Suitable sterile acyl acceptors include cholesterol and phytosterols, for example alpha-sitosterol, beta-sitosterol, stigmasterol, ergosterol, campestrol, 5,6-dihydrosterol, brassicasterol, alpha-spinasterol, beta-spinasterol, gamma-spinasterol, gamma-spinasterol, gamma-spinasterol, gamma-spinsterol, dimosterol, ascosterol, silver polystyrene, episterol, anasterol, hyposterol, chondrylasterol, desmosterol, chalinosterol, poriferrasterol, clionasterol, sterol gltcosides and other natural or synthetic isomeric forms and derivatives.

In one aspect of the present invention, preferably more than one sterol and / or stanol can act as an acyl acceptor, typically more than two sterols and / or stanol can act as an acyl acceptor. In other words, in one aspect of the present invention, more than one sterol ester and / or stanol ester can suitably be formed. Accordingly, when cholesterol is an acyl acceptor, one or more additional sterols can also act as acyl acceptors. Thus, in one aspect, the present invention provides a method for producing in situ and cholesterol ester, and at least one sterol or stanol ester in combination. In other words, the lipid acyltransferase for some aspects of the present invention can transfer the acyl group from lipid to cholesterol, and to at least one additional sterol and / or at least one stanol.

In one aspect, a sterile acyl acceptor is preferably one or more of the following compounds: alpha-sitosterol, beta-sitosterol, stigmasterol, ergosterol and campestrol.

In one aspect, preferably, the acyl sterol acceptor is cholesterol. When cholesterol is an acyl acceptor for lipid acyltransferase, the amount of cholesterol in the food product is reduced compared to the food product before it is exposed to lipid acyltransferase and / or compared to an equivalent food product that has not been processed lipid acyltransferase.

Suitable stanol acyl acceptors include phytostanols, for example beta-sitostanol or ss-sitostanol.

In one aspect, preferably, the sterol and / or stanolic acyl acceptor are sterol and / or stanol other than cholesterol.

In some aspects, a food product prepared in accordance with the present invention can be used to lower serum cholesterol and / or to lower low density lipoprotein. Both serum cholesterol and low density lipoprotein are associated with certain human diseases, such as, for example, atherosclerosis and / or heart disease. Thus, it can be assumed that food products prepared in accordance with the present invention can be used to reduce the risk of such diseases.

Thus, in one aspect, the present invention relates to the use of a food product according to the present invention for use in the treatment and / or prevention of atherosclerosis and / or heart disease.

In a further aspect, the present invention provides a medicament comprising a food product according to the present invention.

In a further aspect, the present invention relates to a method for treating and / or preventing a human or animal disease, wherein the method comprises administering to a patient an effective amount of a food product according to the present invention.

The sterile and / or stanolic acyl acceptor may naturally be contained in the food product. Alternatively, sterol and / or stanol can be added to the food product. When sterol and / or stanol are added to the food product, sterol and / or stenol can be added before, simultaneously and / or after the addition of the lipid acyltransferase according to the present invention. Accordingly, the present invention may cover the addition of exogenous sterols / stanols, in particular phytosterols / phytostanols, to a food product before or simultaneously with the addition of the enzyme according to the present invention.

For some aspects, one or more stanols present in the food product can be converted to one or more stanols before or simultaneously with the addition of the lipid acyltransferase according to the present invention. Any suitable method of converting sterols to stanols may be used. For example, conversion may be carried out by chemical hydrogenation. The conversion can be carried out before the addition of the lipid acyltransferase according to the present invention or simultaneously with the addition of the lipid acyltransferase according to the present invention. Enzymes suitable for the conversion of sterols to stanols are described in WO 00/061771.

Accordingly, the present invention can be used to obtain phytostanol esters in situ in a food product. Phytostanol esters have increased solubility in lipid membranes, bioavailability and increased health benefits (see, for example, WO 92/99640).

In some implementations of the present invention, the stanol ester and / or sterol ester may be a flavoring agent and / or texturizer. In such cases, the present invention encompasses the preparation of in situ flavoring agents and / or texturizers.

For some aspects of the present invention, the lipid acyltransferase according to the present invention can use a carbohydrate as an acyl acceptor. The carbohydrate acyl acceptor may be one or more of the following compounds: a monosaccharide, disaccharide, oligosaccharide or polysaccharide. Preferably, the carbohydrate is one or more of the following compounds: glucose, fructose, anhydrofructose, maltose, lactose, sucrose, galactose, xylose, xylo-oligosaccharides, arabinose, maltooligosaccharides, tagatose, microthecin, ascopyron P, ascopyrone T, cortalcer.

The acyl carbohydrate acceptor may naturally be present in the food product. Alternatively, a carbohydrate may be added to the food product. When the carbohydrate is added to the food product, the carbohydrate may be added before, simultaneously and / or after the addition of the lipid acyltransferase according to the present invention.

Carbohydrate esters can work as valuable emulsifiers in a food product. So, in the case where the enzyme works to transfer the acyl group to sugar, the invention encompasses the in situ formation of a second emulsifier in a food product.

In some embodiments, the lipid acyltransferase may use aster and / or stanol and carbohydrate as the acyl acceptor.

The use of lipid acyltransferase, which can transfer the acyl group to both carbohydrate and sterol and / or stanol, is particularly beneficial for foods including eggs. In particular, the presence of sugars, especially glucose, in eggs and egg products is often considered undesirable. Egg yolk may include up to 1% glucose. Typically, eggs or egg-based products can be treated with glucose oxidase to remove part of the glucose or all of the glucose. However, in accordance with the present invention, such unwanted sugar can be easily removed by "esterifying" the sugar to form a sugar ester.

For some aspects of the present invention, the lipid acyltransferase according to the present invention can use a protein as an acyl acceptor. Typically, a protein may be one or more of the proteins found in a food product, for example, a dairy product or a meat product. By way of example only, proteins found in cottage cheese or whey, such as lactoglobulin, may be suitable. Other suitable proteins include ovalbumin from eggs, gliadin, glutenin, puroindoline protein transfer of lipids from grain and myosin from meat.

Thus, in accordance with the present invention, one or more of the following positive qualities can be achieved: in situ formation of an emulsifier without an increase in free fatty acids; reduction in the accumulation of free fatty acids in a food product; lower levels of free cholesterol in a food product; an increase in sterol esters and / or stenol ethers; lowering serum cholesterol and / or low density lipoproteins; increase in carbohydrate esters; reduction of unwanted free sugars.

An advantage of the present invention is that emulsifier (s) are formed in situ in a food product without or without a substantial increase in the content of free fatty acids in the food product. The formation of free fatty acids can be harmful to the food product. In particular, free fatty acids were associated with loss of odors and loss of taste of food products, as well as other harmful effects, including, for example, the soapy taste of cheese. Preferably, the method according to the present invention results in the formation of in situ emulsifier (s), where the accumulation of free fatty acids is reduced and / or eliminated. Without wishing to be bound by theory, in accordance with the present invention, fatty acids that are isolated from lipids are transferred by a lipid acyltransferase to an acyl acceptor, for example, sterol and / or stanol. Thus, the total level of free fatty acids in a food product does not increase or increases only slightly. This is very different from the situation when lipases are used for the formation of emulsifiers in situ (E.C. 3.1.1.x). In particular, the use of lipases can lead to an increase in the amount of free fatty acids in a food product, which can be harmful. In accordance with the present invention, the accumulation of free fatty acids is reduced or eliminated compared to the amount of free fatty acids that would have accumulated if the lipase enzyme, in particular the phospholipase A enzyme, were used instead of the lipid acyltransferase in accordance with the present invention.

The use of lipid acyltransferase, which can transfer the acyl group to sterol and / or stanol, can be particularly useful for foods including eggs. In particular, it was found that after treatment with lipid acyltransferase as defined here, an egg-based product with significantly better properties can be obtained compared to egg-based products treated with conventional phospholipases, such as, for example, LipopanF® (Novozymes A / S, Denmark), Lecitase Ultra® (Novozymes A / S, Denmark), or Lipomod 22 L from Biocatalysts.

Preferably, the lipid acyltransferase enzyme according to the present invention can be characterized by the following criteria:

(i) the enzyme has an acyltransferase activity, which can be defined as the activity of ether transfer, as a result of which the acyl part of the initial ether linkage of the acyl lipid donor is transferred to the acyl acceptor, forming a new ether, and

(ii) the enzyme comprises a fragment of the GDSX amino acid sequence, where X represents one or more of the following amino acid radicals: L, A, V, I, F, Y, H, Q, T, N, M, or S.

Preferably, the X of the GDSX fragment is L. Thus, preferably, the enzyme of the present invention includes a GSDL amino acid sequence fragment.

The GSDL fragment consists of four stored amino acids. Preferably, the serine within the fragment is a catalytic serine of a lipid acyltransferase enzyme. Preferably, the serine of the GSDX fragment can be at the Ser-16 position in the Aeromonas hydrophilla lipolytic enzyme described by Brumlik & Buckley (Journal of Bacteriology Apr. 1996, Vol. 178, No. 7, p. 2060-2064).

In order to determine whether a protein has a GSDX fragment according to the present invention, the sequence is preferably compared with the hidden Markov model profiles (HMM profiles) of the Pfam database.

Pfam is a database of protein domain families. Pfam contains verified alignments of multiple sequences for each family, as well as a hidden Markov model profile (HMM profile) to identify such domains in new sequences. An introduction to Pfam can be found in Bateman A. et al. (2002) Nucleic Acid Res. 30 ; 276-280. Hidden Markov models are used in a number of protein identification databases; for review, see Bateman A. and Haft DH (2002) Brief Bioinform 3 ; 236-245.

http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=12230032&dopt=Abstract

http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=11752314&dopt=Abstract

For a detailed explanation of hidden Markov models and how they are used in the Pfam database, see Durbin R., Eddy S. and Krogh A. (1998) Biological sequence analysis; probabilistic models of proteins and nucleic acids, Cambridge University Press, ISBN 0-521-62041-4. The Hammer software package can be obtained from Washington University, St. Louis, USA.

Alternatively, a GDSX fragment can be identified using the Hammer software package; instructions are provided in Durbin R., Eddy S. and Krogh A. (1998) Biological sequence analysis; probabilistic models of proteins and nucleic acids, Cambridge University Press, ISBN 0-521-62041-4 both in the references therein and in the HMMER2 profile presented in this application.

The Pfam database can be accessed, for example, through several servers that are currently hosted on the following websites:

http://www.sanger.ac.uk/Software/Pfam/index.shtml

http://pfam.wustl.edu/

http://pfam.jouy.inra.fr/

http://pfam.cgb.ki.se/

This database offers the ability to search where a protein sequence can be entered. Using the default settings of the database, the protein sequence will then be analyzed for the presence of Pfam domains. The GDSX domain is a recognized domain in the database, and if so, then its presence in any requested sequence should be recognized. The database should return the alignment of the Pfam00657 consensus sequence to the requested sequence.

Multiple alignment, including Aeromonas salmonicida or Aeromonas hydrophila , can be obtained:

a) manually

obtain alignment of the target protein to the consensus sequence of Pfam00657 and obtain alignment of P10480 to the consensus sequence of Pfam00657 after the above procedure;

or

b) from the database

After identifying the consensus sequence of Pfam00657, the database offers to show the alignment of the requested sequence to the initial alignment of the consensus sequence of Pfam00657. P10480 is part of this initial alignment and is indicated by GCAT-AERHY. Both the requested sequence and P10480 will be shown on the display in the same window.

Reference sequence Aeromonas hydrophila :

Aeromonas hydrophila GDSX lipase radicals are numbered in the P10480 NCBI file, the numbers in this text refer to the numbers in the file used in the present invention to determine the specific amino acid residues that, in a preferred embodiment, are present in the lipid acyltransferase enzymes of the invention.

Pfam alignment is shown in FIGS. 33 and 34.

The following stored radicals may be recognized and, in a preferred embodiment, may be present in enzymes for use in the compositions and methods of the invention.

Block 1 - GDSX Block

hid hid hid hid Gly Asp Ser hid 28 29th thirty 31 32 33 34 35

Block 2 - GANDY Block

hid Gly hid Asn Asp hid 130 131 132 133 134 135

Block 3 - HPT Block

His 309

where "hid" means a hydrophilic residue selected from Met, Ile, Leu, Val, Ala, Gly, Cys, His, Lys, Trp, Tyr, Phe.

Preferably, the lipid acyltransferase enzyme for use in the compositions / methods of the invention can be aligned using the Pfam00657 consensus sequence.

Preferably, positive compatibility with the hidden Markov model profile (HMM profile) of the pfam00657 domain family indicates the presence of the GDSX or GDSL domain of the present invention.

Preferably, the lipid acyl transferase for use in the compositions / methods of the invention, when it is aligned with the consensus sequence Pfam00657, has at least more than one, preferably more than two of the following blocks: GDSX block, GANDY block, HTP block. Valid when the lipid acyltransferase has a GDSX block and a GANDY block. Alternatively, the enzyme may have a GDSX block and an HTP block. Preferably, the enzyme comprises at least a GDSX unit.

Preferably, the enzyme for use in the compositions / methods of the invention when it is aligned with the consensus sequence of Pfam00657, when it is compared with the reference polypeptide sequence of A.hydrophila , namely SEQ ID No. 32, has at least one, preferably more than one, preferably more than two, preferably more than three, preferably more than four, preferably more than five, preferably more than six, preferably more than seven, preferably more than eight, preferably more than nine, preferably more than ten, preferably more than eleven, preferably more than twelve, preferably more than thirteen, preferably more than fourteen of the following amino acid residues: 28hid, 29hid, 30hid, 31hid, 32gly, 33As p, 34Ser, 35hid, 130hid, 131Gly, 132Hid, 133Asn, 134Asp, 135hid, 309His.

The pfam00657 GDSX domain is a unique identifier that distinguishes proteins that have the specified domain from other enzymes.

The consensus sequence pfam00657 is shown in FIG. 1 as SEQ ID No. 1. It is obtained by identifying the family pfam00657 version 6 of the database, which may also be referred to as pfam00657.6 here.

Consensus consistency can be improved by using the following versions of the Pfam database.

For example, FIGS. 33 and 34 show pfam alignment of the 00657 family of database version 11, which may also be referred to as pfam00657.11 here.

The presence of GDSX, GANDY, and HPT blocks was detected in the pfam00657 family of both versions of the database. Subsequent versions of the Pfam database can be used to identify the pfam00657 family.

Preferably, the lipid acyltransferase enzyme according to the present invention can be characterized using the following criteria:

(i) the enzyme has acyltransferase activity, which can be defined as ether transfer activity, as a result of which the acyl portion of the initial ether linkage of the acyl lipid donor is transferred to the acyl acceptor, forming a new ether;

(ii) the enzyme includes a fragment of the GDSX amino acid sequence, where X represents one or more of the following amino acid radicals: L, A, V, I, F, Y, H, Q, T, N, M, or S;

(iii) the enzyme includes His-309 or comprises a histidine radical at the His-309 position in the lipolytic enzyme Aeromonas hydrophila shown in FIG. 2 (SEQ ID No. 2 or SEQ ID No. 32).

Preferably, the amino acid radical of the GDSX fragment is L.

In SEQ ID No. 2 or SEQ ID No. The 32 first 18 amino acid radicals form a signal sequence. His-309 sequences of full length, i.e. a protein comprising a signal sequence is equated to the His-291 mature portion of the protein, i.e. sequences without signal sequence.

Preferably, the lipid acyltransferase enzyme according to the present invention includes the following catalytic triad: Ser-34, Asp-134 and His-309 or includes a serine residue, an aspartic acid residue and a histidine residue, respectively, at the positions corresponding to Ser-34, Asp-134 and His -309, in the lipolytic enzyme Aeromonas hydrophila shown in FIG. 2 (SEQ ID No. 2) or FIG. 28 (SEQ ID No. 32). As stated above, in the sequence shown in SEQ ID No. 2 or SEQ ID No. 32, the first 18 amino acid radicals form a signal sequence. Ser-34, Asp-134, and His-309 sequences of full length, i.e. a protein including a signal sequence is equated with the Ser-16, Asp-116 and His-291 mature portion of the protein, i.e. sequences without signal sequence. In the consensus sequence pfam00657, which is shown in figure 1 (SEQ ID No. 1), the remains of the active site correspond to Ser-7, Asp-157 and His-348.

Preferably, the lipid acyltransferase enzyme according to the present invention can be characterized using the following criteria:

(i) the enzyme has acyltransferase activity, which can be defined as the activity of ether transfer, as a result of which the acyl part of the initial ether linkage of the first lipid acyl donor is transferred to the acyl acceptor, forming a new ether;

(ii) the enzyme comprises at least Gly-32, Asp-33, Ser-34, Asp-134, and His-309, or includes residues of glycine, aspartic acid, serine, aspartic acid, and histidine at positions corresponding to Gly-32, Asp -33, Ser-34, Asp-134, and His-309 in the Aeromonas hydrophila lipolytic enzyme shown in FIG. 2 (SEQ ID No. 2) or FIG. 28 (SEQ ID No. 32).

Preferably, the lipid acyltransferase enzyme according to the present invention can be obtained, even more preferably, the enzyme is obtained from organisms from one or more of the following genera: Aeromonas, Streptomyces, Saccharomyces, Lactococcus, Mycobacterium, Streptococcus, Lactobacillus, Desulfitobacterium, Campulfobacterium, Campulfobacterium, Campulfobacterium, Campulfibacterae, Campulfibacterae, Campulfus , Xylella, Sulfolobus, Aspergillus, Schizosaccharomyces, Listeria, Neisseria, Mezorhizobium, Ralstonia, Xanthomonas and Candida .

Preferably, the lipid acyltransferase enzyme according to the present invention can be obtained, even more preferably, the enzyme is obtained from one or more of the following organisms: Aeromonas hydrophila, Aeromonas salmonicida, Streptomyces coelicolor, Streptomyces rimosus, Mycobacterium, Streptococcus pyogenes, Lactococcus lactococcus pycococcus lactococcus lactococcus pyogenococcus Streptococcus thermophilus, Lactobacillus helveticus, Desulfitobacterium dehalogenans , Bacillus sp., Campylobacter jejuni, Vibrionaceae, Xylella fastidiosa, Sulfolobus solfataricus, Saccharomyces cervisiae, Aspergillus terreus, Schizosaccharomyces pombe, Listeria innocua, Listeria monocitrogenes, Neisseria meningitides, Mezorhizobium loti, Ralstonia solanacearum, Xanthomonas campestris and Candida parapsilosis .

In one aspect, preferably, the lipid acyltransferase enzyme according to the present invention is obtainable and preferably derived from one or more of Aeromonas hydrophila or Aeromonas salmonicida.

Preferably, the lipid acyltransferase enzyme according to the present invention includes one or more of the following amino acid sequences:

(i) the amino acid sequence shown as SEQ ID No. 2 (see figure 2);

(ii) the amino acid sequence shown as SEQ ID No. 3 (see FIG. 3);

(iii) the amino acid sequence shown as SEQ ID No. 4 (see FIG. 4);

(iv) the amino acid sequence shown as SEQ ID No. 5 (see FIG. 5);

(v) the amino acid sequence shown as SEQ ID No. 6 (see FIG. 6);

(vi) the amino acid sequence shown as SEQ ID No. 12 (see Fig. 14);

(vii) the amino acid sequence shown as SEQ ID No. 20 (see FIG. 16);

(viii) amino acid sequence shown as SEQ ID No. 22 (see Fig. 18);

(ix) amino acid sequence shown as SEQ ID No. 24 (see FIG. 20);

(x) amino acid sequence shown as SEQ ID No. 26 (see FIG. 22);

(xi) amino acid sequence shown as SEQ ID No. 28 (see FIG. 24);

(xii) amino acid sequence shown as SEQ ID No. 30 (see Fig. 26);

(xiii) amino acid sequence shown as SEQ ID No. 32 (see Fig. 28);

(xiv) amino acid sequence shown as SEQ ID No. 34 (see FIG. 30), or an amino group sequence that has 75% or more identity with any one of the sequences shown as SEQ ID No. 2; SEQ ID No. 3; SEQ ID No. four; SEQ ID No. 5; SEQ ID No. 6; SEQ ID No. 12; SEQ ID No. twenty; SEQ ID No. 22; SEQ ID No. 24; SEQ ID No. 26; SEQ ID No. 28; SEQ ID No. thirty; SEQ ID No. 32; SEQ ID No. 34.

Preferably, the lipid acyltransferase enzyme of the present invention includes either the amino acid sequence shown as SEQ ID No. 2, or SEQ ID No. 3, or SEQ ID No. 4, or SEQ ID No. 32, or SEQ ID No. 34, or includes an amino acid sequence that has 75% or more, preferably 80% or more, preferably 85% or more, preferably 90% or more, preferably 95% or more of the identity with the amino acid sequence shown as SEQ ID No. 2, or with the amino acid sequence shown as SEQ ID No. 3, or with the amino acid sequence shown as SEQ ID No. 4, or with the amino acid sequence shown as SEQ ID No. 32, or with the amino acid sequence shown as SEQ ID No. 34.

For the purposes of the present invention, the degree of identity is based on the number of sequence elements that are the same. The degree of identity in accordance with the present invention can be determined by computer programs known in practice such as the GAP GCG (Program Manual for the Wisconsin Package, Version 8, August 1994, Genetics Computer Group, 575 Science Drive, Madison, Wisconsin, US53711) (Needleman & Wunsch (1970), J. of Molecular Biology 48, 443-45), using the following settings for comparing polypeptide sequences: GAP3.0 generation error and GAP expansion error 0.1.

Preferably, the lipid acyltransferase enzyme of the present invention comprises 80% or more, preferably 85% or more, more preferably 90% or more, and even more preferably 95% or more identity with any one of the following sequences shown as SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5, SEQ ID No. 6, SEQ ID No. 12, SEQ ID No. 20, SEQ ID No. 22, SEQ ID No. 24, SEQ ID No. 26, SEQ ID No. 28, SEQ ID No. 30, SEQ ID No. 32 or SEQ ID No. 34.

Preferably, the lipid acyltransferase enzyme according to the present invention includes one or more of the following amino acid sequences:

(a) an amino acid sequence shown as amino acid residues 1-100 of SEQ ID No. 2 or SEQ ID No. 32;

(b) an amino acid sequence shown as amino acid residues 101-200 from SEQ ID No. 2 or SEQ ID No. 32;

(c) an amino acid sequence shown as amino acid residues 201-300 from SEQ ID No. 2 or SEQ ID No. 32; or

(d) an amino acid sequence that has 75% or more, preferably 85% or more, more preferably 90% or more, and even more preferably 95% or more identity with any one of the sequences defined above in (a) - (c).

Preferably, the lipid acyltransferase enzyme according to the present invention includes one or more of the following amino acid sequences:

(a) an amino acid sequence shown as amino acid residues 28-39 from SEQ ID No. 2 or SEQ ID No. 32;

(b) an amino acid sequence shown as amino acid residues 77-88 from SEQ ID No. 2 or SEQ ID No. 32;

(c) an amino acid sequence shown as amino acid residues 126-136 from SEQ ID No. 2 or SEQ ID No. 32;

(d) an amino acid sequence shown as amino acid residues 163-175 from SEQ ID No. 2 or SEQ ID No. 32;

(e) an amino acid sequence shown as amino acid residues 304-311 from SEQ ID No. 2 or SEQ ID No. 32;

(f) an amino acid sequence that has 75% or more, preferably 85% or more, more preferably 90% or more, and even more preferably 95% or more identity with any one of the sequences defined above in (a) - (e).

Preferably, the lipid acyltransferase enzyme according to the present invention includes an amino acid sequence obtained by expression or one or more of the following nucleotide sequences:

(a) the nucleotide sequence shown as SEQ ID No. 7 (see Fig. 9);

(b) the nucleotide sequence shown as SEQ ID No. 8 (see FIG. 10);

(c) the nucleotide sequence shown as SEQ ID No. 9 (see Fig. 11);

(d) the nucleotide sequence shown as SEQ ID No. 10 (see Fig. 12);

(e) the nucleotide sequence shown as SEQ ID No. 11 (see FIG. 13);

(f) the nucleotide sequence shown as SEQ ID No. 13 (see FIG. 15);

(g) the nucleotide sequence shown as SEQ ID No. 21 (see FIG. 17);

(h) the nucleotide sequence shown as SEQ ID No. 23 (see Fig. 19);

(i) the nucleotide sequence shown as SEQ ID No. 25 (see FIG. 21);

(j) the nucleotide sequence shown as SEQ ID No. 27 (see FIG. 23);

(k) the nucleotide sequence shown as SEQ ID No. 29 (see FIG. 25);

(l) the nucleotide sequence shown as SEQ ID No. 31 (see Fig. 27);

(m) the nucleotide sequence shown as SEQ ID No. 33 (see Fig. 29);

(n) the nucleotide sequence shown as SEQ ID No. 35 (see Fig. 31); or

(o) a nucleotide sequence that has 75% or more identity with any one of the sequences shown as SEQ ID No. 7, SEQ ID No. 8, SEQ ID No. 9, SEQ ID No. 10, SEQ ID No. 11, SEQ ID No. 13, SEQ ID No. 21, SEQ ID No. 23, SEQ ID No. 25, SEQ ID No. 27, SEQ ID No. 29, SEQ ID No. 31, SEQ ID No. 33 or SEQ ID No. 35.

Preferably, the nucleotide sequence may have 80% or more, preferably 85% or more, more preferably 90% or more and even more preferably 95% or more identical to any one of the sequences shown as SEQ ID No. 7, SEQ ID No. 8, SEQ ID No. 9, SEQ ID No. 10, SEQ ID No. 11, SEQ ID No. 13, SEQ ID No. 21, SEQ ID No. 23, SEQ ID No. 25, SEQ ID No. 27, SEQ ID No. 29, SEQ ID No. 31, SEQ ID No. 33 or SEQ ID No. 35.

In one aspect, the lipid acyltransferase according to the present invention may be lecithin: cholesterol acyltransferases (LCAT) or a variant thereof (e.g., a variant obtained by molecular evolution).

Suitable LCATs are known in the art and can be obtained from one or more of the following organisms, for example, mammals, mice, rats, chickens, Drosophila melanogaster , Arabidospis and Oryza sativa , nematodes, fungi and yeast.

In one embodiment, the lipid acyltransferase enzyme according to the present invention can be a lipid acyltransferase, which can be obtained, preferably, obtained from E. coli strains TOP 10 storage pPet12Aahydro and pPet12aASalmo deposited Danisco A / S of Langebrodgade 1, DK-100 Copenhagen K, Denmark under the Budapest Treaty on the International Recognition of the Microorganism Depository for the purposes of the patenting procedure for the National Collection of Industrial, Marine and Food Bacteria (NCIMB) 23 St. Machar Street, Aberdeen Scotland, GB dated December 23, 2003 under inventory numbers NICMB 41204 and NICMB 41205, respectively.

Preferably, when the method of the present invention is carried out, the product is obtained without increasing or substantially increasing the free fatty acids in the food product.

The term "transferase", as used here, is used interchangeably with the term "lipid transferase".

Accordingly, lipid transferase, as defined here, catalyzes one or more of the following reactions: interesterification, transesterification, alcoholysis, hydrolysis.

The term “interesterification” refers to an enzymatically catalyzed transfer of acyl groups between a donor lipid and an acceptor lipid, where the donor lipid is not a free acyl group.

The term “transesterification,” as used herein, means an enzymatically catalyzed transfer of an acyl group from a lipid donor (other than free fatty acid) to an acyl acceptor (other than water).

The term "alcoholysis", as used here, refers to the enzymatic decomposition of the covalent bond of acid derivatives by reaction with ROH alcohol so that one of the products combines with H of the alcohol, and the other product combines with the OH group of the alcohol.

The term “alcohol,” as used herein, refers to an alkyl compound containing a hydroxyl group.

The term "hydrolysis", as used here, refers to the enzymatically catalyzed transfer of an acyl group from a lipid to an OH group of a water molecule. Acyl transfer, which is the result of hydrolysis, requires the separation of a water molecule.

The term “without increasing or substantially increasing free fatty acids,” as used herein, means that preferably the lipid acyltransferase according to the present invention has 100% transferase activity (i.e. transfers 100% acyl groups from the acyl donor to the acyl acceptor , without hydrolytic activity), however, the enzyme can transfer less than 100% of the acyl groups present in the acyl donor to the acyl acceptor. In such a case, preferably, the acyltransferase activity is at least 5%, more preferably at least 10%, more preferably at least 20%, more preferably at least 30%, more preferably at least 40% more preferably at least 50%, more preferably at least 60%, more preferably at least 70%, more preferably at least 80%, more preferably at least 90%, more preferably at least 98% of total enzyme activity. The percentage of transferase activity (i.e., transferase activity as a percentage of total enzyme activity) can be determined by the following protocol.

Protocol for the determination of% transferase activity

The food product to which the lipid acyltransferase according to the present invention was added can be extracted after the enzymatic reaction with a mixture of CHCl ₃ : CH ₃ OH 2: 1, and the organic phase containing the lipid material is isolated and analyzed by GLC and HPLC according to the procedure, in detail described here below. The analyzes determined the amount of free fatty acids and one or more of sterol / stanol esters, carbohydrate esters, protein esters, diglycerides or monoglycerides. A control food product to which the enzyme of the present invention was not added was analyzed in a similar manner.

Payment

From the results of GLC and HPLC analyzes, an increase in the content of free fatty acids and one or more of sterol / stanol esters, carbohydrate esters, protein esters, diglycerides or monoglycerides can be calculated.

Δ% fatty acid =% fatty acid (enzyme) -% fatty acid (control); Mv fatty acid = average molecular weight of the fatty acid;

A = Δ% sterol ether / Mv sterol ether (where Δ% sterol ether =% sterol / stanol ether (enzyme) -% sterol / stanol ether (control) and Mv sterol ether = average molecular weight of sterol / stanol esters) - applicable, when the acyl acceptor is sterol and / or stanol;

B = Δ% carbohydrate ether / Mv carbohydrate ester (where Δ% carbohydrate ester =% carbohydrate ester (enzyme) -% carbohydrate ester (control) and Mv carbohydrate ester = average molecular weight of carbohydrate ester) - applicable when the acyl acceptor is a carbohydrate;

C = Δ% of protein ester / Mv of protein ester (where Δ% of protein ester =% of protein ester (enzyme) -% of protein ester (control) and Mv of protein ester = average molecular weight of protein ester) - applicable when the acyl acceptor is protein; and

D = absolute diglyceride and / or monoglyceride / Mv di / monoglyceride (where Δ% diglyceride and / or monoglyceride =% diglyceride and / or monoglyceride (enzyme) -% diglyceride and / or monoglyceride (average) and Mv di / molecular weight of diglyceride and / or monoglyceride) - applicable when the acyl acceptor is glycerol.

Transferase activity is calculated as a percentage of the total enzymatic activity.

* - исключить, если требуется.

* - delete if required.

If the content of free fatty acids in the food product has increased, then it, preferably, has not increased significantly, i.e. to a large extent. This implies that an increase in the content of free fatty acids will not adversely affect the quality of the food product.

In some aspects of the present invention, the term “without a substantial increase in free fatty acids,” as used herein, means that the amount of free fatty acids in a food product or composition treated with a lipid acyltransferase according to the present invention is less than the amount of free fatty acids in a food a product or composition when an enzyme other than the lipid acyltransferase according to the present invention has been used, such as, for example, when compared with the amount of free fatty acid, formed when a conventional phospholipase enzyme was used, for example Lipofan® (Novozymes A / S, Denmark).

The term “ in situ ” as used herein means that emulsifier (s) and / or sterol / stanol esters and / or carbohydrate esters and / or protein esters and / or mono- or diglycerides are formed inside the food product or parts of a food product. This differs from the situation where the emulsifier (s) and / or sterol / stanol esters and / or carbohydrate esters and / or protein esters and / or mono- or diglycerides are formed separately from the food product and added as formed products to the food product during its preparation. In other words, the term " in situ ", as used here, means that by adding the lipid acyltransferase according to the present invention to a food product or to food ingredients / materials forming a food product, emulsifier (s), and / or sterol esters / stanol and / or carbohydrate esters and / or protein esters and / or mono- or diglycerides can be formed from food components. Accordingly, the components of the food product can be a substrate (s) for the enzyme. If necessary, the components of the food product may be supplemented with one or more additional components, which may be the same components that are present in the food product, or may be complementary to components that are already present in the food product. For the avoidance of doubt in one embodiment, the method according to the present invention may be a method of forming an emulsifier and / or sterol ester and / or stanol ester and / or carbohydrate ester and / or protein ester and / or mono- or diglyceride in situ in a food product, and not be a method of preparing an emulsifier and / or sterol ether and / or stanol ether (for example, in isolated and purified form) for subsequent addition to the food product.

In another embodiment, the lipase acyltransferase can be used during cooking, but not remain in the food product. For example, lipase acyltransferase can be immobilized, which allows its reuse.

Preferably, the lipid acyltransferase according to the present invention is capable of transferring an acyl group from lipid to sterol and / or stanol and / or carbohydrate and / or protein and / or glycerol when present in a polar medium, preferably in an aqueous medium, preferably in a water-containing food product. Accordingly, the aqueous medium may be an aqueous buffer, or may be the aqueous phase of a food product. The term "aqueous medium", as used here, preferably means a medium in which there is no organic solvent, preferably there is no polar organic solvent, more preferably there is no non-food organic solvent. In particular, the term "aqueous medium" may refer to a medium into which exogenous organic solvents have not been added, preferably polar solvents have not been added. The term "organic solvent", as used here, does not cover edible oils, preferably does not cover edible oils that are rich in non-polar lipids. In one embodiment, the term “organic solvent” may exclude edible organic solvents such as ethanol, propylene glycol and / or glycerol. A suitable aqueous medium according to the present invention may include less than 80% vol. organic solvents, less than 70% vol. organic solvents, less than 50% vol. organic solvents, less than 30% vol. organic solvents, more preferably less than 15% vol. organic solvents, more preferably less than 5% vol. organic solvents. Preferably, the food product may include between 1% and 5% of an organic solvent, for example ethanol. However, when the food product includes such an organic solvent, it is preferably formed endogenously within the food product. In other words, when the food product includes such an organic solvent, preferably, the organic solvent is not an exogenous organic solvent.

Preferably, the food product of the present invention may be a “light food” including muffins, pastes, confectionery, chocolate, milk sweets, and the like.

In one aspect, the food product of the present invention can be a dough product or a baked product, such as bread, a fried product, a snack, cakes, pies, chocolate cakes, buns, noodles, snacks, such as crackers, Graham crackers, salted pretzels, potato chips and pasta.

In a further aspect, the food product of the present invention can be a vegetable food product such as cereals, premixes, oils, fats, coconut oil, coffee whitener, salad dressings, margarine, pasty products, peanut butter, cooking oil, ice cream, cooking oils .

In another aspect, the food product of the present invention may be a dairy product, including butter, milk, cream, cheese, such as natural, processed cheese and simulated cheeses in various forms (including crushed, in blocks, slices or grated), cream cheese, ice cream, frozen desserts, yogurt, yogurt drinks, butter fat, anhydrous milk fat, other dairy products. The enzyme according to the present invention can improve the stability of fat in dairy products.

Particularly preferred is the use of the present invention in cheeses, since the formation of free fatty acids in cheese is associated with a “soapy” taste. Thus, the use of the lipid acyltransferase according to the present invention advantageously produces cheese without a “soapy” taste.

In another aspect, the CEI food product may be a food product containing animal ingredients such as processed meat products, cooking oils, cooking fats.

In a further aspect, the food product of the present invention may be a beverage, fruit, mixed fruit, vegetable or wine. In some cases, the drink may contain up to 20 g / l of added phytosterols.

In another aspect, the food product of the present invention may be animal feed. Animal feed can be enriched with phytosterol and / or phytostanols, preferably beta-sitosterol / stanol. Preferably, the animal feed may be a poultry feed. If the animal feed is poultry, the present invention can be used to reduce the cholesterol in eggs produced by poultry fed with the food product of the present invention.

In one aspect, preferably, the food product is selected from one or more of the following food products: eggs, egg-based products, including mayonnaise, salad dressing, sauces, ice cream, egg powder, modified egg yolk, and products made from them.

Preferably, the food product of the present invention is a water-containing food product. Accordingly, the food product may contain 10-98% water, usually 14-98%, preferably 18-98% water, preferably 20-98% water, preferably 40-98% water, preferably 50-98% water, preferably 70-98% water, preferably 75-98% water.

For some aspects, preferably, the food product of the present invention is not pure plant derived oil, such as, for example, olive oil, sunflower oil, peanut oil, rapeseed oil. For the avoidance of doubt in some aspects of the present invention, the food product of the present invention may include oil, but preferably, the food product does not consist primarily of oil or a mixture of oils. For some aspects, preferably, the food product comprises less than 95% lipids, preferably less than 90% lipids, preferably less than 85% lipids, preferably less than 80% lipids. Thus, for some aspects of the present invention, the oil may be a component of the food product, but preferably, the food product is not oil per se .

The claims of the present invention should be construed to include each of the above foods.

In the case where a carbohydrate ester of the present invention is formed, the carbohydrate ester is preferably an oligosaccharide ester, a monosaccharide ester or a disaccharide ester.

Accordingly, the carbohydrate ester, when formed according to the present invention, can be one or more of the following: glucose ether, fructose ether, anhydrofructose ether, maltose ether, lactose ether, galactose ether, xylose ether, xyloligosaccharide ether, arabinose ether, maltooligosaccharide ether, tagatose ester, sucrose ester, microtecin ester, ascopyron P ester, ascopyrone T ester or cortalcerone ester.

Preferably, the carbohydrate ester, when formed according to the present invention, is one or more of the following: carbohydrate monoester, sugar monoester, oligosaccharide monoester, disaccharide monoester, monosaccharide monoester, glucose monoester, fructose monoester, fructose monoester, fructose monoester, lactose, galactose monoester, xylose monoester, xyloligosaccharide monoester, arabinose monoester, maltooligosaccharide monoester, tagatose monoester, sucrose monoester, microtecin monoester, monoester firm of ascopyron P, monoester of ascopyrone T or monoester of cortalcerone.

In one embodiment, the microtecin ester, ascopyron P ester, ascopyrone T ester and / or cortalcerone ester can act as an antimicrobial agent. Alternatively or in addition to this, microtecin ester, ascopyron P ester, ascopyrone T ester and / or cortalcerone ester can act as one or both of an antioxidant and / or emulsifier.

Preferably, the formation of a carbohydrate ester (if occurring) according to the present invention is independent of UDP glucose.

Preferably, the food product of the present invention does not include UDP glucose or includes only minor amounts of UDP glucose.

A suitable emulsifier according to the present invention can be, for example, one or more of the following: diglyceride, monoglyceride, such as 1-monoglyceride or lysolecithin, such as lysophosphatidylcholine, digalactosyl monoglyceride (DGMG). The emulsifier is preferably formed from the acyl lipid donor following the removal of one or more acyl groups from the acyl lipid donor. The term “lysolecithin,” as used herein, encompasses lysophosphatidylcholine, lysophosphatidyl ethanolamine, lysophosphatidylinositol, lysophosphatidylserine and lysophosphatidylglycerol.

When one of the emulsifiers is a carbohydrate ester, the second emulsifier may be, for example, one or more of the following: diglyceride, monoglyceride, such as 1-monoglyceride, lysophosphatidylcholine or digalactosyl monoglyceride (DGMG). The second emulsifier is preferably formed from the acyl lipid donor following the removal of one or more acyl groups from the acyl lipid donor. The term “lysophosphatidylcholine,” as used herein, is synonymous with the term “lysolecithin,” and these terms may be used interchangeably herein.

Preferably, the second emulsifier is DGMG. Typically, DGMG is formed " in situ " by the removal of the acyl group from DGDG with the transfer of the removed acyl group to a carbohydrate to form a carbohydrate ester.

When one of the emulsifiers is a protein ester and / or diglyceride and / or monoglyceride, the second emulsifier may be, for example, one or more of the following: diglyceride, monoglyceride, such as 1-monoglyceride or lysolecithin, such as lysophosphatidylcholine, digalacto monoglyceride (DGMG). The second emulsifier is preferably formed from the acyl lipid donor following the removal of one or more acyl groups from the acyl lipid donor. The term “lysophosphatidylcholine,” as used herein, is synonymous with the term “lysolecithin,” and these terms may be used interchangeably herein.

In one embodiment, lipid acyltransferase can be used in a method for producing a food product, such as cooking oil, margarine or spreading paste, due to the fact that the food product contains natural or added glycerin, at least one phospholipid (e.g. lecithin) and / or glycolipid (e.g., digalactosyl monoglyceride) and, optionally, phytosterol or phytostanol.

A food product, when used as cooking oil or margarine, may have improved non-stick properties. In addition or alternatively, the food product may have one or more of the advantageous technical properties, for example, improved oxidative stability, improved emulsifying properties, or health benefits.

In one embodiment, the lipid acyltransferase of the invention can be used in the preparation of low-fat food products, such as low-fat spreading pastes, low-fat salad dressings, low-fat mayonnaise, low-fat fat margarines, etc. In such low fat foods, the fat content is usually reduced compared to high fat equivalents by the addition of emulsifiers and water.

It has been found that the lipid acyltransferase used in the compositions and methods of the invention has unique properties compared to lipolytic enzymes in that it has a clear preference for transferring acyl groups from lipids to acceptors other than water, even in the presence of a significant amount water. Compared to previously used enzymes, the lipid acyltransferase used according to the invention was found to have a high relative transferase activity in the presence of 6% water, 54% water, 73% water, 89% water and approximately 95% water. The tested lipolytic enzymes had practically no significant transferase activity at such concentrations of water.

The lipase and acyltransferase activity of the enzyme can be evaluated using the following assays. In this way, a lipid acyltransferase having the enzymatic characteristics defined herein can be obtained / identified.

Analysis of transferase in a buffered substrate (see example 12)

Enzymes that function as lipid acyltransferases for use in the compositions and methods of the invention can be routinely identified using the assay described here in Example 12. This assay will be referred to hereinafter as “Transferase Assay in Buffered Substrate”. In example 12, the lipid acyltransferase enzyme from Aeromonas salmonicida in accordance with the present invention was analyzed and compared with a number of lipolytic enzymes not covered by the present invention. As you can see, it was found that of the lipolytic enzymes only LIPOPAN® F (Novozymes, Denmark) had some transferase activity, and then at a very low level (1.3%).

Enzymes suitable for use in the compositions and methods of the invention can be routinely identified using the “Transferase Assay in Buffered Substrate”. Using this assay, in which there is a very high water content of approximately 95%, the lipid acyltransferases according to the present invention are those which have at least 2% acyltransferase activity (relative transferase activity), preferably at least 5% relative transferase activity, preferably at least 10% of the relative transferase activity, preferably at least 15%, 20%, 25%, 26%, 28%, 30%, 40%, 50%, 60% or 75% relative transferase activity and. Suitable lipid acyltransferase in accordance with the present invention may have less than 28%, less than 30%, preferably less than 40%, 50%, 60%, 70%, 80%, 90% or 100% acyltransferase activity.

Analysis of transferase in highly flooded egg yolk (see example 11)

As an alternative (or as an adjunct) to the use of the “Transferase Assay in Buffered Substrate” (see above), lipid acyltransferase for use in accordance with the present invention can be identified using the “Highly Watered Egg Yolk Transferase Assay” described herein in Example 11 .

In one embodiment, a lipid acyltransferase suitable for use in the methods and compositions of the present invention is one which, when tested using a highly transfused egg yolk transferase assay in an egg yolk with 54% water, had up to 100% relative transferase activity . In fact, experiments with heavily flooded egg yolk showed that at the beginning of the experiment, the initial transferase rate was calculated as corresponding to 100% transferase activity, i.e. hydrolytic activity was not observed. In contrast, lipolytic enzymes used as a control, i.e. LIPOPAN® F and phospholipase A2 showed no detectable transferase activity in egg yolk with 54% water or in egg yolk with an enriched water content (namely, egg yolk with 73% water or 89% water). Preferably, increasing the water content does not significantly reduce the percentage transferase activity of lipid acyltransferase for use in the methods or compositions of the present invention.

In a preferred embodiment, according to the results of transferase analysis in heavily flooded egg yolk with a water content of 54%, lipid acyltransferase for use in the present invention should have an initial percentage of transferase activity (initial relative transferase activity), measured after spending 10% of the donor molecule (i.e. e. phospholipid) at least 0.1% relative transferase activity, preferably at least 1% relative transferase activity, preferably at least Hereafter, 5% relative transferase activity, preferably at least 10% relative transferase activity, preferably at least 20% relative transferase activity, preferably at least 30% relative transferase activity, preferably at least 40% relative transferase activity preferably at least 50% relative transferase activity, preferably at least 60% relative transferase activity, preferably at least 70% o relative transferase activity, preferably at least 80% relative transferase activity, preferably at least 90% relative transferase activity, preferably at least 95% relative transferase activity, preferably at least 99% relative transferase activity, preferably about 100% relative transferase activity.

In a preferred embodiment, based on the analysis of transferase in heavily flooded egg yolk with a water content of 54% and measurement, after spending 10% of the donor molecule (i.e. phospholipid), lipid acyltransferase for use in the compositions and methods of the invention has detectable transferase activity, those. relative transferase activity between 0.1 and 100%, preferably at least 1% relative transferase activity, preferably at least 5% relative transferase activity, preferably at least 10% relative transferase activity, preferably at least 20 % relative transferase activity, preferably at least 20% relative transferase activity, preferably at least 30% relative transferase activity, preferably at least e 40% relative transferase activity, preferably at least 45%, 50%, 60%, 70%, 80% or 90% relative transferase activity. A suitable lipid acyltransferase in accordance with the present invention may have, when using transferase analysis in heavily flooded egg yolk with a water content of 54% and measuring after spending 10% of the donor molecule (i.e. phospholipid), the percentage of acyltransferase activity (relative transferase activity) is less 45%, 47%, 50%, 60%, 70%, 80%, 90% or 100%.

In a preferred embodiment, based on the analysis of transferase in heavily flooded egg yolk with a water content of 73% and the measurement, after spending 10% of the donor molecule (i.e. phospholipid), lipid acyltransferase for use in the compositions and methods of the invention has detectable transferase activity, those. relative transferase activity between 0.1 and 100%, preferably at least 1% relative transferase activity, preferably at least 5% relative transferase activity, preferably at least 10% relative transferase activity, preferably at least 20 % relative transferase activity, preferably at least 20% relative transferase activity, preferably at least 30% relative transferase activity, preferably at least e 40% relative transferase activity, preferably at least 45%, 50%, 60%, 70%, 80% or 90% relative transferase activity. A suitable lipid acyltransferase in accordance with the present invention may have, when using transferase analysis in heavily flooded egg yolk with a water content of 73% and measuring after spending 10% of the donor molecule (i.e. phospholipid), the percentage of acyltransferase activity (relative transferase activity) is less 45%, 47%, 50%, 60%, 70%, 80%, 90% or 100%.

In a preferred embodiment, based on a transferase assay in a heavily flooded egg yolk with 89% water content and measuring, after spending 10% of the donor molecule (i.e. phospholipid), lipid acyltransferase for use in the compositions and methods of the invention has detectable transferase activity, those. relative transferase activity from 0.1 to 100%, preferably at least 1% of the relative transferase activity, preferably at least 5% of the relative transferase activity, preferably at least 10% of the relative transferase activity, preferably at least 20 % relative transferase activity, preferably at least 20% relative transferase activity, preferably at least 30% relative transferase activity, preferably at least 40% relative transferase activity, preferably at least 45%, 50%, 60%, 70%, 80% or 90% of the relative transferase activity. A suitable lipid acyltransferase in accordance with the present invention may have, when using transferase analysis in heavily flooded egg yolk with a water content of 89% and measuring after spending 10% of the donor molecule (i.e. phospholipid), the percentage of acyltransferase activity (relative transferase activity) is less 45%, 47%, 50%, 60%, 70%, 80%, 90% or 100%.

In a preferred embodiment, based on a transferase assay in heavily flooded egg yolk, lipid acyltransferase for use in the compositions and methods of the invention has significant transferase activity (i.e., at least 0.1% at both water contents) and has an equivalent relative transferase activity in both egg yolk with a water content of 54% and egg yolk with a water content of 73%, measured after spending 10% of the donor molecule (i.e., phospholipid).

In a preferred embodiment, based on a transferase assay in heavily flooded egg yolk, lipid acyltransferase for use in the compositions and methods of the invention has significant transferase activity (i.e., at least 0.1% at both water contents) and has an equivalent relative transferase activity in both egg yolk with a water content of 54% and egg yolk with a water content of 89%, measured after spending 10% of the donor molecule (i.e., phospholipid).

In a preferred embodiment, based on a transferase assay in heavily flooded egg yolk, lipid acyltransferase for use in the compositions and methods of the invention has significant transferase activity (i.e., at least 0.1% at both water contents) and has an equivalent relative transferase activity in both egg yolk with a water content of 73% and egg yolk with a water content of 89%, measured after spending 10% of the donor molecule (i.e., phospholipid).

The term "equivalent relative transferase activity", as used here, means that the enzyme has a relative transferase activity (% acyltransferase activity), which is at least 2% lower, preferably at least 5%, 10%, 20% , 30%, 40%, 50%, 60%, 70%, 80%, or 90% lower in a high-flooded egg yolk compared to a low-flooded egg yolk.

Analysis of transferase in low-water environment

As an alternative (or as an adjunct) to transferase analysis in heavily flooded egg yolk and / or transferase assay in a buffered lipid acyltransferase solution for use in accordance with the present invention, can be identified using a transferase assay in a low-water environment.

In order to determine whether the enzyme is a lipid acyltransferase according to the present invention, it is possible to analyze the transferase in a low-water medium, namely in an oil medium with 6% water, as described in Example 22. This example illustrates that in an oil medium with water content 6% of the lipid acyltransferase according to the invention has a high relative transferase activity, while previously known lipolytic enzymes have hydrolytic activity.

In one embodiment, a lipid acyltransferase suitable for use in the methods and compositions of the present invention is one which, when tested using a transferase assay in a low-water medium, measured in periods of time selected from 30, 20 or 120 minutes, has a relative transferase activity of at least 1%, preferably at least 2%, preferably at least 5%, preferably at least 10%, preferably at least 20%, preferably at least 30%, preferably at least 40%, preferably at least 50%, preferably at least 60%, preferably at least 70%, preferably at least 75%. A suitable lipid acyltransferase in accordance with the present invention may have less than 30%, 40%, 50%, 60%, 70% or 80% of the activity measured after a period of 10, 20, 30 or 120 minutes using a transferase assay low water environment.

As described above, the lipase acyltransferase according to the invention can be identified using either a transferase assay in a buffered substrate, or a transferase assay in a low-water medium, using cholesterol as an acyl acceptor. Of course, the specialist should understand that, with obvious changes in analytical methods, transferase analysis in a buffered substrate or transferase analysis in a low-water medium can be used to determine lipid acyltransferase activity for any lipid acyl donor, or any acyl acceptor, or any combination thereof. The specialist should, if necessary, simply replace the acyl donor substrate (e.g. phospholipid) with an alternative acyl donor substrate (e.g. glycolipid, triglyceride) and / or replace the acyl acceptor (e.g. cholesterol) with an alternative acyl acceptor substrate (e.g. carbohydrate, protein, other sterol, stanol or glycerol).

The term "high water", as used here, means any substrate or food product with a water content of more than 2%, preferably more than 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90%.

The term "low-water", as used here, means any substrate or food product with a water content of less than 6%, preferably less than 5%, 4%, 3%, 2%, 1% or 0.5%.

Preferably, the method and / or use according to the present invention can be carried out, for example, in a food product at a temperature of 15-60 ° C, preferably at a temperature of 20-60 ° C, preferably 20-50 ° C, preferably 20-45 ° C, preferably 20-40 ° C. For some aspects, for example for dough, the temperature of the food product during the time during which the acyltransferase reaction proceeds is preferably between 20 and 40 ° C. For other aspects, for example, related to dairy products, such as cheese, a suitable food temperature may be between 30 ° C and 60 ° C. In still other aspects, for example, relating to mayonnaise, a suitable food product temperature may be between 20 ° C and 40 ° C, more preferably between 25 ° C and 30 ° C.

Preferably, the emulsifier formed according to the present invention is less than 5% wt. food product.

Preferably, the emulsifier formed according to the present invention is from 0.01 to 4% wt. food product.

Preferably, the emulsifier formed according to the present invention is from 0.01 to 2% wt. food product.

Preferably, the emulsifier formed according to the present invention is from 0.01 to 1% wt. food product.

Preferably, the emulsifier formed according to the present invention is from 0.01 to 0.5% wt. food product.

Preferably, the emulsifier formed according to the present invention is from 0.01 to 0.3% wt. food product.

The method according to the present invention may include an inactivated or deactivated enzyme to obtain a food product comprising the enzyme in inactivated or denatured form. Typically, the enzyme can be denatured either by baking or by pasteurization.

The present invention may further encompass the use of lipid acyltransferase, as defined herein, in food and / or feed enzyme compositions and may include food and / or feed compositions including lipid acyltransferase as defined herein. Such compositions may contain one or more additional enzymes, such as those listed here. Alternatively, the enzyme composition of the invention can be used in combination with other food ingredients / additives, such as those listed here, including other enzyme compositions. By incorporating the lipid acyltransferase according to the invention into the formulation of a food and / or feed composition, the enzyme can be stabilized to allow long-term storage (under suitable conditions) before use in the manufacture of food and / or feed products. Additionally, the enzyme composition of the present invention contains the enzyme in a suitable form for safe use " in situ " in the preparation of food and / or feed products or ingredients for use in the preparation of food and feed. Such compositions may be in liquid or semi-liquid, or in solid / granular form.

In one embodiment, the food enzyme composition may be a dough-improving composition. The dough-improving composition may include other useful components, such as an emulsifier and / or other enzymes, which are listed here.

Food enzymes are sold as liquid concentrates or as ground solids. Entering the food enzyme composition minimizes the loss of enzymatic activity during transportation, storage and use. Enzymes are often exposed to a moist, hot or oxidizing environment during the production of food or drink. The formulations improve stability by counteracting the basic forces of deactivation: denaturation, deactivation by catalytic sites and proteolysis. Denaturation occurs by physically coagulating the tertiary protein structure of the enzyme under thermal or chemical stress. Once the enzyme begins to coagulate, it becomes significantly more vulnerable to deactivation and proteolysis. In order to minimize clotting, the compiler can change the environment of the protein so as to result in a compact protein structure, which is most effectively done by “preferentially eliminating” water from the surface of the protein by adding water-binding compounds such as sugars, polyols and lyotropic salts. The best ways to deal with active sites are to provide sufficient concentrations of any desired cofactors, add reversible inhibitors, and eliminate oxidizing or reactive substances from the formulation.

In addition to enzyme stability, the formulation must meet several key secondary requirements, including protection against microbial contamination, avoiding physical sedimentation or turbidity, minimizing the formation of sensitive dusts or aerosols, and optimizing aesthetic criteria such as color and smell. Many of these issues are most addressed, focusing as far upstream as possible, including the choice of raw materials in the fermentation or enzyme extraction process.

Product isolation operations, such as diafiltration, adsorption, chromatography, crystallization, and extraction, can be used to remove contaminants responsible for color, odor, and precipitation. The risk of physical deposition is minimized by formulating a composition near the isoelectric point of the enzyme with a hydrophilic solvent such as glycerol or propylene glycol. Moderate amounts of solvating salts can also be effectively added to avoid either salting out or “back salting”. To prevent microbial contamination, a combination of filtration, acidification and minimization of free water can be used; biocides may be effective, but the range of acceptable chemicals for controlling microbes or killing microbes is limited by health and safety regulations.

Two methods for producing the most abrasion resistant pellets today are shear granulation and spray coating in a fluidized bed, see, for example, T. Becker: "Separation and Purification Processes for Recovery of Industrial Enzymes" in RK Singh, SSH Rivzi ( eds): Bioseparation Processes in Foods , Marcel-Decker, New York, pp. 427-445. These methods use various binders, coatings, and particle morphologies to produce non-crumbling particles, which although they protect the enzymes during storage, but allow them to be easily released into solution during use.

The food enzyme compositions containing the lipid acyltransferase according to the invention can be prepared using standard form preparation methods, such as spray drying or liquid form preparation.

The lipid acyltransferase according to the invention can be expressed in any suitable carrier. For example, the lipid acyltransferase of the invention can be expressed in Bacillus subtilis and can be purified by ultrafiltration and / or precipitation in ethanol and / or centrifugation and can subsequently be spray dried using starch (maltodextrin) as the carrier for the enzyme. The spray drying enzyme can be standardized for a given PLU activity by adding an additional carrier in powder form. The methods used are well known and routine in practice.

Alternatively, a lipid acyltransferase for use in accordance with the present invention, for example, the heterologically obtained lipid acyltransferase according to the invention, when purified, can be stabilized in a suitable liquid form, such as glycerol based forms. Other methods for preparing stabilized enzyme forms are described in EP 0770037 and EP 0702712.

Powdered acyltransferase can also be used in combination with other enzymes, which are listed here, to obtain enzyme compositions with activity defined by the product specification.

Typically, the dosage of food enzyme compositions is from 10 to 1000 g per 1000 kg of food product, preferably 50-200 g per 1000 kg of food product, preferably 75-125 g per 1000 kg of food product.

Preferably, the enzyme according to the present invention is present in the inactive form or in denatured form in the food product.

In one embodiment, the enzyme according to the present invention is preferably not immobilized, in particular, it is not immobilized on a solid support.

In an alternative embodiment, the enzyme may be immobilized.

Immobilized lipid acyltransferase can be obtained using immobilization methods known in the art. These are various methods for producing immobilized enzymes that should be clear to a person skilled in the art (for example, methods described in EP 0746608 or in Balcao VM, Paiva AL, Malcata FX, Enzyme Microb. Technol. 1996 May 1: 18 (6): 392-416 or Reetz MT, Jaeger KE, Chem. Phys. Lipids 1998 Jun: 93 (1-2): 3-14, or Bornscheuer UT, Bessler C., Srinivas R., Krishna SH Trends Biotechnol. 2002 Oct; 20 (10): 433-7, each of which is introduced here by reference).

In one embodiment, the food product of the invention comprises food ingredients that have been prepared using immobilized lipid acyltransferase but do not contain lipid acyltransferase in the food ingredient or food product. For example, a food product may contain one or more of the following: an emulsifier, more than one emulsifier, one or more flavoring agents, one or more texture improvers, and / or one or more sterol esters, such as phytosterol esters or phytostanol esters.

The enzyme according to the present invention can be used with one or more conventional emulsifiers, including, for example, monoglycerides, diacetyl tartaric acid esters, fatty acid mono- and diglycerides and lecithins, for example, derived from soy.

The enzyme according to the present invention can be used with one or more of the other suitable food grade enzymes. Thus, in the framework of the present invention, in addition to the enzyme of the invention, at least one additional enzyme is added to the food product. Such additional enzymes include starch-degrading enzymes such as endo- or exomilases, pullunazases, side-branching enzymes, hemicellulases, including xylanases, cellulases, lipases, phospholipases and proteases.

The enzyme according to the present invention can be used with one or more of the other suitable food grade enzymes. Thus, in the framework of the present invention, in addition to the enzyme of the invention, at least one additional enzyme is added to the food product. Such additional enzymes include starch-degrading enzymes, such as endo- or exomilases, pullunazases, side-branching enzymes, hemicellulases, including xylanases, cellulases, oxidoreductases, for example, glucose oxidase, pyranose oxidase, such as malic acid oxidase, for example (HOX), lipases, phospholipases and hexosoxidases and proteases.

In one preferred embodiment, lipid acyltransferase is used in combination with lipases having one or more of the following lipase activities: glycolipase activity (E.C. 3.1.1.26), triacylglycerol lipase activity (E.C. 3.1.1.3), phospholipase A2 activity (ES 3.1.1.4) or phospholipase A1 activity (ES 3.1.1.32). Suitable lipase enzymes are well known in the art and include, as an example, the following lipases: LIPOPAN® F and / or LECITASE® ULTRA (Novozymes A / S, Denmark), phospholipase A2 (e.g., phospholipase A2 from LIPOMOD ™ 22L from Biocatalysts, LIPOMAX ™ from Genecor), LIPOLASE® (Novozymes A / S, Denmark), the lipase described in WO 03/97835, EP 0977869 or EP 1193314. This combination of lipid acyltransferase as defined herein and lipase may be particularly preferred in dough products or baked goods or in delicate foods such as cakes and sweets.

The use of lipases in combination with the enzyme according to the invention can be particularly advantageous in cases where some accumulation of fatty acids may be desirable, for example in cheese, where free fatty acids can give the desired taste, or in the preparation of delicate foods. The person skilled in the art should be able to combine proportions of lipolytic enzymes, e.g. LIPOPAN® F, LECITASE® ULTRA (Novozymes A / S, Denmark), phospholipase A2 (e.g. phospholipase A2 from LIPOMOD ™ 22L from Biocatalysts, LIPOMAX ™ from Genecor), LIPOLASE® (Novozymes A / S, Denmark), the lipase described in WO 03/97835, EP 0977869 or EP 1193314, and the lipid acyltransferase of the present invention to provide the desired ratio of hydrolytic and transferase activity, which will result in a preferred technical effect or combination of technical effects in a food product (such as those listed in here in the section "Technical Effects").

Typically, cake manufacturers use cake improvers to make cakes and provide high quality cakes in terms of taste, texture, consumer quality and appearance. Such cake improvers are usually based on emulsifiers sprayed onto a carrier such as starch and maltodextrin. Some improvers are also presented in gel form based on emulsifiers, sugars and water. Such cake improvers are very important for the production of cakes for the preparation of high quality products. However, cake improvers contain emulsifiers and other "unnatural" ingredients with E-numbers. Due to the demands of consumers, reducing the number of E-numbers, cake production needs alternative methods of making high-quality cakes without the use of emulsifiers.

An alternative way of making cakes is to use an enzyme, i.e. a lipid acyltransferase as defined herein or an enzyme composition according to the present invention.

The lipid acyltransferase as defined herein and / or the food enzyme composition of the present invention can be used in the preparation of "thin" food products, such as cakes. In such cases, the following components may be formed in the food product:

i) sugar esters and lysolecithin (from carbohydrate in the cake recipe and egg lecithin, which also form part of the cake recipe) and / or

ii) acylated peptides and lysolecithin (by transferring a fatty acid from lecithin to a protein or peptide during the formation of protein-fatty acid condensates, which are known as highly effective emulsifiers (Herstellung und Anvendungmöglichkeiten von Eiweiss-Fettsaürekondensaten. Andreas Sander, Eberhard Eilershards, Andreas Sanders, Eberhard Eilers Edith von Kreis. Fett / lipid 99 (1997) Nr. 4, 115-120).

It is believed that in the manufacture of certain “thin” food products, especially highly fatty thin food products, such as cakes, it may be desirable to have some accumulation of fatty acids. Therefore, the combination of the use of lipolytic enzymes and lipid acyltransferase, as defined here, can be especially favorable for the manufacture of high-fat thin food products. Alternatively, additional free fatty acids or fatty acid soap (E470a) can be selected and used in combination with lipid acyltransferase.

The food product of the present invention may suitably include one or more of the following additives:

soy protein material, carotenoids, flavonoids, antioxidant and phytochemicals (in particular anthocyanide, carotenoid, bioflavonoid, glutanion, catechin, isoflavone, lycopene, ginsenoside, pycnogenol, alkaloid, pyheum phytosterol, sulfoferol ether, resverol ether, resverol ether, resverol , vitamin (especially vitamin C, vitamin A, vitamin B3, vitamin D, vitamin E, thiamine, riboflavin, niacin, pyridoxine, cyanocabalamine, folic acid, biotin, pantothenic acid or vitamin K), minerals (especially calcium, e, magnesium, zinc, iron, selenium, manganese, chromium, copper, cobalt, molybdenum or phosphorus), fatty acid (in particular gamma-linolenic acid, ukospentatenovy acid or decosehexaenoic acid), oil (in particular borage oil, canola oil with high carotenoids or flax seed oil), an amino acid (especially tryptophan, lysine, methionine, phenylalanine, threonine, valine, leucine, isoleucine, alanine, arginine, aspartic acid, cystine, cysteine, glutamic acid, glutamine, glycine, histidine, proline , hydroxyproline, serine, ta rin or tyrosine), enzyme (especially bromelain, papain, amylase, cellulase or coenzyme Q), lignin, stanol ester or friendly bacteria (especially Lactobacillus acidophilus, Lactobacillus bulgaricus, Lactobacillus bifidus , Lactobacillus plantarum or Streptococcus faecium), folic acid and soluble fiber.

TECHNICAL EFFECT

Surprisingly, lipid acyltransferase has significant acyltransferase activity in foods. This activity has unexpectedly beneficial uses in food preparation methods.

The present invention is based on the unexpected discovery that the lipid acyltransferase according to the present invention can carry out the esterification of carbohydrate by alcoholysis, i.e. acyl transfer from lipid in a food product with a significant water content. It was previously assumed that such enzymes, if they work in this way, then only in a solvent medium (i.e., in an environment with a low content or lack of water).

The present invention can provide one or more of the following unexpected technical effects for egg products, in particular mayonnaise: improved thermal stability during pasteurization, improved organoleptic properties and improved texture.

The present invention can provide one or more of the following unexpected technical effects for dough and / or baked products: improved specific volume of either dough or baked products (e.g., bread and / or cake), improved dough stability, improved crust scoring (e.g. finer and / or crisp bread crust), improved crumb score (e.g., more uniform crumb distribution, and / or finer crumb structure, and / or softer crumb), improved appearance (e.g., smoother erhnost without blisters or holes on the surface, or substantially without blisters or holes on the surface), reduced staling, improved softness, improved odor, improved flavor.

The present invention can provide a beneficial effect from the formation of highly surfactants in the food product without the formation of a significant amount of free fatty acids, which reduce the ability of the food product to oxidize during storage, since free fatty acids are more prone to oxidation than the corresponding fatty acid esters.

Accordingly, the present invention can provide one or more of the following unexpected effects in a food product: improved appearance, improved mouth feel, improved stability, in particular improved thermal stability, improved taste, improved softness, improved elasticity, improved emulsification.

Accordingly, the present invention can provide one or more of the following unexpected effects in dairy products, such as, for example, ice cream: improved mouthfeel (preferably a more pronounced creamy mouthfeel), improved taste, improved melt.

Accordingly, the present invention can provide one or more of the following unexpected effects in eggs or egg products: improved emulsion stability, thermal stability of the emulsion, improved taste, reduced bad smell, improved thickening properties, improved consistency.

Specific technical effects associated with the use of lipid acyltransferase, as defined here, when preparing a food product are listed in the table below.

Food product Effect one Bread, donuts and donuts Enhances the dough increases mechanical strength and increases the ability to absorb water. Increases the volume of baked products and maintains the softness of the crumb. 2 Frozen dough Prevents damage during freezing. 3 Biscuit Gives a good cupcake volume and a uniform soft texture. four Sponge cake, crackers and cookies It gives a stable emulsion of fat and prevents sticking to the machine. Prevents greasy graying of highly fatty foods. 5 Chatterbox and breading Improves the texture of fried foods. 6 Noodles Prevents sticking of dough to the machine. Increases water content and reduces cooking losses. 7 Instant noodles Prevents noodles from sticking to each other. 8 Paste Dough conditioner prevents adhesion during cooking. 9 Cream pummeled Gives a starchy paste with a smooth and creamy texture and prevents dehydration. 10 Coffee whitener Prevents the separation of oil and water. eleven Whipped cream Provides a stable emulsion. 12 Chocolate Prevents delayed graying. 13 Caramel, sweets and nougat Improves emulsification of molten sugar and butter. Prevents oil separation. fourteen Processed meat, sausages Improves the ability of sausages and pressed ham to retain water and prevents the separation of the oil phase from pastes and patas.

Accordingly, the present invention can provide one or more of the following unexpected effects in cheeses: reducing the effect of oil separation from cheese, increasing the yield of cheese, improving the taste, the weakened bad smell, the weakened “soapy” taste.

In the manufacture of food products, in particular in the production of cheese, the use of lipid acyltransferase in accordance with the present invention gives a significant advantage in the ability to extract soluble proteins from dairy products. For example, in the production of cheese, almost 20% of all milk protein is removed in whey (i.e. the aqueous portion of the milk that remains after the formation of cottage cheese). Whey contains soluble milk proteins, while hydrophobic proteins are held in cottage cheese. When using the lipid acyltransferase in accordance with the present invention, it is possible to transfer the acyl group from a lipid (preferably from a glycolipid or phospholipid) to a protein (in particular to a whey protein such as lactoglobulin) to form a condensate of the protein and fatty acid. Thus, a product is formed which is more hydrophobic and which should remain in the curd and not be washed in the whey. In this way, more milk protein can be retained in the final food product, i.e. in a final dairy product such as cheese.

In one aspect, the present invention is based in part on the realization that the yield of food products, such as cheese, can be improved by using lipid acyltransferase. In addition or alternatively, the taste, texture, oxidative stability and / or shelf life of the food product can be improved. In addition or alternatively, the food product may have a reduced cholesterol content or an improved content of sterol / stanol esters.

Without the desire to be bound by a specific theory, it is believed that an increase in yield may result from transesterification of whey proteins and peptides, resulting in a significant increase in the hydrophobicity of whey proteins and precipitation of acylated whey proteins in cheese curd.

In biological systems, for example, the deposition of membrane-bound proteins and enzymes is achieved by two different mechanisms. Membrane-bound proteins either have a number of tightening membranes or hydrophobic domains, or they alternatively have a fatty acid attached to the polypeptide mixture. Fatty acids usually have a chain length of 14 or 16 carbon atoms. Fatty acids are covalently attached to the polypeptide chain in 3 different positions: to the N-terminus of an amino acid as an amide bond, to a cysteine residue as a thioether bond, or to an amino acid serine or threonine as an ether bond. Only one fatty acid per polypeptide molecule is needed to introduce the protein into the cell membrane.

When a fatty acid is covalently attached to a non-membrane protein, physical and functional properties will change radically. WO 97/14713 describes soy and gluten proteins transformed into acyl derivatives by treatment with lipase from Mucor miehet (Lipozyme ™, Novozymes) and a fatty acid in an organic solvent. The lipid acyltransferase according to the present invention can be used in the preparation of acylated proteins in a low or high water environment.

The authors note that acylated proteins form amphiphilic complexes that can be used for a number of cosmetic products. The acylated protein can form gels, bind water with residual moisture, have emulsifying properties and be very active in the phase separation between water and lipid.

Thus, the present invention may, in one aspect, relate to a cosmetic composition comprising a lipid acyltransferase as defined herein.

In addition, the present invention may relate to the use of acyltransferase, as defined here, to obtain a cosmetic composition.

In a further aspect, the present invention relates to a method for producing an in situ protein ester in a cosmetic composition, the method comprising the step of adding a lipid acyltransferase as defined herein to the cosmetic composition (or its components).

Many foods are soluble in aqueous solutions and are therefore suitable for in situ modification with lipase acyltransferase. In cheese production, β-lactoglobulin is lost with the whey fraction. After acylation with a lipase acyltransferase or variant acyltransferase lipase, initial results show that β-lactoglobulin can, however, be deposited on the surface of casein micelles during coagulation with abomasum. β-lactoglobulin has three potentially acylated sites (serine residues) on three surface loops. The milk contains sufficient amounts of lecithin, a suitable substrate, so that the lipid acyltransferase enzyme acylates β-lactoglobulin. The resulting lysolecithin may have an additional emulsifying effect.

The improvements observed with the lipid acyltransferase according to the present invention are manifested in comparison with when lipolytic enzymes without acyltransferase activity, such as triacylglycerol lipases and phospholipases, are used.

ADVANTAGES

The formation of an emulsifier and sterol / stanol ester in situ from at least one constituent food material means that the food material will contain at least one additional substance. This is an advantage due to an improvement in facilitating production. For example, additional processing or the addition of ingredients or the addition of emulsifiers may not be required. Moreover, a food product may contain fewer additives. Reducing or eliminating additives is desirable for buyers and the exclusion of additives can often be announced to the buyer when listing the ingredients of a food product. Thus, the present invention has additional advantages.

An advantage of the present invention may be the formation of an in situ emulsifier in the food product without adversely increasing the free fatty acid content of the food product.

The formation of two emulsifiers and / or carbohydrate ester in situ from at least one constituent food material means that the food material will contain at least two additional substances.

In addition, when lipid acyltransferase acts on glycolipid, it can favorably produce DGMG emulsifier in situ without adversely increasing the free fatty acid content of the food product. Thus, the weakening of the harmful effects attributed to the increase in the content of free fatty acids includes, but is not limited to, weakening the “soapy” taste in cheese, preventing overdosing in the dough and improving the baking properties of the dough.

For some aspects, an advantage of the present invention is to lower cholesterol levels in a food product.

For other aspects, increasing the content of stanol and / or sterol esters in the food product. Some sterol / stanol esters may be effective flavoring agents and / or texture enhancers. It is known that some sterol / stanol esters lower cholesterol and / or low density lipoproteins in serum when consumed with a food product. Thus, the present invention can be used to obtain a food product with increased concentrations of sterol esters and / or stanol esters.

For some aspects, especially when the enzyme of the present invention is used in egg-based products, the advantage is the removal of undesired free carbohydrates.

It is also advantageous that the emulsion properties of the food product are improved, leading to an improvement in the appearance and / or workability and / or structure and / or texture and / or thermal stability without negatively affecting the taste.

In addition, for some embodiments, it is advantageous that the “overdose” effect observed with the use of lipases per se is successfully overcome by adding an enzyme in accordance with the present invention. This is due, at least in part, to the fact that free fatty acids do not form or only to a small extent when using the enzyme according to the present invention.

ALLOCATED

In one aspect, preferably, the polypeptide or protein for use in the present invention is in isolated form. The term "isolated" means that the sequence is at least substantially free of at least one other component with which the sequence is naturally associated in nature and is in nature.

PURIFIED

In one aspect, preferably, the polypeptide or protein for use in the present invention is in purified form. The term "purified" means that the sequence is in a relatively pure state, for example, at least 51% purity, or at least about 75%, or at least about 80%, or at least about 90%, or at least at least about 95%, or at least about 98% purity.

Cloning of a nucleotide sequence encoding a polypeptide according to the present invention

A nucleotide sequence encoding either a polypeptide that has specific properties, as defined here, or a polypeptide that is suitable for modification, can be isolated from any cell or organism that produces the specified polypeptide. Various methods for isolating nucleotide sequences are well known in the art.

For example, a library of genomic DNA and / or cDNA can be created using chromosomal DNA or messenger RNA from an organism producing a polypeptide. If the amino acid sequence of the polypeptide is known, labeled oligonucleotide probes can be synthesized and used to identify nucleotide-encoding clones from a gene library prepared from the body. Alternatively, a labeled oligonucleotide probe containing sequences homologous to another known polypeptide gene can be used to identify nucleotide-encoding clones. In the latter case, hybridization and washing conditions of lower stringency are used.

Alternatively, clones encoding the polypeptide can be identified by inserting genomic DNA fragments into an expression vector, such as a plasmid transforming the enzyme negative bacteria with the resulting genomic DNA library, and then plating the transformed bacteria on agar containing the enzyme inhibited by the polypeptide, thereby allowing clones to express the polypeptide to be identified.

In a further alternative, the nucleotide sequence encoding the polypeptide can be obtained synthetically by standard methods, for example, the phosphoramiditine method described by Beucage S.L. et al. (1981) Tetrahedron Letters 22, p. 1859-1869, or by the method described by Matthes et al. (1984) EMBO J. 3, p. 801-806. In the phosphoramiditine method, oligonucleotides are synthesized, for example, in an automatic DNA synthesizer, purified, calcined, stitched and cloned into suitable vectors.

The nucleotide sequence may be of mixed genomic and synthetic origin, mixed synthetic and cDNA origin, or mixed genomic and cDNA origin obtained by crosslinking fragments of synthetic, genomic or cDNA origin (as required) in accordance with standard techniques. Each crosslinked fragment corresponds to different parts of the complete nucleotide sequence. The DNA sequence can also be obtained by reaction of the polymerase chain (PRC) using specific primers described, for example, in USP 4683202 or Saiki R.K. et al. (Science (1988) 239, pp. 487-491).

NUCLEOTIDE SEQUENCES

The present invention also encompasses nucleotide sequences encoding polypeptides having specific properties as defined herein. The term "nucleotide sequence", as used here, refers to an oligonucleotide sequence or polynucleotide sequence and their variants, homologues of fragments and derivatives (such as parts thereof). The nucleotide sequence can be of genomic, or synthetic, or recombinant origin, which can be double-stranded or single-stranded, representing both semantic and antisense strands.

The term "nucleotide sequence" relative to the present invention includes genomic DNA, cDNA, synthetic DNA and RNA. Preferably, it means DNA, more preferably cDNA, for the coding sequence.

In a preferred embodiment, the nucleotide sequence, as such, encoding a polypeptide having specific properties, as defined herein, does not encompass the native nucleotide sequence in its natural environment when it is attached to the naturally associated sequence (s) that also ( are) in their natural surroundings. For convenience of reference, we will call such a preferred embodiment "non-native nucleotide sequence." In this regard, the term "native nucleotide sequence" means a complete nucleotide sequence that is in its native environment and when it is operatively attached to a full promoter, with which it is naturally associated, which promoter is also in its native environment. Thus, the polypeptide of the present invention can be expressed by a nucleotide sequence in its native organism, but where the nucleotide sequence is not under the control of a promoter with which it is naturally linked within a given organism.

Preferably, the polypeptide is not a native polypeptide. In this regard, the term "native polypeptide" means a complete polypeptide that is in its natural environment and when it was expressed by its native nucleotide sequence.

Typically, a nucleotide sequence encoding polypeptides having specific properties as defined herein is prepared using recombinant DNA methods (i.e., recombinant DNA). However, in an alternative embodiment of the invention, the nucleotide sequence can be synthesized in whole or in part using chemical methods well known in the art (see Caruthers MH et al. (1980) Nuc Acids Res Symp Ser 215-23 and Horn T. et al. (1980 ) Nuc Acids Res Symp Ser 225-232).

MOLECULAR EVOLUTION

When the enzyme coding nucleotide sequence is isolated or the putative enzyme coding nucleotide sequence is identified, it may be desirable to modify the selected nucleotide sequence, for example, it may be desirable to mutate the sequence in order to obtain the enzyme in accordance with the present invention.

Mutations can be introduced using synthetic oligonucleotides. Such oligonucleotides contain nucleotide sequences flanking the desired mutation sites.

A suitable method is described in Morinaga et al. (Biotechnology (1984) 2, p. 646-649). Another method for introducing mutations into an enzyme coding nucleotide sequence is described by Nelson and Long (Analytical Biochemistry (1989), 180, p. 147-151).

Instead of site-directed mutagenesis, such as the one described above, mutations can be randomly introduced, for example, using a commercially available reagent kit, such as the Stratagene GeneMorph PCR mutagenesis kit, or the Cliverset Diversify PCR random mutagenesis kit. EP 0583265 refers to methods for optimizing PCR-based mutagenesis that can also be combined with the use of mutagenic DNA analogues, such as those described in EP 0866796. Erroneous PRC technologies are suitable for preparing lipid acyltransferase variants with preferred characteristics. WO 02/06457 refers to the molecular evolution of lipases.

A third method for generating new sequences is to fragment non-identical nucleotide sequences using either any number of restriction enzymes or an enzyme such as DNA I and reassemble the complete nucleotide coding sequences for functional proteins. Alternatively, one or multiple non-identical nucleotide sequences can be used and mutations introduced during assembly of the complete nucleotide sequence. DNA shuffling and family shuffling techniques are suitable for preparing lipid acyltransferase variants with preferred characteristics. Suitable methods for performing shuffling can be found in EP 0752008, EP 1138763, EP 1103606. Shuffling can also be combined with other forms of DNA mutagenesis, as described in US 6180406 and WO 01/34835.

Thus, it is possible to obtain numerous site-directed or random mutations in the nucleotide sequence either in vivo or in vitro and then search for improved functionality of the coding polypeptide in various ways. Using, for example, silico- and exo-mediated recombinant methods (see WO 00/58517, US 6344328, US 6361974), molecular evolution can be carried out where the resulting variant retains very weak homology with known enzymes or proteins. Such variants thus obtained can have a significant structural analogy with known transferase enzymes, but have very low amino acid sequence homology.

As a non-limiting example, additional mutations or natural variants of the polynucleotide sequence can be recombined with either the wild type, or other mutations, or with natural variants to obtain new variants. Such new variants can also be screened to look for improved coding polypeptide functionality.

The use of the above and similar molecular evolutionary methods makes it possible to identify and select enzyme variants of the present invention that have preferred characteristics, without any prior knowledge of the structure or function of the protein, and makes it possible to obtain unpredictable but favorable mutations or variants. There are numerous examples of the application of molecular evolution in practice to optimize or change the activity of an enzyme; such examples include, but are not limited to, one or more of the following: optimized expression and / or activity in a carrier cell or in vitro , increased enzyme activity, altered specificity of the substrate and / or product, increased or decreased enzymatic or structural stability, altered enzyme activity / specificity in preferred environmental conditions, for example temperature, pH, substrate.

As should be clear to an experienced person, using an molecular evolution tool, the enzyme can be modified to improve the functionality of the enzyme.

Accordingly, the lipid acyltransferase used in the invention may be an option, i.e. may contain at least one substitution, exclusion or addition of an amino acid compared to the parent enzyme. Variant enzymes retain at least 1%, 2%, 3%, 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% , 97%, 99% homology with the parent enzyme. Suitable parent enzymes may include any enzyme with esterase or lipase activity. Preferably, the parent enzyme is aligned with the consensus sequence pfam00657.

In a preferred embodiment, the variant lipid acyltransferase enzyme stores or comprises at least one or more of the amino acid residues of the pfam00657 consensus sequence found in the GDSX, GANDY, and HPT blocks.

Enzymes, such as lipases with low or no lipid acyltransferase activity in an aqueous medium, can be mutated using molecular evolution tools in order to introduce or improve transferase activity, thereby obtaining a lipid acyltransferase enzyme with significant transferase activity, suitable for use in the compositions and methods of the present invention.

Accordingly, a lipid acyltransferase for use in the invention may be an option with improved enzymatic activity against polar lipids, preferably phospholipids and / or glycolipids, as compared to the parent enzyme. Preferably, such variants also have low or absent activity with respect to polar lysolipids. Improved enzymatic activity towards polar lipids, phospholipids and / or glycolipids may result from hydrolysis and / or transferase activity, or a combination of both.

Variant lipid acyltransferases for use in the invention may have reduced activity with respect to triglycerides and / or monoglycerides and / or diglycerides compared to the parent enzyme.

A suitable variant enzyme may not have activity with respect to triglycerides and / or monoglycerides and / or diglycerides.

Alternatively, the variant enzyme for use in the invention may have increased activity for triglycerides and may also have increased activity for one or more of the following polar lipids: phospholipids, lecithin, phosphatidylcholine, glycolipids, digalactosylmono-glyceride, monogalactosyl diglyceride.

Variants of lipid acyltransferases are known, and one or more of these variants may be suitable for use in the methods and applications according to the present invention. By way of example only in accordance with the present invention, the lipid acyltransferase variants described in Hilton & Buckley J Biol can be used. Chem. 1991 Jan. 15: 266 (2): 997-1000; Robertson et al. J Biol. Chem. 1994 Jan 21: 269 (3): 2146-50; Brumlik et al. J Bacreriol 1996 Apr; 178 (7): 2064-4; Peelman et al. Protein Sci. 1998 Mar; 7 (3): 587-99.

AMINO ACID SEQUENCES

The present invention also encompasses amino acid sequences of polypeptides having specific properties as defined herein.

The term "amino acid sequence", as used here, is synonymous with the term "polypeptide" and / or the term "protein". In some cases, the term “amino acid sequence” is synonymous with the term “peptide”.

The amino acid sequence can be obtained / isolated from a suitable source, or can be made synthetically, or can be obtained using recombinant DNA methods.

Accordingly, amino acid sequences can be obtained from isolated polypeptides studied here by standard methods.

One suitable method for determining amino acid sequences from isolated polypeptides is as follows.

The purified polypeptide can be freeze dried and 100 μg of freeze dried material can be dissolved in 50 μl of a mixture of 8 M urea and 0.4 M ammonium hydrogen carbonate, pH 8.4. The dissolved protein can be denatured and reduced for 15 minutes at 50 ° C after being coated with nitrogen and adding 5 μl of 45 mM dithiotretiol. After cooling to room temperature, 5 μg of 100 mM iodoacetamide can be added to derivatize the cysteine residue for 15 minutes at room temperature in the dark under nitrogen.

135 μl of water and 5 μg of Lys-C endoproteinase in 5 μl of water can be added to the above reaction mixture, and cleavage can be carried out at 37 ° C. under nitrogen for 24 hours.

The resulting peptides can be separated by reverse phase HPLC on a VYDAC C18 column (0.46 × 15 cm; 10 μm; The Separation Group, Califirnia, USA) using solvent A: 0.1% TFA in water and solvent B: 0, 1% TFA in acetonitrile. Selected polypeptides can be rechromatographed on a Devosil C18 column using the same solvent system prior to N-termination. Ordering can be performed using an Applied Biosystems 476A sequencer, using fast pulsating cycles of fluid according to manufacturer's instructions (Applied Biosystems, California, USA).

SEQUENCE IDENTITY OR SEQUENCE HOMOLOGY

The present invention also encompasses the use of sequences having a degree of identity or homology with a sequence (s) of a polypeptide having the specific properties defined herein, or any nucleotide sequence encoding such a polypeptide (hereinafter referred to as "homologous sequence" ("homologous sequences") ) As used herein, the term “homologous” means an entity having explicit homology with the amino acid sequences in question and the nucleotide sequences in question. Here, the term "homology" can be equated with the term "identity".

A homologous amino acid sequence and / or nucleotide sequence should provide and / or encode a polypeptide that retains functional activity and / or improves enzyme activity.

In this context, a homologous sequence is used to include an amino acid sequence that may be at least 75, 85 or 90% identical, preferably at least 95 or 98% identical, to be considered. Typically, homologues should include the same active sites and the like as the amino acid sequence in question. Although homology can also be considered with respect to similarity (i.e., amino acid residues having similar chemical properties / functions), in the context of the present invention, it is preferable to express homology with respect to sequence identity.

In this context, a homologous sequence is used to include a nucleotide sequence that may be at least 75, 85 or 90% identical, preferably at least 95 or 98% identical to the nucleotide sequence encoding the polypeptide of the present invention (sequence subject to review). Typically, homologues should include the same sequences that encode active sites and the like as the sequence in question. Although homology can also be considered with respect to similarity (i.e., amino acid residues having similar chemical properties / functions), in the context of the present invention, it is preferable to express homology with respect to sequence identity.

Homology comparisons can be made by eye or, more conveniently, using readily available sequence comparison programs. Such commercially available computer programs can calculate% homology between two or more sequences.

% homology can be calculated between adjacent sequences, i.e. one sequence is aligned with another sequence, and each amino acid in one sequence is directly compared with the corresponding amino acid in another sequence, one residue at a time. This is called "alignment without spaces". Typically, such alignments are carried out only on a relatively small number of residues.

Although this is a very simple and logical method, it does not take into account that, for example, in an identical pair of sequences, one insert or one deletion will cause the following amino acid residues to drop out of alignment, which potentially leads to a large decrease in% homology when performing global alignment . Therefore, most sequence comparison methods are designed to obtain optimal alignments that take into account possible insertions and deletions without undue penalty on the assessment of overall homology. This is achieved by inserting “spaces” in the alignment sequence to try to maximize local homology.

However, such more sophisticated methods set “fines for a space” for each space that appears during sequence alignment, so that for the same number of identical amino acids, sequence alignment with as few spaces as possible, reflecting a higher connection between the two compared sequences, will higher score than sequence with many spaces. Usually they use the “affine space price”, which charges a relatively high price for the existence of each space and a lower penalty for each subsequent remainder in the space. This is the most widely used gap rating system. A high penalty for a space should, of course, give optimized alignments with smaller spaces. Most alignment programs allow you to modify fines for a space. However, when using such a software product for sequence comparisons, it is preferable to use the default values. For example, when using the GCG Wisconsin Bestfit package, the default space penalty for amino acid sequences is -12 per space and -4 per extension.

The calculation of the maximum% homology therefore, first of all, requires optimal alignment, taking into account the fines for the gap. A suitable computer program for performing such alignment is the GCG Wisconsin Bestfit package (Devereux et al. 1984 Nuc. Acids Research 12 p. 387). Examples of other programs that can perform sequence comparisons include, but are not limited to, the BLAST package (see Ausbel et al. 1999 Short Protocols in Molecular Biology, 4 ^th Ed. - Chapter 18), FASTA (Altschut et al. 1990 J .Mol.Biol. 403-410) and a set of tools for comparing GENEWORKS. Both BLAST and FASTA are available for offline and online searches (see Ausbel et al. 1999, pp. 7-58 to 7-60). However, for some applications, it is preferable to use the GCG Bestfit program. A new tool, called BLAST 2 Sequences, is also available for comparison of protein and nucleotide sequences (see FEMS Micribiol. Lett 1999 174 (2), 247-50; FEMS Micribiol. Lett 1999 177 (1), 187-8 and tatiana @ ncbi .nml.gov).

Although the final% homology can be determined with respect to identity, the alignment process itself is usually not based on a comparison of pairs on an all-or-nothing basis. Instead, a matrix of scale similarity scores is usually used, which sets the scores for each pairwise comparison based on chemical similarity or evolutionary distance. A widely used example of such a matrix is the BLOSUM62 matrix, the default matrix for the BLAST software package. GCG Wisconsin programs typically use either public default values, or a custom character comparison table, if available (see the user manual for further details). For some applications, it is preferable to use the public default values for the GCG package or, in the case of other programs, a default matrix such as BLOSUM62.

Alternatively, the percent homology can be calculated using the multiple alignment feature in DNASIS ™ (Hitachi Software), based on an algorithm similar to CLUSTAL (Higgins DG & Sharp PM (1988), Gene 73 (1), 237-244).

Once the program has made the optimal alignment, it becomes possible to calculate% homology, preferably% sequence identity. A program usually does this as part of a sequence comparison and generates a numerical result.

The sequences may also have deletions, insertions, or substitutions of amino acid residues that produce an undeclared change and result in a functionally equivalent substance. Intentional amino acid substitutions can be made based on the similarity of polarity, charge, solubility, hydrophobicity, hydrophilicity and / or amphipathic nature of the residues, since the secondary binding activity of the substance is maintained. For example, negatively charged amino acids include aspartic acid and glutamic acid, positively charged amino acids include lysine and arginine, and amino acids with uncharged polar head groups having similar hydrophilicity values include leucine, isoleucine, valine, glycine, alanine, asparagine, glutamine, serine, threonine, phenylalanine and tyrosine.

Conservative substitutions can be made, for example, according to the table below. Amino acids in the same block in the second column, and preferably in the same row in the third column, can replace each other.

ALIPHATIC Non-polar G a p I L V Polar - Uncharged C S T M N Q Polar - charged D e K r AROMATIC H F W V

The present invention also encompasses homologous substitution (and substitution and substitution are used here to indicate the interchangeability of an existing amino acid residue and an alternative residue) that may occur, i.e. substitution similar to similar, such as basic basic, acidic acid, polar polar, etc. Non-homologous substitution may also occur, i.e. one class of residue to another, or alternatively involving the incorporation of unnatural amino acids such as ornithine (hereinafter referred to as Z), ornithindiaminobutyric acid (hereinafter referred to as B), norleucinornithine (hereinafter referred to as O), pyrilalanine, thienylalanine, naphthylalanine and phenylglycine.

Substitutions can also be made by unnatural amino acids.

Variant amino acid sequences may include suitable spacer groups that can be inserted between any two amino acid residues of the sequence, including methyl, ethyl or propyl groups in addition to amino acid spacers, such as glycine or β-alanine residues. The following form of variation involves the presence of one or more amino acid residues in peptoid form and should be well understood by those skilled in the art. For the avoidance of doubt, the expression "peptoid form" is used to denote an amino acid residue variant in which the α-carbon substituent group is on the nitrogen atom of the residue, and not on the α-carbon. Methods for producing peptides in peptoid form are known in the literature, for example, Simon R.J. et al., PNAS (1992) 89 (20), 9367-9371 and Horwell D.C., Trends Biotechnol. (1995) 13 (4), 132-134.

The nucleotide dependencies for use in the present invention for encoding a polypeptide having the specific properties defined herein may include synthetic or modified nucleotides. Many different types of oligonucleotide modifications are known in the art. These include methylphosphonate and phosphorothioate skeletons and / or the addition of acridine or polylysine chains to the ends of a 3 'or 5' molecule.

For the purposes of the present invention, it should be understood that the nucleotide sequences described herein can be modified by any method available from practice. Such modifications can be made in order to improve the in vivo activity or the life span of the nucleotide sequences.

The present invention also encompasses the use of nucleotide sequences that are complementary to the sequences discussed herein, or any derivatives, fragments or derivatives thereof. If the sequence is complementary to their fragment, then such a sequence can be used as a probe to identify similar coding sequences in other organisms, etc.

Polynucleotides that are not 100% homologous to the sequences of the present invention but are within the scope of the invention can be obtained in many ways. Other variants of the sequences described here can be obtained, for example, by probing libraries of DNA made from individuals, for example, individuals from different populations. In addition, other viral / bacterial or cellular homologs, especially cellular homologs found in mammalian cells (e.g., rats, mice, bovine cells and primate cells) can be obtained, and such homologs and fragments thereof will in principle be able to selectively hybridize the sequences shown here in the sequence listing. Such sequences can be obtained by probing cDNA libraries composed of genomic DNA libraries from other animal species, and probing such libraries with probes that include all or part of any one of the sequences in the lists of attached sequences under moderate to high stringency conditions. Similar considerations apply to the preparation of homologous species and allelic variants of the polypeptide or nucleotide sequences of the invention.

Variants and strains / species homologues can also be obtained using degenerate PCR, which uses primers that target the sequence among the variants and homologues encoding conserved amino acid sequences among the sequences of the present invention. Conservative sequences can be predicted, for example, by aligning amino acid sequences from several variants / homologs. Sequence alignment can be accomplished using computer programs known in the art. For example, the GCG Wisconsin PileUp program is widely used.

The primers used in degenerate PCR must contain one or more degenerate positions and should be used under stringent conditions lower than the conditions used to clone sequences with a single sequence primer against known sequences.

Alternatively, such polynucleotides can be obtained by site directed mutagenesis of the characterized sequences. This can be useful when, for example, asymptomatic changes in the codon sequence are required in order to optimize the codon preference for the particular recipient cell into which the nucleotide sequence has been expressed. Other sequence changes may be desirable in order to introduce restriction polypeptide recognition sites or to alter the property or function of polypeptides encoded by polynucleotides.

The polynucleotides (polynucleotide sequences) of the invention can be used to prepare a primer, for example, a PCR primer, a primer for an alternative amplification reaction, a probe, for example, labeled with a distinctive label, by conventional methods using radioactive or non-radioactive tags, or polynuleotides can be cloned into vectors. Such primers, probes, and other fragments must be at least 15, preferably at least 20, for example at least 25, 30, or 40 nucleotides long, and are also encompassed by the term “nucleotides of the invention” as used herein.

Polynucleotides, such as DNA polynucleotides and probes according to the invention, can be obtained recombinantly, synthetically or by any other methods available to specialists. They can also be cloned by standard techniques.

In principle, primers can be obtained by synthetic methods, including the stepwise preparation of the desired nucleic acid sequence, one nucleotide at a time. Techniques for implementing this using automated technologies are readily available in practice.

Longer polynucleotides will typically be obtained using recombinant agents, for example, using PCR cloning techniques (chain polymerase reaction). This should include the manufacture of a pair of primers (for example, from about 15 to 30 nucleotides) flanking the region of the lipid-targeting sequence that it is desired to clone, contacting the primers with mRNA or cDNA derived from animal or plant cells, and carrying out the polymerase chain reaction that cause amplification of the desired region, isolating the amplified fragment (for example, purifying the reaction mixture on agarose gel) and extracting the amplified DNA. Primers can be designed to contain suitable restriction enzyme recognition sites so that the amplified DNA can be cloned into a suitable cloning vector.

HYBRIDIZATION

The present invention also encompasses sequences that are complementary to sequences of the present invention, or sequences that are capable of hybridization, or sequences of the present invention, or sequences complementary to them.

The term "hybridization", as used here, should include "the process by which a nucleic acid strand is connected to a complementary strand by pairing of nucleic acid bases", as well as the amplification process, as it is carried out in the technology of polymerase chain reaction (PCR).

The present invention also encompasses the use of nucleotide sequences that are capable of hybridizing with sequences that are complementary to the aspect sequences discussed herein or to any derivatives, fragments or derivatives thereof.

The present invention also encompasses sequences that are capable of hybridizing to the nucleotide sequences discussed herein.

Hybridization conditions are based on the melting temperature ( _Tm ) of the binder complex, as described in Berger and Kimmel (1987, Guide to Molecular Cloning Techniques, Methods in Enzymology, Vol. 152, Academic Press, San Diego CA), and suggest a certain “stiffness” as explained below.

Maximum stiffness usually appears at a temperature of approximately T _pl -5 ° C (5 ° C lower than T _pl probe); high rigidity at a temperature of about 5-10 ° C below T _pl ; average stiffness at a temperature of about 10-20 ° C below T _pl and low stiffness at a temperature of about 20-25 ° C below T _pl . As should be understood by those skilled in the art, maximum hybridization stiffness can be used to identify or determine similar or related polynucleotide sequences.

Preferably, the present invention also encompasses sequences that are complementary to sequences capable of hybridization under high stringency conditions or medium stringency conditions with nucleotide sequences encoding polypeptides having specific properties as defined herein.

More preferably, the present invention encompasses sequences that are complementary to sequences capable of hybridizing under highly stringent conditions (eg, 65 ° C. and 0.1 × SSC {1 × SSC = 0.15 M Na-citrate, pH 7.01} with nucleotide sequences encoding polypeptides having specific properties as defined herein.

The present invention also relates to nucleotide sequences that can hybridize to the nucleotide sequences discussed herein (including complementary sequences of the sequences discussed herein).

The present invention also relates to nucleotide sequences that are complementary to sequences that can hybridize to the nucleotide sequences discussed herein (including complementary sequences of the sequences discussed herein).

Polynucleotide sequences that are capable of hybridizing to the nucleotide sequences discussed herein under conditions of medium to maximum stringency are also included within the scope of the present invention.

In a preferred aspect, the present invention relates to nucleotide sequences that can hybridize to the nucleotide sequences discussed here or their complements under high stringency conditions (e.g., 50 ° C and 0.2 × SSC).

In a more preferred aspect, the present invention protects nucleotide sequences that can hybridize to the nucleotide sequences or their complements discussed herein under high stringency conditions (e.g., 65 ° C and 0.1 × SSC).

EXPRESSION OF POLYPEPTIDES

The nucleotide sequence for use in the present invention for encoding a polypeptide having specific properties as defined herein can be introduced into a recombinant replicable vector. The vector can be used to replicate and express the nucleotide sequence in a polypeptide form to and from or from a compatible recipient cell. Expression can be controlled using control sequences, including promoters / enhancers and other expression regulation signals. Prokaryotic promoters and promoters functional in eukaryotic cells can be used. Specific tissues or stimulating specific promoters may be used. Chimeric promoters may also be used, including sequence elements from two or more different promoters described above.

Polypeptides formed by a recombinant recipient cell by expression of a nucleotide sequence may be secreted or may be contained intracellularly depending on the sequence and / or vector used. Coding sequences can be made with a signal sequence that directs the secretion of the substance of coding sequences through specific membranes of prokaryotic or eukaryotic cells.

EXPRESSION VECTOR

The term "expression vector" means a construct capable of expression in vivo or in vitro .

Preferably, the expression vector is introduced into the body's genome. The term "introduced" preferably covers stable entry into the genome.

The nucleotide sequence of the present invention or the coding polypeptide having specific properties as defined herein may be part of a vector in which the nucleotide sequence is operably linked to regulatory sequences so that the regulatory sequences are capable of providing expression of the nucleotide sequence with a suitable host organism, i.e. e. the vector is an expression vector.

The vectors of the present invention can be transformed into a suitable host cell, as described below, in order to ensure the expression of a polypeptide having specific properties, as defined here.

The choice of a vector, for example a plasmid, cosmid, virus or phage, will often depend on the host cell into which it is to be introduced.

The vectors may contain one or more selectable marker genes, such as a gene that confers antibiotic resistance, for example, resistance to ampicillin, kanamycin, chloramphenicol or tetracycline. Alternatively, selection can be carried out by co-transformation (as described in WO 91/17243).

Vectors can be used in vitro , for example, to obtain RNA, or used to transfect or transform a host cell.

Thus, in a further embodiment, the invention relates to a method for producing nucleotide sequences of the present invention or nucleotide sequences encoding polypeptides having specific properties as defined herein by introducing a nucleotide sequence into a replicable vector, introducing the vector into a compatible host cell and culturing the cell -host in conditions that are favorable for vector replication.

The vector may further include a nucleotide sequence enabling replication of the vector in the host cell in question. Examples of such sequences are the replication start sites of plasmids pUC19, pACYC177, pUB110, pE194, pAMB1 and pIJ702.

REGULATORY SEQUENCES

In some applications, the nucleotide sequence for use in the present invention or the nucleotide sequence encoding a polypeptide having specific properties as defined herein may be operably linked to a regulatory sequence that is capable of expressing a nucleotide sequence, such as expression selected by a host cell. By way of example, the present invention relates to a vector comprising a nucleotide sequence of the present invention operably linked to such a regulatory sequence, i.e. the vector is an expression vector.

The term "functionally linked" refers to an adjacent position in which the described components are in a relationship that ensures their functioning in the manner prescribed by him. A regulatory sequence operably linked to a coding sequence is ligated in such a way that expression of the coding sequence is achieved under conditions compatible with the control sequences.

The term "regulatory sequences" includes promoters and enhancers and other expression regulation signals.

The term "promoter" is used in the usual sense for this area, i.e. such as the RNA polymerase binding site.

Improved expression of the nucleotide sequence encoding an enzyme having the specific properties defined herein can also be achieved by using the selection of heterologous regulatory zones, for example, promoter zones, secretion leader and terminator.

Preferably, the nucleotide sequence of the present invention may be operably linked to at least a promoter.

Examples of suitable promoters for directing transcription of the nucleotide sequence in bacterial, fungal, or yeast hosts are well known in the art.

CONSTRUCTS

The term "construct", which is synonymous with terms such as "conjugate", "cassette" and "hybrid", includes a nucleotide sequence encoding a polypeptide having specific properties, as defined here, for use according to the present invention, directly or indirectly attached to to the promoter. An example of indirect attachment is a suitable spacer group, such as an intron sequence, such as a Sh1 intron or an ADH intron, between the promoter and the nucleotide sequence of the present invention. The same is true for the term "fused" in connection with the present invention, which includes direct or indirect connection. In some cases, the terms do not cover the natural combination of the nucleotide sequence that encodes a protein, usually associated with the promoter of the wild-type gene and where they are both in their natural environment.

The construct may even contain or express a marker that allows selection of the genetic construct.

For some applications, preferably, the construct includes at least a nucleotide sequence of the present invention or a nucleotide sequence encoding a polypeptide having specific properties, as defined herein, operably linked to a promoter.

HOUSING CELLS

The term "host cell" in relation to the present invention includes any cell containing either a nucleotide sequence encoding a polypeptide having specific properties, as defined here, or an expression vector, as described above, which is used in the recombinant production of a polypeptide having specific properties as defined here.

Thus, a further embodiment of the present invention relates to host cells transformed or transfected with a nucleotide sequence of the present invention or a nucleotide sequence that expresses a polypeptide having specific properties as defined herein. Cells must be selected to be compatible with the specified vector, and may, for example, be prokaryotic (e.g. bacterial), fungal, yeast, or plant cells. Preferably, the host cells are not human cells.

Examples of suitable bacterial host organisms are gram negative or gram positive bacteria.

Depending on the nature of the nucleotide sequence encoding the polypeptide having the specific properties as defined herein and / or the desirability of further processing the expressed protein, eukaryotic hosts such as yeast or other fungi may be preferred. In general, yeast cells are preferred over fungal cells because they are easier to manipulate. However, some proteins are either poorly secreted from the yeast cell, or in some cases are not processed properly (for example, hyperglycosylation in yeast). In such cases, various fungal cells should be selected.

The use of suitable host cells, such as yeast, fungal, and plant host cells, can provide post-translational modification (e.g., myristoylation, glycosylation, truncation, fossilization, and phosphorylation of serine or threonine) if necessary to ensure optimal biological activity of recombinant expression products by the present invention.

The host cell may be proteolytically deficient or proteolytic minus strain.

ORGANISM

The term "organism" in connection with the present invention includes any organism that may include a nucleotide sequence according to the present invention or a nucleotide sequence encoding a polypeptide having specific properties as defined herein and / or products derived therefrom.

Suitable organisms may include prokaryotes, fungi, yeast, or plants.

The term "transgenic organism" in connection with the present invention includes any organism that includes a nucleotide sequence encoding a polypeptide having specific properties as defined herein and / or products derived therefrom, and / or in which a promoter can allow expression of a nucleotide sequence encoding a polypeptide having specific properties, as defined herein, within an organism.

The term "transgenic organism" does not encompass native nucleotide coding sequences in their natural environment when they are under the control of their natural promoter, which is also in its natural environment.

Therefore, the transgenic organism of the present invention includes any one or combination of a nucleotide sequence encoding a polypeptide having the specific properties of, as defined here, constructs, as defined here, vectors, as defined here, plasmids, as defined here, cells, as defined here, or their products. For example, a transgenic organism may also include a nucleotide sequence encoding a polypeptide having specific properties, as defined herein, under the control of a heterologous promoter.

TRANSFORMATION OF CELLS / HOSPITAL ORGANISMS

As indicated above, the host organism may be a prokaryotic or eukaryotic organism. Examples of suitable prokaryotic hosts include E. coli and Bacillus subtilis .

Guidelines for transforming prokaryotic hosts are well documented (see, for example, Sambrook et al. (Molecular Cloning: A Laboratory Manual, 2 ^nd edition, 1989, Cold Spring Harbor Laboratory Press). If a prokaryotic host is used, the nucleotide sequence may be must be suitably modified before transformation, for example, by removing introns.

In another embodiment, the transgenic organism may be yeast.

Mycelial fungal cells can be transformed using various methods known in the art, such as a process involving the formation of phytoplasts and the transformation of phytoplasts followed by regeneration of cell walls in a known manner. The use of Aspergillus as a host microorganism is described in EP 0238023.

Another host organism may be a plant. An overview of common techniques used to transform plants can be found in Potrykus ( Ann Rev Plant Physiol Plant Mol Biol [1991] 42: 205-225 and Christou (Agro-Food-Industry Hi-Tech March / April 1994 17-27). Further guidance on plant transformation can be found in EP-A-0449375.

General guidelines for the transformation of fungi, yeast, and plants are presented in the following sections.

TRANSFORMED MUSHROOMS

The host organism may be fungi, such as mycelial fungi. Examples of such suitable hosts include any member of the Thermomyces , Acremonium , Aspergillis , Penicillium , Mucor , Neurospora , Trichoderma, and the like genera.

A review of guidelines for the transformation of mycelial fungi is given in US-A-5741665, where it is indicated that standard techniques for transforming mycelial fungi and cultivating fungi are well known in the art. An extended review of the techniques applied to N. crassa can be found, for example, in Davis and de Serres, Methods Enzymol (1971) 17A : 79-143.

Additional guidance on the transformation of mycelial fungi is given in US-A-5674707.

In one aspect, the host organism may belong to the genus Aspergillu s, such as Aspergillus niger .

The transgenic Aspergillus according to the present invention can also be obtained following, for example, Roter G. 1994 (Vectors for genetic manipulation. In Martinelli SD, Kinghorn JR (Editors) Aspergillus : 50 years on. Progress in industrial microbiology, vol. 29. Elsevier Amsterdam 1994, pp. 641-666).

Gene expression in mycelial fungi was reviewed by Punti et al. (2002) Trends Biotechnol 2002 May; 20 (5): 200-6, Archer & Peberdy Crit Rev Biotechnol (1997) 17 (4): 273-306.

TRANSFORMED YEAST

In another embodiment, the transgenic organism may be yeast.

A review of the principles of heterologous gene expression in yeast is provided, for example, in Methods Mol. Biol. (1995), 49: 341-54 and Curr Opin Biotechnol (1997) Oct; 8 (5): 554-60.

In this regard, yeast, such as species of Saccharomyces cerevisiae or Pichia pastoris (see FEMS Microbiol Rev (2000 24 (1): 45-66), can be used as a carrier for heterologous gene expression.

A review of the principles of heterologous expression in Saccharomyces cerevisiae and the secretion of gene products is given in E. Hinchcliffe and E. Kenny (1993), "Yeast as a vehicle for the expression of heterologous genes", Yeasts , Vol. 5, Anthony H. Rose and J. Stuart Harrison, eds.

2 ^nd edition, Academic Press Ltd.).

Several transformation protocols have been developed for yeast transformation. For example, the transgenic Saccharomyces according to the present invention can be obtained in accordance with the instructions of Hinnen et al., (1978), Proceedings of the National Academy of Sciences of the USA 75 , 1929); Beggs JD (1978), Nature , London, 275 , 104); and Ito H. et al. (1983, J Bacteriology 153, 163-168).

Transformed yeast cells can be selected using various selection markers, such as auxotrophic markers with dominant antibiotic resistance.

A suitable host yeast may be selected from biotechnologically relevant yeast species such as, but not limited to, yeast species selected from Pichia spp., Hansenula spp., Kluyveromyces spp., Yarrowinia spp., Saccharomyces spp., Including S. cerevisiae , or Schizosaccharomyces spp., including Schizosaccharomyces pombe .

A strain of methylotrophic yeast of the species Pichia pastoris can be used as the host organism.

In one embodiment, the host organism may be a species of Hansenula , such as H. polymorpha (as described in WO 01/39544).

TRANSFORMED PLANTS / PLANT CELLS

A host organism suitable for the present invention may be a plant. An overview of general techniques can be found in Potrykus ( Ann Rev Plant Mol Biol [1991] 42 : 205-225) and Christou (Agro-Food-Industry Hi-Tech March / April 1994 17-27) or in WO 01/16308. A transgenic plant can produce higher levels of, for example, phytosterol esters and phytostanol esters.

Therefore, the present invention also relates to a method for producing a transgenic plant with improved levels of phytosterol esters and phytostanol esters, comprising the steps of transforming a plant cell with a lipid acyltransferase as defined herein (in particular, an expression vector or construct including a lipid acyltransferase as defined here), and growing a plant from a transformed plant cell.

SECRETION

It is often desirable that the polypeptide be secreted from an expression-carrying host into a culture medium from which the enzyme can be more easily recovered. According to the present invention, the secretion leader sequence may be selected depending on the host used for expression. Hybrid signal sequences may also be used in the context of the present invention.

Typical examples of heterologous secretion leader sequences are those derived from fungal amyloglucosidase (AG), the gene (glaA are both amino acid versions, and 18 and 24, for example, from Aspergillus ), the a-factor gene (yeast Saccharomyces , Kluyveromyces and Hansenula ) or the gene for α-amylase ( Bacillus ).

DETECTION

Various protocols are known in the art for detecting and measuring the expression of an amino acid sequence. Examples include enzyme-linked immunosorbent assay (ELISA), radioimmune assay (RIA), and fluorescence sorting of activated cells (FACS).

A wide variety of labels and conjugation techniques are known to those skilled in the art and can be used in various nucleic acid and amino acid analyzes.

A number of companies, such as Pharmacia Biotech (Piscataway, NJ), Promega (Madison, WI) and US Biochemical Corp (Cleveland, OH), supply kits and protocols for such procedures.

Suitable reporter molecules or labels include radionuclides, enzymes, fluorescent, chemiluminescent or chromogenic agents, as well as substrates, cofactors, inhibitors, magnetic particles and the like. Patents describing the use of such labels include US-A-3817837, US-A-3850752, US-A-3939350, US-A-3996345, US-A-4277437, US-A-4275149 and US-A- 4,366,241.

In addition, recombinant immunoglobulins can be prepared as shown in US-A-4816567.

Fused Proteins

A polypeptide having specific properties, as defined here, can be obtained as a fused protein, for example, to facilitate its extraction and purification. Examples of fusion protein partners include glutathione S-transferase (GST), 6xHis, GAL4 (DNA binding and / or transcription activating domains) and β-galactosidase. It may also be convenient to include a proteolytic cleavage site between the fusion protein partner and the target protein sequence to allow removal of the protein sequence. Preferably, the fusion protein does not interfere with the activity of the protein sequence.

Fusion gene expression systems in E. coli were reviewed by Curr. Opin. Biotechnol. (1995) 6 (5): 501-6.

In another embodiment, the amino acid sequences of a polypeptide having specific properties as defined herein can be ligated to a heterologous sequence to encode a fusion protein. For example, to screen peptide libraries for agents capable of influencing the activity of a substance, it may be useful to code a chimeric substance expressing a heterologous epitope that is recognized by a commercially available antibody.

The invention will now be described by way of example only with reference to the following figures and examples.

Figure 1 shows the consensus sequence pfam00657 from the database, version 6 (SEQ ID No. 1).

Figure 2 shows the amino acid sequence (SEQ ID No. 2) obtained from the organism of Aeromonas hydrophila (P10480; GI: 121051).

Figure 3 shows the amino acid sequence (SEQ ID No. 3) obtained from Aeromonas salmonicida (AAG098404; GI: 964017).

Figure 4 shows the amino acid sequence (SEQ ID No. 4) obtained from Streptomyces coelicolor A3 (2) (Genbank accession number NP-6321558).

Figure 5 shows the amino acid sequence (SEQ ID No. 5) obtained from Streptomyces coelicolor A3 (2) (Genbank accession number CAC42140).

6 shows the amino acid sequence (SEQ ID No. 6) obtained from the organism Saccharomyces cerevisiae A3 (2) (Genbank accession number P41734).

7 shows the alignment of the selected sequence with the consensus sequence pfam00657.

Fig. 8 shows a pair alignment of SEQ ID No. 3 c SEQ ID No. 2, showing 93% amino acid sequence identity. The signal sequence is underlined + differences are indicated. The GDSX fragment containing the active site of serine 16 and the active sites of aspartic acid 116 and histidine 291 are highlighted (see shaded areas). The numbers after the amino acid represent the minus the signal sequence.

Figure 9 shows the nucleotide sequence (SEQ ID No. 7) encoding a lipid acyltransferase according to the present invention, obtained from Aeromonas hydrophila.

Ig.10 F shows the nucleotide sequence (SEQ ID No. 8) encoding a lipid acyl transferase according to the present invention obtained from the organism Aeromonas salmonicida.

Ig.11 F shows the nucleotide sequence (SEQ ID No. 9) encoding a lipid acyl transferase according to the present invention obtained from the organism Streptomyces coelicolor A3 (2) (Genbank accession number NC-003888.1 : 8327480..8328367).

12 shows a nucleotide sequence (SEQ ID No. 10) encoding a lipid acyltransferase according to the present invention, obtained from Streptomyces coelicolor A3 (2) (Genbank accession number AL939131.1: 265480..266367).

FIG. 13 shows a nucleotide sequence (SEQ ID No. 11) encoding a lipid acyltransferase according to the present invention, obtained from Saccharomyces cerevisiae (Genbank accession number Z75034).

Fig. 14 shows an amino acid sequence (SEQ ID No. 12) obtained from the organism of Ralstonia (Genbank accession number: AL646052).

Fig. 15 shows a nucleotide sequence (SEQ ID No. 13) encoding a lipid acyltransferase according to the present invention, obtained from Ralstonia .

16 shows SEQ ID No. 20. Scoe1 NCBI protein, access code CAB39707.1 GI: 4539178 conservative hypothetical protein [Streptomyces coelocolor A3 (2)].

17 shows the nucleotide sequence shown as SEQ ID No. 21, encoding an NCBI protein, access code CAB39707.1 GI: 4539178 conservative hypothetical protein [Streptomyces coelocolor A3 (2)].

Fig. 18 shows the amino acid shown as SEQ ID No. 22. Scoe2 NCBI protein, access code CAC01477.1 GI: 9716139 conservative hypothetical protein [Streptomyces coelocolor A3 (2)].

Fig.19 shows the nucleotide sequence shown as SEQ ID No. 23, encoding Scoe2 NCBI protein, access code CAC01477.1 GI: 9716139 conservative hypothetical protein [Streptomyces coelocolor A3 (2)].

20 shows an amino acid sequence (SEQ ID No. 24). Scoe3 NCBI protein, access code CAB88833.1 GI: 7536996 putative protein [Streptomyces coelocolor A3 (2)].

Fig.21 shows the nucleotide sequence shown as SEQ ID No. 25 encoding a Scoe3 NCBI protein, access code CAB88833.1 GI: 7536996 putative secreted protein [Streptomyces coelocolor A3 (2)].

22 shows an amino acid sequence (SEQ ID No. 26). Scoe4 NCBI protein, access code CAB89450.1 GI: 7672261 putative secreted protein [Streptomyces coelocolor A3 (2)].

23 shows the nucleotide sequence shown as SEQ ID No. 27 encoding a Scoe4 NCBI protein, access code CAB89450.1 GI: 7672261 putative secreted protein [Streptomyces coelocolor A3 (2)].

24 shows an amino acid sequence (SEQ ID No. 28). Scoe5 NCBI protein, access code CAB62724.1 GI: 6562793 putative lipoprotein [Streptomyces coelocolor A3 (2)].

25 shows the nucleotide sequence shown as SEQ ID No. 29, encoding Scoe5 NCBI protein, access code CAB62724.1 GI: 6562793 putative lipoprotein [Streptomyces coelocolor A3 (2)].

26 shows an amino acid sequence (SEQ ID No. 30). Srim1 NCBI protein, access code AAK84028.1 GI: 15082088 GDSL lipase [Streptomyces rimosus].

Fig. 27 shows the nucleotide sequence shown as SEQ ID No. 31, encoding Srim1 NCBI protein, access code AAK84028.1 GI: 15082088 GDSL lipase [Streptomyces rimosus].

28 shows an amino acid sequence (SEQ ID No. 32). lipid acyltransferase from Aeromonas hydrophila (ATCC # 7965).

Fig. 29 shows a nucleotide sequence (SEQ ID No. 33) encoding a lipid acyltransferase from Aeromonas hydrophila (ATCC # 7965).

30 shows an amino acid sequence (SEQ ID No. 34). lipid acyltransferase from Aeromonas salmonicida, subspecies Salmonicida (ATCC # 14174).

Fig. 31 shows a nucleotide sequence (SEQ ID No. 35) encoding a lipid acyltransferase from Aeromonas salmonicida, a subspecies of Salmonicida (ATCC # 14174).

Fig. 32 shows that Aeromonas gene homologues can be identified using a basic local alignment search system in National Center for Biotechnology Information, NTH, MD, USA and updated genomic databases. The GDSX fragment was used in a database search and a number of sequences / genes were identified that potentially encoded enzymes with lipolytic activity. Genes have been identified from the genes Streptomyces, Xanthomonas and Ralstonia . As an example below, Ralstonia solanacearum was aligned with the Aeromonas salmonicida (satA) gene. Pair alignment showed 23% identity. The active site of serine is present at the amine ends and catalytic residues of histidine and aspartic acid can be identified.

Fig. 33 shows the consensus sequence Pfam00657.11 [family 00657, version 11 of the database], hereinafter referred to as Pfam consensus, and the alignment of various sequences to the consensus Pfam sequence. Arrows indicate the remains of active sites; underlined boxes show three of the homologous boxes indicated by Upton C and Buckley JT (1995) Trends Biochem. Sci 20 ; 179-179. Capital letters in the Pfam consensus indicate conservative residues in many members of the family. Symbol - indicates the position where the hidden Markov model of consensus Pfam expected to find the remainder, but did not find, so a space is inserted. Symbol. denotes a residue without a corresponding residue in the Pfam consensus. The sequences are the amino acid sequences listed in FIGS. 16, 18, 20, 22, 24, 26, 28, and 30.

Fig. 34 shows the consensus sequence Pfam00657.11 [family 00657, version 11 of the database], hereinafter referred to as Pfam consensus, and the alignment of various sequences to the Pfam consensus sequence. Arrows indicate the remains of active sites; underlined boxes show three of the homologous boxes indicated by Upton C and Buckley JT (1995) Trends Biochem. Sci 20 ; 179-179. Capital letters in the Pfam consensus indicate conservative residues in many members of the family. Symbol - indicates the position where the hidden Markov model of consensus Pfam expected to find the remainder, but did not find, so a space is inserted. Symbol. denotes a residue without a corresponding residue in the Pfam consensus. The sequences are the amino acid sequences listed in FIGS. 2, 16, 18, 20, 26, 28, and 30. It has been found that all of these proteins are active against lipid substrates.

Fig. 35 shows an expression vector pet12-AsalGCAT = pSM containing the C-terminal His-labeled Aeromonas salmonicida lipid acyltransferase gene.

Fig. 36 and Fig. 37 shows the results of testing cell extracts in the NEFA A Kit Assay test, which describes the activity of the recombinant A. salmonicida lipid acyltransferase against lecithin. Cell extracts were tested for phospholipase activity using the NEFA Kit Assay test. Wells from left to right: positive, control, negative, control; 20 ° C, 30 ° C.

Fig. 38 shows crude cell extracts from BL21 (DE3) pLysS expressed active lipid acyltransferase incubated with lecithin substrate, and the reaction mixture was analyzed using thin layer chromatography showing the presence of decomposition products. Lanes: 1 - no enzyme; 2 - + A.sal. - 10 μl, 37 ° C; 3. + A.sal - 20 μl, 37 ° C; 4. + A.sal. - 10 μl, 24 ° C; 5. + A.sal. - 20 μl, 24 ° C.

Fig. 39 shows a partial purification of the Aeromonas salmonicida acyltransferase exhibiting phospholipase activity associated with purified His-labeled protein. SE = sonicated extracts; His = purified by Ni-NTA spin kit from Qiagen.

Fig. 40 shows the expression vector pet12-Ah GCAT = hSMa containing the C-terminal His-labeled Aeromonas hydrophila glycerolipid acyltransferase gene was used to transform E. coli strain BL21 (DE3) pLysS.

Fig. 41 shows the activity of crude extracts (5 & 10 μl) containing the recombinant Aeromonas hydrophila GCAT enzyme. The enzyme was tested for lecithin using a non-esterifiable fatty acid (NEFA) kit (Roche, Switzerland), showing the presence of an enzyme active against lecithin phospholipid.

Fig. 42 shows growth optimization of BL21 (DE30pLysS refuge of the expression vector pet12-AsalGCAT = pSM showing cultivation at 30 ° C leading to the production of an enzyme with high activity against lecithin. Cell extracts were tested for phospholipase activity using an NEFA assay kit.

Fig. 43 shows a partial purification of the Aeromonas hydrophila & A. salmonicida acyltransferase exhibiting phospholipase activity associated with purified His-tagged protein. SE = sonicated extracts; His = purified by Ni-NTA spin kit from Qiagen.

Fig. 44 shows the expression of Aeromones genes in Bacillus subtilis 163, showing the production of a secreted enzyme with activity against both lecithin and DGDG. The construct pUB-AH = containing the A. hydrophila gene and the construct pUB-AS containing the A. salmonicida gene. The culture filtrate was incubated with the substrate for 60 minutes.

Fig. 45 and Fig. 46 show a TLC plate in a developing solvent IV (chloroform: methanol: water (65: 24: 4)); lane 1: 40 mg sitosterol, 30 min; lane 2: transferase + 40 mg sitosterol, 30 min; lane 3: transferase + 80 mg sitosterol, 30 min; lane 4: transferase + 40 mg sitosterol, 120 min; lane 5: transferase + 80 mg sitosterol, 120 min; lane 6: transferase + 40 mg sitosterol, 300 min; lane 7: 40 mg sitosterol, 300 min; lane 8: cholesterol; lane 9: sitosterol.

Fig. 47 depicts the reaction between phosphatidylcholine and cholesterol, which is catalyzed by acyltransferase.

Fig. 48 shows a TLC analysis of lipids extracted from an enzyme-treated or untreated egg yolk: 6) 0.31 PLU / g transferase # 179, 7) 1.25 PLU / g transferase # 178-9, 8) 23.25 PLU / g phospholipase # 3108, 9) control.

Fig. 49 shows test samples of mayonnaise obtained from an enzyme-treated or untreated egg yolk: 5) transferase # 179, 0.31 PLU / g, 6) transferase # 178-9, 1.25 PLU / g, 7) phospholipase # 3108 , 23.3 PLU / g, 8) control, water.

Fig. 50 shows TLC (in solvent I) of an egg yolk lipid treated with a lipid acyltransferase from A. hydrophila .

Fig. 51 shows a TCS (in solvent IV) of an egg yolk lipid treated with a lipid acyltransferase from A. hydrophila .

52 shows TLC analysis of transferase-treated lipid from egg yolk over time.

Fig. 53 shows the amount of cholesterol fatty acid and ester formed as a function of time using lipid acyltransferase (Tranf # 178-9) in comparison with the control lipolytic enzyme Thermomyces lanuginosus .

Fig. 54 shows the relative transferase activity as% of the transferase and lipolytic activity during the enzymatic reaction in a high water egg yolk, the control phospholipases are # 1991 (phospholipase A2) and # 2427 (phospholipase A1), lipid acyltransferase is # 178.

55 shows the effect of water content in the analysis of the transferase activity of transferase # 178 in a reaction in egg yolk with a high water content.

Fig. 56 shows the transferase activity for lipid acyltransferase (# 178) as a function of reaction time during transferase reactions in egg yolk with a high water content.

Fig. 57 and Fig. 58 show graphs showing the amount of fatty acid and cholesterol as a function of time. The graphs reflect the results obtained by GLC analysis in an experiment for measuring acyltransferase activity using lecithin and cholesterol in a buffer as a substrate.

Figure 59 shows TLC in solvent I. Egg yolk treated with lipid acyltransferase # 138 from Aeromonas salmonicida (lanes 1 and 2) or phospholipase # 2938 (LIPOPAN ™ F) (lane 3); untreated egg yolk (lane 4).

Fig. 60 shows TLC in solvent IV. Egg yolk treated with lipid acyltransferase # 138 (lanes 1 and 2) or phospholipase # 2938 (lane 3); untreated egg yolk (lane 4).

61 shows an egg yolk treated with lipid acyltransferase # 138 (samples 1 and 2) or phospholipase # 2938 (sample 3); untreated egg yolk (sample 4).

Fig. 62 shows a food emulsion after 2 hours at 100 ° C. 0) untreated egg yolk, 1) egg yolk treated with lipid acyltransferase # 138 for 210 minutes, 3) egg yolk treated with control phospholipase # 2938 for 210 minutes.

63 shows TLC plates showing screening for transferase activity for plant sterol and glycerol. PC = phosphatidylcholine, LPC = lysophosphatidylcholine, PE = phosphatidylethanolamine, monogl = monoglyceride.

64 shows a TLC plate in solvent I, samples 1-6 after 24 hours and samples 1-4 after 4 hours of reaction time. TLC analysis confirms the formation of sterol ester in samples 1, 2, 5 and 6.

Fig. 65 shows a TLC plate in solvent IV, where the transferase activity of immobilized acyltransferase from Aeromonas salmonicida was tested in an oil mixture with sampling at 0.5, 1, 3, 6 and 24 hours.

Figures 66 and 67 show TLC plates in solvent I and IV. Lane 1 = lecithin; lane 2 = control - 10 min; lane 3 = 0.75 PLU, 10 min; lane 4 = 0.75 PLU, 60 min; lane 5 = 0.75 PLU, 220 min; lane 6 = control, 20 hours; lane 7 = 0.75 PLU, 20 hours; and lane 8) cholesterol ester.

Figures 68 and 69 show TLC plates in solvent IV. Lane 1 = lecithin; lane 2 = control - 10 min; lane 3 = 1 PLU, 10 min; lane 4 = 1 PLU, 60 min; lane 5 = 1 PLU, 180 min; lane 6 = 1 PLU, 220 min; lane 7 = 1 PLU, 1200 min; lane 8) = control, 1200 min; lane 9) = glucose ester; lane 19) = cholesterol and lane 11) = glucose.

70 shows the reaction between DGDG and glucose catalyzed by lipid acyltransferase.

Fig. 71 shows the amino acid sequence (SEQ ID No. 36) of the fusion construct used for mutagenesis of the Aeromonas hydrophila lipid acyltransferase gene in Example 17. The underlined amino acids represent the xylanase signal peptide.

Fig. 72 shows a nucleotide sequence (SEQ ID No. 45) encoding an enzyme from Aeromonas hydrophila , including the xylanase signal peptide; and

FIG. 73 shows a TLC plate clearly showing the formation of plant sterol ether and monoglyceride. Lane 1 after 1 hour of reaction time, lane 2 after 2 hours of reaction time, lane 3 after 24 hours of reaction time, and lane 4 represents plant sterol.

EXAMPLES

Except where stated, TLC analysis was performed as described in example 6, and GLC analysis was performed as described in example 1.

Example 1. Cloning, sequencing and heterologous expression of transferase from Aeromonas salmonicida subsp. Salmonicida

Used strains

Aeromonas salmonicida subsp. Salmonicida (ATCC 14174) was obtained from ATCC and cultured overnight at 30 ° C. in Luria-Bertani (LB) medium. Cells were centrifuged and genomic DNA was isolated using a genomic acid isolation technique from Qiagen Ltd. Genomic DNA buffer set (cat. 19060), protease K (cat. 19131) and RNase A (cat. 19101), all from Qiagen Ltd. (Boundary court, Gatwick Court, West Sussex, RH10 2AX).

To obtain recombinant Aeromonas enzymes, the bacterial host strain BL21 (DE3) pLysS (Novagen) was used. Competent BL21 (DE3) pLysS cells were used as hosts for transformation with the expression vector pet12-AsalGCAT = pSM . Transformants containing the corresponding plasmid were cultured at 37 ° C in LB agar medium containing 100 μg / ml ampicillin.

Construction of the expression vector pet12-AsalGCAT = pSM

For all amplifications of the DNA transferase genes from Aeromonas , genomic DNA (0.2-1 μl) was used as template and pfu DNA polymerase (2.5 units) was used with 10 μl of 10 × pfu buffer, 1 μl of each primer (50 pmol / μl ), 200 uMdNTP in a total reaction volume of 100 μl. PCR reactions were carried out in a programmable thermal cycler using the following conditions: 95 ° C for 30 seconds, 30 cycles at 95 ° C for 30 seconds, 60 ° C for 1 minute, and 68 ° C for 2 minutes. Used an additional extension of 5 minutes at 72 ° C.

PCR amplification of the transferase gene from A. salmonicida was performed for 2 separate PCR reactions. PCR reaction 1 was performed using a pair of primers, as1USNEW (5'AGCATATGAAAA AATGGTTTGT TTGTTTATTG GGG 3 '[SEQ ID No. 36]) and as1s950new (5' GTG ATG GTG GGC GAG GAA CTC GTA CTG3 '[SEQ ID No.] . A second PCR reaction was performed to introduce a C-terminal histidine tag using the PCR product of the first reaction and primers: as1USNEW (5'AGCATATGAAAA AATGGTTTGT TTGTTTATTG GGG 3 '[SEQ ID No. 38]) and AHLS1001 (5'TTTGGGATCC GA ATG GTG ATG GTG GGC3 '[SEQ ID No. 39]). The PCR product of the second reaction was purified and digested with restriction enzymes Ndel and BamHL. 2 μg of the pET 12a DNA vector was also digested with restriction enzymes Ndel and BamHL and treated with phosphatase. The restriction enzyme treated pET 12a and the PCR product of reaction 2 were purified and ligated using the Rapid Ligation Kit (Roche, Switzerland). The ligation mixture was used to transform E. coli TOP 10 cells. Transformants were plated on LB agar medium containing 100 μg / ml ampicillin.

The T7 promoter primer (5'TAATACGACTCACTATAG3 '[SEQ ID No.40]) and the T7 terminator primer (5'CTAGTTATTGCTCAGCGG3' [SEQ ID No.41]) were used to verify the sequences and orientation of the cloned transferase genes in the pET12a vector. DNA sequencing was performed using an ABI Prism® BigDye ™ Terminators Cycle sequencing kit with 500 ng DNA plasmid as template and 3 pmol of promoter and terminator primers.

The construct shown in FIG. 35 was used to transform the competent bacterial host strain BL21 (DE3) pLysS (Novagen), and ampicillin-resistant transformants were collected and used for expression analysis.

Expression of the recombinant lipid acyltransferase Aeromonas salmonicida

The quantitative determination of enzyme activity with respect to lecithin was carried out using the Non-Esterified Fatty Acid (NEFA) kit (Roche, Switzerland).

In FIG. 36, BL21 (DE3) pLysS containing the expression vector pet12-AsalGCAT = pSM were cultured in LB + 100 ng / ml ampicillin and incubated with shaking at 37 ° C. until OD ₆₀₀ = 0.6-1.0 was reached. The cultures were then induced using IPTG (0.4 mM), and incubation was continued for the next 3 hours. Samples were taken at 0, 1, 2, and 3 hours after IPTG administration. Enzymatic activity was determined using a set of NEFA and lecithin as a substrate.

Cultivation optimization for more active enzymes

BL21 (DE3) pLysS containing the expression vector pet12-Asal GCAT = pSM was cultured in LB medium + 100 μg / ml ampicillin and incubated with shaking at different temperatures (37 ° C, 30 ° C and 20 ° C). The optimal condition for the formation of the active lipid acyltransferase enzyme was culture at 30 ° C, as shown in Fig. 37.

Partial Purification of Recombinant Aeromonas salmonicida Transferase

Strain BL21 (DE3) pLysS containing the expression vector pet12-AsalGCAT = pSM was cultured at 37 ° C, and the crude cell extracts were prepared by sonication. The recombinant enzyme was further purified from sonicated crude cell extracts using a Ni-NTA spin kit from Qiagen. For phospholipase activity, a NEFA kit and lecithin as a substrate were used. Raw cell extracts from BL21 (DE3) pLysS expressed by active transferase were incubated with a lecithin substrate and the reaction mixture was analyzed using thin layer chromatography showing the presence of decomposition products (see FIG. 38).

Partial Purification of Recombinant Aeromonas salmonicidae Transferase

Strain BL21 (DE3) pLysS containing the expression vector pet12-AsalGCAT = pSM was cultured at 37 ° C and the crude cell extracts were prepared by sonication. The recombinant enzyme was further purified from sonicated crude cell extracts using a Ni-NTA spin kit from Qiagen. Phospholipase activity was determined using a set of NEFA and lecithin as a substrate.

Example 2. Cloning and expression of Aeromonas hydrophila transferase in E. coli

Aeromonas hydrophila (ATCC # 7965) was obtained from ATCC and cultured overnight at 30 ° C in Luria-Bertani (LB) medium. Cells were centrifuged and genomic DNA was isolated using a genomic acid isolation technique from Qiagen Ltd. Genomic DNA buffer set (cat. 19060), protease K (cat. 19131) and RNase A (cat. 19101), all from Qiagen Ltd. (Boundary court, Gatwick Court, West Sussex, RH10 2AX).

To obtain recombinant Aeromonas enzymes, the bacterial host strain BL21 (DE3) pLysS (Novagen) was used. Competent BL21 (DE3) pLysS cells were used as hosts for transformation with the expression vector pet12-AhGCAT = pSMa . Transformants containing the corresponding plasmid were cultured at 37 ° C in LB agar medium containing 100 μg / ml ampicillin.

Construction of the expression vector pet12-A.h.GCAT = pSMa

For all amplifications of the DNA transferase genes from Aeromonas , genomic DNA (0.2-1 μl) was used as template and pfu DNA polymerase (2.5 units) was used with 10 μl of 10 × pfu buffer, 1 μl of each primer (50 pmol / μl ), 200 uMdNTP in a total reaction volume of 100 μl. PCR reactions were carried out in a programmable thermal cycler using the following conditions: 95 ° C for 30 seconds, 30 cycles at 95 ° C for 30 seconds, 60 ° C for 1 minute, and 68 ° C for 2 minutes. An additional extension of 5 minutes was used at 72 ° C.

PCR amplification of the transferase gene from A. hydrophila was performed for 2 separate PCR reactions.

PCR reaction 1 was carried out using a pair of primers, AHUS1 (5 'GTCATATGAAAAAATGGTTTGTGTGTTTTTTGGGATTGGTC3', SEQ ID No. 42) and as1s950 (5 'ATGGTGATGGTGATGGTGGGCGAGGACTCGT, No. 43).

A second PCR reaction was performed to introduce a C-terminal Histidine tag using the PCR product of the first reaction and the primer pair: AHUS1 (5'GTCATATGAAAAAATGGTTTGTGTGTTTATTGGGATTGGTC3 ', SEQ ID No. 44) and AHLS1001 (5'TTGGATCCGAATTCATCAATGGTGATGGTGATGGTGGGC3', SEQ ID No . 45).

The PCR product of the second reaction was purified and digested with restriction enzymes Ndel and BamHL. 2 μg of the pET 12a DNA vector was also digested with restriction enzymes Ndel and BamHL and treated with phosphatase. The restriction enzyme treated pET 12a and the PCR product of reaction 2 were purified and ligated using the Rapid Ligation Kit (Roche, Switzerland). The ligation mixture was used to transform E. coli TOP10 cells. Transformants were plated on LB agar medium containing 100 μg / ml ampicillin.

The T7 promoter primer (5'TAATACGACTCACTATAG3 ') and the T7 terminator primer (5'CTAGTTATTGCTCAGCGG3') were used to verify the sequences and orientation of the cloned GCAT genes in the pET12a vector. DNA sequencing was performed using an ABI Prism® BigDye ™ Terminators Cycle sequencing kit with 500 ng DNA plasmid as template and 3 pmol of promoter and terminator primers.

The construct shown in FIG. 40 was used to transform the competent bacterial host strain BL21 (DE3) pLysS (Novagen), and ampicillin-resistant transformants were collected and used for expression analysis.

Aeromonas hydrophila transferase expression in BL21 (DE3) pLysS

The E. coli strain BL21 (DE3) pLysS containing the expression vector pet12a-AhGCAT = pSMa was cultured in LB medium + 100 ng / ml ampicillin and incubated with shaking at 37 ° C until reaching OD ₆₀₀ = 0.6-1.0. The cultures were then induced using IPTG (0.4 mM), and incubation was continued for the next 3 hours. Samples were taken at 0, 1, 2, and 3 hours after IPTG administration. Enzymatic activity was determined using a set of NEFA and lecithin as a substrate (Fig. 41).

Growth optimization for more active enzymes

BL21 (DE3) pLysS containing the expression vector pet12a-A.h.GCAT = pSMa was cultured in LB medium + 100 μg / ml ampicillin and incubated with shaking at different temperatures (37 ° C, 30 ° C and 20 ° C). The optimal condition for the formation of the active GCAT enzyme was culture at 30 ° C, as shown in Fig. 42.

Partial Purification of Recombinant Aeromonas hydrophila Transferase (GCAT)

Strain BL21 (DE3) pLysS containing the expression vector pet12a-A.h. GCAT = pSMa was cultured at 37 ° C and the crude cell extracts were prepared by sonication. The recombinant enzyme was further purified from sonicated crude cell extracts using a Ni-NTA spin kit from Qiagen. Phospholipase activity was determined using a set of NEFA and lecithin as a substrate (Fig. 43).

Example 3. Expression of Aeromonas transferases in Bacillus subtilis 163

Construction of plasmids

Two different expression vectors of Bacillus subtilis (pUB110 & pBE5) were used for heterologous expression of the Aeromonas genes in Bacillus subtilis . The pUB110 vector contains the alpha-amylase promoter, while the pBE vector contains the P32 promoter as a regulatory region for the expression of Aeromonas hybrid genes. In vector pUB110, the first amino acid of the mature Bacillus subtilis GCAT genes was fused in frame with the last amino acid of the Bacillus subtilis xylanase signal peptide sequence by restriction of the Nhe 1 site, which creates 2 additional amino acids ahead of the mature proteins. The pBE5 vector contains the fusion of the signal sequence of the cg-basin at the Nco1 site to isolate recombinant proteins in the culture filtrate.

PCR reactions were performed to obtain Aeromonas genes fused in frame with the signal sequences of the vectors pUB 110 and pBE5. PCR reactions were carried out using the following primer pairs for the A.hydrophila gene:

PCR Reaction 1: usAHncol (5'ATGCCATGGCCGACAGCCGTCCCGCC3 ', SEQ. ID No. 46) and 1sAH (5'TTGGATCCGAATTCATCAATGGTGATC3', SEQ. ID No. 47).

PCR Reaction 2: US-AhnheI (5'TTGCTAGCGCCGACAGCCGTCCCGCC3 ', SEQ ID No. 48) and 1sAH (5'TTGGATCCGAATTCATCAATGGTGATG3, SEQ ID No. 49).

PCR reactions were performed using the following primer pairs for the A. salmonicida gene:

PCR Reaction 3: US-Asncol (5'TTGCCATGGCCGACACTCGCCCCGCC3 ', SEQ ID No. 50) and 1sAH (5'TTGGATCCGAATTCATCAATGGTCATG3', SEQ ID No. 51).

PCR Reaction 4: US-ASnhe1 (5'TTGCTAGCGCCGACACTCGCCCCGCC3 ', SEQ ID No. 52) and 1sAH (5'TTGGATCCGAATTCATCAATGGTGATG #', SEQ ID No. 53).

All PCR products were cloned into a blunt end PCR II reaction (TOPO vector) and sequenced with reverse and direct sequencing primers.

Clones of PCR reactions 1 and 3 were trimmed with Nco1 and Bam HI and used as ligation inserts in the pBE5 vector trimmed with Nco1 / Bam HI / phosphatase. Clones of PCR reactions 2 and 4 were trimmed with Nco1 and Bam HI and used as ligation inserts in the pUB vector trimmed with Nco1 / Bam HI / phosphatase.

Aeromonas transferase gene expression in Bacillus subtilis and enzyme activity characterization

Acyltransferases from two Aeromonas species were successfully expressed in E. coli (results are given above). The Bacillus pUB110 & pBE5 gene fusion constructs were used to transform Bacillus subtilis , and the transformants were selected by plating on kanamycin plates. Isolated and grown in 2 × YT, kanamycin-resistant transformants were capable of heterologous expression of Aeromonas genes in Bacillus . The culture filtrates had digalactolysyldiacylglycerol (DGDG) galactolipase activity in addition to acyltransferase and phospholipase activities. The activity with respect to digalactolysyldiacylglycerol (DGDG) was measured after 60 minutes of incubation of the culture supernatant with the substrate, DGDG from wheat flour (obtained from Sigma) as well as the activity with respect to lecithin, as shown in Fig. 44. Bacillus produces an enzyme in the form of a secreted protein after cultivation in a culture medium from overnight (20-24 hours) to 48 hours. In some cases, it has been shown that the expression of Aeromonas genes interferes with cell viability and growth in Bacillus & E. coli , therefore it is necessary to carefully select expression strains and optimize culture conditions to ensure expression. For example, some Bacillus host strains (Bs 163, DB104, and OS 21) were transformed with expression vectors to compare culture conditions. Bs 163 was transformed by 2 Aeromonas genes and was able to express the active protein. DB104 turned out to be capable of transformation by all constructs, but capable of expressing only A. salmonicida transferase.

Example 4: Fermentation and Purification of Aeromonas Lipid Acyltransferase Produced in E. coli

Fermentation of E. coli

Microorganisms

Two strains of Eschericia coli were used in this study, one containing Aeromonas hydrophila lipid acyltransferase (Example 2) and two containing Aeromonas salmonicida lipid acyltransferase (Example 1).

The E. coli strain containing the A. hydrophila gene was named DIDK0124, and the E. coli strain containing A. salmonicida was named DIDK0125. Fermentation DIDK0124 was named HYDRO0303, and fermentation DIDK0125 was named SAL0302. The purified protein from HYDRO025 was named REF # 138, and the purified protein from HYDRO0303 was named REF # 135.

Culture medium and cultivation conditions

Agar LB

The LB agar plates used to maintain the strains contained 10 g / L tryptone, 5 g / L yeast extract, 5 g / L NaCl, 15 g / L agar, 100 mg / L ampicillin and 35 mg / L chloramphenicol. Agar plates were incubated at 30 ° C.

Shake flask with LB

LB medium (50 ml per shake flask) used to produce seed for cultivation in a bioreactor contained 10 g / L tryptone, 5 g / L yeast extract, 5 g / L NaCl, 100 mg / L ampicillin and 35 mg / L chloramphenicol. Shake flasks were seeded from LB agar plates and incubated at 30 ° C. and 200 rpm.

Cultivation in a bioreactor

Cultivation in the bioreactor was carried out in 6 l of homemade bioreactors filled with 4 l of medium containing 10 g / l of tryptone, 5 g / l of yeast extract, 5 g / l of NaCl, 8 g / l of KH ₂ PO ₄ , 0.9 g / l MgSO ₄ · 7H ₂ O, 40 g / L glucose monohydrate, 0.4 ml / L ADD APT® Foamstop Sin 260 (ADD APT Chemicals AG, Helmond, The Netherlands), 10 mg / L (NH ₄ ) ₂ Fe (SO ₄ ) ₂ · 6H ₂ O, 0.7 mg / L CuSO ₄ · 5H ₂ O, 3 mg / L ZnSO ₄ · 7H ₂ O, 3 mg / L MnSO ₄ · H ₂ O, 10 mg / L EDTA, 0 , 1 mg / L NiSO ₄ · 6H ₂ O, 0.1 mg / L CoCl ₂ , 0.1 mg / L H ₃ BO ₄ , 0.1 mg / L KI, 0.1 mg / L Na ₂ MoO ₄ · 2H ₂ O, 1 g / l ampicillin and 35 mg / l chloramphenicol.

The bioreactors were seeded with an amount of LB culture to guarantee completion of cultivation after approximately 20 hours of cultivation (calculated from a maximum specific growth rate of 0.6 h ^-1 , OD ₆₀₀ in a shake flask with LB and a final OD ₆₀₀ in the bioreactor of approximately 20).

SAL0302 was inoculated with 10 ml of LB culture and HYDRO0303 was inoculated with 4 ml of LB culture.

Bioreactors worked under the following conditions: temperature 30 ° C, stirring 800-1000 rpm (depending on experience), aeration 5 l / min, pH 6.9, regulation of pH 8.75% (w / v) NH _3- water and 2 M H ₂ SO ₄ . Induction was achieved by adding isopropyl-β-D-thiogalactoside to a final concentration of 0.6 mM when, respectively, 0.4 moles (HYDRO0303) and 0.7 moles of CO _{2 were} produced.

Collection of cells from the culture

The following procedure was used to collect cells and homogenize biomass:

1) The fermentation broth after fermentation was centrifuged at 5000 g and 4 ° C for 10 minutes and the supernatant was unloaded. Biomass was stored at -20 ° C until use. The biomass was thawed and resuspended in 500 ml of 20 mM NaH ₂ PO ₄ , pH 7.4, 500 mM NaCl, 10 mM imidazole and a protease inhibitor (not containing EDTA) Complete (Roche, Germany).

2) Suspended biomass was homogenized at 2 kbar and 4 ° C in a cell destroyer from Constant Systems Ltd (Warwick, UK).

3) Cell debris was removed by centrifugation at 10,000 g and 4 ° C for 30 minutes, followed by collection of the supernatant.

4) The supernatant was clarified by centrifugation at 13700 g and 4 ° C for 60 minutes, followed by collection of the supernatant.

5) The supernatant was filtered through 0.2 μm Vacu Cap filters (Pall Life Sciences, UK) and the filtrate was collected for immediate chromatographic purification.

Chromatographic purification of transferases

The column (2.5 × 10 cm) was filled with 50 ml of Chelating Sepharose ff gel. and loaded with Ni sulfate (according to the procedure described by the manufacturer, Amersham Biosciences). The column was equilibrated with 200 ml of 20 mM Na ₂ HPO ₄ , pH 7.4, 500 mM NaCl, 10 mM imidazole. 400 ml of the crude product was applied to the column at a flow rate of 5 ml / min. The column was then washed with 20 mM Na ₂ HPO ₄ , pH 7.4, 500 mM NaCl, 10 mM imidazole until UV ₂₈₀ reached the baseline. Then GCAT was suirable 40 ml of 20 mm Na ₂ HPO ₄ , pH 7.4, 500 mm NaCl and 500 mm imidazole.

Example 5: Fermentation and Purification of Aeromonas Lipid Acyltransferases Produced in Bacillus subtilis

Fermentation

BAC0318-19, BAC0323-24

Microorganism

The microorganisms used in this study are obtained by transforming the Bacillus subtilis # 163 recipient strain with a plasmid containing the gene encoding the Aeromonas salmonicida transferase integrated into the pUB110OIS vector. Gene expression was monitored by the alpha-amylase promoter and transferase secretion was mediated by the B. subtilis xylanase signal sequence (Example 3). The strains were named DIDK0138 (fermentation BAC0318-19) and DIDK0153 (fermentation BAC0323-24).

Culture medium and cultivation conditions

Environment for preculture

The shaken flask (total volume 500 ml, with dividing baffles) was filled with 100 ml of medium containing:

NaCl 5 g / l K ₂ HPO ₄ 10 g / l Soya flour 20 g / l Yeast Extract, BioSpringer 106 20 g / l Antifoam SIN260 5 ml / l

The pH was adjusted to 7.0 before autoclaving.

After autoclaving, 6 ml of 50% (wt.) Nutriose was added to the flask. Kanamycin was added at a concentration of 50 mg / L after autoclaving.

Inoculation

The shaken flask for preculture was inoculated with a frozen culture directly from 25% (w / v) glycerol stock solution. The shaken flask was incubated at 33 ° C and 175 rpm for about 16 hours, after which 50 ml was used to inoculate the fermenter.

Fermentation

Fermentations were carried out in 6 l of homemade fermenters. A one-time loading medium (3 l) contained:

Corn Extract (50% dw) 40 g / l Yeast Extract, BioSpringer 153 (50% dw) 10 g / l NaCl 5 g / l CaCl ₂ · 2H ₂ O 0.25 g / l Mn (NO ₃ ) ₂ · H ₂ O 0.2 g / l Antifoam SIN260 1 ml / l Kanamycin (sterilized by filtration into a fermenter after autoclaving) 50 mg / l

Raw materials contained:

Glucose monohydrate 540 g / kg MnSO ₄ · 7H ₂ O 4.8 g / kg Antifoam SIN260 4 ml / kg Yeast Extract, BioSpringer 153 (50% dw) (autoclaved separately) 150 g / kg

The fermentation feed BAC0318 and BAC0323 was started based on the accumulation of CO ₂ according to the equations below:

Power flow [g / h] = 0, Ac.CO ₂ <0.15

Power flow [g / h] = 2.85 + t × 1.54, Ac.CO ₂ ≥ 0.15 and t <12

Power flow [g / h] = 21.3, t> 12

t - time (hours) from the moment when the accumulation of CO ₂ (Ac.CO ₂ ) reached 0.15 moles

The fermentation feed BAC0319 and BAC0324 was started based on the accumulation of CO ₂ according to the equations below:

Power flow [g / h] = 0, Ac.CO ₂ <0.15

Power flow [g / h] = 2.0 + t × 1.08, Ac.CO ₂ ≥ 0.15 and t <12

Power flow [g / h] = 15, t> 12

t - time (hours) from the moment when the accumulation of CO ₂ (Ac.CO ₂ ) reached 0.15 moles

The pH was maintained at 7.0 by the addition of 12.5% (w / v) NH ₃ water or 2 M phosphoric acid.

Aeration was 3 l / min, corresponding to 1 vvm.

The temperature was 33 ° C.

The fermenter was equipped with two 8 cm ⌀ Rushton impellers placed at a distance of 10 cm.

Collection of cells from the culture

Biomass was removed by centrifugation at 16,000 g for 10 minutes at room temperature. The supernatant was sterilized by filtration and the filtrate was used for purification and application experiments.

Example 6: Application Tests for Egg Yolk

In the following experiments, isolated transferase from Aeromonas salmonicida expressed in E. coli was tested on one egg yolk and on egg yolk, to which plant sterol was added.

Material

Transferase from Aeromonas salmonicida REF # 138

Egg yolk from fresh eggs (chicken eggs)

Plant Sterol: β-sitosterol, Sigma S 5753

TLC plates: silica plates, Merck No. 1.05715.0001

TLC analysis

TLC plates were activated in a heated cabinet (110 ° C) for 1/2 hour.

100 ml of developing solvent was poured into a chromatographic chamber with a lid. The walls of the chamber were covered with filter paper (Whatman 2) in order to saturate the chamber with solvent vapor.

TLC plates were framed and the sample was applied to a 2 cm TLC plate from the bottom. Then, a TLC plate was placed in a TLC chamber with a developing solvent. When the developing solvent reached 14 cm from the bottom of the plate, the plate was removed and dried in a fume hood and then placed in an oven at 110 ° C. for 10 minutes.

The TLC plate was then immersed in a developing reagent and dried in an oven at 110 ° C. for 15 minutes.

Developing solvent

No. IV: chloroform: methanol: H ₂ O (65: 25: 4)

No. I: Ph-ether: MTBE: acetic acid (60: 40: 1)

Developing buffer (vanadate buffer)

32 g of Na ₂ CO ₃ and 300 ml of H ₂ O (1 M)

18.2 g of vanadium pentoxide (V ₂ O ₅ ) were added and dissolved by gentle heating.

The solution was cooled to room temperature.

460 ml of 2.5M H ₂ SO ₄ (460 ml of H ₂ O + 61 ml of H ₂ SO ₄ ) were carefully added.

Water was added to 1000 ml.

Phospholipase activity

Substrate

0.6% 95% plant L-α-phosphatidylcholine (Avanti # 441601) + 0.4% Triton-X 100 (Sigma X-100) + 5 mM CaCl _{2 was} dissolved in 0.05 M HEPES pH 7.0 buffer.

Procedure

400 μl of substrate was added to an Eppendorf tube and placed in an Eppendorf thermomixer at 30 ° C for 5 minutes.

At T = 0, 50 μl of enzyme solution was added. Also analyzed the control with water instead of the enzyme.

The sample was mixed at 1000 rpm in an Eppendorf thermomixer at 30 ° C for 10 minutes. At T = 10 min, the Eppendorf tube was placed in another thermomixer at 99 ° C for 10 minutes in order to stop the reaction.

Free fatty acid in the sample was analyzed using a Wako Gmbh NEFA kit.

The enzymatic activity of PLU-7 was calculated as the number of micromoles of fatty acid produced per minute under assay conditions.

Lipid extraction

1 g of egg yolk and 7.5 ml of a chloroform: methanol 2: 1 mixture were mixed in a Whirley mixer and centrifuged at 7.5 g for 10 minutes.

3 ml of the chloroform phase was isolated and used for subsequent lipid analysis.

results

The transferase (REF # 138) from Aeromonas salmonicida expressed in E. coli was analyzed for phospholipase activity, as described above, and also analyzed in egg yolk with and without β-sitosterol. The sample was stirred with a magnetic stirrer during the reaction. The picture of the experiment is shown in table 1.

Table 1 Experience Reaction time at 37 ° C Egg yolk Sitosterol Transferase # 138 No. minutes g mg units one thirty one 40 2 thirty one 40 0.75 PLU 3 thirty one 80 0.75 PLU four 120 one 40 0.75 PLU 5 120 one 80 0.75 PLU 6 300 one 40 0.75 PLU 7 300 one 40 0.75 PLU 8 300 one

The reaction was stopped by adding 7.5 ml of a mixture of chloroform: methanol (2: 1), and stirred in a Whirley mixer for 30 seconds. The chloroform phase was isolated by centrifugation and 2 μl of the chloroform phase was transferred to a preactivated silica TLC plate and eluted with a developing solvent No. I, and another TLC plate with a developing solvent No. IV.

TLC analysis results are shown in FIGS. 45 and 46.

The transferase reaction for transferase from Aeromonas salmonicida in egg yolk, to which plant sterol was added, showed that the enzyme transfers fatty acid from lecithin in egg yolk to cholesterol during the formation of cholesterol ester. The TLC chromatogram also shows that part of the sterol added to the egg yolk was transferred to cholesterol ether.

The amount of sterol ester relative to the amount of cholesterol ester formed during the reaction can be analyzed by HPLC or GLC.

Plant sterol esters are known to reduce intestinal cholesterol absorption. When transferase and plant sterol are added to the egg yolk, a product is produced that causes reduced cholesterol absorption, and at the same time, lysolecithin is obtained, which improves the emulsification properties of the egg yolk. An additional advantage of adding transferase and plant sterol to egg yolk is that plant sterol ether is absorbed along with naturally available cholesterol, which is expected to have a stronger effect in lowering cholesterol absorption.

Example 7: Modification of Egg Yolk by Lipid Acyltransferase from Aeromonas salmonicida

In accordance with the present invention, it has now been shown that it is possible to obtain lysolecithin from egg yolk without significant formation of free fatty acid when using transferase.

The lecithin contained in egg yolk is an important emulsifier in the preparation of mayonnaise with the limitation that mayonnaise is not stable when heated. Therefore, for several years it was known to use phospholipase from the pancreas to modify egg yolk lecithin into lysolecithin, which is a more effective emulsifier. The use of enzymatically modified egg yolk in the preparation of mayonnaise leads to better thermal stability of mayonnaise during pasteurization. A limitation of the use of pancreatic phospholipase for egg yolk is that the amount of free fatty acid also increases, which leads to reduced oxidative stability, since free fatty acids are more susceptible to oxidation than the corresponding esters. Free fatty acid can also cause a soapy taste.

The transferase from Aeromonas salmonicida was successfully expressed in B. subtilis and fermented on a laboratory scale as described in Example 5, purified by liquid chromatography and used to modify egg yolk lipids. An enzymatically modified egg yolk was used to make the thermally stable mayonnaise.

Transferase from A. salmonicida can be used to produce lysolecithin and cholesterol ester in egg yolk without the formation of significant amounts of free fatty acids, in other words, without or without a significant increase in the content of free fatty acids in the food product.

The enzymatically modified egg yolk obtained with transferase showed improved emulsification properties and can be used for thermally stable mayonnaise.

This enzyme is highly functional in the modification of egg yolk, catalyzing the lipid transfer reaction between lecithin and cholesterol (Fig. 47).

This study further examined the use of transferase to modify egg yolk and the use of modified egg yolk in the preparation of thermally stable mayonnaise.

This example describes the fermentation, isolation and introduction of transferase into egg yolks, as well as the introduction of enzymatically modified egg yolk into mayonnaise. The example is divided into two parts:

A. Enter transferase into egg yolk

B. Test enzymatically modified egg yolk in mayonnaise

experimental part

A. Entry

Enzyme and substrate

Transferase # 178-9 from A. salmonicida , purification 2554-100 C73, 15 PLU-7 / ml.

Transferase # 179 from A. salmonicida , 18.5 PLU-7 / ml.

Phospholipase A1 LECITASE ™ Ultra (Novozymes A / S, Denmark).

Egg yolk: liquid egg yolk with 8% salt, SANOVA FOODS, DK.

TLC analysis was performed as described previously (see Example 6 above).

Phospholipase activity: see previous examples.

Lipid extraction

1 g of egg yolk and 7.5 ml of a chloroform: methanol 2: 1 mixture were mixed in a Whirley mixer and centrifuged at 7.5 g for 10 minutes.

4 ml of the chloroform phase was isolated and used for subsequent lipid analysis.

Oxidative Stability Test

The oxidative stability of mayonnaise was determined in a ML OXYPRESS apparatus, where the sample was subjected to oxidative stress by heating under pressure in an oxygen atmosphere.

After some time, called the induction period (PI), the oxidation of the sample causes a certain consumption of oxygen, which is recorded as a change in pressure by the pressure sensor. A longer induction period indicates better oxidative stability.

Procedure

5 g of mayonnaise was placed in a glass vessel and the glass vessel was closed with a pressure sensor. The vessel was filled with oxygen at a pressure of 5 bar. The valve was opened to empty the vessel. This procedure was repeated twice and a sample with 5 bar of oxygen atmosphere was placed at a temperature of 80 ° C. The oxygen pressure was measured as a function of time and the induction period in hours was calculated.

results

Samples of purified transferase from Aeromonas salmonicide # 179 and 178-9 were used to treat egg yolk as shown in Table 2. An initial test showed that GCAT transferase should be administered with much lower phospholipase (PLU) activity than commercial phospholipase. This is due to the fact that GCAT is a transferase and therefore has a much lower hydrolytic activity than regular phospholipase.

table 2 Sanofo Egg Yolk, 8% Salt 2344-44 C89 18.5 PLU-7 / ml Transferase # 178-9 # 3108 Lecitase Ultra Water No. Egg yolk Transferase # 179 18.5PLU-7 / ml 1500 PLU-7 / ml g g g ml g PLU-7 / ml 6 120 2.00 8.00 0.31 7 120 10 0 1.25 8 120 1.86 8.14 23.25 9 120 10 0

Enzymatic reactions were carried out by weighing the egg yolk and the enzyme into a beaker. Samples were placed in a heating chamber at 37 ° C during slow stirring. After 1, 2, and 4 hours of reaction time, samples were taken for TLC analysis. After 4 hours of reaction time, the product was stored at 5 ° C and used for experiments with mayonnaise.

TLC analysis of lipids extracted from the enzyme-treated egg yolk is shown in FIG.

The TLC analysis of FIG. 48 shows the apparent hydrolytic effect of phospholipase # 3108 on triglyceride during the formation of free fatty acids, as well as some mono- and diglyceride. It seems that phospholipase # 3108 has no effect on cholesterol. Both transferase samples are clearly involved in the formation of cholesterol ester simultaneously with a decrease in cholesterol.

D. Enzyme-modified egg yolk in mayonnaise

In order to study the effect of the modification of the egg yolk samples mentioned in table 2, tests were carried out on their use in mayonnaise with a fat content of 50%. Mayonnaise was also prepared containing unprocessed egg yolk.

The aim of the study was to determine the effect of enzymatically modified egg yolks on emulsion properties and the effect on thermal stability. All samples of mayonnaise contained the same amount of oil and were emulsified only with egg yolk. All samples of mayonnaise were prepared using a Koruna mixer (Disho V60 / 10) and heated during preparation to 95 ° C for 5 minutes.

Samples of mayonnaise (Fig. 49), prepared with the enzyme-treated egg yolk, were successful and homogeneous without oil separation. The control sample was separated into an oil and water phase.

The particle size of oil droplets in mayonnaise samples with enzyme-treated egg yolk was measured on a Malvern Mastersizer. The sample was mixed with 0.1% SDS in 0.1 M phosphate buffer, pH 7, before measurement. The indication was the average particle size of all particles, as shown in table 3.

Table 3 Experience Enzyme The average particle size, microns 6 Transferase # 179, 0.31 PLU-7 / g 12.9 7 Transferase # 178-9, 1.25 PLU-7 / g 7.2 8 # 3108, Lecitase Ultra, 23 PLU-7 / g 5.2

Particle size results clearly show the effect of increasing the transferase dosage from A. salmonicida . At a high dose of transferase, the particle size is close to mayonnaise prepared with Lecitase Ultra. However, keep in mind that Lecitase Ultra produces a lot of fatty acids, which can lead to a finer particle distribution.

The droplet size of the mayonnaise prepared with the enzyme is much smaller than the droplet size of the mayonnaise made without the enzyme (i.e. the control mayonnaise).

Oxidative Stability

The oxidative stability of samples of mayonnaise 7 and 8 was determined on ML OXYPRESS with the results shown in table 4.

Table 4 Sample Induction period Induction period Definition 1, hours Definition 2, hours 7 37.44 38.08 8 35.68 35.52

Measurement of oxidative stability gave a clear significant difference in oxidative stability. Mayonnaise with egg yolk treated with transferase 178-9 has significantly better oxidative stability than mayonnaise with egg yolk treated with Lecitase Ultra. This can be explained by the fact that Lecitase Ultra produces more free fatty acids, which are more prone to oxidation than the corresponding fatty acid esters.

Samples of egg yolks used to make mayonnaise were extracted with chloroform, and lipids from egg yolks were analyzed by GLC with the results shown in Table 5.

Table 5 Experience Enzyme Fatty acid Cholesterol Cholesterol ester Triglyceride 6 Transferase # 179 0.96 0.94 0.49 23.95 7 Transferase # 178-9 1.84 0.60 1.06 24.54 8 # 3108, Lecitase Ultra 14.05 1.16 0.12 2.45 9 The control 0.48 1.16 0.13 22.87

The GLC results in table 5 confirm the results of TLC analysis, that Lecitase Ultra produces a very large amount of free fatty acids, and most of the triglyceride is hydrolyzed. On the other hand, transferase produces only a moderate amount of free fatty acids, and triglycerides do not hydrolyze. It also clearly shows that transferase produces cholesterol ester from cholesterol.

The results show that the amount of MS in the “enzyme-treated” mayonnaise is reduced compared to the control mayonnaise, while the amount of LPC is increased in the enzyme-treated mayonnaise compared to the control mayonnaise. An increase in LPC may well explain the improved emulsification properties of enzyme-treated mayonnaise compared to control mayonnaise, possibly because cholesterol was used as an acceptor molecule in the transferase reaction, resulting in an increase in the amount of cholesterol esters in enzyme-treated mayonnaise compared to control mayonnaise. In addition, the results show that the amount of free fatty acids does not increase significantly when the egg yolk is treated with transferase. The results further show that the amount of free fatty acids formed in a food product treated with lipid acyltransferase is significantly lower than in a food product treated with a control phospholipase, and this is true even when the amount of lysolecithin formed in food products is the same.

Example 8: Effect of Aeromonas salmonicida transferase in cupcakes

The effect of the GCAT acyltransferase from Aeromonas salmonicida was tested on a cupcake recipe. The enzyme was tested individually and in combination with other lipolytic enzymes. Enzymes were added to some of the cupcake ingredients or added together with other ingredients before kneading the cupcake.

Preliminary results showed that acyltransferase, coupled with a triglyceride hydrolyzing enzyme, improves cake volume and crumb structure compared to control.

In subsequent experiments, transferase from A. salmonicida and variants were tested individually and in combination with triglyceride hydrolyzing enzymes. Such enzymes are active against the lipid components of eggs and shortening, as well as to carbohydrates, protein, glycerin and cholesterol (in the egg), which form part of the cake formulation.

Materials and Method

Enzyme

Acyltransferase # 179 from Aeromonas salmonicida

Grindamyl EXEL 16, Lipase from Thermomyces lanuginosus

Cupcake Recipe

Ingredient % g Sugar 35/20 20.37 204 Pastry Flour, Albatros 18.11 181 Wheat starch 5.21 52 baking powder 0.36 four Pasteurized Liquid Whole Egg 22.63 226 Shortening Vegao (Aarhus United) 18.11 181 Dry whey 0.68 7 Glucose Syrup, 75% 42 DE 4,53 45 Glycerol 1.36 fourteen Salt 0.32 3 Rapeseed Oil 6.34 63 Potassium sorbate 0.18 1.8

Equipment

Mixer: Hobart N50 with spatula

Oven: Simon bread machine

Procedure

All ingredients should be brought to room temperature.

1. Beat sugar and shortening for 3 minutes - start at 2nd speed and switch to 3rd speed for 30 seconds.

2. Add the remaining ingredients - start at 1st speed and switch to 2nd speed within 30 seconds - mix for a total of 5 minutes.

3. Measure the volume of the talker into 1 dl cup.

4. Spread pound cake molds with Babette butter paste and cover with paper.

5. Weigh 2 × 350 g into pound cake molds.

6. Spread the mass evenly with a spatula.

7. Before putting it into the oven, add a trickle of oil to the top of the cake (along the length in the middle in order to make the cake break in the middle).

8. The furnace for 50 minutes at 180 ° C.

8. After baking, remove the molds from the oven and “drop” them on the table before removing the cake from the molds.

10. Remove the paper from the cupcakes and rotate the correct side up.

11. Cool the cupcakes on the wire rack for 60 minutes before weighing and measuring volume.

Notes

The enzyme used (enzymes used) is added at the beginning of mixing or added to some of the cake ingredients before being added to the other cake ingredients.

Enzymes are active only during mixing or reaction of the cake components, and the enzymes are inactivated during cake baking.

results

The following experiments were performed as shown in the following table.

one 2 3 four Whole egg g 250 250 250 250 Glucose Syrup, 75% DE 42 g 10 10 10 10 Acyltransferase # 179, 26 PLU / ml ml 25 25 Grindamyl EXEL 16 mg 37.5 37.5 Water 25

The eggs, glucose syrup and enzyme interacted for 30 minutes at 37 ° C, and shortly afterwards, the eggs were used to make the cake according to the above recipe.

Preliminary results showed that the combination of acyltransferase and hydrolyzing lipase triglycerides from Thermomyces lanuginosus improves the volume of the cake, as well as the crumb structure, nutritional quality and appearance are improved compared to the water control. Preliminary results indicate that for a cake, a combination of lipid acyltransferase and lipase may be preferable.

Example 9: The purpose of these experiments was to test the transferase from A. hydrophila expressed in E. coli

The transferase reaction of A. hydrophila # 135 (0.5 NEFA-PLU / ml) was tested on egg yolk. The experimental parameters are presented in table 6.

Table 6 Reaction time Egg yolk Concentration # 135 No. minutes g units PLU-NEFA one thirty one 0,000 2 thirty 2 0,100 3 60 2 0,100 four 150 2 0,100 5 240 2 0,100 6 1560 2 0,100 7 1560 one 0,000

The egg yolk was heated to 37 ° C and an enzyme was added. After the reaction time, 7 ml of a mixture of CHCl ₃ : methanol 2: 1 was added and stirred in a Whirley mixer for 30 sec.

The sample was centrifuged at 800 g for 10 minutes and the lower solvent phase was separated. 2 μl of this sample was applied to a TLC silica wafer and eluted with an eluting solvent IV. TLC analysis results are shown in FIGS. 50 and 51.

The techniques and materials mentioned in this example are those that are described in detail in the above examples.

Samples from this experiment were also analyzed by GLC in the form of TMS derivatives. The results of the GLC analysis are shown in table 7.

Table 7
GLC analysis of egg yolk lipids No. Reaction time Transferase Concentration # 135 units / g egg yolk Free fatty acid Cholesterol Cholesterol ester min % % % 7 the control 0 0.25 2.88 0.34 3 60 0,025 0.25 2.68 0.56 four 150 0,025 0.29 1.85 1.72 5 240 0,025 0.53 1.42 3,54 6 1560 0,025 0.95 0.3 4.43

From the GLC analysis of free fatty acid, cholesterol and cholesterol ester, you can calculate the molar concentration of each component and calculate the% transferase activity, which is shown in table 7.

Calculation of% Transferase Activity

From the results of an increase in the content of free fatty acid, sterol ester, the following are calculated:

Δ% fatty acid =% fatty acid (enzyme) -% fatty acid (control),

Δ% sterol ether =% sterol ether (enzyme) -% sterol ether (control).

Transferase activity is calculated as% of total enzymatic activity:

% transferase activity =

Where:

Mv of sterol ester = average molecular weight of sterol esters;

Mv fatty acid = average molecular weight of fatty acids.

Table 8
Transferase activity of A. hydrophila # 135 in egg yolk No. Reaction time Transferase Concentration # 135 units / g egg yolk Free fatty acid Cholesterol Cholesterol ester Transferase activity min mm mm mm % 7 the control 0 8.9 74.5 5.3 - 3 60 0.05 8.9 69.3 8.7 one hundred four 150 0.05 10,4 47.8 26.5 93 5 240 05/05 18.9 36.7 54.6 77 6 1560 0.05 33.9 7.8 68,4 48

Both TLC analysis and GLC analysis confirm that the initial transferase reaction of A. hydrophila # 135 is the dominant reaction. After 150 minutes of reaction time, some hydrolytic activity appears. After 1560 minutes, the transferase reaction and the hydrolytic reaction almost reach the same level. The results also show that as long as the cholesterol acceptor molecule is available, the transferase reaction is the dominant reaction. When cholesterol concentration decreases, hydrolytic activity becomes more dominant.

Example 10: Assay for measuring transferase activity using egg yolk as a substrate (hereinafter referred to as “egg yolk sample”)

Lipid acyltransferase was isolated from Aeromonas salmonicida and expressed in Bacillus subtilis . The aim of this study is to develop an analytical method with which it would be possible to measure both the transferase and hydrolytic activity of enzymes, and from such analyzes it would be possible to determine both the transferase and hydrolytic activity of enzymes using a substrate that contains lecithin and cholesterol.

In this work, egg yolk was used as a substrate for enzyme analysis, since egg yolk contains both lecithin and cholesterol, and it is known that transferases and phospholipases work very well in this substrate.

An obstacle to using egg yolk is that this substrate is a complex mixture of water, lipids and proteins. Lipid components include glycerides 66.2%, phospholipids 29.6% and cholesterol 4.2%. Phospholipids are composed of 73% lecithin, 15% cephalin and 12% other phospholipids. Of the fatty acids, 33% are saturated and 67% are unsaturated, including 42% oleic acid and 7% linoleic acid (see Kirk-Othmer Encyclopedia of Chemical Technology, John Wiley & Sons, Inc.).

You can expect some variations in the composition of the egg yolk. However, in the literature (Biochimica et Biophysica Acta, 1124 (1992) 205-222), it is mentioned that: "the mature egg yolk of domestic chickens has a remarkably constant composition of lipids and lipoproteins despite numerous variations in feeding and environmental conditions", and further indicates: "As a result, egg yolk is an almost constant food product that serves to maintain its chemical and physico-chemical properties for reliable use in the bakery, cosmetic and pharmaceutical industries."

This reference indicates that the composition of the egg yolk is very constant, and therefore it was decided to use the chicken yolk as a substrate for the egg yolk sample.

Quantification of the reaction products of lipids from the enzymatic treatment of egg yolk was carried out by extraction of lipids from the substrate, followed by GLC analysis of lipid components.

Procedure

Materials

Egg yolk: pasteurized liquid egg yolk from Danæg Products A / S, DK-4000 Roskilde.

HEPES Sigma buffer, cat. number H 3375.

Chloroform, chd.

Enzymes

Purified lipid acyltransferase from A. salmonicida # 178-9

Thermomyces languginosus lipase . Grindamyl EXEL 16, ibid., Number 147060 (control)

Enzyme analysis with egg yolk substrate

5 g of a liquid egg yolk was weighed into a 20 ml glass of Viton and heated to 35 ° C. 0.25 ml of the enzyme solution was added and the stopwatch started.

At regular intervals, 0.5 g samples were transferred to a 10 ml glass Dram. 20 μl of 4 M HCl was added to stop the enzymatic reaction and acidify the fatty acid soap.

3 ml of chloroform was added and the sample was stirred in a Whirley mixer for 30 sec.

The sample was centrifuged at 3000g for 10 min and 0.8 ml of the chloroform phase was transferred into a calibrated Dram glass. Chloroform was evaporated at 60 ° C under nitrogen vapor. The glass of Drama was weighed again.

The isolated lipids were analyzed by GLC and TLC.

TLC analysis - as described here.

GLC analysis - as described here.

results

For samples of egg yolk and using egg yolk as a substrate, the experiments were performed, are presented in table 9.

Table 9 one 2 3 Liquid egg yolk g 5 5 5 Transferase # 178-9, PLU-7 / ml * ml 0.25 Lipase T. lanuginosus , 200 LIPU / ml ml 0.25 Water ml 0.25

0.5 g of the sample was taken after 15, 30, 60, 120 and 1080 minutes and the lipids were isolated by solvent extraction. Lipids were analyzed by TLC using solvents I and IV, respectively. The TLC plate pattern is shown in FIG.

TLC analysis clearly shows the activity of transferase # 178-9 from A. salmonicida (sample 3). This can be seen by a decrease in the amount of phospholipids of RS and PE. The results also show that the amount of lysolecithin LPC is not as high as expected. This may indicate hydrolytic activity with respect to lysolecithin or may also be due to insufficient extraction, since lysolecithin is highly polar and therefore may partially be distributed into the aqueous phase.

The lipids isolated by solvent extraction were also analyzed by GLC in order to determine the amount of free fatty acid, cholesterol and cholesterol ester. GLC results are shown in table 10.

Table 10
GLC analysis of lipids from enzyme-treated egg yolk.
The results are given in% based on the lipid content. fifteen thirty 60 120 1080 min min min min min Free fatty acids The control one 0.328 0,304 0.322 0.333 0.369 T. lanuginosus 2 0.391 0.376 0.459 0.627 22,909 A. salmonicida # 178-9 3 1.007 1,668 4,013 6,761 15,098 Cholesterol The control one 3,075 2,968 3,103 3,056 3,099 T. lanuginosus 2 3,130 3,032 3,045 3,026 3,225 A. salmonicida # 178-9 3 2,835 1,912 0.356 0.220 0.206 Cholesterol ester The control one 0.416 0.397 0.422 0.408 0.437 T. lanuginosus 2 0.436 0.400 0.425 0.419 0.416 A. salmonicida # 178-9 3 1,414 2,988 6,107 6,694 5,760 Triglyceride The control one 76,153 73,505 75,565 79,344 77,382 T. lanuginosus 2 74,099 74,413 77,079 74,284 21,781 A. salmonicida # 178-9 3 73,781 73,342 77,857 82,040 72,117

From the results it can be seen that almost all of the cholesterol was esterified after 60 minutes in sample 3. It was concluded that in the first 30 minutes there was an excess of substrate for the reaction. Results from samples taken after 15 and 30 minutes were therefore used to calculate enzyme activities.

Based on the information in table 10 and the fact that the egg yolk contains 27% lipid, the number of micromoles of fatty acid and cholesterol ester produced per 1 ml of the enzyme was calculated, and the results are shown in table 11.

The results in table 11 were obtained by the following calculations from the results for fatty acids in sample 3 ( A. salmonicida , 15 min):

Lipid in 5 g of egg yolk = 5 × 0.27 = 1.35 g.

1.35 g of lipid contain 1.007% fatty acids = 1.35 × 1.007 / 100 = 0.01359 g.

The average molecular weight of fatty acids is 272.

0.01359 g = 0.01359 × 1,000,000 / 272 = 49.9798 μmol.

0.25 ml of the enzyme was added.

μmol of fatty acid / ml of enzyme = 49.9798 / 0.25 = 199.9.

Table 11 Enzyme, μmol / ml 0 min 15 minutes 30 minutes Free fatty acids The control 65.01 60.37 T. lanuginosus 77.61 74.71 Transferase # 178-9 199.86 331.06 Cholesterol ester The control 35.09 33,50 T. lanuginosus 36.77 33.73 Transferase # 178-9 119.29 252.15

From the results of table 11, it is possible to calculate the change in the amounts of fatty acid and cholesterol ester caused by the enzyme relative to the control, as shown in table 12

Table 12 Enzyme, ∆ µmol / ml 0 min 15 minutes 30 minutes Free fatty acid T. lanuginosus 0 12,593 14,340 Transferase # 178-9 0 134,843 270,691 Cholesterol ester T. lanuginosus 0 1,677 0.235 Transferase # 178-9 0 84,196 218,652

The amount of cholesterol fatty acid or ester produced as a function of time is shown in FIG.

Hydrolytic activity (FFA formation) and lipid acyltransferase activity (cholesterol ester formation) as a function of time were calculated from the slope of the curve. Then, the relative transferase activity (% acyltransferase activity) and the relative hydrolytic activity were calculated, which are shown in Table 13. The relative transferase activity was determined using the protocol for determining the% acyltransferase activity described earlier here. For example, calculating relative activity for # 178-9:

Total activity is FFA activity + transferase activity = 9.023 + 7.2884 = 16.311 μmol / min / ml.

Relative transferase activity = 7.2884 × 100 / 16.311 = 44.7.

Relative hydrolytic activity = 9.023 × 100 / 16.311 = 55.3.

Table 13 T. lanuginosus FFA activity 0.4780 μmol / min / ml A. salmonicida # 178-9 FFA activity 9.0230 μmol / min / ml T. lanuginosus Cholesterol ester activity 0.0078 μmol / min / ml A. salmonicida # 178-9 7,2884 μmol / min / ml T. lanuginosus Relative transferase activity 1,6 A. salmonicida # 178-9 44.7 T. lanuginosus Relative hydrolytic activity 98.4 A. salmonicida # 178-9 55.3

The results in table 13 confirm that the transferase enzyme from A. salmonicida has significant transferase activity, but the results also confirm that this enzyme has significant hydrolytic activity.

The lipase from T. lanuginosus has hydrolytic activity, and the relative transferase activity of 1.6 is not evidence of any transferase activity, but is due to inaccurate analysis.

Conclusion

Egg yolk was used as a substrate to determine the transferase and hydrolase activity of lipid acyltransferase from Aeromonas salmonicid a and lipase from Thermomyces lanuginosus .

Under the assay conditions, there was initially a linear relationship between the formation of cholesterol ester and free fatty acid and the time for the lipid acyltransferase enzyme. Based on this linear relationship, hydrolytic activity (formation of FFA) and transferase activity (formation of cholesterol ester) can be calculated. The relative hydrolytic and transferase activity was also calculated. Lipid acyltransferase (in this case GCAT) from Aeromonas salmonicid a showed almost equal hydrolytic activity and transferase activity under these test conditions. Thermomyces lanuginosus lipase showed very low hydrolytic activity, and the transferase activity was not significant.

Example 11: Analysis of transferase in egg yolk with a high water content

Introduction

The lipid acyltransferase according to the present invention was isolated from Aeromonas salmonicida and expressed in Bacillus subtilis . Initial experiments showed that this enzyme is very effective in transferring fatty acids from lecithin to cholesterol when using egg yolk as a substrate.

In subsequent experiments, the transferase reaction was studied in more detail, using egg yolk as a substrate and focusing on the concentration of water in the substrate.

Procedure

Materials

Egg yolk: pasteurized liquid egg yolk from Danæg Products A / S, DK-4000 Roskilde.

HEPES Sigma buffer, cat. number H 3375.

Chloroform, chda

Squalane

Enzymes

# 178-9 lipid acyltransferase according to the present invention from A. salmonicida .

# 2427 phospholipase A1 from Fusarium oxysporum , LIPOPAN® F from Novozymes, DK (comparative lipolytic enzyme).

# 1991 Phospholipase A2 from the pancreas, LIPOMOD 221 from Biocatalysts, UK (comparative lipolytic enzyme).

Enzyme analysis with egg yolk substrate

5 g of a liquid egg yolk was weighed into a 20 ml glass of Viton and heated to 35 ° C. Water and enzyme were added and a stopwatch started.

At regular intervals, 0.5 g samples were transferred to a 10 ml glass Dram. 20 μl of 4 M HCl was added to stop the enzymatic reaction and acidify the fatty acid soap.

3 ml of chloroform was added and the sample was stirred in a Whirley mixer for 30 sec.

The sample was centrifuged at 3000g for 10 min and 0.8 ml of the chloroform phase was transferred into a calibrated Dram glass. Chloroform was evaporated at 60 ° C under nitrogen vapor. The glass of Drama was weighed again.

The isolated lipids were analyzed by GLC.

GLC analysis

A Perkin Elmer Autosystem 900 capillary gas chromatograph equipped with a 12.5 m × 0.25 mm WCOT fused silica column internal diameter × 0.1 μm film thickness 5% phenylmethyl silicone (CR Sil 8 GB from Chromopack).

Carrier gas: helium

Inlet: PSSI cold slotted injector (initial temperature 50 ° С, heating up to 385 ° С), volume 1.0 μl

PID detector: 395 ° C

Thermostat program:

Thermostat temperature, ° С 90 280 350 Isothermal time, min one 0 10 The rate of temperature rise, ° C / min fifteen four

Sample preparation: 30 mg of sample was dissolved in 9 ml of a heptane: pyridine 2: 1 mixture containing an internal standard of heptadecane, 0.5 mg / ml. 300 μl of the sample solution was transferred into a curved tube, 300 μl of MSTFA (N-methyl-N-trimethylsilyl trifluoroacetamide) was added and allowed to react for 20 min at 60 ° C.

Calculation: response coefficients for mono-, di- and triglycerides and free fatty acid were determined according to standard 2 (mono-di-triglyceride), for cholesterol, cholesteryl palmitate and cholesteryl stearate. Response coefficients were determined by the pure control substance (10 μg sample of pure substance).

results

An egg yolk containing 2% squalane was used as a substrate for the reactions. Squalane was added as an internal standard for GLC analysis to quantify the lipid components in egg yolk.

The experiments were carried out as shown in table 14.

Table 14 one 2 3 four 5 6 7 8 Substrate, egg yolk with 2% squalane g 5 5 5 5 5 5 2.5 2.5 Transferase # 178-9, 14 PLU-7 / ml ml 0.25 0.25 0.13 LIPOPAN® F, solution, 200 PLU-7 / ml ml 0.25 0.25 0.13 # 1991 phospholipase A2, 6300 PLU / ml ml 0.25 Water ml 0.25 3.8 3.8 8.75 8.75

Samples were taken after 30, 60 and 120 minutes and analyzed according to the procedure described above. Samples of 0.5 ml (experiments 1-4), 0.86 ml (experiments 5-6) and 2.2 ml (experiments 7-8) were taken.

GLC analysis results are shown in Table 15. GLC results are expressed as a percentage of the substrate (egg yolk). The table also shows the reaction time and the total amount of water in the reaction mixture.

Table 15 Enzyme Reaction time % water GLC GLC GLC minutes in reaction % fatty acid % cholesterol % cholesterol ester The control 120 54 0.247 0.863 0,083 # 178 thirty 54 0.422 0.669 0.445 # 178 60 54 0.515 0.549 0.672 # 178 120 54 0.711 0.364 1,029 # 2427 thirty 54 2,366 0.848 0,090 # 2427 60 54 3,175 0.837 0,088 # 2427 120 54 3,926 0.833 0,082 # 1991 thirty 54 1,606 0.911 0,083 # 1991 60 54 1,701 0.838 0,080 # 1991 120 54 1,781 0.873 0,053 # 178 thirty 73 0.377 0.874 0.495 # 178 60 73 0.488 0.665 0.719 # 178 120 73 0.626 0.426 0.931 # 2427 thirty 73 2,471 0.853 0,092 # 2427 60 73 3,284 0.858 0,087 # 2427 120 73 4,176 0.837 0,081 # 178 thirty 89 0.344 0.720 0,308 # 178 60 89 0.443 0.725 0.446 # 178 120 89 0.610 0.597 0,607 # 2427 thirty 89 0.510 0.167 0.010 # 2427 60 89 0.602 0.133 0.010 # 2427 120 89 0.867 0.147 0.009

Based on analyzes of fatty acid, cholesterol and cholesterol ester, the amount of free fatty acid and cholesterol ester formed can be calculated as a function of reaction time and water content. Based on these results, the total enzymatic activity can then be calculated as the sum of the formation of fatty acid and the formation of cholesterol ester. Relative hydrolytic activity and relative transferase activity (i.e.,% acyltransferase activity) were then calculated and the results are shown in Table 16.

The results in table 16 were also analyzed statistically using Statigraphic Multifactor ANOVA. The statistical results in Fig. 54 confirm that phospholipase A1, # 2427 and phospholipase A2 # 1991 do not have transferase activity, whereas transferase # 178-9 shows almost 50% transferase activity under these test conditions.

The effect of water content in the test on the transferase activity of transferase # 178-9 was also analyzed statistically, as shown in Fig. 55. These results show that in the range from 54 to 89% of the water during the tests there was no strong effect of the water content on the relative transferase activity.

The effect of reaction time on transferase activity for transferase # 178-9 was evaluated with the results shown in table 16 and Fig. 56. The results in FIG. 56 show that the relative transferase activity decreases as a function of reaction time. This can be explained by the fact that most of the molecules of the cholesterol acceptor are consumed and therefore the relative hydrolytic activity increases. Negative values of the transferase reaction for # 2427 only show that, within the framework of the error of the analytical method, transferase activity is absent.

Table 16 Enzyme Reaction time, minutes % water in the reaction mixture Fatty acid formation Cholesterol intake Cholesterol ester formation Hydrolytic activity,% Transferase activity,% # 178 thirty 54 0.175 0.194 0.362 53 47 # 178 60 54 0.268 0.314 0.589 52 48 # 178 120 54 0.464 0.499 0.946 53 47 # 2427 thirty 54 2,119 0.015 0.007 one hundred 0 # 2427 120 54 2,928 0,026 0.005 one hundred 0 # 2427 60 54 3,679 0,030 -0.001 one hundred 0 # 1991 thirty 54 1.359 -0.048 0,000 one hundred 0 # 1991 60 54 1,454 0,025 -0.003 one hundred 0 # 1991 120 54 1,534 0,100 -0.030 101 -one # 178 thirty 73 0.130 0,099 0.412 42 58 # 178 60 73 0.241 0.198 0.636 47 53 # 178 120 73 0.379 0.437 0.848 51 49 # 2427 thirty 73 2,224 0.010 0.009 one hundred 0 # 2427 60 73 3,037 0.005 0.004 one hundred 0 # 2427 120 73 3,929 0,026 -0.002 one hundred 0 # 178 thirty 89 0,097 0.143 0.225 fifty fifty # 178 60 89 0.196 0.138 0.363 56 44 # 178 120 89 0.363 0.266 0.524 62 38 # 2427 thirty 89 0.263 0.606 -0.073 113 -13 # 2427 60 89 0.355 0.730 -0.073 110 -10 # 2427 120 89 0.620 0.716 -0.074 105 -5

Conclusion

Lipid acyltransferase from Aeromonas salmonicida was tested in egg yolk as a substrate and with different levels of water content. This enzyme was compared with control lipolytic enzymes, namely, phospholipase A1 from Fusarium oxysporum and phospholipase A2 from the pancreas.

The results prove that only transferase catalyzed the transferase reaction between lecithin and cholesterol during the formation of cholesterol ester. The results showed that in the range from 54% to 89% of the water in the substrate, the relative transferase activity was almost the same for the transferase from Aeromonas salmonicida .

Example 12: Analysis of transferase in a buffered substrate for measuring acyltransferase activity (for example, for use in a food product using lecithin and cholesterol)

Lipid acyltransferase was isolated from Aeromonas salmonicida and expressed in Bacillus subtilis . This enzyme is very effective in transferring fatty acids from lecithin to cholesterol during the formation of cholesterol esters. It was also shown that the enzyme has some hydrolytic activity, which is observed by the formation of free fatty acid. Traditional phospholipases (AC3.1.1.4 and EC3.1.1.32) have the ability to hydrolyze lecithin during the formation of free fatty acids and lysolecithin, and no transferase activity has been reported for these enzymes.

Here, a test is detailed that is able to evaluate both the transferase and hydrolytic activity of enzymes and thus identify the lipid acyltransferases according to the present invention; the test uses a substrate that contains lecithin and cholesterol. In this work, a substrate based on phosphatidylcholine and cholesterol dispersed in a buffer was used. Quantification of the reaction products was carried out by extraction of lipids from the substrate, followed by GLC analysis of lipid components.

Procedure

Materials

L-alpha-phosphatidylcholine 95% (plant) Avanti No. 441601

Cholesterol: Sigma Cat. C 8503

Cholesterol palmitate: Sigma C 6072

Cholesterol stearate: Sigma C 3459

HEPES Sigma cat buffer. No. H 3375

Chloroform, chda

Enzymes

Purified GCAT from A. salmonicida # 178-9

TLC analysis was performed as described in example 6.

GLC analysis was performed as described in example 11.

Results: Analysis of transferase based on phosphatidylcholine and cholesterol as a substrate.

In the following, the transferase activity of the transferase was tested in a substrate based on phosphatidylcholine and cholesterol in accordance with the following procedure.

450 mg of phosphatidylcholine (> 95% PC Avanti, paragraph No. 441601) and 50 mg of cholesterol were dissolved in chloroform and evaporated to dryness in vacuo. 300 mg of a cholesterol / phosphatidylcholine mixture was transferred to a Viton glass and 15 ml of HEPES buffer, pH 7.0, was added. The lipid was dispersed in buffer while stirring.

The substrate was heated to 35 ° C with stirring with a magnetic stirrer and 0.25 ml of the enzyme solution was added. It is a heavily flooded environment with a water content of approximately 95%.

Samples in 2 ml were taken after 0, 5, 10, 15, 25, 40 and 60 minutes of reaction time. 25 μl of 4 M HCl was immediately added to acidify the free fatty acid and stop the enzymatic reaction. 3.00 ml of chloroform was added and the sample was vigorously shaken on Whirley for 30 sec. The sample was centrifuged and 2 ml of the chloroform phase was isolated and filtered through 0.45 μm filters in a 10 ml calibrated Dram glass. Chloroform was evaporated by a stream of nitrogen at 60 ° C and the samples were weighed again. The extracted lipid was analyzed by GLC.

The results of GLC analyzes are shown in table 17. The results are expressed in%, calculated on the extracted lipid. The amount of free fatty acid and cholesterol ester formed as a function of time is shown in FIG. 57. From Fig. 57, it can be concluded that the enzymatic reaction is not a linear function of time, since initially strong and hydrolytic and transferase activity are observed. After about 10 minutes and up to about 60 minutes, the reaction shows an almost linear pattern of formation of fatty acid and cholesterol ester as a function of time. Therefore, it was decided to consider the enzymatic reaction in this time interval.

Table 17 Minutes 0 5 10 fifteen 25 40 60 Cholesterol% 10,064 8,948 8.577 8,656 8,102 7,856 7,809 Cholesterol ester,% 0,000 1,571 2,030 2,058 2,282 2,659 3,081 FFA total,% 0.260 1,197 1,239 1,466 2,445 2,943 3,940

Knowing the amount of lipid in the reaction mixture and the amount of enzyme added, it is possible to calculate the formation of fatty acid and cholesterol ester, expressed in μmol / ml enzyme (table 18 and Fig. 58).

Table 18 Minutes 10 fifteen 25 40 60 μm / ml μm / ml μm / ml μm / ml μm / ml FFA in total 58.1 68.7 114.6 138.0 184.7 Cholesterol ester 88.9 90.0 99.3 115.6 133.8

From the results in table 18 and the slope of the curves in FIG. 58, the amount of fatty acid and cholesterol ester can be calculated as a function of time, expressed in μmol / min per ml of enzyme.

The calculation of hydrolytic activity and transferase activity is shown in Table 19. Relative transferase activity was determined using the protocol for determining% acyltransferase activity described earlier here.

Table 19 Hydrolytic activity (fatty acid) 2,52 μmol / min per ml of enzyme Transferase activity (cholesterol ester) 0.94 μmol / min per ml of enzyme Total activity 3.45 μmol / min per ml of enzyme Relative transferase activity 27.1 % Relative hydrolytic activity 72.9 %

Search for other enzymes with transferase activity

The method described above was used to evaluate various lipolytic enzymes for transferase and hydrolytic activity. Enzymes were tested as shown in table 20.

Table 20 one 2 3 four 5 Substrate ml 1,5 1,5 1,5 1,5 1,5 # 178-9 Transferase A. salmonicida 32 PLU-7 / ml ml 0.25 5% # 3016 LIPOPAN® F ( F. oxysporum ) ml 0.25 5% Thermomyces lanuginosus ml 0.25 5% Candida rugosa # 2983 ml 0.25 5% Candida cylindracea # 3076 ml 0.25

A substrate containing 300 mg of phosphatidylcholine / cholesterol dispersed in 50 mM HEPES buffer, pH 7.0, was heated to 35 ° C. with stirring. An enzyme solution was added and the sample was kept at 35 ° C with stirring. Samples were taken at regular intervals and extracted with chloroform. The isolated lipids were analyzed by GLC, the results are shown in table 21.

Table 21 Try one Transferase 178-9 Minutes 0 5 10 fifteen 25 40 60 SJK 1,216 2,516 2,983 2.62 2,894 3,448 3,911 Cholesterol 7,547 6,438 6,365 6.15 6,136 5,936 5,662 Cholesterol ester 0 1,835 2,177 2.44 2,58 2,851 3,331 2 Fusarium oxysporum (LIPOPAN® F) Minutes 0 5 10 fifteen 25 40 60 SJK 1,216 1,345 1,796 1.95 2,487 2,424 2,977 Cholesterol 7,547 7,309 7,366 7.33 7,429 7,341 7,326 Cholesterol ester 0 0.26 0.386 0.35 0.267 0.36 0.394 3 Thermomyces lanuginosus Minutes 0 5 10 fifteen 25 40 60 SJK 1,216 0.853 0.875 one 0.896 1.105 1.009 Cholesterol 7,547 7,384 7,639 7.63 7,675 7,603 7,529 Cholesterol ester 0 0 0 0 0 0 0 four Candida rugosa (# 2938) Minutes 0 5 10 fifteen 25 40 60 SJK 1,216 0.982 0.987 1,02 1.135 1,131 1.15 Cholesterol 7,547 7.438 7,656 7.66 7,638 7,575 7,585 Cholesterol ester 0 0 0 0 0 0 0 5 Candida cylindricea (# 3076) Minutes 0 5 10 fifteen 25 40 60 SJK 1,216 1,032 1,097 1,07 1,203 1,131 1.43 Cholesterol 7,547 7,502 7,425 7.65 7,619 7,502 7,411 Cholesterol ester 0 0 0 0 0 0 0

GLC analyzes show that only lipid acyltransferase (178-9) produces a significant amount of cholesterol ester and fatty acids. The phospholipase from Fusarium oxysporum also gives a stable increase in free fatty acid, but only a small amount of cholesterol ester was initially formed, and no increase in cholesterol ester depending on time was observed.

Knowing the amount of lipid substrate and GLC analyzes, the relative transferase activity and relative hydrolytic activity can be calculated based on the results for the reaction time from 10 to 60 minutes. The results for transferase 178-9 and Fusarium oxysporum lipase are shown in Table 21. Other enzymes tested did not show activity.

Table 21A Trans Ferase 178-9 Fusarium oxysporum Hydrolytic activity, micromol / min per ml of enzyme 1,03 0.96 Transferase activity, micromol / min per ml of enzyme 0.40 0.01 Total enzyme activity, micromol / min per ml of enzyme 1.43 0.98 Relative hydrolytic activity 71.8 98.7 Relative transferase activity 28,2 1.3

The result, shown in table 21A, confirms the significant transferase activity of lipid acyltransferase (sample 178-9). It was also observed that the relative transferase activity is in good agreement with the experiment mentioned in table 19.

However, a very low transferase activity of Fusarium oxysporum phospholipase is observed. This transferase level is so low that it falls into the analysis error. As expected, Fusarium oxysporum phospholipase has significant hydrolytic activity.

Conclusion

Instead of the egg yolk (shown in Example 11), an artificial substrate based on purified phosphatidylcholine and cholesterol was used as a substrate in order to measure the transferase activity from Aeromonas salmonicida . Between 10 minutes and 60 minutes of reaction time, the analysis gave an almost linear formation of free fatty acids and cholesterol ester as a function of time. Based on the activity between 10 minutes and 60 minutes of the reaction time, hydrolytic activity and transferase activity were calculated.

The substrate concentration in this test was relatively lower than in egg yolk, and the amount of water was relatively higher.

Based on the results of the analysis of lipid acyltransferase (in this case GCAT) from Aeromonas salmonicida in an artificial substrate of their phosphatidylcholine / cholesterol in a buffer, it can be concluded that this enzyme also has a very good transferase activity in a system with a very high water content.

Both egg yolk-based analysis (see Example 11) and phosphatidylcholine / cholesterol analysis in buffer (Example 12) can be used to measure the transferase and hydrolytic activity of enzymes. Egg yolk is preferred in that the hydrolytic and transferase activity is a linear time dependence, and the phosphatidylcholine / cholesterol in the buffer is linear only in a certain time interval.

Example 13: Food Emulsions

The effect of the enzyme modified egg yolk was tested on a standard formulation of a food emulsion with 60% oil.

Standard methods and materials are those that have been discussed in detail in the previous examples.

The egg yolk was treated with a lipid acyltransferase from Aeromonas salmonicida (# 138) or phospholipase, namely the commercially available Lipopan F® enzyme (Novozymes A / S, Denmark) (# 2938), as shown in table 22.

Table 22
Enzymatic processing of egg yolk one 2 3 four Egg Yolk, Sanofo Product No. 1123P2 g 10 10 10 10 # 138, 10 PLU / ml ml one one # 2938, 200 PLU / ml ml one Water ml one Reaction time min 210 360 210 360

TLC analysis of egg yolk lipids from an enzyme treated egg yolk (table 9) is shown in FIGS. 59 and 60.

In this experiment, dose # 2938 was increased 10-fold, and this had a very clear effect on the egg yolk. The amount of free fatty acid increased significantly, and lecithin (MS) was hydrolyzed to lysolecithin (LPC). Transferase # 138 gave a clear transferase reaction, since free cholesterol was converted to cholesterol ether and part of the lecithin was converted to lysolecithin.

Another interesting aspect of the enzymatic modification was the consistency of the product. The sample treated with phospholipase # 2938 became very solid, while the samples treated with lipid acyltransferase # 138 retained the same liquid consistency as the control sample (see FIG. 61).

These modified egg yolks were tested in the food emulsion formulation shown in table 23.

Table 23
Enzyme-modified egg yolk mayonnaise 0 1a 2a 3a 4a % % % % % Rapeseed oil 60 60 60 60 60 Egg Yolk, Sanofo Product No. 1123P2 2,8 Farms. modified egg yolk No. 1 2,8 Farms. modified egg yolk No. 2 2,8 Farms. modified egg yolk No. 3 2,8 Control (untreated egg yolk) No. 4 2,8 Water 39 36,2 36,2 36,2 36,2 Vinegar, 10% Acetic Acid one one one one one

Modified egg yolks 1 and 2 were treated with lipid acyltransferase, and modified egg yolk 3 was treated with a commercially available phospholipase.

A food emulsion was prepared as an oil in water emulsion according to the following procedure: an egg yolk and water were weighed into a glass. The oil was weighed separately.

A Turrax mixer (20,000 rpm) was immersed in the aqueous phase. Oil was pumped into the aqueous phase at a constant rate for 2 minutes. Stirring was continued for an additional 1 minute. Then vinegar was added and mixed for 5 seconds.

The stability of the emulsion was tested in a heating chamber at 100 ° C. After 2 hours at 100 ° C., the emulsion was evaluated (see FIG. 62).

The stability of the raw egg yolk emulsion in this experiment was quite satisfactory. However, treating the egg yolk with lipid acyltransferase # 138 improved stability as the amount of water that separated was reduced. An egg yolk treated with phospholipase # 2938 gave a very unstable emulsion with an almost complete separation of the oil and water phases at 100 ° C.

The authors believe that in some areas the use of the compositions and methods of the invention can provide improved thermal stability of emulsions, such as oil-in-water salad dressings and the like. This is especially important for food emulsions that are pasteurized to provide long shelf life and / or heated before serving, for example, in pre-cooked dishes that are reheated before serving (for example, in microwave ovens). Although not wanting to be bound by any particular theory, it is suggested that, in some applications, the accumulation of free fatty acids can be detrimental to the thermal stability of such emulsions. It should be recognized that improved thermal stability of food emulsions prepared using the methods of the invention may not occur or may even be undesirable in some food applications. It will be apparent to those skilled in the art in which applications such characteristics are desired, and the stability of the emulsions can be easily determined using simple thermal tests equivalent to, for example, pasteurization and / or reheating in a microwave oven. The inventors have found that in a preferred embodiment, the food emulsion obtained using the enzymes of the invention has improved thermal stability.

Example 14: Transferase reaction in egg yolk enriched with plant sterol

Transferase from Aeromonas salmonicida was able to catalyze the formation of lysolecithin, monoglyceride and sterol esters in egg yolk enriched with plant sterol and glycerol. The same enzyme was tested in a low-water system containing palm oil, lecithin, plant sterol and glycerin. TLC and GLC analyzes showed that plant sterol monoglycerides and esters are produced under these reaction conditions.

Introduction

Transferase from Aeromonas salmonicida was tested for transferase activity in an almost water-free system of lecithin, fat, plant sterol and glycerol.

Materials

Egg yolk: pasteurized liquid egg yolk from Danæg Products A / S, DK-4000 Roskilde.

GCAT transferase purified # 178-9, 32 PLU-7 / ml (journal 2254-100).

Yolkin Soy Lecithin from Aarhus United, Denmark.

Palm Oil 43, from Aarhus United, Denmark.

L-α-phosphatidylcholine 95% vegetable (Avanti # 441601).

Sitosterol, Sigma nr. S5753.

Plant Sterol: Generol N122 from Cognis, Germany.

Glycerin, p. 085915.

results

Initial screening for transferase activity against plant sterol and glycerol was performed in egg yolk, as shown in table 24.

Table 24 one 2 3 four Egg yolk g one one one one Glycerol g 0.1 0.1 Sitosterol: oil 3: 7 g 0.13 0.13 Transferase # 178-9 units one one Water *

* Water corresponding to the amount of water in the enzyme solution = 83 μl

The ingredients were mixed and heated to 37 ° C and kept at this temperature with stirring with a magnetic stirrer.

Samples of 0.1 g were taken after 3 and 23 hours and analyzed by TLC. TLC analysis results are shown in FIG.

The result in FIG. 63 shows that both cholesterol and plant sterols are esterified as a result of the transferase reaction simultaneously with the formation of lysolecithin (samples 3 and 4), since almost all free sterol and cholesterol were converted to the corresponding ester in sample 3.

The results also show that a sample containing only glycerin and egg yolk produced monoglyceride. The amount of monoglyceride should be confirmed by GLC analysis. When sterol was added together with glycerol (sample 2), the amount of monoglyceride was very low and not detectable by TLC. This shows that as long as there is an excess of sterol or cholesterol, the transferase reaction using glycerol is moderate.

In another experiment, the transferase enzyme 178-9 was added to a mixture of soya lecithin, glycerol and plant sterol in order to study the catalytic activity of the enzyme in this reaction mixture.

The composition of the reaction mixtures in these experiments is shown in table 25.

Table 25 one 2 3 four 5 6 Soya lecithin g 1,875 2.25 1,875 2.5 3,5 3,5 Plant Sterol Generol N 122 g 0.225 0.225 0 0 0.225 0.5 Palm oil 43 g 2,675 2.25 2,8 2,125 1,062 0.831 Glycerol g 0.225 0.275 0.325 0.375 0.248 0.238 Transferase # 178-9, 32 PLU / ml ml 0.2 0.2 0.2 0.2 0.2 0.2

The experiment was carried out by mixing the lipid components with stirring at 46 ° C. The enzyme was added and samples were taken after 4 and 24 hours.

Samples were analyzed by TLC, as shown in Fig.64.

Samples from experiments 2, 4 and 5 after 24 hours of reaction time were also analyzed by GLC, and the results are shown in table 26.

Table 26 2 four 5 Glycerol % 3.16 5.71 4.17 Fatty acid % 4.23 5.36 6.67 Mono % 2.24 3.87 3.92 Sterol % 2.13 2.62 Sterol Ether % 2.89 2.14

The results confirmed that transferase 178-9 is capable of catalyzing the formation of plant sterol esters and monoglyceride from a reaction mixture containing soya lecithin, glycerin and plant sterol. Such a reaction mixture could be of interest for use in the production of margarine, where monoglycerides are desirable because of their emulsifying properties, and plant sterol esters are desirable because of their cholesterol lowering effect.

Conclusion

GCAT transferase from Aeromonas salmonicida is able to catalyze the formation of plant sterol esters and monoglyceride in egg yolk when plant sterol and glycerin are added. The same enzyme catalyzes the formation of plant sterol esters and monoglyceride in a mixture of palm oil, lecithin, plant sterol and glycerol. Therefore, the enzyme is of interest for use in margarine and other oil-containing foods, where monoglyceride and lysolecithin are necessary to improve emulsification, and plant sterol esters are desirable because of their cholesterol lowering effect.

Example 15: Immobilization of lipid acyltransferase from Aeromonas salmonicida and use in the synthesis of sterol esters

Lipid acyltransferase (in this case GCAT) from A. salmonicida was immobilized on celite by precipitation with acetone. 10 ml of an enzyme solution in 20 mM TEM buffer, pH 7, was slowly mixed with 0.1 g of Celite 535 535 (from Fluka) for 2 hours at room temperature.

50 ml of cold acetone was added with continued stirring. The precipitate was isolated by centrifugation at 5000 g for 1 minute. The precipitate was washed 2 times with 20 ml of cold acetone. Celite was dried at room temperature for about 1 hour.

Immobilized transferase was tested in an oil mixture containing 13% phosphatidylcholine and 7% plant sterol (table 27).

Table 27 % Avanti Lecithin 12.0 Plant Sterol Generol 122N 6.6 Palm oil 43 71,4 Glycerol 5,0 Immobilized Transferase # 178, 45 U / g 2.0 Water 3.0

Lecithin, vegetable sterol and soybean oil were heated to 46 ° C and vegetable sterol was dissolved. Immobilized transferase was added.

The transferase reaction continued at 46 ° C with gentle stirring with a magnetic stirrer. Samples for analysis were taken after 1/2, 1, 3, 6 and 24 hours and analyzed by TLC. The reaction was stopped after 24 hours of reaction time and the immobilized transferase was filtered.

Samples were analyzed by TLC, and the results are shown in Fig. 65.

TLC analysis clearly showed the effect of immobilized transferase from A. salmonicida in the conversion of cholesterol to cholesterol ester. It was also observed that a small amount of monoglyceride was formed. It was also shown that the enzyme has high activity in environments with a high water content (6-89% water), therefore, transferase and other transferases for use according to the invention can also be used in applications with an immobilized enzyme with a significant water content. This makes it possible to replace the solvents used in modern immobilized lipases during lipid bioconversion using transferases.

Example 16: Transferase Aeromonas salmonicida can transfer from phospholipid to sterol to form a sterol ester and / or to a sugar molecule to form a sugar ester

The lipid acyltransferase from Aeromonas salmonicida expressed in E. coli (Hydro 0303), designated as # 139, was purified on an HR 2.5 / 10 column with Chelating Sepharose FF and assayed for phospholipase activity. Transferase activity was evaluated in egg yolk for enzymatic activity and functionality in egg yolk. The enzyme was also tested in egg yolk containing glucose.

Phospholipase activity

Transferase # 139 isolated from a 2.5 / 10 HR column with Chelating Sepharose FF was analyzed with NEFA-PLU (pH 7). Activity was 1.15 units of NEFA-PLU / ml.

Egg yolk

In the initial applicability test, transferase # 139 was tested in egg yolk according to the following procedure.

1 g of fresh egg yolk was weighed into a 10 ml screw-top flask. An enzyme preparation was added and mixed on a Vortex mixer. The sample was stirred at 37 ° C and stirred with a magnetic stirrer.

The reaction was stopped by the addition of 7.5 ml of a mixture of chloroform: methanol (2: 1) and stirred on a Whirley stirrer for 30 seconds. The chloroform phase was separated by centrifugation, and 2 μl of the chloroform phase was transferred to a previously activated silicon dioxide TLC plate and eluted with current buffer I, and the other plate with current buffer IV.

The experimental parameters are shown in table 28.

Table 28 Experience Reaction time Egg yolk Transferase # 139 No. min g units one 10 one 2 10 one 0.75 NEFA-PLU 3 60 one 0.75 NEFA-PLU four 300 one 0.75 NEFA-PLU 5 1200 one 6 1200 one 0.75 NEFA-PLU

TLC analyzes are shown in FIGS. 66 and 67. TLC analysis clearly demonstrates the transferase transferase reaction # 139. Cholesterol is converted to cholesterol ester, and the amount of lecithin decreases. The result, however, also shows that lysolecithin accumulates only in very small amounts due to the fact that transferase # 139 is also active against lysolecithin. This observation is confirmed by the formation of free fatty acids (FFA).

Egg yolk and glucose

It was previously shown that transferase from Aeromonas salmonicida (# 138) is able to use glucose as an acceptor molecule in the transferase reaction. It was also tested whether transferase # 139 can use glucose as an acceptor molecule. The parameters of the experiment are presented in table 29.

Table 29 Experience Reaction time Egg yolk Glucose, 70% Transferase # 139 No. minutes g mg units one 10 one 500 2 10 one 500 1 NEFA-PLU 3 60 one 500 1 NEFA-PLU four 180 one 500 1 NEFA-PLU 5 300 one 500 1 NEFA-PLU 6 1200 one 500 1 NEFA-PLU 7 1200 one 500

The reaction products were analyzed by TLC and GLC.

TLC analysis showed the formation of a glucose ester after 220 minutes of reaction time (FIG. 69, lane 6), but after 1200 minutes of reaction time no glucose ester was seen. Therefore, it should be concluded that transferase # 139 has both transferase and hydrolytic activity. This is also confirmed by the fact that the amount of free fatty acids is constantly increasing during the reaction time.

Transferase from Aeromonas hydrophila was tested in egg yolk. The result confirms that this enzyme catalyzes the formation of cholesterol ester simultaneously with the formation of lysolecithin. After a long reaction time, when most of the cholesterol was consumed, free fatty acid was also formed. We can therefore conclude that the enzyme has predominantly transferase activity, but hydrolytic activity was also observed when only water was available as a donor molecule.

In an experiment with egg yolk and glucose, it was found that transferase from Aeromonas hydrophila is able to catalyze the formation of glucose ester in situ in a high-water food medium (Fig. 70).

Example 17: Variants of lipid acyltransferase from Aeromonas hydrophila (Ahyd2) (SEQ ID No.36, see Fig. 71)

Mutations were introduced using the QuikChange® Multi-Site Directed Mutagenesis kit Stratagene reagent kit, La Jolla, CA 92037, USA, following the instructions provided by Stratagene.

Options with Tyr256 showed increased activity against phospholipids.

Options with Tyr256 and Tyr260 showed increased activity against galactolipids.

The Tyr265 variant showed increased transferase activity with galactolipids as an acyl donor.

The numbers indicate the positions in the following sequence: An enzyme from Aeromonas hydrophila whose amino acid sequence is shown as SEQ ID No.36 in FIG. 71 (underlined amino acids indicate xylanase signal peptide). A nucleotide sequence is a sequence that is shown as SEQ ID No.54 in FIG.

Example 18: Use of an acyltransferase reaction to produce plant sterol ester and monoglyceride for the preparation of margarine

Aeromonas salmonicida acyltransferase expressed in Bacillus subtilis was tested in a mixture of palm oil containing plant lecithin, plant sterol and glycerin. Acyltransferase has shown the ability to utilize both plant sterol and glycerin as acceptor molecules during the production of plant sterol ester and monoglyceride. The reaction mixture was used to prepare good quality table margarine based on monoglyceride in the reaction mixture, and at the same time, margarine was enriched with plant sterol ether, which has been shown to have an effect on lowering cholesterol.

The aim of this work was to study the possibility of producing plant sterol monoglyceride and ether by the enzymatic reaction of lecithin, plant sterol and glycerol dissolved in vegetable fat.

Initial experiments showed that it is possible to use the acyltransferase from Aeronmonas salmonicida in order to produce plant sterol monoglyceride and ester from lecithin, glycerol and plant sterol.

In this experiment, such a reaction mixture was used to prepare table margarine.

Materials

Lipid acyltransferase from Aeromonas salmonicida , # 196 C101, 18.6 PLU / g (Journal 2254-104).

Palm Oil 43 from Aarhus United, DK.

L-α-phosphatidylcholine 95% vegetable (Avanti, # 441601).

Plant Sterol: Generol N122 from Cognis, Germany.

Glycerin, p. 085915.

Distilled monoglyceride, Dimodan HP from Danisco.

Cooking margarine

1. Mix the ingredients of the aqueous phase (if necessary, pasteurize the aqueous phase by heating to about 80 ° C). Bring the pH to 5.5.

2. Melt the fat phase and bring the temperature to about 40-45 ° C.

3. Heat the emulsifier with a certain amount of oil in the ratio of 1 part emulsifier to 5 parts of oil to a temperature (75-80 ° C), which is 5-10 ° C higher than the melting temperature of the emulsifier. When the mixture has completely melted and mixed well, add the remaining heated oil, stirring continuously.

4. Add flavoring.

5. Add the aqueous phase to the fat phase, mixing continuously.

6. Cool in a tube refrigerator (normal capacity, normal cooling) to an outlet temperature of 8-10 ° C.

results

The acyltransferase from A. salmonicida was tested in a mixture of palm oil, as shown in table 30. Lecithin, plant sterol, glycerin and palm oil were heated to 60 ° C with stirring to solubilize plant sterol and lecithin.

Table 30 Substrate % Avanti Lecithin 12.0 Plant Sterol Generol 122N 6.6 Palm oil, melting point 43 76,4 Glycerol 5,0

The substrate was cooled to 48 ° C and acyltransferase # 196 was added in the amount indicated in Table 31. The reaction mixture was kept at 48 ° C for 24 hours with slow stirring.

Table 31 g Substrate 220 Transferase # 196 C101, 18.6 PLU / g fifteen

Samples of the reaction mixture were taken after 1, 4 and 24 hours of reaction time and analyzed by TLC in solvent I (Fig. 73). TLC analysis clearly shows the formation of plant sterol ether and monoglyceride. In Fig. 73, the first lane represents the sample after 1 hour of reaction time, lane 2 represents 4 hours of reaction time, lane 3 represents 24 hours of reaction time, and lane 4 represents plant sterol.

The reaction was stopped after 24 hours of reaction time and the residues of undissolved plant sterol were removed and a clear solution was used to obtain margarine.

Margarine

The reaction mixture containing monoglyceride and plant sterol ester was used to produce table margarine according to the formulation shown in table 32.

Table 32 Protocol No. 3734 one 2 Water phase Water 16 16 Salt 0.5 0.5 Skimmed milk powder one one Potassium sorbate 0.1 0.1 EDTA 0.015 0.015 pH 5.5 5.5 Water phase total 16.6 16.6 Fat phase Palm oil 43 25 25 Rapeseed oil 75 75 Fat phase, total 83,2 78,4 Dimodan HP 0.2 Reaction mixture 5

Margarine obtained from the reaction mixture was rated as having good quality with good spreadability and good mouth feel without any extraneous taste. Margarine was comparable in quality to standard margarine prepared using distilled monoglyceride Dimodan HP.

The only difference observed was that margarine, protocol 3734 No. 2 with the reaction mixture was slightly harder, due to the fact that this formulation contained more palm oil than control margarine.

Example 19: The use of lipid acyltransferase in the preparation of bread

One of the limitations of the use of lipases in bakery is that free fatty acid is formed during the lipase reaction. It is well known that the formation of too much free fatty acid will have a negative effect on the behavior of flour in making bread, as gluten becomes too hard and forms an elastic (i.e. less elastic) dough that cannot expand during fermentation and baking .

The formation of free fatty acids should also be avoided in terms of oxidative stability, since free fatty acids are more prone to lipid oxidation than the corresponding triglycerides.

In the present invention, the problems of free fatty acid formation upon addition of a lipolytic enzyme to the dough were overcome by the use of lipid acyltransferase, which instead of producing free fatty acids transfers one or more fatty acids from the acyl lipid donor to the non-aqueous acceptor molecule present in the test, such like a carbohydrate, protein, or peptide, or, if used in bread with milk fat, sterol. Alternatively or in combination, other acceptors listed above, for example phytosterols or phytostanols, can be added to the dough. Preferably, the acceptor molecule in the test may be one or more of glucose, sucrose or maltose and / or other carbohydrates commonly available in the test.

In the following experiments, acyltransferase was tested in small-scale baking experiments. The resulting reaction products and lipid components in a fully spaced test were extracted with water saturated with butanol, and analyzed by HPLC and GLC

Materials and methods

Enzymes

Acyltransferase 550 PLU-7 / ml.

Lipopan ™ F BG, Industrial Lipase from Novozymes. 12000 LIPU / g or Grindamyl Exel 16; 12000 LIPU / g.

Lecithin powder, 95% phospholipid (available from Danisco A / S, Denmark).

Whole Wheat Digalacosyl Diglyceride (from Sigma D4651).

Flour: Sølvmel nr. 2001084 (Danish wheat flour obtained from Havnemøllerne, Odense, Denmark).

Mini baking test

Flour, 50 g, dry yeast 10 g, glucose 0.8 g, salt 0.8 g, 70 ppm ascorbic acid and 400 units of Brabender water were kneaded in 50 g of a Brabender kneading bowl for 5 min at 30 ° C.

The proofing time was 10 min at 34 ° C. The dough was weighed 15 g of each dough, then molded on a special device, where the dough was rolled between a wooden plate and a plexiglass frame. Samples of the dough were placed in molds for 45 minutes at 34 ° C and baked in a Voss home oven for 8 minutes at 225 ° C.

After baking, the loaves were cooled to room temperature and after 20 minutes the loaves were weighed and the volume was determined by rape seed displacement. Crispbread was also cut and graded on the crumb and crust.

Results and Conclusion

Preliminary results show that lipid acyltransferase clearly demonstrates a positive effect on both bread volume and bread appearance. In particular, preliminary results show that the use of lipid acyltransferase leads to an increase in the specific volume of bread compared to bread obtained with control (without enzyme) and obtained using a commercially available protolytic enzyme, namely Grindamyl Exel or Lipopan F ™.

Example 20: Standard ice cream with milk fat

The function of emulsifiers used in ice cream is to effect controlled crystallization of fat and mild destabilization as a result of protein desorption during ice cream aging. This change improves the quality of ice cream. Monoglycerides are usually used to make ice cream, but polar emulsifiers like polysorbates and sugar esters in combination with mono- and diglycerides are also known in ice cream production to help control fat destabilization and get ice cream with a very good creamy and uniform consistency.

The emulsifiers used in ice cream are usually added to the ice cream mix in powder form. Recently, however, it has been shown that mono-diglycerides can be produced by the enzymatic reaction of fat in lipase ice cream formulations. A problem for the use of lipases, however, is that lipases also catalyze the formation of free fatty acids when water is available in the reaction mixture.

However, it has been unexpectedly shown that lipid acyltransferase overcomes the limitations of lipase, since acyltransferase is able to transfer fatty acid from lecithin and other lipids to acceptor molecules like sterol, cholesterol, glucose, glycerin and proteins / peptides without the formation of a significant amount of free fatty acids.

One of the main ingredients of ice cream is milk cream containing 38% milk fat. Milk cream also contains less lecithin, which is a donor molecule for acyltransferase ("The milk lipid complex is about 1% of total milk fat and consists mainly of phospholipids," Ref. Ullman's Encyclopedia of Industrial Chemistry Copyright © 2003 by Wiley-VCH Verlag GmbH & Co. KGaA). Milk cream also contains a small amount of cholesterol, which is an acyltransferase acceptor molecule.

Thus, both monoglyceride and polar emulsifiers, such as lysolecithin and sugar ester, which are known to have a beneficial effect in the manufacture of ice cream, can be produced from the components of ice cream.

An additional beneficial effect of the acyltransferase reaction in milk cream is the formation of cholesterol ester, which can slow down the absorption of cholesterol in the intestine.

Ice cream recipe with emulsifier with enzyme Milk Cream, 38% 23.65 23.65 Skimmed milk 53.30 53.30 Skimmed milk powder 4.90 11.30 Sugar 12.00 12.00 Glucose Syrup, DE 42, 75% TS 4.25 4.25 Glycerol 1,0 1,0 Mixture of stabilizers 0.2 0.2 Cremodan SE 30 0.6 Lipid Acyltransferase, 500 PLU / g 0.1 Grinsted flavoring 2976 0.1 0.1 Dye + +

The process of making ice cream

1. Heat milk cream, glucose syrup and glycerin to about 40 ° C. Add acyltransferase and let the mixture react for 30 minutes. A sample was taken for analysis.

2. Heat all other liquid ingredients to approximately 40 ° C.

3. Add other dry ingredients (a mixture of stabilizers is mixed with sugar before adding).

4. When the dry ingredients dissolve, add a mixture of milk cream and glucose syrup.

5. Pasteurize at 80-85 ° C / 20-40 seconds.

6. Homogenize at 80 ° C (190 bar for recipe 1 and 175 bar for recipe 2).

7. Cool to an aging temperature of 4 ° C.

8. Freeze in a continuous freezer to the desired overrun (100% recommended).

9. Temper ice cream in a tunnel quenching apparatus at -40 ° C.

10. Store at temperatures below -25 ° C.

results

The use of acyltransferase in the manufacture of ice cream contributes to the production of ice cream with a very good taste and excellent delicate mouthfeel comparable to ice cream made using the Cremodan SE 30 industrial emulsifier. The melt of ice cream made with lipid acyltransferase has also been improved.

Example 21: Acyltransferase in Cheese

Cheese is a fresh or mature solid or semi-solid product obtained by coagulation of milk, skim milk, partially skim milk, cream, cheese cream, or buttermilk, or any combination of these materials through rennet or other suitable coagulating agents and partial drainage of whey, which is the result of such coagulation.

The yield of cheese depends primarily on the content of fat and protein in milk. Concentrations of salt (especially calcium salts) and protein, as well as acidity are very important for coagulation (Ref. Ullman's Encyclopedia of Industrial Chemistry Copyright © 2003 by Wiley-VCH Verlag GmbH & Co. KGaA).

Such an attempt was made in order to optimize and increase the yield of cheese by optimizing the cheese production procedure (USP 4959229) or by using the improved curing method (USP 2581240), which increased the amount of whey protein in the cottage cheese.

In the present invention, the amount of whey protein in the curd is increased by enzymatically modifying the whey protein by treating the milk during the preparation of the cheese with lipid acyltransferase.

When a fatty acid covalently binds to a non-membrane protein like β-lactoglobulin, the physical and functional properties change radically.

To prepare the cheese of the present invention, an acyltransferase is added to milk before or at the same time that the abomasum is added to the milk.

During the precipitation of casein, acyltransferase is able to use lecithin and other milk lipids as a donor, and peptides or protein as acceptor molecules during the formation of an acylated protein or acylated peptides.

Changes in the hydrophobic properties of milk protein result in increased protein precipitation in cottage cheese during the formation of cheese.

Since the increase in the yield of cheese obtained by the present invention originates from increased retention of protein in the cheese coagulum, which is usually lost with whey, a suitable method directly related to the mechanism of the invention is based on determining the amount of protein that remains in the whey. Less protein in whey inevitably means more protein in cottage cheese and a higher yield of cheese.

A test for the amount of protein in serum can be carried out in the following way. Skimmed or whole milk is heated to a temperature suitable for rennet coagulation, usually 30-35 ° C in a 100 ml glass. Optionally, 1% of loose lactic acid bacterial starter culture is added and standard abomasum is added in an amount corresponding to, for example, 0.03-0.05%. When the milk coagulated into a coagulum, hard enough to be able to cut into cubes in a lateral length of about 0.5 cm, such cutting was carried out with a sharp knife. Thus, syneresis was initiated and after 30 minutes of the exposure period, which allowed the cottage cheese to settle, a serum sample was taken and centrifuged in a laboratory centrifuge for 10 minutes. This sample was analyzed for protein content using, for example, the Kjeldahl method. Alternatively and / or in addition, the sample could be analyzed by methods that allow the type and amount of individual protein components to be determined.

Example 22: Analysis in a low-water environment

Transferase reactions of lipolytic enzymes in a low-water environment.

Procedure

Materials

Cholesterol Sigma cat. C 8503

L-alpha-phosphatidylcholine 95% (plant) Avanti # 441601.

Soybean Oil, Aarhus United, DK.

Chloroform, chd.

Enzymes

# 179, GCAT from A. salmonicida.

# 2427, phospholipase A1 from Fusarium oxysporum , LIPOPAN® F from Novozymes, Denmark.

# 1991, pancreatic phospholipase A2, LIPOMOD 22L from Biocatalysts, UK.

# 2373, Candida antarctica lipase, Novozyme 525 L from Novozymes, Denmark.

Enzyme tests

13.1% lecithin and 6.6% cholesterol were dissolved in soybean oil heated to 60 ° C with stirring.

The substrate was weighed into a 20 ml glass of Viton and heated to 46 ° C. Water and an enzyme solution were added and a stopwatch started.

At regular intervals, 50 mg of the sample was transferred to a 10 ml glass Dram and frozen. The isolated lipid was analyzed by GLC.

GLC analysis

GLC analysis was performed as described in example 11.

results

The experiment was carried out as shown in table 33.

A soybean oil based substrate containing 13.1% lecithin and 6.6% cholesterol was heated to 46 ° C. The enzyme solution was added and the stopwatch started. After 30, 60 and 120 minutes of reaction time, samples were taken for GLC analysis.

Table 33 one 2 3 four 5 Substrate g 5 5 5 5 5 Transferase # 179-C72, 56 PLU-7 / ml ml 0.3 # 2427, 200 PLU-7 / ml ml 0.3 Pancreas PLA 2 # 1991 6300 PLU / ml ml 0.3 Novozyme 525 L, # 2373, 200 LIPU / ml ml 0.3 Water ml 0.3 % water 6 6 6 6 6

The results of the GLC analysis are shown in table 34. The results are expressed as a percentage of the total sample composition. Based on the results of GLC, the amount of fatty acid and cholesterol ester produced by the enzymatic reaction can be calculated relative to the control sample without the addition of the enzyme. Under these experimental conditions, the total enzymatic activity was determined as hydrolytic activity for the formation of fatty acids and transferase activity, determined by the formation of cholesterol ester. From these results and information on the molecular weight of the fatty acid and cholesterol ester, the relative molar hydrolytic activity and the relative molar transferase activity can be calculated, which are shown in Table 35.

Table 34 Enzyme Reaction time, Fatty acid, Cholesterol, Cholesterol ester minutes % % % The control 120 0.533 7,094 0,000 # 179 thirty 0.770 5,761 2,229 # 179 60 0.852 5,369 2,883 # 179 120 0.876 4,900 3,667 # 2427 thirty 3,269 7,094 0,000 # 2427 60 3,420 7,094 0,000 # 2427 120 3,710 7,094 0,000 # 1991 thirty 2,871 7,094 0,000 # 1991 60 3,578 7,094 0,000 # 1991 120 3,928 7,094 0,000 # 2373 thirty 1,418 7,094 0,000 # 2373 60 1,421 7,094 0,000 # 2373 120 1,915 7,094 0,000

Table 35 Enzyme Reaction time, Fatty acid formation Cholesterol consumption Cholesterol ester formation Hydrolytic activity Transferase activity min % % # 179 thirty 0.238 1,334 2,229 twenty 80 # 179 60 0.319 1,725 2,883 21 79 # 179 120 0.343 2,195 3,667 eighteen 82 # 2427 thirty 2,737 0,000 0,000 one hundred 0 # 2427 60 2,887 0,000 0,000 one hundred 0 # 2427 120 3,177 0,000 0,000 one hundred 0 # 1991 thirty 2,338 0,000 0,000 one hundred 0 # 1991 60 3,046 0,000 0,000 one hundred 0 # 1991 120 3,395 0,000 0,000 one hundred 0 # 2373 thirty 0.885 0,000 0,000 one hundred 0 # 2373 60 0.888 0,000 0,000 one hundred 0 # 2373 120 1,383 0,000 0,000 one hundred 0

Conclusion

In these experiments, it was observed that all tested enzymes showed hydrolytic activity as the amount of fatty acid increased. However, the only enzyme that showed transferase activity was GCAT from A. salmonicida . Therefore, they came to the conclusion that in an oil system with lecithin and cholesterol containing 6% water, phospholipase A1 from Fusarium oxysporum , phospholipase A2 from the pancreas and lipase from Candida antarctica show only hydrolytic activity.

All publications mentioned in the above description are hereby incorporated by reference. Various modifications and variations of the described methods and systems of the present invention should be clear to specialists without deviating from the scope and spirit of the present invention. Although the present invention has been described in connection with specific preferred embodiments, it should be understood that the invention, as claimed in the claims, should not be unduly limited to such specific embodiments. Indeed, various modifications of the described methods of carrying out the invention, which are obvious to experts in biochemistry and biotechnology or related fields, are considered to be within the scope of the following claims.

Claims (24)

1. A method of producing an in situ emulsifier in a food product, wherein the method comprises the step of adding a lipid acyltransferase to the food product, wherein the lipid acyltransferase is characterized as an enzyme capable of transferring an acyl group from a lipid to one or more of acyl acceptors, and which includes a fragment of the GDSX amino acid sequence, where X represents one or more of the amino acid residues L, A, V, I, F, Y, H, Q, T, N, M, or S. 2. The method according to claim 1, where at least 2 emulsifiers are formed. 3. The method according to claim 1, where the emulsifier is formed without increasing or without significantly increasing the content of free fatty acids in the food product. 4. The method according to claim 1, where the acceptor of the acyl group is sterol, stanol, carbohydrate, protein or its subunit, glycerin. 5. The method according to claim 2, where at least one of the emulsifiers is a carbohydrate ester. 6. The method according to claim 2, where at least one of the emulsifiers is a protein ester. 7. The method according to claim 1, where one or more compounds from among the sterol ester, or stanol ester, or protein ester, or carbohydrate ester, or diglyceride, or monoglyceride are obtained in situ in a food product. 8. The method according to claim 7, where the sterol ester is one or more of the alpha-sitosterol ester, beta-sitosterol ester, stigmasterol ester, ergosterol ester, campesterol ester or cholesterol ester. 9. The method according to claim 7, where the stanol ether is one or more beta-sitostanol or ss-sitostanol ether compounds. 10. The method according to claim 1, where the lipid acyltransferase enzyme comprises H-309 or includes a histidine residue at the position corresponding to His-309 in the amino acid sequence of the aeromonas hydrophila lipolytic enzyme shown as SEQ ID No. 2 or SEQ ID No. 32. 11. The method according to claim 1, where the lipid acyltransferase can be obtained from an organism belonging to one or more of the following genera: Aeromonas, Streptomyces, Saccharomyces, Lactococcus, Mycobacterium, Streptococcus, Lactobacillus, Desulfitobacterium, Bacillus, Campylobella , Sulfolobus, Aspergillus, Schizosaccharomyces, Listeria, Neisseria, Mezorhizobium, Ralstonia, Xanthomonas and Candida. 12. The method according to claim 1, where the lipid acyltransferase includes one or more of the following amino acid sequences:
(i) amino acid sequence of SEQ ID No. 2;
(ii) the amino acid sequence of SEQ ID No. 3;
(iii) the amino acid sequence of SEQ ID No. four;
(iv) amino acid sequence of SEQ ID No. 5;
(v) amino acid sequence of SEQ ID No. 6;
(vi) amino acid sequence of SEQ ID No. 12;
(vii) amino acid sequence of SEQ ID No. twenty;
(viii) amino acid sequence of SEQ ID No. 22;
(ix) amino acid sequence of SEQ ID No. 24;
(x) amino acid sequence of SEQ ID No. 26;
(xi) amino acid sequence of SEQ ID No. 28;
(xii) amino acid sequence of SEQ ID No. thirty;
(xiii) amino acid sequence of SEQ ID No. 32;
(xiv) amino acid sequence of SEQ ID No. 34;
or an amino acid sequence that has 75% or more identity with any of the sequences shown as SEQ ID No. 2; SEQ ID No. 3; SEQ ID No. four; SEQ ID No. 5; SEQ ID No. 6; SEQ ID No. 12; SEQ ID No. twenty; SEQ ID No. 22; SEQ ID No. 24; SEQ ID No. 26; SEQ ID No. 28; SEQ ID No. thirty; SEQ ID No. 32; or SEQ ID No. 34. 13. The method according to claim 1, where the emulsifier is one or more of the following compounds: monoglyceride, lysophosphatidylcholine, DGMG. 14. The use of lipid acyltransferase to obtain a food product from an edible material, including an emulsifier, where the emulsifier is obtained without or without a significant increase in the content of free fatty acids in the food product, and where the emulsifier is formed from constituents of the edible material by means of lipid acyltransferase, where the lipid acyltransferase is characterized as an enzyme capable of transferring an acyl group from a lipid to one or more of the following acceptors of an acyl group and including a fragment of a amino atelnosti GDSX, wherein X is one or more of the amino acid residues L, A, V, I, F, Y, H, Q, T, N, M or S. 15. The use of claim 14, wherein at least two emulsifiers are formed. 16. The application of clause 15, where at least one of the emulsifiers is a carbohydrate ester. 17. The application of clause 15, where at least one of the emulsifiers is a protein ester. 18. The use of claim 14, wherein one or more of the sterol ester or stanol ester, or protein ester, or carbohydrate ester, or diglyceride, or monoglyceride is also obtained in situ in a food product. 19. The use according to claim 18, wherein the sterol ester is one or more alpha-sitosterol ester, beta-sitosterol ester, stigmasterol ester, ergosterol ester, campesterol ester or cholesterol ester. 20. The application of claim 18, wherein the stanol ester is one or more beta-sitostanol or ss-sitostanol ester compounds. 21. The use of claim 14, wherein the lipid acyltransferase enzyme comprises H-309 or includes a histidine residue at the position corresponding to His-309 in the amino acid sequence of the Aeromonas hydrophila lipolytic enzyme shown as SEQ ID No. 2 or SEQ ID No. 32. 22. The application of clause 14, where the lipid acyltransferase can be obtained from an organism belonging to one or more of the following genera: Aeromonas, Streptomyces, Saccharomyces, Lactococcus, Mycobactrium, Streptococcus, Lactobacillus, Desulfitobacterium, Bacillus, Campylobella , Sulfolobus, Aspergillus, Schizosaccharomyces, Listeria, Neisseria, Mezorhizobium, Ralstonia, Xanthomonas and Candida. 23. The application of clause 15, where the lipid acyltransferase includes one or more of the following amino acid sequences:
(i) amino acid sequence of SEQ ID No. 2;
(ii) the amino acid sequence of SEQ ID No. 3;
(iii) the amino acid sequence of SEQ ID No. four;
(iv) amino acid sequence of SEQ ID No. 5;
(v) amino acid sequence of SEQ ID No. 6;
(vi) amino acid sequence of SEQ ID No. 12;
(vii) amino acid sequence of SEQ ID No. twenty;
(viii) amino acid sequence of SEQ ID No. 22;
(ix) amino acid sequence of SEQ ID No. 24;
(x) amino acid sequence of SEQ ID No. 26;
(xi) amino acid sequence of SEQ ID No. 28;
(xii) amino acid sequence of SEQ ID No. thirty;
(xiii) amino acid sequence of SEQ ID No. 32;
(xiv) amino acid sequence of SEQ ID No. 34;
or an amino acid sequence that has 75% or more identity with any of the sequences shown as SEQ ID No. 2; SEQ ID No. 3; SEQ ID No. four; SEQ ID No. 5; SEQ ID No. 6; SEQ ID No. 12; SEQ ID No. twenty; SEQ ID No. 22; SEQ ID No. 24; SEQ ID No. 26; SEQ ID No. 28; SEQ ID No. thirty; SEQ ID No. 32; or SEQ ID No. 34. 24. The use of claim 14, wherein the emulsifier is one or more of the following compounds: monoglyceride, lysophosphatidylcholine, DGMG.

Images