RU2350650C2 - RECOMBINANT PLASMIDE DNA pVar15-HIV-LTR, CARRYING CLONED FRAGMENT GENOME HIV OF 1 TYPE FROM CONSERVATIVE SITE OF 5-LTR SEQUENCE, RECOMBINANT PLASMIDE DNA pBluKSM-HIV-LTR mod CARRYING CLONED MODIFIED FRAGMENT OF SAME SITE GENOME HIV OF 1 TYPE, TEST SET FOR QUANTITATIVE EXPRESS IDENTIFICATION OF GENOME HIV-1 OF ANY TYPE IN ASSAY AND METHOD WITH ITS USE - Google Patents

Abstract

FIELD: medicine; molecular biology.

SUBSTANCE: invention concerns molecular biology, genetic engineering and can be used in medicine. Quantitative express identification of the HIV-1 genome in assay is detected with the help of oligonucleotide primers, complementary to a conservative site 5'-LtR-part of the HIV-1 genome, fluorescently marked probes and the RNA-modified fragment of a conservative site of 5'LTR area of the HIV-1 genome as the internal quantitative standard. The analysis is performed in real time in "the closed test tube" format by means of the calibration curves received with the help plasmides pVarl5-HIV-LTR and pBluSK-HIV-LTR mod, containing the native and modified kdnk-fragment virus genome from conservative 5'-LTR-pocledovatelnocti accordingly. Plasmide pVar15-HTV-LTR it is received on the basis of the pVar15 plasmides. The pBluSK-HIV-LTR mod plasmides is received on the basis of pBluKSM plasmide.

EFFECT: possibility of determination of HIV-1 presence in assay irrespective of type of a virus, a combination of types and presence of related kinds.

4 cl, 10 dwg, 9 ex

Description

The invention relates to molecular biology, genetic engineering, medicine, and is intended for rapid diagnosis of any type of HIV-1 in a biological sample. The proposed test kit and method using it allows you to quantify directly the genome of the HIV-1 virus and is based on real-time one-step polymerase chain reaction (PCR) using oligonucleotide primers -5 '-' GCTTGCCTTGAGTGCTT-3 'and 5'-CGCCACTGCTAGAGTT -3 ', complementary to the conserved region of the 5'-LTR region of the HIV-1 genome, detection of the resulting amplicons using labeled hybridization probes - I and II - oligonucleotides with sequences 5'-6-FAM-AGTACTCTGTCCGCGTCTGTTGTA-BHQ1-3' and 5 ' -TAMRA-AGTACTCTGTCCGCGTCTGTTGTA-BHQ2-3 ', with e The volume analysis is carried out by measuring the fluorescence of the sample in real time in the “closed tube” format. To calculate the amount of HIV-1 RNA in the analyzed sample, calibration curves are used to determine HIV-1 cDNA and mutated HIV-1 cDNA obtained using DNA plasmid pVar15-HIV-LTR carrying the cloned fragment of the HIV-1 genome from the 5 'conserved region -LTR sequences having a nucleotide sequence

5'-CGCGGATCCCTCAATAAAGCTTGCCTTGAGTGCTTTAAGTAGTGTGTGCCCGTCTGTTGTATGACTCTGGTAACTAGAGATCCCTCAGACCACTCTAGACGGTGTAAAAAATCTCTAGCAGTGGCGCCGCG 1GT - 1 IDT

and using the DNA of the plasmid pBluSK-HIV-LTR mod used to construct a calibration curve for determining the amount of internal standard carrying the cloned modified fragment of the HIV-1 genome from a conserved region of the 5'-LTR sequence having a nucleotide sequence

5'-ATGCTCAATAAAGCTTGCCTTGAGTGCTTTAAGTACTCTGTCCGCGTCTCTTGTATGACTCTGGTAACTAGAGATCCCTCAGACCACTCTAGACGGTGTAAAAAATCTCTAGCAGTGGCGCCC-3 ', hereinafter - SEQ. As an internal RNA standard, an RNA-modified fragment of a conserved region of the 5'-LTR region of the HIV-1 genome is used, having a nucleotide sequence

5'-AUGCUCAAUAAAGCUUGCCUUGAGUGCUUUAAGUACUCUGUCCGCGUCUCUUGUAUGACUCUGGUAACUAGAGAUCCCUCAGACCACUCUAGACGGUGUAAAAAAUCUCUAGCAGUGGCGCCC-3 ', hereinafter - SEQ ID: 3.

Using the proposed kit and method allows a specific determination of the presence of HIV-1 in the sample, regardless of the type of virus, combination of types and the presence of related species, without resorting to the use of additional methods of post-amplification analysis, which reduces the time and cost of testing. At the same time, testing is carried out in the "closed tube" mode, thereby significantly reducing the risk of possible false-positive analysis results.

The most commonly used diagnosis of HIV is based on the detection of a serological response to the virus. Various types of enzyme-linked immunosorbent assay (ELISA) are used [1, 2], based on the detection of antibodies to viral proteins, followed by confirmation of the diagnosis using immune blotting. The ELISA test is relatively cheap, very sensitive and easy to use. It can be used to scan a large number of blood samples. However, there is evidence of a group of infected people who remain seronegative for 2–36 months. To identify this category of patients, a different way of detecting the virus is needed. It is most rational to directly determine the virus genome itself.

Currently, there are several methods that can be used to determine RNA or HIV-1 cDNA derived from it.

One of them, the Quantiplex HIV-1 RNA method (Chiron Diagnostics, Norwood, MA), uses branched DNA (bDNA) and allows to quantify the content of HIV-1 RNA in blood plasma due to amplification of the signal, rather than the target nucleic acid [3] . The method based on bDNA does not require purification of viral RNA or its amplification by PCR. Viral particles are concentrated by centrifugation and then destroyed by detergent and proteinase K, which leads to the release of viral RNA. The resulting lysate is then incubated with two sets of oligonucleotides. The first set of oligonucleotides is necessary for immobilization of viral RNA due to hybridization with conserved regions of the HIV-1 pol gene and with oligonucleotides that are connected to the wells of microtiter plates. The second set of oligonucleotides provides amplification of the signal. This kit consists of four components: (a) oligonucleotides having homology with target RNA and with "preamplification" oligonucleotides; (b) preamplification oligonucleotides; (c) amplification oligonucleotides; and (d) oligonucleotide probes associated with alkaline phosphatase. Each of these components binds as a result of hybridization, followed by several sites. In this way, the signal is amplified without copying the target RNA. Detection is carried out using a chemiluminescence method with a substrate specific for alkaline phosphatase. The amount of light emitted is directly proportional to the amount of nucleic acid bound. The absolute content of HIV-1 RNA is determined using a standard curve (using an external standard), which is based on data obtained on the same tablet.

The disadvantages of determining using the bDNA method are the lack of an internal quantitative standard for each sample and the need for relatively large volumes of the sample (at least 1 ml of blood plasma), which can cause problems with a limited sample volume, for example, when analyzing material from small children .

Organon Teknika [4] developed a quantitative test based on the use of NASBA methodology [5]. This technology allows the selective and direct amplification of HIV-1 RNA without the use of PCR. First of all, using primers, one of which is complementary to viral RNA in the region of the gag gene and contains a promoter of T7 phage RNA polymerase, according to the method, cDNA is synthesized from viral RNA, then RNA is transcribed from the obtained cDNA with synthesis of 10 ⁶ -10 ⁹ copies of it. The amount of nucleic acid is determined by enzymatic or chemiluminescent methods, which are characterized by very high sensitivity and a wide dynamic range. Quantification of the HIV-1 viral load is achieved by using the joint amplification of three internal quantitative RNA standards.

The advantages of quantifying HIV-1 using this method are that a relatively small volume of plasma is required (0.1 ml is usually used). The dynamic range of the method is very large (80-1000000 copies of RNA / ml).

The main disadvantage of this test is the complex system of internal quantitative standards, the need to use an expensive instrument base.

The AMPLICOR HIV-1 MONITOR method developed by Roche Diagnostics Corporation [6, prototype] is the only FDA-approved test for the quantification of HIV-1 RNA [7]. It is based on reverse transcription of HIV-1 RNA (target) and amplification of the resulting cDNA in the presence of biotinylated oligonucleotide primers specific for the conserved HIV-1 gag region. The resulting amplicons are denatured and hybridized with oligonucleotides immobilized on the surface of the microtiter plate wells. Then add the conjugate of avidin with horseradish peroxidase, which binds to amplicons labeled with biotin. The number of coupled amplicons is determined by measuring the products of the enzymatic reaction. The test uses an internal quantitative standard with a known concentration, which is added to each sample before extraction. The quantitative standard consists of RNA transcribed in vitro and identical in size to the target amplicon.

Despite the declared sensitivity of 96% and specificity of 100%, testing showed that this system allows the detection of 87% of isolates of subspecies A, 67% of isolates of subspecies B, 66% of isolates of subspecies E, 88% of isolates of subspecies F. Moreover, the actual sensitivity of the method when testing clinical samples, it turned out to be 51%. This is due to the selection of an insufficiently conservative fragment of the HIV-1 virus genome.

The disadvantage of the prototype is also the test in the format of an "open tube". To identify the genome of the virus and its quantification, the resulting amplicons are transferred to open plates. At the same time, there is pollution of the premises and the occurrence of false positive results of the analysis.

An object of the invention is the creation of a kit for one-step quantitative rapid identification of HIV-1 of any type in a biological sample using real-time PCR analysis without post-amplification analysis in the closed tube format, which will drastically reduce the possibility of false-positive analysis results .

To solve this problem, we used a methodology based on the use of the 5'-exonuclease activity of Taq polymerase when building the oligonucleotide chain [8]. The hybridization probe contains a fluorescent label at the 5'-position and a fluorescence quencher at the 3'-position of the oligonucleotide. During PCR, the probe binds to a complementary DNA strand. As the chain grows, Taq polymerase cleaves the probe, which leads to an increase in fluorescence. This allows you to identify viral material directly during amplification, without resorting to the use of additional stages of post-amplification analysis, which greatly simplifies the test and eliminates the possibility of false-positive analysis results due to contamination of the premises with amplicons of previous tests.

To quantify the content of HIV-1 RNA, an internal standard is used, which is the RNA of the modified LTR region of the virus and designed to control the reverse transcription (RT) and PCR reactions, as well as to calculate the exact concentration of the virus in the original sample.

To create a test kit and a method for specific universal PCR detection of HIV-1 in a biological sample, a computer analysis of the genomes of all known HIV-1 isolates was performed. As a result, a conserved region in the 5'-LTR region of the genome with a length of about 200 nucleotides was identified. The use of this region for diagnosis allows a specific determination in the sample of the presence of HIV, regardless of type (O or M), a combination of types and the presence of related species.

The test kit for quantitative rapid identification of any type of HIV-1 genome in a sample contains the following components:

1. Designed amplification primer to the conserved region of the 5'-LTR region of the HIV-1 genome (533-549 HIVHXB2, GenBank, sample KO3455) of 17 nucleotides

5'-GCTTGCCTTGAGTGCTT-3 '.

2. Designed amplification primer to a conserved region of the 5'-LTR region of the HIV-1 genome (623-640) of 18 nucleotides 5'-CGCCACTGCTAGAGATTT-3 '.

3. Designed hybridization probe I, complementary to the site of the HIV-1 genome (552-575), located between the primers, and at the 5'-end of the fluorescent label in the form of FAM fluorescein, and at the 3'-end of the fluorescence quencher - non-radiating compound BHQ1:

5'-FAM-AGTAGTGTGTGCCCGTCTGTTGTA-BHQ1-3 '.

4. Designed hybridization probe II to determine the internal standard, containing TAMRA fluorescent dye at the 5'-end and BHQ2 fluorescence quencher at the 3'-end:

5'-TAMRA-AGTACTCTGTCCGCGTCTGTTGTA-BHQ2-3 '.

5. The cloned fragment of the HIV-1 virus genome containing the conserved region of the left 5'-LTR to determine the specificity of the hybridization probe I to the target sequence of the HIV-1 genome and to construct a calibration curve in the form of recombinant plasmid DNA pVar15-HIV-LTR of size 4583 p. n and a molecular weight of 3 Mda, containing:

- k-DNA fragment of the conserved 5'-LTR region of 138 bp, having the nucleotide sequence of SEQ ID NO: 1, flanked by recognition sites of restriction endonucleases BamHI and EcoRI;

- BamHI-EcoRI fragment of the vector plasmid pVar15 [9] with a size of 4445 bp,

- genetic marker: β-lactamase gene (Amp ^r ), which determines ampicillin resistance;

- unique restriction sites: BamHI (2) and EcoRI (128) (see figure 1).

6. The cloned fragment of the HIV-1 virus genome containing the modified 5'-LTR conserved region (a start codon and five nucleotide substitutions were introduced to prevent premature termination of RNA polymerase) to determine the specificity of the hybridization probe II to the cDNA sequence of the RNA control and to construct a calibration a curve in the form of a recombinant plasmid DNA pBluKSM-HIV-LTR mod size 3063 bp and a molecular weight of 2 Mda, containing:

- cDNA - a modified fragment of the conserved region 5'-LTR of 123 bp, having the transcribed nucleotide sequence of SEQ ID NO: 2, flanked by recognition sites of restriction endonucleases BamHI and EcoRI, and under the control of the T7 promoter;

- BamHI-EcoRI fragment of the vector plasmid pBluKSM (pBluescript KS (-) from Stratagene) 2940 bp in size, including the following functional areas: beta-lactamase alpha-peptide gene (lacZ ') - 460-816; the initiation site of the T7 polymerase promoter - 643; ampicillin resistance gene (bla) - 1976-2833;

- unique restriction sites: BamHI (690) and EcoRI (819), through which the fragment can be extracted without loss (see figure 2).

7. RNA - a modified fragment of the conserved region 5'-LTR size 123 bp (internal RNA standard) having the nucleotide sequence of SEQ ID NO: 3.

Hybridization probes I and II are designed in such a way that they reveal only their target sequences. Hybridization probe I detects HIV-1 virus cDNA, but does not detect internal standard cDNA. Hybridization probe II detects the cDNA of the internal standard of the HIV-1 virus, but does not detect cDNA of the HIV-1 virus. Such properties of hybridization probes, along with the known initial concentration of the internal RNA standard, allow one to calculate the concentration of HIV-1 virus in a test sample.

The procedure for quantifying HIV-1 RNA in a clinical sample includes:

1. Isolation of total RNA.

2. Obtaining cDNA from HIV-1 RNA using specific primers. To assess the degree of conversion of the original HIV-1 RNA into a clinical sample, a known amount (500 copies) of the mutated HIV-1 RNA of 5'-ATGCTCAATAAAGCTTGCCTTGAGTGCTTTAAGTACTCTGTCCGCGTCTCTTGTATGACTCTGGTACGTAGCAGTAGCAGTAGCAGTAGCAGTAGCAGTAGCAGTAGCAGTAGA.

At this stage, cDNA synthesis occurs from both HIV-1 RNA and mutated HIV-1 RNA.

3. Construction of calibration curves for determining the amount of HIV-1 cDNA (calibration curve 1) and determining the amount of mutated HIV-1 cDNA (calibration curve 2).

To build the first calibration curve using a hybridization probe I and a series of serial dilutions of the plasmid pVar15-HIV-LTR.

To build the second calibration curve using a hybridization probe II and a series of serial dilutions of the plasmid pBluSK-HIV-LTR mod.

4. Calculation of the content of HIV-1 cDNA and mutated HIV-1 cDNA in the sample based on calibration curves.

5. Recalculation of the content of HIV-1 RNA in a clinical sample, taking into account the non-quantitative formation of cDNA according to the formula:

where N ₁ is the amount of HIV-1 cDNA calculated from the calibration curve 1,

where N ₂ is the amount of mutated HIV-1 cDNA calculated from calibration curve 2.

The main advantages of the proposed method are:

- high reliability based on the analysis of a highly conserved region of the HIV-1 genome;

- the speed of the analysis, since the PCR format is used in real time, which does not require additional post-amplification analysis operations;

- analysis in the format of a “closed tube”, which significantly reduces the risk of contamination and technological errors.

The invention is illustrated by the following graphic materials.

Figure 1. Scheme of the plasmid pVar15-HIV-LTR.

Figure 2. Scheme of the plasmid pBluKSM-HIV-LTR mod.

Figure 3 Determination of the specificity of the hybridization probe I.

1 - plasmid pVar15-HIV-LTR;

2 - Control plasmid pBluSK-HIV-LTR mod with replacements;

K - amplification control without a matrix.

Figure 4. Determination of the specificity of the hybridization probe II.

1 - Control plasmid pBluSK-HIV-LTR mod;

2 - plasmid pVar15-HIV-LTR;

K - amplification control without a matrix.

Figure 5. Construction of a calibration curve for determining the amount of viral cDNA

A. Amplification with a different amount of matrix. Plasmid pVar15-HIV-LTR (copies / reaction), where: 1 - 10 ² ; 2-10 ³ ; 3-10 ⁴ ; 4 - 10 ⁵ .

B. Calibration curve of the threshold amplification cycle versus pVar15-HIV-LTR DNA amount.

6. Construction of a calibration curve for determining the amount of mutated pVar15-HIV-LTR.

A. Amplification with a different amount of matrix. Plasmid pBluSK-HIV-LTR mod (copies / reaction), where: 1 - 10 ² ; 2-10 ³ ; 3-10 ⁴ ; 4 - 10 ⁵ .

B. Calibration curve of the dependence of the threshold amplification cycle on the amount of DNA pBluSK-HIV-LTR mod.

7. Determination of the content of viral cDNA.

A. Amplification with varying amounts of standard. Plasmid pBluSK-HIV-LTR mod (copies / reaction), where: 1 - 10 ³ ; 2-10 ⁴ ; 3-10 ⁵ ; H - curve of amplification of viral cDNA of the analyzed sample.

B. Calculation of the amount of viral cDNA content.

Fig. 8. Determination of the content of mutated viral cDNA.

A. Amplification with varying amounts of standard. Plasmid pBluSK-HIV-LTR mod (copies / reaction), where: 1 - 10 ³ ; 2-10 ⁴ ; 3-10 ⁵ ; H is the amplification curve of the mutated viral cDNA of the analyzed sample.

B. Calculation of the amount of content of mutated viral cDNA.

For a better understanding of the invention, the following are examples of its specific implementation.

Example 1. Obtaining plasmids pVar15-HIV-LTR.

When constructing the plasmid pVar15-HIV-LTR, synthetic oligonucleotides of the following composition are used for amplification:

5'-CCGGAATTCGGGCGCCACTGCTAGAGATTTTTTACAC-3 '

5'-CGCGGATCCCTCAATAAAGCTTGCCTTGAGTGCTTTAAGT-3 '

5'-TTGAGTGCTTTAAGTAGTGTGTGCCCGTCTGTTGTATGAC-3 '

5'-CGTCTGTTGTATGACTCTGGTAACTAGAGATCCCTCAGAC-3 '

5'-AGAGATCCCTCAGACCACTCTAGACGGTGTAAAAAATCTC-3 '

5'-CCGGAATTCGGGCGCCACTGCTAGAGATTTTTTACAC-3 '

Amplification is carried out in 50 μl of a reaction mixture containing: 200 μM dNTP, 40 rM of each of the oligonucleotides, 1 unit. Taq and Vent DNA polymerases, 67 mM tris-HCl, 16.6 mM (NH ₄ ) ₂ SO ₄ , 0.01% Tween 20, 3 mM MgCl ₂ .

The PCR conditions are as follows: denaturation - 95 ° С - 600 sec, annealing - 58 ° С - 60 sec, then 35-39 cycles according to the scheme: denaturation - 93 ° С - 45 sec, annealing 55 ° С - 60 sec, elongation at 72 ° C - 10 sec. A total of 25 cycles of amplification.

After amplification, the obtained DNA duplexes are isolated, then they are sequentially treated with Wat HI and Eco RI restriction endonucleases, low molecular weight fragments are separated and cloned in the plasmid pVar15 [9] at the obtained sticky ends. The competent E.Coli XL-Blue cells are transformed with a ligase mixture. The latter are plated on an ampicillin selective agar medium. The resulting colonies are analyzed using PCR and restriction analysis using restriction enzyme HindIII. The DNA of clones having theoretical restriction and PCR analysis patterns is sequenced. Sequencing performed showed complete agreement between the resulting cloned fragment of the theoretical sequence of left LTR HIV-1. Scheme of the plasmid pVar15-HIV-LTR is shown in Fig 1.

Example 2. Obtaining the plasmid pBluSK-HIV-LTR mod.

When constructing the plasmid pBluSK-HIV-LTR mod for the amplification, synthetic oligonucleotides of the following composition are used:

5'-TTGAGTGCTTTAAGTACTCTGTCCGCGTCTCTTGTATGAC-3 '

5'-CGCGGATCCATGCTCAATAAAGCTTGCCTTGAGTGCTTTAAGT-3 '

5'-TTGAGTGCTTTAAGTAGTGTGTGCCCGTCTGTTGTATGAC-3 '

5'-CGTCTGTTGTATGACTCTGGTAACTAGAGATCCCTCAGAC-3 '

5'-AGAGATCCCTCAGACCACTCTAGACGGTGTAAAAAATCTC-3 '

5'-CCGGAATTCGGGCGCCACTGCTAGAGATTTTTTACAC-3 '

Amplification is carried out in 50 μl of a reaction mixture containing: 200 μM dNTP, 40 rM of each of the oligonucleotides, 1 unit. Taq and Vent DNA polymerases, 67 mM tris-HCl, 16.6 mM (NH ₄ ) ₂ SO ₄ , 0.01% Tween 20, 3 mM MgCl ₂ .

The PCR conditions are as follows: denaturation - 95 ° С - 600 sec, annealing - 58 ° С - 60 sec, then 35-39 cycles according to the scheme: denaturation - 93 ° С - 45 sec, annealing 55 ° С - 60 sec, elongation at 72 ° C - 10 sec. A total of 25 cycles of amplification. After amplification, the obtained DNA duplexes are isolated, then they are sequentially treated with Bam HI and Eco RI restriction endonucleases, low molecular weight fragments are separated and cloned into pBluscriptKSM at the obtained sticky ends. Ligase mixture transform competent E. coli XL-Blue cells. The latter are plated on an ampicillin selective agar medium. The resulting colonies are analyzed using PCR and restriction analysis using restriction enzyme HindIII. The DNA of the clones having theoretical pictures of restriction and PNR analysis was sequenced. Sequencing performed showed complete correspondence of the obtained cloned fragment of the constructed sequence of left LTR HIV-1. Scheme of the plasmid pBluKSM-HIV-LTR mod shown in Fig 2.

Example 3. Obtaining mutated RNA of HIV-1.

10 pg of pBluSK-HIV-LTR mod DNA is hydrolyzed with Eco RI restriction endonuclease. The obtained linear form of the plasmid is used to obtain mutated HIV-1 RNA using T7 RNA polymerase.

Transcription is carried out in 20 μl of the reaction mixture containing 0.4 mM rNTP, 10 0.4 mM DTT, 3 units. T7 RNA polymerase in a buffer containing 2 mM spermidine, 16 mM MgCl ₂ , 0.2 M Tris (pH 8.1) for 2 hours at 37 ° C. Then, the resulting RNA was purified by phenol-chloroform extraction and precipitated with 0.3 M sodium acetate at pH 5.2 and 2.5 volumes of absolute ethanol at -70 ° C. Additionally, RNA was purified by TSK gel chromatography. The exact amount of RNA obtained is determined spectrophotometrically.

Example 4. Determination of the specificity of the hybridization probe I.

The specificity of the hybridization probe I to the target sequence of the HIV-1 genome is determined using a cloned virus fragment containing the conserved 5'-LTR region (plasmid DNA pVar15-HIV-LTR) having the nucleotide sequence of SEQ ID NO: 1.

Amplification is carried out in 50 μl of a reaction mixture containing: 200 μM dNTP, 600 nM, primers I and II, 300 nM hybridization probe I, 5 units. Hot-rescue DNA polymerase, 67 mM tris-HCl, 16.6 mM (NH ₄ ) ₂ SO ₄ , 0.01% Tween 20, 3 mM MgCl ₂ . The content of the matrix for amplification varies in the range of 0.1-100 pcg.

The PCR conditions are as follows: denaturation - 95 ° С - 600 sec, annealing - 58 ° С - 60 sec, then 35-39 cycles according to the scheme: denaturation - 95 ° С - 15 sec, annealing 58 ° С - 60 sec. The measurement of fluorescence intensity is carried out at annealing temperature. The amplification results are shown in figure 3

Under similar conditions, pBluSK-HIV-LTR mod DNA is amplified containing a DNA sequence (0.1-100 pg) corresponding to the RNA control sequence. Under PCR conditions, amplification of pBluSK-HIV-LTR mod does not occur (Fig. 3).

Similarly, fluorescent signal does not accumulate during PCR in the absence of DNA.

Thus, the hybridization probe I is selective for detecting the target sequence of the conserved region of the HIV-1 genome.

Example 5. Determination of the specificity of the hybridization probe II.

The specificity of the hybridization probe II to the cDNA sequence of the RNA control is determined using the cloned fragment contained in the plasmid pBluSK-HIV-LTR mod and having the composition SEQ ID NO: 2.

Amplification is carried out in 50 μl of a reaction mixture containing: 200 μM dNTP, 600 nM, primers I and II, 300 nM hybridization probe II, 5 units. Hot-rescue DNA polymerase, 67 mM tris-HCl, 16.6 mM (NH ₄ ) ₂ SO ₄ , 0.01% Tween 20, 3 mM MgCl ₂ . The content of the matrix for amplification varies in the range of 0.1-100 pcg.

The PCR conditions are as follows: denaturation - 95 ° С - 600 sec, annealing - 58 ° С - 60 sec, then 35-39 cycles according to the scheme: denaturation - 95 ° С - 15 sec, annealing 58 ° С - 60 sec. The measurement of fluorescence intensity is carried out at annealing temperature. The amplification results are shown in figure 4

Under similar conditions, DNA amplification (0.1-100 pg) of pVar15-HIV-LTR containing the sequence of the cloned 5'-LTR fragment of the virus is performed. Under PCR conditions, amplification of pVar15-HIV-LTR does not occur (FIG. 4).

Similarly, fluorescent signal does not accumulate during PCR in the absence of DNA.

Thus, the hybridization probe II is selective for the detection of cDNA RNA control.

Example 6. The selection of the sample for analysis.

RNA isolation.

In a 1.5 ml test tube in an ice bath, 200 μl of a solution of guanidine thiocyanate and 4 μl of an RNA carrier are added. Then, 200 μl of the test material is added to the solution, the tube on the Vortex is shaken for 10-15 seconds and left in the cold for 10 minutes. Then 200 μl of a mixture of phenol-chloroform (pH 4.3) -isoamyl alcohol (v / v 25: 25: 1) was added and shaken for 1 min. To form a dense interphase, tubes are frozen in liquid nitrogen. After thawing, the sample is centrifuged for 5 min at 10-12 thousand rpm, the upper aqueous phase is taken and 1/10 part of 2M sodium acetate (pH 4.5) is added, an equal volume of isopril alcohol, stirred and left in the freezer overnight. RNA precipitated by centrifugation for 5 min at 10-12 thousand rpm The supernatant is removed with a pipette, 600 μl of 75% ethanol (pre-cooled in the freezer) is added to the pellet, centrifuged again, the supernatant is removed, the RNA pellet is dried in vacuo and dissolved in 20-30 μl of DEPK-treated water. Obtaining cDNA.

0.5 μg of the reverse primer is added to 15 μl of the RNA sample solution, heated for 5 minutes at 70 ° C and placed in an ice bath, kept for 5 minutes. Drops precipitate, add the components of the reaction mixture — 5 μl of 5xM-MLV buffer (250 mM Tris-HCl, 375 mM KCl, 15 mM MgCl ₂ , 50 mM DTT), 1.25 μl 10 mM dNTP, 25 units. ribonuclease inhibitor, 200 units M-MLV RT and water to a volume of 25 μl, incubated for 90 min at 42 ° C.

To quantify the content of HIV-1 RNA in the analyzed sample at the stage of cDNA production, 500 copies of mutated HIV-1 RNA composition are added to the reaction mixture

5'-ATGCTCAATAAAGCTTGCCTTGAGTGCTTTAAGTACTCTGTCCGCGTCTCTTGTATGACTCTGGTAACTAGAGATCCCTCAGACCACTCTAGACGGTGTAAAAAATCTCTAGCAGTGGCGCCC-3 ''.

Example 7. Construction of a calibration curve for determining the amount of HIV-1 cDNA.

To build the calibration curve using a hybridization probe I and a series of serial dilutions of the plasmid pVar15-HIV-LTR from 10 ² to 10 ⁵ copies. Amplification is carried out in 50 μl of a reaction mixture containing: 200 μM dNTP, 600 nM primers I and II, 300 nM hybridization probe I, 5 units. Hot-rescue DNA polymerase, 67 mM tris-HCl, 16.6 mM (NH ₄ ) ₂ SO ₄ , 0.01% Tween 20, 3 mM MgCl ₂ , 10 ² -10 ⁵ copies of the control plasmid pVar15-HIV-LTR .

PCR conditions: denaturation - 95 ° С - 10 min, annealing - 58 ° С - 60 sec, then 40 cycles according to the scheme: denaturation - 95 ° С - 15 sec, annealing 58 ° С - 60 sec. The measurement of fluorescence intensity is carried out at the annealing stage. The amplification results are shown in figure 5.

The calibration curve in the coordinates C (T) - log P is built automatically by the iCycler instrument program.

With _T is the value of the threshold cycle, which determines the point at which the fluorescence level exceeds 10 times the standard deviation detected in the first amplification cycles; P is the concentration of DNA standard.

Example 8. Construction of a calibration curve to determine the amount of mutated HIV-1 cDNA.

To build a calibration curve using a hybridization probe II and a series of serial dilutions of the plasmid pBluSK-HIV-LTR mod from 10 ² to 10 ⁵ copies.

Amplification is carried out in 50 μl of a reaction mixture containing: 200 μM dNTP, 600 nM primers I and II, 300 nM hybridization probe II, 5 units. Hot-rescue DNA polymerase, 67 mM tris-HCl, 16.6 mM (NH ₄ ) ₂ SO ₄ , 0.01% Tween 20, 3 mM MgCl ₂ 10 ² -10 ⁵ copies of the control plasmid pBluSK-HIV-LTR mod .

Conditions for PCR: denaturation - 95 ° С - 10 min, annealing - 58 ° С - 60 sec, then 40 cycles according to the scheme: denaturation - 95 ° С - 15 sec, annealing 58 ° С - 60 sec. The measurement of fluorescence intensity is carried out at the annealing stage. The amplification results are shown in Fig.6.

The calibration curve in the coordinates C (T) - log P is built automatically by the iCycler instrument program.

With _T is the value of the threshold cycle, which determines the point at which the fluorescence level exceeds 10 times the standard deviation detected in the first amplification cycles; P is the concentration of DNA standard.

Example 9. Quantitative analysis of the content of viral cDNA.

The determination of the amount of viral cDNA is analyzed using fluorescent probes I and II.

When determining the quantitative content of viral cDNA, calibration curves for determining both HIV-1 cDNA and mutated HIV-1 cDNA are constructed each time. This helps to avoid errors associated with changes in the activity of enzymes, different composition of impurities from different blood samples. In addition, the added calculated amount of mutated HIV-1 RNA (500 copies) of the composition: 5'-ATGCTCAATAAAGCTTGCCTTGAGTGCTTTAAGTACTCTGTCCGCGTCTCTTGTATGACTCTGGTAACTAGAGATCCCTCAGACC-3A blood test allows for the loss of a blood sample to isolate.

Amplification during the construction of calibration curves is carried out in 50 μl of the reaction mixture containing: 200 μM dNTP, 600 nM primers I and II, 300 nM hybridization probe I, (or 300 nM hybridization probe II), 5 units. Hot-rescue DNA polymerase, 67 mM tris-HCl, 16.6 mM (NH ₄ ) ₂ SO ₄ , 0.01% Tween 20, 3 mM MgCl ₂ , and 10 ² to 10 ⁵ copies of pVar15-HIV- DNA LTR (or pBluSK-HIV-LTR mod).

PCR conditions: denaturation - 95 ° С - 10 min, annealing - 58 ° С - 60 sec, then 40 cycles according to the scheme: denaturation - 95 ° С - 15 sec, annealing 58 ° С - 60 sec. The measurement of fluorescence intensity is carried out at the annealing stage.

When analyzing a clinical sample containing both viral cDNA and mutated viral cDNA obtained at the stage of isolation from the introduced mutated HIV-1 RNA, amplification is carried out under similar conditions. 50 μl of the reaction mixture contains: 200 μM dNTP, 600 nM primers I and II, 300 nM hybridization probe I, 300 nM hybridization probe II, 5 units Hot-rescue DNA polymerase, 67 mM tris-HCl, 16.6 mM (NH ₄ ) ₂ SO ₄ , 0.01% Tween 20, 3 mM MgCl ₂ , viral cDNA and mutated viral cDNA.

PCR conditions: denaturation - 95 ° С - 10 min, annealing - 58 ° С - 60 sec, then 40 cycles according to the scheme: denaturation - 95 ° С - 15 sec, annealing 58 ° С - 60 sec. The measurement of fluorescence intensity is carried out at the annealing stage.

The FAM channel analyzes the presence of viral cDNA. The amount of viral cDNA (N ₁ ) is calculated from the calibration curve to determine the amount of HIV-1 cDNA.

The TAMRA channel analyzes the amount of mutated HIV-1 cDNA. The amount of mutated HIV-1 cDNA (N ₂ ) is calculated from the calibration curve to determine the amount of mutated HIV-1 cDNA. The true number of copies of HIV-1 RNA contained in the analyzed sample is calculated by the formula:

LITERATURE

1. International application WO No. 88/08039, cl. C12Q 1/70, publ. 10.20.88 g.

2. RF patent No. 2032907, class. G01N 33/53, publ. 06/08/92

3. Dewar R. L., Highbarger H. C., Sarmiento M. D., Todd J. A., Vasudevachari M. B., Davey R. T. J., Kovacs J. A., Salzman N. P., Lane H. C., Urdea M. S. // Application of branched DNA signal amplification to monitor human immunodeficiency virus type 1 burder in human plasma.// 1994. // J. Infect Dis. // v. 170 // No. 5 // p. 1172 - 1179.

4. Romano J.W., Van Gemen B., Kievits T. // NASBA: a novel, isotermal detection technology for qualitative and quantitative HIV-1 RNA measurments. // 1996 // Clin Lab Med. // v.16 // No. 1 // p. 89-103.

5. Application EPO No. 329822, cl. С07Н 21/00, publ. 08/30/89

6. US patent No. 5985544, CL. C12Q 1/68, publ. November 16, 1999

7. Mulder J., McKinney N., Christopherson C., Sninsky J., Greenfield L., Kwok S. // Rapid and simple PCR assay for quantitation of human immunodeficiency virus type 1 RNA in plasma: aplication to acute retroviral infection. // 1994 g. // J. Clin. Microbiol. // // v.32 // No. 2 // p. 292-300.

8. Lee L.G., Connell C.R., Bloch W. // 1993 // Nucl. Acid Res.// // v.21 // No. 16 // p.3761-3766.

9. Fodor I.I. et al. // Biotechnology // 1987 // vol. 3 // p. 302.

Claims (4)

1. Recombinant plasmid DNA pVar15-HIV-LTR, used to construct a calibration curve for determining the amount of human immunodeficiency virus type 1 (HIV-1) in the sample, carrying a cloned fragment of the HIV-1 genome from a conserved portion of the 5'-LTR sequence, size 4583 bp and a molecular weight of 3 Mda, including:
BamHI / EcoRI - fragment of the vector plasmid pVar15 size 4445 bp .;
BamHI / EcoRI - cDNA - fragment of the conserved region of the 5'-LTR sequence of human immunodeficiency virus type 1 138 bp, having the nucleotide sequence of SEQ ID NO: 1;
genetic marker: β-lactamase gene (Amp ^r ), which determines ampicillin resistance;
unique recognition sites of restriction endonucleases having the following coordinates: BamHI - 2 and EcoRI - 128. 2. Recombinant plasmid DNA pBluKSM-HIV-LTR mod, used to construct a calibration curve for determining the amount of the internal standard, carrying a cloned modified fragment of the human immunodeficiency virus genome of type 1 from a conserved region of the 5'-LTR sequence, size 3063 bp and a molecular weight of 2 Mda, including:
BamHI / EcoRI - fragment of the vector plasmid pBluKSM size of 2940 bp containing the gene of the alpha peptide beta-lactamase (lacZ ') - 460-816; the initiation site of the T7 polymerase promoter - 643; ampicillin resistance gene (bla) - 1976-2833;
BamHI / EcoRI - cDNA - a modified fragment of the conserved region of the 5'-LTR sequence of human immunodeficiency virus type 1 123 bp, having the transcribed nucleotide sequence of SEQ ID NO: 2;
unique recognition sites of restriction endonucleases having the following coordinates: BamHI - 690 and EcoRI - 819. 3. A test kit for quantitative rapid identification of the HIV-1 genome of any type in a sample containing the following components:
amplification primer to the conserved region of the 5'-LTR region of the HIV-1 genome (533-549) of 17 nucleotides
5'-GCTTGCCTTGAGTGCTT-3 ';
amplification primer to the conserved region of the 5'-LTR region of the HIV-1 genome (623-640) of 18 nucleotides
5'-CGCCACTGCTAGAGATTT-3 ';
hybridization probe I, complementary to the site of the HIV-1 genome (552-575), located between the primers, and having a fluorescent label at the 5'-end, and a fluorescence quencher at the 3'-end:
5'-FAM-AGTAGTGTGTGCCCGTCTGTTGTA-BHQ1-3 ';
hybridization probe II to determine the internal standard containing a fluorescent dye at the 5'-end and a fluorescence quencher at the 3'-end:
5'-TAMRA-AGTACTCTOTCCGCGTCTGTTGTA-BHQ2-3 ';
a cloned fragment of the HIV-1 virus genome as part of recombinant plasmid DNA pVar15-HIV-LTR, described in claim 1, to determine the specificity of the hybridization probe I to the target sequence of the HIV-1 genome;
a cloned fragment of the HIV-1 virus genome as part of the recombinant plasmid DNA pBluKSM-HIV-LTR mod, described in claim 2, to determine the specificity of the hybridization probe II to the cDNA sequence of the RNA control and to construct a calibration curve;
RNA is a modified fragment of the conserved region of the 5'-LTR region of the HIV-1 genome of 123 bp (internal RNA standard) having the following nucleotide sequence of SEQ ID NO: 3. 4. A method for the quantitative rapid identification of any type of HIV-1 genome in a sample, including obtaining an HIV-1 cDNA of a test sample by real-time one-step polymerase chain reaction using oligonucleotide primers specific for a conserved HIV-1 genome region, detection of the obtained amplicons using labeled hybridization probes and the calculation of the amount of viral RNA using an internal quantitative standard, characterized in that as primers for amplification the analyzed viral cDNA use oligonucleotides with the sequences 5'-GCTTGCCTTGAGTGCTT-3 'and 5'-CGCCACTGCTAGAGATTT-3', complementary to the conserved region of the 5'-LTR region of the HIV-1 genome, oligonucleotides 5 and 5 are used as hybridization probes '-FAM-AGTAGTGTGTGCCCGTCTGTTGTA-BHQ1-3' and 5'-TAMRA-AGTACTCTOTCCGCGTCTGTTGTA-BHQ2-3 ', the analysis is carried out by measuring the fluorescence of the sample in real time in a closed tube format, using the internal RNA standard -modified fragment of the conserved region of the 5'-LTR region of the genome and HIV-1 having the nucleotide sequence of SEQ ID NO: 3, and to calculate the amount of HIV-1 RNA in the analyzed sample, calibration curves are used to determine HIV-1 cDNA and to determine the mutated HIV-1 cDNA obtained using DNA of plasmid pVar15-HIV -LTR described in claim 1, and the DNA of the plasmid pBluKSM-HIV-LTR mod, characterized in claim 2, respectively.

Images