RU2268304C1 - Method for microbiological synthesis of lactic acid and recombinant strain of yeast schizosaccharomyces pombe for its realization - Google Patents

Abstract

FIELD: biotechnology, microbiology, genetic engineering.

SUBSTANCE: invention relates to methods for preparing lactic acid. Lactic acid is prepared by culturing the recombinant strain of yeast of genus Schizosaccharomyces as a producer of lactic acid comprising at least one foreign lactate dehydrogenase gene. The recombinant strain of yeast Schizosaccharomyces pombe VKPM Y-3127 is prepared by using the strain Schizosaccharomyces pombe VKPM Y-285 as a recipient and transformation of the strain is carried out with plasmid DNA carrying IdhA gene from fungus Rhizopus oryzae. Invention provides carrying out synthesis of lactic acid at low pH values and show capacity for producing lactic acid at pH 4.0 up to the concentration of lactic acid in medium 80-100 g/l.

EFFECT: improved preparing method.

3 cl, 5 dwg, 2 tbl, 4 ex

Description

The invention relates to the biotechnology industry, in particular to methods for producing lactic acid.

Lactic acid (MK) is widely used in the food industry for canning, flavoring and in the production of biodegradable plastic - polylactate (PLA). World consumption of lactic acid is more than 100,000 tons per year, and its significant increase is expected due to the many prospects for the use of polylactate. Another area of use of lactic acid is the production of a biodegradable solvent of ethyl lactate, which is used in the manufacture of electrical engineering, varnishes and paints, textiles, lubricants, adhesives, etc. It is estimated that non-toxic lactic acid esters can potentially replace more than 80% of the currently used solvents in the world. In this regard, it becomes urgent to develop effective methods for the production of lactic acid.

Traditionally, microbiological production methods based on the cultivation of bacterial strains are used to obtain MK. However, as a rule, when using bacteria, the rate of formation of lactic acid strongly depends on the pH of the medium, which leads to the need to add additional pH-statizing components to the fermentation medium to maintain a neutral or slightly acidic pH value, which in turn greatly complicates and increases the cost of cleaning the obtained lactic acid.

One of the main properties of yeast, making them a promising object for the production of lactic acid, is the increased resistance of some of them to low pH values. The ability of the yeast to grow and ferment under conditions of high acidity allows fermentation to be carried out at lower pH values, which makes it possible to significantly reduce the amount of neutralizing agent added during fermentation, and therefore, greatly simplifies the process of product purification and, ultimately, reduces the cost of the whole process .

Yeast normally does not produce significant quantities of lactic acid for production, however, recombinant yeast containing the lactate dehydrogenase (Idh) gene can produce lactic acid in amounts comparable to the production level (US Patent 6485947; US Patent 6429006; US Patent 6268189). As the recipient in these studies, yeasts such as Saccharomyces cerevisiae, Kluyveromyces sp., Pichia sp. and Hansenula sp., and bacteria (Lactobacillus plantarum), fungi (Rhizopus oryzae), and mammals (Idh gene from bovine muscle tissue) were used as a source of the lactate dehydrogenase gene.

As the closest analogue (prototype) of the proposed method, a method for the synthesis of MK using recombinant Saccharomyces cerevisiae yeast containing the lactate dehydrogenase gene from the fungus Rhizopus oryzae (J. Ind. Microbiol. Biotechnol., 2003; 30; 22-27) was selected.

The Saccharomyces cerevisiae JnvSc1 strain (J. Ind. Microbiol. Biotechnol., 2003; 30; 22-27) was selected as a prototype of the inventive producer strain of MK.

A distinctive feature of the prototype method is that the rate of formation of MK remains unchanged in the range of pH 3.5-6.0, and the main disadvantage is that the synthesis of MK practically stops as soon as its concentration in the culture fluid reaches 35-40 g / l , which negatively affects the efficiency of the process of obtaining MK. In addition, continuous methods for the synthesis of MK are currently becoming more widespread, in which, as a rule, MK is isolated by electrodialysis of the culture fluid, and the efficiency of the electrodialysis process increases significantly with increasing concentration of lactic acid in the culture fluid.

The task of the claimed group of inventions is to develop a method for the synthesis of MK using recombinant strains of yeast that can produce MK at low pH and in conditions of its high content in the environment.

Problem solved

- the development of a method for the synthesis of MK by culturing recombinant yeasts of the genus Schizosaccharomyces containing at least one foreign gene of lactate dehydrogenase;

- designing a recombinant strain of the yeast Schizosaccharomyces pombe VKPM Y-3127 - producer MK.

The essence of the invention is as follows.

The effectiveness of the formation of lactic acid depends on the efficiency of the two stages of the metabolic pathway - the stage of glycolysis (a series of biochemical conversions of glucose to pyruvate) and the stage of conversion of pyruvate to lactic acid, controlled by the enzyme lactate dehydrogenase, and it is precisely the 1st stage - the glycolysis stage - that is sensitive to low values pH and elevated concentrations of lactic acid.

The introduction of the lactate dehydrogenase gene into the yeast cell does not interfere with glycolysis; therefore, yeast cultures capable of normal glycolysis at low pH and high concentrations of lactic acid will retain these properties even after the introduction of a foreign gene into them.

In order to identify yeasts capable of glycolysis at low pH and high concentrations of lactic acid, we conducted a screening among various representatives of acid-resistant yeast (Table 1). Strains were selected according to the rate of decrease in glucose level in the fermentation medium during the process under anaerobic conditions at pH 4.0 and an increased level of lactic acid in the fermentation medium (50 g / l, 80 g / l and 100 g / l).

The screening procedure is shown in example 1.

Table 1 Kind Number of species Number of strains Selected strains at pH 4.0 and 50 g / l MK Selected strains at pH 4.0 and 80 g / l MK Selected strains at pH 4.0 and 100 g / l MK Debaryomyces 8 86 0 0 0 Bretanomyces 3 10 0 0 0 Metschnikowia four 35 0 0 0 Deckera one 3 0 0 0 Williopsis one 23 0 0 0 Zygowilliopsis one fifteen 0 0 0 Saccharomyces 13 44 27 four 0 Zygosaccharomyces 3 6 0 0 0 Hansenula 10 41 0 0 0 Kluyveromyces 6 63 eleven 0 0 Schizosaccharomyces 3 22 22 22 eleven

Screening results (Table 1) showed that the yeast of the genus Schizosaccharomyces is better than others capable of glycolysis at a concentration of MK in the medium of 50-100 g / l.

Since the introduction of the lactate dehydrogenase gene does not affect the ability of the yeast to carry out glycolysis, but only affects the efficiency of the metabolic stage associated with the conversion of pyruvate to MK, we proposed the use of Schizosaccharomyces yeast as promising recipients for obtaining recombinant strains - producers of MK used in the claimed way.

To transform the recipient strain, the lactate dehydrogenase gene from any organism encoding an enzyme with high affinity for pyruvate can be used.

The inventive method is as follows.

A recombinant strain of the yeast of the genus Schizosaccharomyces containing at least one foreign gene of lactate dehydrogenase is grown on a complete yeast medium, preferably under anaerobic conditions for 1-3 days at a temperature of 25-30 ° C. The biomass is separated, resuspended in a minimal yeast medium, preferably not containing a nitrogen source, and incubated to form MK, preferably under anaerobic conditions. The concentration of MK in the culture fluid is determined by high performance liquid chromatography (HPLC).

To demonstrate the implementation of the proposed method, the inventive recombinant strain of Schizosaccharomyces pombe VKPM U-3127 yeast was constructed, during the creation of which one of the strains selected during screening was used as a recipient, namely, the Schizosaccharomyces pombe VKPM U-285 strain, and strain A was transformed from the fungus I gene Rhizopus oryzae.

The work on creating the strain can conditionally be divided into 4 stages.

1. Creation of a genetic construct for the expression of the IdhA gene from Rhizopus oryzae in Schizosaccharomyces pombe yeast cells.

The DNA fragment containing the IdhA gene of Rhizopus oryzae under the control of the promoter and terminator of the nmt1 Schizosaccharomyces pombe gene in the plasmid pUC-nmt-Idh was obtained by PCR using overlapping sequence primers (Fig. 1).

2. Creation of the integrative plasmid pdURA-nmt-Idh for transformation of Schizosaccharomyces pombe and expression of the IdhA gene.

A DNA fragment was obtained by PCR that encodes part of the amino acid sequence of the Schizosaccharomyces pombe URA4 gene in the plasmid pUC-dURA4. Then this DNA fragment was transferred to the plasmid pUC-nmt-Idh with the formation of the plasmid pdURA-nmt-Idh (figure 2).

3. Transformation of the strain Schizosaccharomyces pombe VKPM Y-285 with the plasmid pdURA-nmt-Idh.

4. Heterologous expression of the IdhA gene in a strain of Schizosaccharomyces pombe VKPM Y-285 during fermentation.

The constructed recombinant strain of Schizosaccharomyces pombe yeast, containing the heterologous IdhA gene from the fungus Rhizopus oryzae and capable of producing lactic acid, differs from the strain, the closest analogue, in its ability to continue MK synthesis at a concentration of 80-100 l.

The strain is deposited in the All-Russian Collection of Industrial Microorganisms (VKPM) and has a registration number VKPM Y-3127.

The inventive strain of Schizosaccharomyces pombe VKPM Y-3127 has the following properties.

Cultural and morphological characters.

To describe the cultural and morphological characters used the medium "Malt extract", "Malt agar" and potato-corn agar (The yeasts of toponomic study. Ed. NJWKreger-van Rij, Amsterdam, Elsevier Sci. Publ.BV, 1984, p. 421).

After three days of cultivation on a Malt extract medium, the culture forms round, ellipsoidal and cylindrical cells (3.0-5.0) × (5.0-15.0-24.0) μm. A precipitate forms.

On the medium, "Malt agar" on day 5 forms medium-sized colonies of a white or slightly creamy hue. The surface of the colonies is smooth, the edge is even. Vegetative propagation - cell division in half.

Askeys with spores form on potato corn agar. Conjugation of vegetative cells precedes the formation of asks containing from 2 to 4 ellipsoidal ascospores. Free ascospores can be combined into small groups.

Physiological and biochemical characteristics.

The culture is able to ferment glucose, sucrose, maltose and raffinose. Unable to ferment galactose, lactose and melibiosis. Assimilates sucrose, maltose, and raffinose as the sole carbon source. It does not assimilate galactose, cellobiose, trehalose, lactose, xylose, arabinose, ribose, rhamnose, erythritol, ribitol, mannitol, starch, succinic, citric acid, inositol culture does not assimilate nitrates, is not able to grow on a medium without vitamins.

Optimum conditions for the propagation of the strain.

Temperature 30 ° С, pH 6, complete yeast medium (A. Zakharov et al. Collection of techniques for the genetics of saccharomycetes yeast. - L., Nauka, 1984, p. 144).

The strain is stored in lyophilized form or in pairs of liquid nitrogen.

The obtained strain of Schizosaccharomyces pombe VKPM Y-3127 retains the ability to form lactic acid after 18 consecutive transfers in a complete medium.

The invention is illustrated by the following figures of the graphic image:

Figure 1 Scheme for the construction of plasmids pUC-nmt-ldh.

Figure 2 Scheme for the construction of the plasmid pdURA-nmt-ldh.

Figure 3 Scheme depicting the inactivation mechanism of the URA4 Schizosaccharomyces pombe gene upon integration of the plasmid pdURA-nmt-ldh into chromosome III of Schizosaccharomyces pombe.

Figure 4 The accumulation of MK in the medium during cultivation of a strain of Schizosaccharomyces pombe VKPM Y-3127.

Figure 5 Dynamics of MK accumulation at different initial concentrations in the medium.

The invention is confirmed by the following examples.

Example 1. Determination of glycolysis rate in non-recombinant strains of the genera Saccharomyces and Schizosaccharomyces.

The studied yeast for two days was grown on a complete yeast medium (wt.%): Glucose 5.0, yeast extract 0.5, peptone 1.0, water the rest, at 30 ° C in 750 ml flasks with stirring on a shaker (250 r / min). The volume of the culture fluid is 25 ml. As a seed, a one-day biomass of yeast (2.5 × 10 ⁶ cells) grown on a complete yeast agar medium was used.

The biomass was separated by centrifugation, washed with distilled water, and 0.2 g of crude biomass was transferred into 40 ml tubes with a minimum medium of the following composition (wt.%): Glucose 1, KH ₂ PO ₄ 0,085; K ₂ HPO ₄ 0.015; MgSO ₄ 0.05; NaCl 0.01; CaCl ₂ 0.01; biotin 2 × 10 ^-5 ; pantothenate Ca 2 × 10 ^-4 ; folic acid 2 × 10 ^-6 ; inositol 1 × 10 ^-2 ; nicotinic acid 4 × 10 ^-4 ; para-aminobenzoic acid 2 × 10 ^-4 ; pyridoxine hydrochloride 4 × 10 ^-4 ; riboflavin 2 × 10 ^-4 ; boric acid 2 × 10 ^-6 ; CuSO ₄ 5 × 10 ^-6 ; KJ 1 x 10 ^-5 ; FeCL ₃ 2 × 10 ^-5 ; MnSO ₄ 4 × 10 ^-5 ; Na ₂ MoO ₄ 2 × 10 ^-5 ; ZnSO ₄ 4 × 10 ^-5 , the rest is water.

The tubes are equipped with special sulfuric acid shutters, providing sterility and anaerobic conditions for the experiment.

Each strain was cultured for 3 hours at a temperature of 30 ° C and pH 4.0. The glycolysis rate was determined in the medium without the addition of MK, at an initial MK concentration of 50 g / l, 80 g / l and 100 g / l.

At the end of the cultivation, the glucose concentration in the culture fluid was measured and the glycolysis rate was calculated by the formula

V glycolysis = (C ^T1 glitch-C ^T0 glitch) ΔT,

Where

V glycolysis — glycolysis rate, g / l × hour;

With ^T0 glitch - glucose concentration at the initial time, g / l;

With ^T1 glitch - glucose concentration at the end of cultivation, g / l;

ΔТ - cultivation time, hours.

The glucose concentration was determined on a spectrophotometer at a wavelength of 500 nm using a set of reagents for determining the glucose content in serum and blood plasma ("Diacom Glucose GO". Moscow).

Table 2 shows the results of determining the glycolysis rate for 22 strains of the yeast of the genus Schizosaccharomyces belonging to the 3 currently known species of this genus.

For comparison, Table 2 also shows the glycolysis rate for 4 yeast strains of the genus Saccharomyces, which demonstrated the ability to perform glycolysis at pH 4.0 and a concentration of MK in the medium of 80 g / L.

From the above results it follows that for the first time a specific ability for yeast of the genus Schizosaccharomyces was found to be capable of glycolysis in an acidic medium under conditions of an increased (50-100 g / l) MK content in the medium.

This served as the basis for the use of yeast of this kind as recipients in the construction of recombinant strains producing MK.

table 2 Type, strain Glycolysis rate (g / l / hr) at pH 4.0 Schizosaccharom yces pombe Control (without MK) The initial concentration of MK 50 g / l 80 g / l 100 g / l Y-285 1.26 1.19 0.51 0.31 Y-282 0.72 0.62 0.28 - Y-747 0.62 0.59 0.24 0.16 Y-2586 0.49 0.46 0.27 - Y-2592 0.52 0.44 0.28 - Y-2596 0.60 0.56 0.28 - Y-2594 0.49 0.41 0.27 - Y-2590 0.69 0.62 0.29 - Y-2591 0.63 0.55 0.27 0.19 Y-2588 0.56 0.49 0.25 - Y-2593 0.65 0.55 0.30 0.22 Y-2587 0.48 0.45 0.20 - Y-2595 0.57 0.52 0.25 0.18 Y-304 0.50 0.46 0.35 0.13 Y-319 0.73 0.69 0.38 0.28 Y-774 0.39 0.37 0.22 - Y-585 0.50 0.40 0.29 0.14 Y-441 0.41 0.39 0.27 - Y-3106 0.66 0.60 0.32 0.20 Y-3107 0.55 0.51 0.25 - Schizosaccharomyces japonicus Y-3131 0.59 0.58 0.36 0.18 Schizosaccharomyces octosporus Y-3132 0.61 0.55 0.36 0.17 Saccharomyces cerevisiae Y-1213 0.57 0.31 0.10 - Y-1218 0.49 0.26 0.08 - Saccharomyces exigans Y-2550 0.37 0.20 0.11 - Saccharomyces castellii Y-2538 0.43 0.25 0.13 -

Example: 2 Construction of a strain of Schizosaccharomyces pombe VKPM Y-3127.

When constructing the inventive recombinant strain, the Schizosaccharomyces pombe VKPM Y-285 strain was used as a recipient, which, when screened, showed the highest glycolysis rate during cultivation in the presence of MK. The strain was transformed with plasmid DNA carrying the IdhA gene of the fungus Rhizopus oryzae with a known nucleotide sequence (Applied and Environmental Microbiology, June 2000, 2343-2348).

Step 1. Creation of a genetic construct for the expression of the IdhA gene of Rhizopus oryzae in Schizosaccharomyces pombe.

To express the R. oryzae IdhA gene in Schizosaccharomyces pombe, a construct containing the gene under the control of the promoter and terminator of the nmtl Schizosaccharomyces pombe gene is obtained. All of the PCR primers listed below were synthesized by Syntol (Moscow), and their sequences were selected based on publicly available DNA sequences (http://www.ncbi.nlm.nih.gov/Genbank/index.html).

A DNA fragment of 989 bp encoding the amino acid sequence of the gene IdhA R. oryzae, prepared by PCR using Pfu-Polymerase (Fermentas Inc.), and primers: TCGCTTTGTTAAATCATGGTATTACACTCAAAGGTCG (G-ldhA-F) and GAGACATTCCTTTTAACAGCTACTTTTAGAAAAGGAAG (G-ldhA- R). The total genomic DNA of R. oryzae NRRL 395 obtained by the phenolic method (Letters in Applied Microbiology 2000, 30, 53-56) is used as a template for PCR.

A 1182 bp DNA fragment encoding the promoter sequence of the nmtl Schizosaccharomyces pombe gene was obtained by PCR using Pfu polymerase (Fermentas Inc.) and primers: TTAGCGCTAAGACAGAATAAGTCATCAGCG (P-nmtl-F) and CTTTACGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTTA ) The matrix for PCR is the total genomic DNA of Schizosaccharomyces pombe VKPM Y-285 obtained by the phenolic method.

A 285 bp DNA fragment encoding the sequence of the nmtl Schizosaccharomyces pombe gene terminator was obtained by PCR using Pfu polymerase (Fermentas Inc.) and primers: TCTAAAAGTAGCTGTTAAAAGGAATGTCTCCCTTGG (T-nmtl-GTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT ) The matrix for PCR is the total genomic DNA of Schizosaccharomyces pombe VKPM Y-285.

All three fragments of amplified DNA are purified after electrophoresis on a 1% agarose gel by DNA extraction (Kit # K0513, Fermentas Inc.). Purified DNA fragments 989 bp in size and 285 bp in an amount of 0.05 μg are used as a template for PCR using primers G-ldhA-F and T-nmtl-R, using Pfu polymerase (Fermentas Inc.).

The resulting DNA fragment size of 1261 bp purified on an agarose gel by a similar method and used together with a DNA fragment 1182 bp in size. as a matrix for PCR in an amount of 0.05 μg each of the primers P-nmtl-F and T-nmtl-R. 0.5 μg of a 2411 bp DNA fragment obtained after amplification, agarose gel electrophoresis and purification are ligated with 0.2 μg of pUC19 vector DNA treated with Hindi restriction endonuclease and transformed into E. coli XL1 (Blue) by electroporation (Molecular Cloning, J. Sambrook et al., Cold Spring Harbor Laboratory Press 1989, 1, 1.75). Clones containing the required 2411 bp amplified DNA insert were selected on plates with LB agar medium (wt.%): Tryptone 1, yeast extract 0.5, 0.5 NaCl, rest water, ampicillin and standard resistance a test for the absence of β-galactosidase activity (Molecular Cloning, J. Sambrook et al., Cold Spring Harbor Laboratory Press 1989, 1, 1.85-1.86). Plasmid DNA isolated from the selected clones was checked by restriction analysis and sequenced (primers M13 / pUC 17-mer, M13 / pUC reverse 17-mer, G-ldhA-F, G-ldhA-R and CTGATATATGAAAATAATACCCAC). The resulting plasmid size 5095 N. p. named pUC-nmt-Idh (FIG. 1).

Step 2. Creation of an integrative plasmid pdURA-nmt-Idh for transformation of Schizosaccharomyces pombe and expression of the IdhA gene.

To create a vector capable of integrating into a chromosome of Schizosaccharomyces pombe, a DNA fragment encoding a portion of the amino acid sequence of the gene URA4 Schizosaccharomyces pombe, by PCR using Taq-polymerase (Fermentas Inc.), and primers: AAGGATCCAGCTATTCAGCTAGAGCTGAG and AAGAGCTCTTTGAAGGTTAGGAAATCGAC. The matrix for PCR is the total genomic DNA of Schizosaccharomyces pombe VKPM Y-285. For the amplification reaction, 100 nanomoles of each primer are used. 0.5 μg of amplified DNA of 569 bp digested with BamHI and Sad endonucleases and ligated with 0.2 μg of pUC19 vector DNA treated in the same manner. The resulting plasmid was transformed into E. coli XL1 (Blue). Clones containing the required 559 bp amplified DNA insert are selected for ampicillin resistance and standard 6-galactosidase activity test. Plasmid DNA isolated from selected clones was checked by restriction analysis. The resulting plasmid size 3230 N. p. named pUC-dURA4. It contains a 559 bp DNA fragment homologous to parts of the open reading frame of the Schizosaccharomyces pombe URA4 gene sequence. Such a plasmid can be used as an integrative vector, because when recombining in the homology region on the chromosome, Schizosaccharomyces pombe integrates into it with the formation of two delegated copies of the URA4 gene (Fig. 3).

1 μg of DNA of the plasmid pUC-dURA4 is treated with restriction endonucleases BamHI and Sad. The smallest of the obtained fragments, 559 bp in size, containing a portion of the amino acid sequence of the Schizosaccharomyces pombe URA4 gene, is purified by extraction after agarose gel electrophoresis. The plasmid pUC-mnt-ldh is cut and purified in the same manner. 0.2 μg of DNA of the obtained linearized plasmid pUC-nmt-Idh is treated with alkaline phosphatase (# EF0341, Fermentas Inc.), ligated with 0.5 μg of a 559 bp DNA fragment. and transformed into E. coli XLl (Blue) by electroporation. Transformants are selected for ampicillin resistance. Plasmid DNA isolated from selected clones was checked by restriction analysis. The resulting plasmid size 5639 N. p. named pdURA-nmt-Idh (FIG. 2).

Step 3. Transformation of the strain Schizosaccharomyces pombe VKPM Y-285 plasmid pdURA-nmt-Idh.

The Schizosaccharomyces pombe strain VKPM Y-285 is cultured in YE medium (Experiments with Fission Yeast, C. Alfa et al., Cold Spring Harbor Laboratory Press 1992, 129) at 30 ° C and stirring on a shaker (250 rpm) to cell density 10 ⁸ / ml. Wash twice with an equal volume of ice distilled water and twice with ice-cold 1M sorbitol solution. 10 ⁷ cells are resuspended in 50 μl of a 1M sorbitol solution and 5 μg of DNA linearized with StuI restriction endonuclease plasmid pdURA-nmt-Idh is added. The suspension is placed in an electroporation cuvette with an electrode spacing of 0.2 cm and is porous at 1500V. Immediately after pore formation, the suspension is diluted with 300 μl of a 1M sorbitol solution. 5 × 10 ⁶ cells (1/10 of the suspension) are seeded in a 750 ml flask and cultured for 48 h in 30 ml of YE medium supplemented with uracil (50 mg / l) and thiamine (0.1 mg / l) at 30 ° C and 250 rpm 10 ⁸ cells are plated on an EMM agar plate (Experiments with Fission Yeast, C. Alfa et al., Cold Spring Harbor Laboratory Press 1992, 128) supplemented with 5-fluorotoric acid (5-FOA) (1 g / L) and uracil (50 mg / l). Colonies that appeared on the fifth day were tested for uracil auxotrophy by the replica method on a similar medium (without 5-FOA) with and without uracil. Uracil auxotrophic clones are checked for the presence of a plasmid integrated into the chromosome in the region of the URA4 gene by PCR (primers AGCTCGAGAAGCTTAGCTACAAATCC and GTAAAACGACGGCCAGT). Uracil auxotrophic transformants and containing the plasmid pdURA-nmt-Idh in integrated form are used for fermentation.

Stage 4. Heterologous expression of the IdhA gene in the Schizosaccharomyces pombe strain VKPM Y-285 during fermentation.

The transformants selected in stage 3 are cultured for 48 hours at 30 ° C and stirring on a shaker (250 rpm) on YE medium with the addition of glucose 20 g / l, uracil (50 mg / l) and thiamine (0.1 mg / l). After washing, 10 ⁷ cells are resuspended in 10 ml of minimal yeast medium (Example 1) with the addition of glucose 100 g / L (pH 5.1) and incubated at 30 ° C for 72 hours. The cells are pelleted and the culture fluid is analyzed for the presence of lactic acid. Analysis showed that all selected transformants are capable of producing MK. The presence of lactic acid in the culture fluid of transformants and its absence in the culture fluid of the recipient strain of Schizosaccharomyces pombe VKPM Y-285 indicates that a yeast strain with a cloned heterologous and efficiently expressed lactate dehydrogenase gene from the fungus Rhizopus oryzae was obtained.

The Schizosaccharomyces pombe transformant, which showed the highest MK productivity, was deposited, deposited in VKPM under VKPM number Y-3127 and used for further studies.

Example 3. Synthesis of MK using a recombinant strain VKPM Y-3127.

Seed is prepared as described in example 1.

The biosynthesis process is carried out in 3 stages.

1. Yeast is grown on a liquid complete yeast medium of the following composition (wt.%): Glucose 10, peptone 1, yeast extract 1, water the rest. Cultivation is carried out under anaerobic conditions for 3 days at 30 ° C. The biomass is separated from the culture fluid by centrifugation and washed twice with distilled water.

2. 0.2 g of raw biomass is transferred into test tubes with a minimum medium of the following composition (wt.%): Glucose 10, KH ₂ PO ₄ 0,085; K ₂ HPO ₄ 0.015; MgSO ₄ 0.05; (NH ₄ ) ₂ SO ₄ 0.35; NaCl 0.01; CaCl ₂ 0.01; biotin 2 × 10 ^-5 ; pantothenate Ca 2 × 10 ^-4 ; folic acid 2 × 10 ^-6 ; inositol 1 × 10 ^-2 ; nicotinic acid 4 × 10 ^-4 ; para-aminobenzoic acid 2 × 10 ^-4 ; pyridoxine hydrochloride 4 × 10 ^-4 ; riboflavin 2 × 10 ^-4 ; boric acid 2 × 10 ^-6 ; CuSO ₄ 5 × 10 ^-6 ; KJ 1 x 10 ^-5 ; FeCL ₃ 2 × 10 ^-5 ; MnSO ₄ 4 × 10 ^-5 ; Na ₂ MoO ₄ 2 × 10 ^-5 ; ZnSO ₄ 4 × 10 ^-5 , the rest water, and incubated for 16 hours at 30 ° C under anaerobic conditions. The biomass is separated by centrifugation and washed with distilled water.

3. 0.2 g of raw biomass is transferred into test tubes with a minimal medium, as in Example 1, but at a glucose concentration of 10 wt.%. Fermentation is carried out for 8 days at 30 ° C and pH 5.5 (pH-statization is carried out with chalk).

The dynamics of the accumulation of MK in the culture fluid is shown in Fig.4.

The data obtained confirm that the inventive recombinant strain - producer MK - continues to synthesize MK under conditions when its concentration exceeds 50 g / l.

Example 4. Demonstration of the ability of the strain VKPM Y-3127 to carry out the biosynthesis of MK at different initial concentrations in the culture fluid.

The preparation of the culture is carried out according to the scheme described in example 3.

2.0 g of crude biomass prepared in the 2nd stage are placed in 40 ml glass cells and cultured at 30 ° C, with gentle stirring and pH 4.0. pH-stating is carried out with 10% NaOH solution. Before part of the cultivation, lactic acid at a concentration of 80 g / l and 100 g / l is added to some of the cells. The accumulation rate of lactic acid with the recombinant strain VKPM Y-3127 at high initial concentrations of lactic acid is shown in Fig.5.

The data presented confirm that the resulting producer strain can produce MK at pH 4.0 and concentrations of lactic acid of 80-100 g / l, which corresponds to the properties of the original recipient strain capable of glycolysis at a high content of MK in the medium.

Thus, as a result of screening conducted among 11 genera of yeast (348 strains belonging to 53 species were studied), the yeast of the genus Schizosaccharomyces (22 strains belonging to 3 known species were studied) capable of glycolysis (the first stage of MK synthesis) under conditions increased concentration of lactic acid in the medium and low pH values.

On the example of a specific strain of the yeast Schizosaccharomyces pombe VKPM Y-3127, constructed on the basis of the yeast of the genus Schizosaccharomyces, capable of glycolysis under conditions of increased MK concentration, and the lactate dehydrogenase gene from the fungus Rhizopus oryzae, which gives the claimed strain the ability to synthesize Schinocaris aces, recombin containing the lactate dehydrogenase gene, to synthesize MK under conditions of its increased content (80-100 g / l) in the medium and low pH values.

The inventive method of microbiological synthesis of lactic acid based on recombinant yeast producers from the genus Schizosaccharomyces is promising when used in the manufacture of MK, because the resistance of yeast strains to low pH allows the process to be carried out without the addition of pH-stabilizing reagents, and the ability of recombinant producers to continue the synthesis of MK under conditions of its increased concentration in the medium leads to an increase in the efficiency of the process.

Claims (2)

1. The method of microbiological synthesis of lactic acid by culturing a recombinant yeast strain - a producer of lactic acid containing at least one foreign lactate dehydrogenase gene, characterized in that a recombinant strain of the genus Schizosaccharomyces is used as a strain producing lactic acid. 2. Recombinant strain of the yeast Schizosaccharomyces pombe VKPM Y-3127 - producer of lactic acid.

Images