Background technology
Adenosylmethionine (SAM) is an intermediary metabolism substance important in the organism, participates in numerous biological respinses, and it also is intracellular main methyl donor.The synthetic of known many nitrogenous substancess all will obtain methyl from SAM, comprise creatine, suprarenin, epiphysin, important physical active substances such as choline.SAM also participates in nucleic acid and the proteinic modification that methylates, and is such as gsh, halfcystine, the precursor of this class sulfocompound of taurine and coenzyme A.
The content of SAM, all very low in general biomass cells, but some bacterial strains at certain micro-organisms especially yeast Saccharomyces genus, can be when the growth that contains methionine(Met), the SAM of accumulation higher concentration in cell (Shiozaki S et al.Agric Biol Chem, 1984,48:2293-2300), thereby can obtain SAM easily by fermentation to them.Intracellular SAM is accumulated in mainly that (JBacteriol 1960,79:841) for Svihla G, Schlenk F in the vacuole of cell.
The production of SAM is always based on fermentation (Shiozaki S, Yamada H et al., US4562149,1985 of Saccharomyces Cerevisiae in S accharomyces cerevisiae; Shiozaki S, Yamada H et al.Arig Biol Chem, 1989,53:3269-3274).It all is to separate by the wild bacterium of screening different genera on a large scale to obtain that early stage SAM produces bacterium, Shiozaki is by the bacterial strain of screening strain more than 300 different genera, be separated to a strain Saccharomyces sake K-6 bacterium (Shiozaki S et al., Agric Biol Chem, 1984,48 (9): 2293-2300), the content of SAM reaches the 0.153g/g stem cell in the SAM that can output 1.55g/L when the 10ml substratum ferments in a small amount, cell; Further optimize culture condition, this bacterium in the 10L fermentor tank, cultivate after 7 days SAM output up to 10.8g/L (thalline reaches 53 and restrains) (Shiozaki S et al.Journal ofBiotechnology, 1986,4:345-354).This is the highest output of being found on various patents and the periodical at present.
(Pajares Maria Angeles such as Pajares Maria Angeles, 1995, EP0647712) by in bacterium, expressing the SAM synthetic enzyme in rat liver source, make intracellular SAM content improve greatly, but the SAM output in its unit fermentation volume is still very low, have only the 28nmol/ml fermented liquid, calculate, have only 0.012 grams per liter fermented liquid according to the molecular weight of SAM hydrochloride.Low like this fermentation yield can increase fermentation costs on the one hand, can make that on the other hand the purifying in later stage is pretty troublesome.
The production cost of this class intermediate metabolites of SAM, depend on the factor of three aspects: 1. the content of purpose product in producing bacterium, promptly product accounts for the per-cent of dry cell weight; 2. produce the biological accumulation amount of bacterium in the unit fermentation volume, i.e. the biomass of unit fermentation volume; 3. produce the cost of the fermention medium of bacterium.The methyl alcohol that develops rapidly at bioengineering field utilizes type yeast (methylotrophicyeast) in recent years, comprise Hansenula, Candida, the yeast that Pichia and Torulopsis belong to, it is the yeast that a class can utilize methyl alcohol to grow as single carbon source, being compared to traditional yeast saccharomyces cerevisiae, to have culture medium cost low, the characteristics that the biological accumulation amount is high, large scale fermentation can obtain high cell density (dry cell weight of>130g/L) and biological transformation ratio ((the Wegner G H of 12g stem cell/Lhour), FEMSMicrobiol Rev, 1990,279-284).This characteristic makes it possess the potentiality of producing mesostate in the cell with extremely low price.Yet the methyl alcohol of wild-type utilizes its intracellular SAM content of type yeast extremely low, and the SAM content that we test the pichia pastoris phaff GS115 bacterial strain of being measured has only 0.0039 gram/gram stem cell, promptly has only 0.39% content.
Summary of the invention
The objective of the invention is by recombinant expressed external source SAM synthetic enzyme, strengthen intracellular SAM synthetic enzyme vigor, change the pathways metabolism of cell self, thereby develop the method that the bacterial strain of new genetic modification is produced SAM; Utilize methyl alcohol to utilize the high-density of type yeast itself, fermenting characteristic cheaply on the other hand, reduce the production cost of SAM significantly, satisfy the SAM demand that increases day by day, promote the exploitation of domestic SAM, enhance our international competitiveness.
The biosynthesizing of SAM is synthetic through SAM synthetic enzyme [EC2.5.1.6] enzymatic by substrate L-methionine(Met) (Met) and ATP.The isozyme SAM synthetase 1 and the SAM synthetic enzyme 2 of two kinds of SAM synthetic enzyme are arranged in the brewing yeast cell, and the concensus sequence of both aminoacid sequences is up to 92%.The SAM synthetase 1 is responsible for the most of SAM in the synthetic cell, suppresses phenomenon but the SAM synthetase 1 shows stronger product, and SAM synthetic enzyme 2 does not then have.It is the same with the metabolic gene of SAM that Thomas etc. find that the mode of the transcriptional control of SAM synthetase 1 participates in sulfur-containing amino acid with other, and in the presence of excessive methionine(Met), transcribing of it is suppressed; SAM synthetic enzyme 2 then shows different control methods, it transcribe the inhibition that is not subjected to methionine(Met), and with growth curve increase (Thomas, D.et al., 1991, Mol.Gen.Genet.226,224-232).
The present invention utilizes methyl alcohol to utilize the type yeast to be the host, by cloning known SAM synthase gene, embodiment of the invention utilization be the SAM synthetic enzyme 2 that derives from yeast saccharomyces cerevisiae, but be not limited thereto enzyme, also can be the SAM synthetic enzyme in other biological source, or the mutant of the SAM synthetic enzyme of synthetic.This enzyme is fitted into methyl alcohol utilizes type zymic expression vector, and place under the control of strong promoter, the promotor of this carrier can be that AOX1 also can be GAP promotor or other any promotor that can play a role in methyl alcohol utilizes the type yeast cell.
This plasmid is transformed into methyl alcohol by protoplastis or the electric method that transforms and utilizes the type yeast cell through after the linearizing, and the transformant that obtains is the required engineering strain of the inventive method.The embodiment of the invention provides a kind of new bacterial strain, and promptly methyl alcohol utilizes the pichia pastoris phaff of type, and its kind is Pichiapastoris.(culture presevation number is: CGMCC, NO.0648, the date: October 29 calendar year 2001, preservation ground: Beijing, China Committee for Culture Collection of Microorganisms common micro-organisms center, storage conditions is: the cryogenic freezing preservation, with glycerine or DMSO as protective material.) like this this plasmid be integrated into the chromosomal DNA of cell by the mode of homologous recombination, thereby make that the SAM synthetic enzyme of external source can stably obtain expressing in reconstitution cell.It is this that to be integrated in chromosomal recombinant expressed mode stronger than the stability of the plasmid expression form of duplicating separately, after even if the experiment of Hideyuki Ohi shows this type of reorganization bacterium continuous passage through 83 generations, karyotype and expressing quantity all do not have obvious variation (HideyukiOhi, 1998, yeast, 14:895-903).
Under many situations, the high strain protein expression amount of the copy number of exogenous origin gene integrator greater than the bacterial strain of low copy or single copy (Clare JJ et al., 1991, Gene, 105:205-212).Therefore utilize the optimization that exogenous protein is expressed in the type yeast at methyl alcohol, usually comprise and separate the bacterial strain that contains multi-copy gene.Utilization has the expression plasmid of the resistant gene of G418, as pPIC3.5K, can screen the multiple copied recombinant bacterial strain easily because the reorganization bacterium roughly the copy number with carrier is relevant to the resistance level of G418.So after carrying out resistance screening on the G418 of a series of different concns flat board, we obtain the bacterial strain of hundreds of strain multiple copied, and have determined their copy number by the dot-blot method.
Cultivate this project bacterium in the liquid nutrient medium that contains an amount of methionine(Met), cell can utilize the methionine(Met) in the substratum to do substrate under the catalysis of SAM synthetic enzyme, synthetic a large amount of SAM.By relatively not having under the different situations of methyl alcohol and interpolation methyl alcohol in the substratum, intracellular SAM output, can prove conclusively the expression of external source SAM synthetic enzyme in reconstitution cell and promote the raising of SAM output in the cell: under the condition that does not add methanol induction, external source SAM synthetic enzyme is not expressed substantially in the cell, intracellular SAM output is compared with the wild-type host cell, does not also have significantly to change; But after adding methyl alcohol was done carbon source in the substratum, intracellular SAM synthetic enzyme vigor and SAM output all were enhanced.
Intracellular in addition SAM content is not only relevant with SAM synthetic enzyme vigor, also relevant with the carbon source in the substratum, when not only replenishing methyl alcohol in the fermention medium as carbon source and inductor, also add when glycerine is this to utilize the type yeast to be the carbon source of utilizing fast to methyl alcohol, the output of SAM can improve.This can be understood as ATP that cell utilizes these carbon sources to synthesize capacity, and to supply with SAM synthetic required.
Effect of the present invention:
The present invention has overcome in the method for existing production SAM, the very high but low shortcoming of bacterial classification content in the unit fermentation volume of SAM content in the brewing yeast cell, the culture medium cost of utilizing methyl alcohol to utilize the type yeast to have is low, biological accumulation amount height, large scale fermentation can obtain the characteristics of high cell density and biological transformation ratio, being used in methyl alcohol utilizes type zymic cell inner expression to derive from the technological line of the SAM synthetic enzyme of yeast saccharomyces cerevisiae, under the regulation and control that are placed on strong promoter, make to produce a large amount of SAM synthetic enzyme in the cell, thereby make synthetic a large amount of SAM in the cell.By screening high copy transformant, we have obtained having improved 10~40 times than SAM synthetic enzyme vigor in the wild mycetocyte, the also corresponding reorganization bacterium of having improved more than 10~40 times of its intracellular SAM content.After having optimized the test tube culture condition, the SAM output of this bacterium is up to the 1.3-2.1 grams per liter, and SAM content reaches 0.10-0.20 gram/gram stem cell.
Embodiment
The present invention can further illustrate by following embodiment
Experiment material and method brief description:
1, reagent: test used Taq archaeal dna polymerase and restriction enzyme all available from GIBCOLBRL and Takara company.DNA glue reclaims test kit and plasmid DNA extraction agent box is a Promega company product.Pichia pastoris phaff Pichia pastoris host bacterium GS115 and expression plasmid pPIC3.5K are preserved by this laboratory.All the other reagent are homemade analytical pure.
2, conventional molecular biology operation
The extracting of genes of brewing yeast group DNA, yeast cell transform, gene clone, spot hybridization press Ausubel etc. method (Ausubel, F.M.et al, 1992, Short protocols in MolecularBiology, 2nd edition P13-43) carries out.
Embodiment 1
The structure (referring to Fig. 1) of recombinant expressed SAM synthetic enzyme plasmid pPIC3.5K-SAM
1, the extracting of Saccharomyces Cerevisiae in S accharomyces cerevisiae chromosomal DNA
According to the method for Ausubel etc. (Ausubel, F.M.et al, 1992, Short protocols inMolecular Biology, 2nd edition, P13-43), extracting yeast saccharomyces cerevisiae chromosomal DNA.Inoculation Wine brewing yeast strain YPH499 cultivated 16-24 hour for 28-30 ℃ in 5ml YPD substratum (10 grams per liter yeast extract pastes, 20 grams per liter peptones, 20 grams per liter glucose).The centrifugal 5min of 5000rpm/min collects thalline.After bacterial sediment washs with the cold sterilized water of 0.5ml, be resuspended in 0.5ml Sorbitol Solution USP (0.9M sorbyl alcohol, 0.1M Tris-Cl, ph8.0,0.1MEDTA), the 2 mercapto ethanol of the Zymolase of the 0.3mg/ml of adding 50ul and the 0.28M of 50ul, 37 ℃ were reacted 1 hour behind the mixing.The centrifugal 5min of 5000rpm collects thalline, respectively washes once with the cold sorbyl alcohol of 0.5ml Tris/EDTA solution (50mM Tris-HCl (pH8.0) 20ml) cold sterilized water and 20ml 1mol/L.After washing at every turn all at the centrifugal 5min of 5000rpm and collect thalline.Add 50ul 10%SDS, 65 ℃ of incubation 20min behind the mixing.The Potassium ethanoate that adds 200ul 5M subsequently, put upside down mixing after, place more than the 30min on ice.The centrifugal 3min of room temperature.Change supernatant over to a new centrifuge tube, add the centrifugal 5min of dehydrated alcohol room temperature of 1ml, inhale and go supernatant, vacuum to drain the DNA precipitation.Add 300ul TE damping fluid dissolving DNA precipitation again.Behind an amount of RNase digestion RNA, add 100% Virahol of 0.5ml, mixing solutions is separated out until the DNA precipitation.Precipitation is transferred to a new centrifuge tube, and is dissolved in the 125ul TE damping fluid.
2, design of primers and PCR reaction
S-adenosylmethionine synthetic enzyme 2 (SAM synthetic enzyme 2) gene (accession number is M23368) according to the source of the Saccharomyces cerevisiae among the GenBank, design two PCR primers:
Primer 15 ' CAGGATCCACCATGGCCAAGAGCAAACT3 '
Primer 25 ' GCGGCCGCGAATTCAGCCTAGCATAAAGAAA3 '
Comprise ribosome bind site at design gene 5 ' end primer (primer 1), introduced an EcoRI restriction enzyme site simultaneously.Gene 3 ' end primer (primer 2) has comprised near the sequence the terminator codon TAG, and has introduced a BamHI restriction enzyme site.
With the yeast saccharomyces cerevisiae chromosomal DNA is template, adds a certain amount of primer 1, primer 2, Taq archaeal dna polymerase and dNTP mixture, and the PCR reaction conditions is as follows:
94 ℃, 94 ℃ of 5 of 30sec circulations, 94 ℃ of 5min → → 40 of 30 circulations of 30sec ℃, 30sec → → → → 50 ℃, 30sec → → → → 72 ℃, 10min
72℃,75sec????????72℃,75sec
3, the clone of PCR product
The PCR product adopts PromegaDNA to reclaim the pcr amplified fragment that test kit reclaims the 1.2kb size after 1% agarose electrophoresis.The PCR product that reclaims links to each other with the pUC18 of BamHI/EcoRI double digestion after BamHI and EcoRI enzyme are cut.Gained connects product Transformed E .coli TG1 competent cell, coats the ampicillin plate screening positive clone.Adopt Promega plasmid extraction test kit extracting plasmid DNA, the gained plasmid is cut evaluation with enzyme.
The plasmid pUC-SAM that obtains, the gene of the SAM synthetic enzyme of delivering in order-checking conclusive evidence and GenBank 2 is identical.In order to screen the convenience of high copy, select for use the pPIC3.5K plasmid as the carrier of expressing SAM synthetic enzyme 2 in the born of the same parents in the pichia pastoris phaff, make that like this bacterial strain that has transformed this plasmid has dose-dependent G418 resistance, with BamHI and EcoRI SAM synthetic enzyme 2 genes are cut out, be fitted among the pPIC3.5K.
Embodiment 2 expresses the structure of the reconstitution cell of external source SAM synthetic enzyme
1, electricity transforms the preparation of pichia pastoris phaff cell
Inoculation pichia pastoris phaff bacterial strain GS115 is in 500ml YPD substratum (1 grams per liter yeast extract paste, 2 grams per liter peptones, 2 grams per liter glucose), and 28-30 ℃ is cultured to OD
600Be 1.3-1.5, the centrifugal 5min of 5000rpm/min, bacterial sediment is respectively washed once with the freezing sorbyl alcohol of the freezing sterilized water of 100ml, the freezing sterilized water of 20ml and 20ml1mol/L respectively, wash the equal centrifugal 5min of 5000rpm/min in back at every turn and collect thalline, at last the centrifugal somatic cells is suspended with the freezing sorbyl alcohol of 200 μ l 1M, promptly obtain the electric shock competent cell.
2, recombinant expression plasmid pPIC3.5K-SAM electricity transformed yeast cell
With the about 10 μ g SalI linearization for enzyme restriction of recombinant expression plasmid pPIC3.5K-SAM that make up, ethanol sedimentation reclaims linear DNA and is dissolved in the 10 μ l sterilized waters, simultaneously the identical linearization for enzyme restriction of unloaded pPIC3.5K plasmid is also reclaimed in contrast.Above-mentioned linearizing DNA is mixed with 80 μ l GS115 electricity transformant respectively, adopt GIBCOL BRL electricity conversion instrument CELL-PORATOR electric shock to transform, electric conversion condition is: voltage 1500V, electric capacity 50 μ F resistance 4K Ω.Transform the sorbyl alcohol that adds the precooling of 0.5ml 1mol/L ice bath in the cup to electricity immediately, and electric converted product is transferred to respectively in the aseptic Eppendorf tube, get 200-600 μ l and coat MD (13.4g/LYNB, 4 * 10
-4The g/L vitamin H, 10g/L glucose, 15g/L agarose) flat board.30 ℃ of cultivations are up to single bacterium colony occurring.
3, the screening of high copy bacterial strain
Growing on the MD flat board of electric transformant, adding the 1ml sterilized water, harrowing hypothallus with spreading rod.Resuspended bacterium liquid, centrifugal.The supernatant that inclines, the 0.5ml sterilized water is resuspended again.Suitably get after the dilution 100 μ l coating contain G418 (0,0.25,0.5, YPD flat board 1.0mg/ml).Cultivated 4-6 days for 30 ℃.With the G418 resistant strain that filters out, be inoculated in the YPD substratum in 96 orifice plates, cultivated 2 days for 30 ℃.The total DNA of extracting after quantitative each sample concentration of back adjustment is identical, on nylon membrane, uses P with the DNA sample spot
32The SAM synthetic enzyme 2 of mark is done probe hybridization, determines the copy number of the gene of SAM synthetic enzyme 2 according to hybridization signal.
SAM in the embodiment 3 in a small amount quick extracting cells
The centrifugal collection thalline of the fermented liquid of known cell concn, add with isopyknic 10% trichoroacetic acid(TCA) of original fermented liquid in 4 ℃ of extractings more than one hour, 12, behind centrifugal 10 minutes of the 000g, behind the membrane filtration of supernatant, therefrom get 20 microlitres, the quantitative SAM of last sample HPLC with 0.2 μ m.
High performance liquid chromatography (HPLC) standard measure of embodiment 4 SAM
Sulphur atom in the SAM molecule has positive charge, and its this characteristic makes it come analyzing and testing with ion exchange column.(4.6 * 250mm), moving phase is strong cation type ion exchange column Hypercil 10 SCX: 0.5M ammonium formiate (pH4.0), flow velocity 2.0ml/min, the optical density(OD) of detection 254nm.The SAM retention time is 25.4 minutes, because the slight fluctuations of room temperature and pH, the front and back deviation is about 1 minute.Adopt external standard method, the typical curve of doing according to the peak area of the SAM standard substance of different concns comes quantitatively.
The mensuration of embodiment 5 SAM synthetic enzyme vigor
28 ℃ cultivate 5 days after, centrifugal collection thalline (3,000g * 10min, 4 ℃), and use lysis buffer---contain the potassium phosphate buffer of 50mM pH7.4,5% glycerine (V/V), the mercaptoethanol of 5mM and the EDTA of 1mM (the benzene first miaow of adding 1mM and the PMSF of 1mM are as proteinase inhibitor) clean once.Add the long-pending pickling glass pearl of thalline monoploid and the lysis buffer of 4 times of volumes, handled lysing cell 10 minutes in 0~4 ℃ with ultrasonic wave (in maximum output, 50% work period).Granulated glass sphere and the centrifugal 10000g of cell relic * removed in 15 minutes.Crude extract keeps supernatant after 12000g * 30 are minute centrifugal.
Set the reaction mixture of 1ml, wherein contain the L-methionine(Met) of 20mM, the ATP of 20mM, the reduced glutathion of 8mM, the MgCl of 20mM
2, the KCl of 100mM, the Tris-HCl of the pH7.4 of 150mM and an amount of cell pyrolysis liquid were 37 ℃ of incubations 60 minutes.The reaction that does not add the L-methionine(Met) is as blank.After reaction finishes, add 20% perchloric acid solution of 0.5ml, the centrifugal precipitation of removing.Resulting supernatant is analyzed the content of SAM by HPLC.
After 5 days cultivations and inducing, the SAM synthetic enzyme vigor of measuring the host bacterium GS115 that obtains is 0.241 μ mol/hour/mg, and the enzyme activity of reorganization bacterium can reach 8.87 μ mol/hour/mg, and vigor has improved more than 30 times, referring to table 1.Do not having under the condition of methanol induction, do not having external source SAM synthetic enzyme to express in the reorganization bacterium, intracellular SAM content and host bacterium do not have marked difference; And when being added with methyl alcohol in the substratum, intracellular SAM synthetic enzyme vigor is compared with the host bacterium and has been improved more than 30 times, and intracellular SAM output has also improved about 30 times.
Table 1 wild-type and the SAM output of reorganization bacterium and the comparison of SAM synthetic enzyme vigor
| Host bacterium GS115 | The reorganization bacterium is through methanol induction | The reorganization bacterium is without methanol induction |
SAM output | 0.040mg/ml | ??1.34mg/ml | ??0.116mg/ml |
SAM content | 3.9mg/g?dry?cell | ??132mg/g?dry?cell | ??12.3mg/g?dry?cell |
SAM synthetic enzyme vigor | 0.241μmol/hr/mg | ??8.87μmol/hr/mg | ??0.534μmol/hr/mg |
The SAM of embodiment 6 reorganization bacterium produces fermentation
With the Pichia pastoris transformant inoculation 3ml YPD test tube that filters out, 30 ℃ of 300r/min overnight incubation, contain 10mL substratum (10g/L yeast extract paste with the access of 1% inoculum size, the 10g/L peptone, 0.05mol/l potassium phosphate buffer pH6.0,13.4g/L contain the basic nitrogenous source of the yeast of ammonium sulfate, 4 * 10
-4G/L vitamin H, 2g/L glycerine, 20g/L methyl alcohol, the L-methionine(Met) of 7.5g/L) the 50mL centrifuge tube in.30 ℃ of 300r/min cultivate.Add methyl alcohol to 0.5% since the 48th hour every 24h, add glycerine to 0.2%, cultured continuously is after 6 days, and SAM output reaches the highest (referring to Fig. 2).The output of the SAM of reorganization bacterium reaches 1.58 grams per liters, is compared to 0.04 grams per liter of host bacterium, and output has improved more than 30 times (referring to table 1).Under above-mentioned culture condition, added 0.15% methionine(Met) on the 6th day, the 8th day SAM output of this reorganization bacterium reaches 1.72 grams per liters.
Same reorganization bacterium is not when having methanol induction, that is to say that the SAM synthetic enzyme 2 that does not have reorganization is by under the situation of abduction delivering, the amount of SAM and host bacterium are relatively near (referring to table 1), the expression that this is just illustrating just because of external source SAM synthetic enzyme 2 has directly promoted increasing substantially of the interior SAM semi-invariant of cell.
Need to prove, the pichia pastoris phaff of present embodiment is the process of a high flow rate oxygen when fermentation, especially with methyl alcohol as single carbon source in---the metabolism of methyl alcohol is the process of a high oxygen consumption, the advantage (the highest above 130 grams per liter stem cells in its fermentor tank) of its high biological accumulation amount is not brought into play in fermentation fully in small test tube, in the present embodiment, the highest of dry cell weight reaches 15 grams per liters, therefore method of the present invention is applied in the industrial production increase that the SAM output of genetic engineering bacterium also can be greatly.