CN101676384B - Method for simultaneously producing glutathione and S-adenosyl methionine at high yield - Google Patents
Method for simultaneously producing glutathione and S-adenosyl methionine at high yield Download PDFInfo
- Publication number
- CN101676384B CN101676384B CN 200810042978 CN200810042978A CN101676384B CN 101676384 B CN101676384 B CN 101676384B CN 200810042978 CN200810042978 CN 200810042978 CN 200810042978 A CN200810042978 A CN 200810042978A CN 101676384 B CN101676384 B CN 101676384B
- Authority
- CN
- China
- Prior art keywords
- glutathione
- fragment
- plasmid
- sequence
- synthetase
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides a recombined strain capable of simultaneously compressing glutathione synthetase system and adenosyl methionine synthetase and a method for simultaneously producing glutathione and S-adenosyl methionine at high yield. The recombined strain comprises: fragment capable of exogenously expressing gama-glutamyl cysteine synthetase or glutathione synthetase and fragment capable of exogenously expressing adenosyl methionine synthetase and the strain is capable of expressing glutathione synthetase system and/or adenosyl methionine synthetase, thereby fermenting glutathione and adenosyl methionine. The recombined strain is capable of simultaneously producing glutathione and adenosyl methionine by fermentation at high yield and independently producing glutathione or adenosyl methionine by fermentation.
Description
Technical field
The invention belongs to bioengineering field, specifically, relate to the method for a kind of while high-yield glutathione and S-adenosylmethionine.
Background technology
Gsh, namely γ-GSH is called for short GSH.It by precursor substance Pidolidone, Cys and glycine through gamma-glutamylcysteine synthetase (GSH I, GSH1) and glutathione synthetase (GSH II, GSH2) catalyze and synthesize, the two consists of glutathione synthetases, and wherein gamma-glutamylcysteine synthetase is considered to the rate-limiting enzyme in the GSH route of synthesis.GSH can effectively dispose the free radical in the human body, purifies the environmental pollution in the human body, promotes HUMAN HEALTH, all has a wide range of applications in clinical medicine, foodstuffs industry and associated biomolecule research field.Its industrial production mainly contains extraction process, chemical synthesis, fermentation method and enzyme process etc., along with technique and method constantly are improved, adopt fermentative Production GSH to become and produces one of the most general method of GSH.
S-adenosylmethionine (SAM is called for short SAM-e or SAM) is the important molecule that extensively exists in a kind of biomass cells, and it is catalyzed and synthesized by adenosine methilanin synthase.SAM safeguards the indispensable important living matter of function of human body, to treatment hepatopathy, treatment depressive illness, the anti-ageing preferably effect of having waited for a long time.It mainly is with yeast-leavened mode manufacture.
Because gsh and adenosylmethionine belong to the sulfur-containing amino acid derivative, anabolic process in vivo closely links to each other, and the two can use fermentative Production, therefore, utilize same strain fermentation to produce simultaneously gsh and adenosylmethionine has certain possibility.And, Liu Hui etc. also once report utilize Wine brewing yeast strain zju1 ferment simultaneously gsh and adenosylmethionine (H.Liu et al.Process Biochemistry39 (2004), p1993-1997), but the report according to the document, adenosylmethionine and gsh that its fermentation obtains are respectively 45mg/g dry weight and 18mg/g dry weight, be 1.35g/L and 0.54g/L, output is lower, therefore, be necessary to provide a kind of new method, with while high-yield glutathione and S-adenosylmethionine.
Summary of the invention
The object of the invention is to, the recombinant bacterial strain of a kind of coexpression gamma-glutamylcysteine synthetase and adenosine methilanin synthase is provided, with while high expression level glutathione synthetases and adenosine methilanin synthase.
A further object of the invention is, a kind of coexpression glutathione synthetase and adenosine methilanin synthase recombinant bacterial strain are provided.
A further object of the invention is, a kind of method of producing simultaneously gsh and adenosylmethionine is provided.
The recombinant bacterial strain of coexpression gamma-glutamylcysteine synthetase provided by the invention and adenosine methilanin synthase comprises the fragment of ectogenic expression gamma-glutamylcysteine synthetase and the fragment of ectogenic expression adenosine methilanin synthase.
According to a preferred embodiment of the present invention, bacterial strain provided by the invention also comprises the fragment of ectogenic expression glutathione synthetase.
According to a preferred embodiment of the present invention, the exogenous fragment that provides is integrated in karyomit(e), perhaps is present in expression vector, and described carrier is plasmid or artificial chromosome.
According to a preferred embodiment of the present invention, the fragment of expressing gamma-glutamylcysteine synthetase in the recombinant plasmid that provides comprises the sequence of the gamma-glutamylcysteine synthetase of encoding and the strong promoter of described sequence upstream; The fragment of expressing adenosine methilanin synthase comprises the sequence of the adenosine methilanin synthase of encoding and the strong promoter of described sequence upstream.
According to a preferred embodiment of the present invention, the fragment of expressing glutathione synthetase in the recombinant plasmid that provides comprises the sequence of coding for glutathion synthetic enzyme and the strong promoter sequence of described sequence upstream.
According to a preferred embodiment of the present invention, the bacterial strain that provides is pichia spp or yeast saccharomyces cerevisiae.
The recombinant bacterial strain of coexpression glutathione synthetase provided by the invention and adenosine methilanin synthase comprises the fragment of ectogenic expression glutathione synthetase and the fragment of exogenous expression's adenosine methilanin synthase.
According to a preferred embodiment of the present invention, the exogenous fragment that provides is integrated in karyomit(e), perhaps is present in expression vector, and described carrier is plasmid or artificial chromosome.
According to a preferred embodiment of the present invention, the fragment of expressing glutathione synthetase in the recombinant plasmid that provides comprises the sequence of coding for glutathion synthetic enzyme and the strong promoter of described sequence upstream; The fragment of described expression adenosine methilanin synthase comprises the sequence of the adenosine methilanin synthase of encoding, and the strong promoter of described sequence upstream.
The method of production gsh provided by the invention and adenosylmethionine comprises above-mentioned recombinant bacterial strain fermentation culture, produces the step of gsh and adenosylmethionine.
In the fermented liquid that the strain fermentation that uses coexpression adenosine methilanin synthase provided by the invention and glutathione synthetases obtains, after adding Cys and METHIONINE, further the content of the fermented liquid GSH-PX activity that obtains of fermentation and S-adenosylmethionine all is significantly higher than gsh that the coproduction fermentation in the existing report obtains and the content of S-adenosylmethionine, and add separately Cys or METHIONINE, the gsh that its fermentation obtains and/or the content of S-adenosylmethionine are also very high.
Description of drawings
Fig. 1 is the GSH1 of pcr amplification acquisition and the detected result of GSH2, and wherein, swimming lane 1 is GSH1, and swimming lane 2 is GSH2.
Fig. 2 is the structural representation of plasmid pGKG1G2.
Fig. 3 is the structural representation of plasmid pYESG1G2.
Fig. 4 is the structural representation of plasmid pSH62SAM.
Fig. 5 is the detected through gel electrophoresis result of HZ111, wherein, swimming lane 1 is for using the Auele Specific Primer GAP-50 and the GSH2R500 that detect GSH2 to carry out the result that pcr amplification obtains, swimming lane 2 is for using the Auele Specific Primer GAP-50 and the GSH1R650 that detect GSH1 to carry out the result that pcr amplification obtains, and swimming lane 3 is for using the Auele Specific Primer GAP-50 and the SAMR650 that detect the SAM synthetic enzyme to carry out the result that pcr amplification obtains.
Fig. 6 is the detected through gel electrophoresis result of HZ203, wherein, swimming lane 1 is for using the Auele Specific Primer GAL-200 and the GSH2R500 that detect GSH2 to carry out the result that pcr amplification obtains, swimming lane 2 is for using the Auele Specific Primer GAL-200 and the GSH1R650 that detect GSH1 to carry out the result that pcr amplification obtains, and swimming lane 3 is for using the Auele Specific Primer GAL-200 and the SAMR650 that detect the SAM synthetic enzyme to carry out the result that pcr amplification obtains.
Bacterial strain HZ111 submits Chinese Typical Representative culture collection center (CCTCC) preservation that is positioned at Wuhan University on July 11st, 2008, and preserving number is CCTCC M 208107, and Classification And Nomenclature is pichia pastoris phaff (Pichiapastoris).
Embodiment
Below in conjunction with specific embodiment, the invention will be further described.Should be understood that following examples are only for explanation the present invention but not for limiting scope of the present invention.
The experimental technique of unreceipted actual conditions in the following example, usually according to normal condition, the scheme that conditioned disjunction manufacturer described in " molecular cloning: laboratory manual " (New York:Cold Spring Harbor Laboratory Press, 1989) provides is carried out.
In following embodiment of the present invention, the glue of use reclaims test kit available from Shanghai China Shun biotechnology company limited.
In following embodiment of the present invention, cloning vector pMD18-T is available from Takara; Plasmid pPIC3.5K, pGAPZB, pYES2 are available from Invitrogen, and pSH47, pSH62, pUG6 are obtained from EUROSCARF.
In following embodiment of the present invention, the T4DNA ligase enzyme of use is available from Takara; The KOD archaeal dna polymerase is available from Toyobo; T7DNA polysaccharase, Taq archaeal dna polymerase, Klenow enzyme, restriction enzyme BamHI, BglII, EcoRV, SmaI, Kpn2I, PvuII, SwaI etc. are all available from Fermentas.
In following embodiment of the present invention, the yeast saccharomyces cerevisiae of use (Saccharomyces cerevisiae) BY4742 is obtained from EUROSCARF; Bacillus coli DH 5 alpha is available from Takara; Pichia spp (Pichia pastoris) Host Strains GS115 is available from Invitrogen.
In following embodiment of the present invention, the culture medium prescription of use is as follows:
The prescription of YPD substratum is: 1% yeast extract, 2% peptone, 2% glucose;
The prescription of YPG substratum is: 1% yeast extract, 2% peptone, 2% semi-lactosi;
The prescription of BMGY substratum is: 1% yeast extract, 2% peptone, 100mM potassium phosphate buffer (pH6.0), 1.34% yeast nitrogen (YNB), 4 * 10
-5The % vitamin H, 1% glycerine;
The prescription of MD substratum is: 1.34% yeast nitrogen, 4 * 10
-5The % vitamin H, 1% glucose;
The prescription of SD substratum is: 0.67% yeast nitrogen, and 1% glucose, and add as required the nutritive ingredients such as required amino acid and/or base.
When configuring the solid plate substratum of above-mentioned substratum, in above-mentioned prescription, add 2% agar and get final product.
In following embodiment of the present invention, the preparation of pichia spp competent cell and conversion are all carried out according to the method that provides in the Pichia Expression Kit of the Invitrogen company handbook.The preparation of yeast saccharomyces cerevisiae competent cell and conversion, reference: Qin Yujing, Jin Jianling, Bao Xiaoming, Gao Dong affect the condition of yeast saccharomyces cerevisiae electric shock transformation efficiency, journal of Shandong university (natural science edition), 02 phase in 1999.Wherein, electric revolving cup is 0.2mm, and electric conversion instrument uses the Micropulser electricity conversion instrument of bio-rad, and electric Transformation Parameters is 1.5kV, 6ms.
In following embodiment of the present invention, take the HPLC method to detect the respectively reference of concrete detection method:
The detection reference of GSH output: Wang Chun, Yan Weimin, foundation and the checking of glutathione for injection quality standard analytical procedure---HPLC method, Chinese Journal of Clinical Pharmacy the 3rd phase of the 14th volume in 2005.
The detection reference of SAM output: Wu Wei, Jinsong ZHANG, Yu Jiansheng, Yao Lidong, Xie Zhipeng, the related substance in high effective liquid chromatography for measuring Isosorbide-5-Nitrae-butane disulfonic acid ademetionine raw material and the preparation, medical Leader, the 7th phase of 27 volumes in 2008.
In the present embodiment, the expression glutathione synthetases that is used for pichia spp or yeast saccharomyces cerevisiae and the plasmid of expressing the SAM synthetic enzyme have been made up respectively first, the above-mentioned plasmid that then will build is transformed into respectively in corresponding pichia spp or the yeast saccharomyces cerevisiae, thereby but makes up the bacterial strain that obtains coexpression glutathione synthetases and SAM synthetic enzyme in pichia spp and yeast saccharomyces cerevisiae.
1.1, GSH1, GSH2, SAM fragment amplification
In the present embodiment, designed first the primer that is used for amplification, then extracting is increased respectively by PCR and has been obtained the fragment of GSH1, GSH2 and SAM synthetic enzyme 2 as the genome of amplification template, specific as follows:
GSH1, GSH2 sequence (EF633694, EF633695) according to the Genebank report design following 4 primers, are used for clone GSH1, GSH2 sequence:
GSH1UP：
ATCGATACGATGGGACTCTTAGCTTTGGG；
GSH1DNM：CAATTGTTAACATTTGCTTTCTATTG；
GSH2UP：
TTCGAAACGATGGCACACTATCCACCTTC；
GSH2DNE：GAATTCCTAGTAAAGAATAATACTGTC。
Wherein, GSH1UP and GSH1DNM are used for amplification GSH1 coding region; GSH2UP and GSH2DNE are used for amplification GSH2 coding region; Underscore on GSH1UP and GSH2UP sign be respectively AsuII restriction enzyme site and the ClaI restriction enzyme site of introducing at GSH1UP and GSH2UP.
SAM synthetic enzyme 2 sequences (accession number M23368) according to the Genebank report design following 2 primers, are used for clone SAM synthetic enzyme 2 sequences:
SAMUP：TAT
TTCGAAACCATGGCCAAGAGCAAAACT
SAMDN：GCGGCCGC
GAATTCAGCCTAGCATAAAGAAA
Wherein, the underscore among SAMUP and the SAMDN identifies respectively is the NspV enzyme introduced at SAMUP and SAMDN and the restriction enzyme site of EcoRI enzyme.
Extracting obtains yeast saccharomyces cerevisiae BY4742 genome.
Take yeast saccharomyces cerevisiae BY4742 genome as template, take primer GSH1UP and GSH1DNM and primer GSH2UP and GSH2DNE as primer pair, carry out pcr amplification respectively, then pcr amplification product is carried out respectively detected through gel electrophoresis, detected result is as shown in Figure 1.According to the result of Fig. 1, the size of the product of acquisition is respectively 1.5kb, 2.0kb, meets the expection size of GSH1, GSH2 product.
Use glue to reclaim test kit and reclaim acquisition GSH1, GSH2 fragment.
Take yeast saccharomyces cerevisiae BY4742 genome as template, take SAMUP and SAMDNM as primer pair, carry out pcr amplification, then pcr amplification product is carried out respectively detected through gel electrophoresis.Detected result demonstration, the product of acquisition meet the expection size of SAM synthetic enzyme product.
Use glue to reclaim test kit and reclaim acquisition SAM synthetic enzyme fragment.
1.2, express the structure of the Pichi strain of SAM synthetic enzyme and glutathione synthetases simultaneously
1.2.1, the glutathione synthetases expression vector establishment
Because the PCR reaction obtains in the step 1.1 GSH1, GSH2 are flat end productses, be difficult for carrying out subclone, therefore, operate for ease of subclone, use the Taq enzyme that GSH1, GSH2 are processed, for GSH1, GSH2 end add an outstanding A, to match with the terminal outstanding T of pMD18-T carrier, thereby so that follow-up subclone step can obtain higher connection cloning efficiency, concrete steps are as follows:
Reclaim in GSH1 that the test kit purifying obtains, the GSH2 fragment to glue and to add the Taq enzyme, in 72 ℃ of reaction 10min, reaction system is as follows:
10 * Taq damping fluid, 5 μ l, 2.5mM dATP4 μ l, 25mM MgCl
23 μ l, the flat terminal fragment 20uL of GSH1, GSH2, Taq archaeal dna polymerase 0.2uL adds deionized water to system cumulative volume 50uL.
After reaction finishes, use glue to reclaim the test kit purifying and reclaim reaction product.
With reaction product and the pMD18-T carrier behind the purifying that obtains, use the T4DNA ligase enzyme, to spend the night in 16 ℃ of connections, reaction system is as follows:
PCR product after 5 μ L process, 0.5 μ L pMD18-T carrier, 1 μ L T4DNA ligase enzyme damping fluid, 3 μ L aseptic deionized waters, 0.5 μ L T4DNA ligase enzyme.
Connect product and transform bacillus coli DH 5 alpha and be coated with the LB flat board that contains 50 μ g/ml penbritins, choose transformant after the cultivation and identify, according to qualification result, finally obtain two plasmid pMDGSH1, pMDGSH2.
Plasmid pMDGSH1 and pMDGSH2 comprise respectively GSH1 through sequence verification, and GSH2 coding region (GSH1, GSH2 coding region sequence are respectively shown in SEQ ID NO:1,2), and also the coding region does not have to cause the sudden change of amino-acid residue variation.
From pMDGSH1, pMDGSH2, the coding region of GSH1 and GSH2 gene is cut out with AsuII/SalI and ClaI/SalI respectively that (introduce when the pcr amplification by primer in AsuII and ClaI site, the SalI site is on the pMD18-T carrier), connect into respectively among the expression vector pGAPZB that the AsuII/XhoI enzyme cuts (available from Invitrogen, contain the GAP promotor), obtain two plasmid pGZG1, pGZG2.
Plasmid pGZG1 and pGZG2 comprise respectively GSH1 through sequence verification, GSH2 coding region (GSH1, the GSH2 coding region sequence is respectively shown in SEQ ID NO:1,2), wherein, GSH1, GSH2 coding region place respectively under the GAP promotor, and the coding region suddenlys change without amino-acid residue.
Because the GAP promotor is the composing type strong promoter, therefore, these two plasmids can be distinguished constitutive expression GSH1 and GSH2.
The BamHI/BglII enzyme is cut the pGZG2 plasmid, obtains the GSH2 expressed sequence, then it is connected into the pGZG1 plasmid that uses the BglII enzyme to cut, and obtains the pGZG1G2 plasmid.After testing, this plasmid can composing type coexpression GSH1 and GSH2.
Because pGZG1, when pGZG2 and three Plasmid Transformation pichia spp of pGZG1G2, the homologous region that can restructuring occur with genome is hundreds of bp only all, and integration efficiency is lower, is not easy to operation, therefore need to be optimized transformation to these three plasmids.The mode of transforming is to introduce one section sequence with Host Strains genome homology in this plasmid.Long homologous region can obtain higher integration efficiency.
The bacterial strain that the present embodiment uses is as the derivative bacterium of GS115, with the his4 gene of a mutant; Therefore, the mode of Optimizing Reconstruction is to introduce the HIS4 gene segment of wild-type as homologous region in co-expression plasmid.The wild-type HIS4 gene fragment of introducing and Host Strains with mutant his4 gene fragment except the difference of several base pairs, almost completely identical, homologous region reaches about 3kb, therefore can obtain higher integration efficiency.
And the recombinant bacterium that finally obtains after the conversion will obtain wild-type HIS4 gene, thereby can possess the Histidine synthesis capability, show as prototroph; The prototroph bacterial strain is more convenient for, and next step implements fermentative production.
Concrete Optimizing Reconstruction process is as follows:
EcoRV cuts plasmid pPIC3.5K, obtains size and is fragment 5.0kb, that comprised HIS4, and then the flush end with this fragment is connected into the pGZG1G2 that uses the SmaI single endonuclease digestion, thereby obtains plasmid pGKG1G2.Plasmid pGKG1G2 is checked order, and sequencing result is analyzed the structural representation that obtains pGKG1G2, the result as shown in Figure 2.In this plasmid, GSH1 and GSH2 coding region place respectively under two GAP promotors.According to the detected result of Fig. 2 and SDS-PAGE, plasmid pGKG1G2 can composing type coexpression GSH1 and GSH2.
Simultaneously also pGZG1 and pGZG2 have been carried out same transformation.The same EcoRV that uses cuts plasmid pPIC3.5K, obtains size and is fragment 5.0kb, that comprised HIS4, and then the flush end with this fragment is connected into pGZG1 and the pGZG2 that uses the SmaI single endonuclease digestion, thereby obtains plasmid pGKG1 and pGKG2.
1.2.2, express the structure of the pichia spp of SAM synthetic enzyme
With reference to the method among the CN02112087, use the AsuII/EcoRI enzyme to cut the PCR product that contains SAM synthetic enzyme 2 gene fragments, be connected into the pGAPZB carrier that same AsuII/EcoRI enzyme is cut.Obtain plasmid pGZSAM.
Plasmid pGZSAM comprises SAM synthetic enzyme coding region (SAM synthetic enzyme coding region sequence is shown in SEQID NO:3) through sequence verification, and the coding region does not have to cause the sudden change of amino-acid residue variation.
PGZSAM Plasmid Transformation GS115 is that the YPD flat board of 100mg/L Zeocin screens transformant containing concentration, therefrom filters out the higher strain bacterial strain of output, with this bacterial strain called after HZ102.
1.2.3, the structure of the pichia spp of coexpression SAM synthetic enzyme and glutathione synthetases
With the pGKG1G2 plasmid that extracting obtains, use the Kpn2I linearization for enzyme restriction, electricity changes HZ102 over to, then converted product is coated the MD flat board, and 30 ℃ are cultured to transformant and grow.
Choose arbitrarily some transformants, shake flask fermentation is cultivated, and the GSH in the detection fermented liquid and SAM, then, therefrom select a strain output the higher person, with its called after HZ111, this bacterial strain is submitted Chinese Typical Representative culture collection center (CCTCC) preservation that is positioned at Wuhan University on July 11st, 2008, and preserving number is CCTCC M208107.
The design special primer is for detection of the coexpression bacterial strain, and primer sequence is as follows respectively:
GAP-50：TGGTTTCTCCTGACCCAAAG
GSH2R500：GGCCTGCAAATGACACTGAC
GSH1R650：TCCTGATGGATGCTGTCAAG
SAMR500：CATCTGCCATAGCCATGTTC
Wherein, GAP-50 and GSH1R650 are used for the insertion that PCR detects GSH1; GAP-50 and GSH2R500 are used for the insertion that PCR detects GSH2; GAP-50 and SAMR500 are for detection of the insertion of SAM synthetic enzyme.
Total DNA of extracting HZ111 uses respectively primer GAP-50 and GSH1R650, GAP-50 and GSH2R500GAP-50 and SAMR500 as primer pair, carries out the PCR reaction, and with the product process agarose gel electrophoresis that pcr amplification obtains, the result as shown in Figure 5.According to the result of Fig. 5, obtain length and be respectively 0.7kb, 0.5kb, the fragment of 0.5kb, according to this result, GSH1, GSH2, SAM synthetic enzyme expressed sequence all correctly insert corresponding bacterial strain.
HZ111 is being contained YPD (1% yeast extract paste, 2% peptone, 2% glucose) add simultaneously precursor methionine(Met), halfcystine in the substratum, shake flask fermentation is after 3 days, detect fermented liquid, the result shows the associating high yield that uses the above-mentioned bacterial strains fermentation can obtain GSH and SAM.
1.2.4, the structure of coexpression SAM synthetic enzyme and glutathione synthetases part member's (being GSH1 or GSH2) pichia spp
PGKG1 and pGKG2 plasmid that extracting obtains are used respectively the Kpn2I linearization for enzyme restriction, and electricity changes HZ102 over to respectively, then converted product is coated the MD flat board, and 30 ℃ are cultured to transformant and grow.
Choose arbitrarily some transformants, shake flask fermentation is cultivated, and detects GSH and SAM in the fermented liquid, then, therefrom selects respectively a strain output the higher person, with its called after HZ123 and HZ124.
Total DNA of extracting HZ123 uses respectively primer GAP-50 and GSH1R650, GAP-50 and SAMR500 as primer pair, carries out the PCR reaction, and with the product process agarose gel electrophoresis that pcr amplification obtains, the result is shown in Fig. 5.Obtain length and be respectively 0.7kb, the fragment of 0.5kb, according to this result, GSH1, SAM synthetic enzyme expression cassette all insert.HZ123 can coexpression SAM synthetic enzyme and GSH1.
Total DNA of extracting HZ124, use respectively primer GAP-50 and GSH2R500, GAP-50 and SAMR500 as primer pair, carry out the PCR reaction, product process agarose gel electrophoresis with the pcr amplification acquisition, the result as shown in Figure 5, the length of the fragment that obtains is 0.5kb, and according to this result, GSH1, SAM synthetic enzyme expression cassette all insert.HZ124 can coexpression SAM synthetic enzyme and GSH2.
HZ123, HZ124 are being contained YPD (1% yeast extract paste, 2% peptone, 2% glucose) add simultaneously precursor methionine(Met), halfcystine in the substratum, behind the shake flask fermentation 3 days, detect fermented liquid, the result shows accumulation when using the above-mentioned bacterial strains fermentation can obtain GSH and SAM, and GSH output all is higher than HZ102 in contrast.
HZ123, HZ124 and HZ111 all can highly unite product GSH and SAM, but Comparatively speaking the output of HZ111 is higher than HZ123 and HZ124, therefore, in following amplification fermenting experiment, only uses HZ111 to amplify fermenting experiment.
1.3, the structure of the Wine brewing yeast strain of coexpression SAM synthetic enzyme and glutathione synthetases
In the present embodiment, made up respectively the plasmid of expressing GSH1, GSH2 and the plasmid of expressing the SAM synthetic enzyme, then it has successively been changed in the Saccharomyces cerevisiae host bacterium, obtained to contain the Wine brewing yeast strain of above-mentioned two plasmids, detailed process is as follows:
1.3.1, design of primers and pcr amplification GAL promotor
Design primer T7HpaI and T3NotI, sequence is as follows:
T7HpaI：CGGTTAACTAATACGACTCACTATAGGG；
T3NotI：ATGCGGCCGCAATTAACCCTCACTAAAGGGAA。
Extracting obtains saccharomyces cerevisiae expression pSH47 plasmid.
Take primer T7HpaI and T3NotI as primer pair, as masterplate, then pcr amplification, and detecting uses glue to reclaim test kit and reclaims the PCR product, obtains to comprise the fragment of GAL promotor with saccharomyces cerevisiae expression pSH47 plasmid.
1.3.2, the structure of the Wine brewing yeast strain of coexpression SAM synthetic enzyme and glutathione synthetases
In the present embodiment, at first made up the plasmid with GAL promotor, being used for subsequent experimental, specific as follows:
The PCR that obtains among the embodiment 1.3.1 is reclaimed product cloning enter among the pMD18-Tsimple, obtain plasmid pMD-GAL; Use the SalI enzyme to cut the pUG6 plasmid, re-use the end-filling that the Klenow enzyme is cut enzyme the fragment of rear acquisition, and certainly connect, to remove the SalI site of pUG6 plasmid.Then cut out from the pUG6 plasmid of having removed the SalI site with NotI and contain the kanMX sequence, and the kanMX sequence that obtains is connected in the pMD-GAL plasmid, obtain plasmid pWP01.After testing, plasmid pWP01 has the GAL promotor, and has the kanMX gene as selection markers.
Then, make up respectively the plasmid of coexpression GSH1 and GSH2 and the plasmid of expression SAM synthetic enzyme, specific as follows:
The GSH2 gene and the GSH1 gene that obtain among the embodiment 1.1 are cloned into respectively among plasmid pWP01 and the pYES2, obtain recombinant plasmid, with recombinant plasmid difference called after pGALKGSH2 and the pYESGSH1 that obtains.
Plasmid pGALKGSH2 and pYESGSH1 comprise respectively GSH1 through sequence verification, and GSH2 coding region (GSH1, GSH2 coding region sequence are respectively shown in SEQ ID NO:1,2), and also the coding region does not cause the sudden change of amino-acid residue variation.
Use PvuII that the fragment that contains GAL promotor and GSH2 coding region among the pGALKGSH2 is cut out, then the fragment that obtains is connected in the pYESGSH1 plasmid that SwaI singly cuts the plasmid called after pYESG1G2 of acquisition.After testing, plasmid pYESG1G2 can coexpression GSH1 and GSH2.
The SAM synthase gene that obtains among the embodiment 1.1 is cloned among the plasmid pSH62, obtains recombinant plasmid, with the plasmid called after pSH62SAM that obtains.
Plasmid pSH62SAM comprises SAM synthetic enzyme coding region (SAM synthetic enzyme coding region sequence is shown in SEQ ID NO:3) through sequence verification, and the coding region does not cause the sudden change of amino-acid residue variation.
By transforming first plasmid pYESG1G2, transform again the method for plasmid pSH62SAM, make up the bacterial strain of coexpression glutathione synthetases and SAM synthetic enzyme, concrete grammar is as follows:
Plasmid pYESG1G2 electricity is transformed in the yeast saccharomyces cerevisiae BY4742 competent cell, screens transformant at the SD flat board that does not contain uridylic, obtain the bacterial strain of coexpression GSH1 and GSH2, therefrom select the highest strain bacterial strain of output, called after HZ201.
Preparation yeast saccharomyces cerevisiae HZ201 Electroporation-competent cells, then plasmid pSH62SAM electricity is transformed among the yeast saccharomyces cerevisiae HZ201, screen transformant at the SD flat board that does not contain uridylic and Histidine, obtain the bacterial strain of coexpression glutathione synthetases and SAM synthetic enzyme, therefrom select the highest strain bacterial strain of expression amount, called after HZ204.
By transforming first plasmid pSH62SAM, transform again the method for plasmid pYESG1G2, make up the bacterial strain of coexpression glutathione synthetases and SAM synthetic enzyme, concrete grammar is as follows:
Plasmid pSH62SAM is transformed in the competent cell of yeast saccharomyces cerevisiae BY4742, by screening transformant at the SD flat board that does not contain Histidine, obtains to express the bacterial strain of SAM synthetic enzyme, therefrom select the highest strain bacterial strain of expression amount, called after HZ202.
Preparation yeast saccharomyces cerevisiae HZ202 Electroporation-competent cells, then plasmid pYESG1G2 electricity is transformed among the yeast saccharomyces cerevisiae HZ202, do not contain on the SD flat board of uridylic and Histidine and screen transformant, obtain the bacterial strain of coexpression glutathione synthetases and SAM synthetic enzyme, therefrom select the highest strain bacterial strain of expression amount, called after HZ203.
The design primer is for detection of the coexpression bacterial strain, and primer sequence is as follows respectively:
GAL-200：TGGTTTCTCCTGACCCAAAG
GSH2R500：GGCCTGCAAATGACACTGAC
GSH1R650：TCCTGATGGATGCTGTCAAG
SAMR500：CATCTGCCATAGCCATGTTC
Wherein, GAL-200 and GSH1R650 are for detection of the insertion of GSH1; GAL-200 and GSH2R500 are for detection of the insertion of GSH2; GAL-200 and SAMR500 are for detection of the insertion of SAM synthetic enzyme.
Total DNA of extracting HZ203, HZ204, then use respectively primer GAL-200 and GSH1R650, GAL-200 and GSH2R500, GAL-200 and SAMR500 as primer pair, carry out the PCR reaction, product process agarose gel electrophoresis with the pcr amplification acquisition, the result shows that having obtained length scale is respectively 0.9kb, 0.7kb the fragment of 0.7kb has GSH1, GSH2, SAM synthetic enzyme expressed sequence thereby can prove conclusively among described bacterial strain HZ203, the HZ204.
HZ203, HZ204 are being contained YPG (1% yeast extract paste, 2% peptone, 2% semi-lactosi) adds simultaneously precursor methionine(Met), halfcystine in the substratum, behind the shake flask fermentation 3 days, detect fermented liquid, the result shows the associating high yield that uses above-mentioned 2 kinds of strain fermentations all can obtain GSH and SAM.
According to the above results, in recombinant bacterial strain, insert ectogenic GSH1 and/or GSH2 sequence, and the SAM sequence, can effectively improve GSH1 and/or GSH2 in the recombinant bacterial strain, and the expression amount of SAM synthetic enzyme, and then after having added precursor substance, improve the output of GSH and SAM.
Although in embodiments of the invention 1; pass through construction recombination plasmid; and then made up the recombinant bacterial strain of associating high yield GSH and SAM; but to those skilled in the art; on basis of the present invention, by other modes such as structure artificial chromosomes, can and then make up the recombinant bacterial strain of associating high yield GSH and SAM; being apparent, also is the claimed content of the present invention therefore.Simultaneously; according to content of the present invention and spirit; sequence with ectogenic coding GSH1 and/or GSH2 and SAM; transform bacterial strain; thereby also can obtain the recombinant bacterial strain of associating high yield GSH and SAM, this also is apparent to those skilled in the art; therefore, also be the claimed content of the present invention.Simultaneously; according to content of the present invention and spirit; transform the sequence of the original GSH1 of bacterial strain and/or GSH2 and SAM by original position; be strong promoter with the original promoter engineering in its upstream; also can obtain the recombinant bacterial strain of associating high yield GSH and SAM, this also is apparent to those skilled in the art; therefore, also be the claimed content of the present invention.
Because HZ203 and HZ204 all can unite high yield GSH and SAM, therefore, in following amplification test, only use HZ203 to amplify fermenting experiment.
Choose the single colony inoculation of three days HZ111 of growth to the YPD substratum of 30ml, 30 ℃, 240rpm cultivates 20h, then access the YPD substratum of 320ml, 30 ℃, 240rpm cultivates about 8h, among the fermention medium BMGY of access 3.15L (7.5L fermentor tank), add the defoamer (polyoxyethylene polyoxypropylene glyceryl ether, i.e. bubble enemy) of final concentration 0.01%, ferment, temperature is controlled at 30 ℃, flows glycerol adding in the fermenting process, to satisfy the Growth of Cells needs, by Feeding ammonia water, pH is controlled at 6.0.Adding Cys and the total amount that total amount is 30 grams when fermenting to 30h is the METHIONINEs of 30 grams, proceed fermentation, fermentation detects to 70h's, and detected result shows, the content of fermented liquid GSH-PX activity is 3.0g/L, and the content of S-adenosylmethionine is 3.5g/L.
Adding separately respectively total amount during to 30h in fermentation is the Cys of 30g or to add separately total amount be 30 METHIONINEs that restrain, put tank when continuing to ferment to 70h, and detect, detected result shows, when the interpolation total amount was the Cys of 30g separately, the output of fermented liquid GSH-PX activity was 6.2g/L; When the interpolation total amount was the METHIONINE of 30 grams separately, the output of S-adenosylmethionine was 3.9g/L in the fermented liquid.
The prescription of the substratum that uses in the present embodiment following (g/L):
Semi-lactosi 40, yeast extract paste 20, peptone 40, ammonium sulfate 2.0, urea 2.0, KH
2PO
41.5, MgSO
47H
2O0.5, ZnSO
47H
2O
4.0 * 10
-3, FeSO
47H
2O3.0 * 10
-3, MnCl
24H
2O0.3 * 10
-3, CuSO
45H
2O0.5 * 10
-3, CaCl
22H
2O1.0 * 10
-3
The single colony inoculation of two days HZ203 of picking growth is to the above-mentioned substratum of 30ml, and 30 ℃, 240rpm cultivates 20h, then access the above-mentioned substratum of 320ml, 30 ℃, 240rpm cultivates about 6h, in the above-mentioned fermention medium of access 3.15L (7.5L fermentor tank), add the defoamer bubble enemy of final concentration 0.01%, ferment, temperature is controlled at 30 ℃, stream is with semi-lactosi in the fermenting process, to satisfy the Growth of Cells needs, by Feeding ammonia water, pH is controlled at 6.0.Adding Cys and the total amount that total amount is 30 grams when fermenting to 25h is the METHIONINEs of 30 grams, proceed fermentation, fermentation detects time 70h, and detected result shows, the content of fermented liquid GSH-PX activity is 2.1g/L, and the content of S-adenosylmethionine is 2.9g/L.
It is the Cys of 30g or to add separately total amount be 30 METHIONINEs that restrain that total amount is added separately respectively in fermentation during to 25h, detect when then continuing to ferment to 70h, detected result shows, adds separately total amount when being the Cys of 30g, and the output of fermented liquid GSH-PX activity is 2.3g/L; When the interpolation total amount was the METHIONINE of 30 grams separately, the output of S-adenosylmethionine was 3.1g/L in the fermented liquid.
In sum, in the fermented liquid that behind the strain fermentation that uses coexpression SAM synthetic enzyme provided by the invention and glutathione synthetases, obtains, after adding Cys and METHIONINE, further the content of the fermented liquid GSH-PX activity that obtains of fermentation and S-adenosylmethionine all is significantly higher than gsh that the coexpression fermentation in the existing report obtains and the content of S-adenosylmethionine, and add separately Cys or METHIONINE, the gsh that its fermentation obtains and the content of S-adenosylmethionine are also very high.
Sequence table
＜110〉Shanghai Institute for Biological Sciences China Academy of Sciences, Huzhou Research Center of Industrial Biotechnology
＜120〉method of a kind of while high-yield glutathione and S-adenosylmethionine
<130>P5081044
<160>3
<170>PatentIn?version3.1
<210>1
<211>2087
<212>DNA
＜213〉intestinal bacteria
<400>1
<210>2
<211>1513
<212>DNA
＜213〉intestinal bacteria
<400>2
<210>3
<211>1821
<212>DNA
＜213〉intestinal bacteria
<400>2
Claims (4)
1. the restructuring yeast strains of a coexpression glutathione synthetases and adenosine methilanin synthase is characterized in that, described glutathione synthetases is gamma-glutamylcysteine synthetase and glutathione synthetase;
Correspondingly, described restructuring yeast strains comprises fragment and the fragment of ectogenic expression glutathione synthetase and the fragment of ectogenic expression adenosine methilanin synthase of ectogenic expression gamma-glutamylcysteine synthetase;
Wherein, the fragment of described expression adenosine methilanin synthase is the sequence of the coding adenosine methilanin synthase in yeast saccharomyces cerevisiae source, and the strong promoter sequence of described sequence upstream;
The fragment of described expression gamma-glutamylcysteine synthetase is the sequence of the coding gamma-glutamylcysteine synthetase in yeast saccharomyces cerevisiae source, and the strong promoter sequence of described sequence upstream;
The fragment of described expression glutathione synthetase is the sequence of the coding for glutathion synthetic enzyme in yeast saccharomyces cerevisiae source, and the strong promoter sequence of described sequence upstream.
2. restructuring yeast strains as claimed in claim 1 is characterized in that, described strong promoter is GAP promotor or GAL promotor.
3. restructuring yeast strains as claimed in claim 1 is characterized in that, described yeast is pichia spp or yeast saccharomyces cerevisiae.
4. a method of producing gsh and adenosylmethionine is characterized in that, described method is produced gsh and adenosylmethionine with each described restructuring yeast strains fermentation culture among the claim 1-3.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200810042978 CN101676384B (en) | 2008-09-16 | 2008-09-16 | Method for simultaneously producing glutathione and S-adenosyl methionine at high yield |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200810042978 CN101676384B (en) | 2008-09-16 | 2008-09-16 | Method for simultaneously producing glutathione and S-adenosyl methionine at high yield |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101676384A CN101676384A (en) | 2010-03-24 |
| CN101676384B true CN101676384B (en) | 2013-02-06 |
Family
ID=42029095
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200810042978 Active CN101676384B (en) | 2008-09-16 | 2008-09-16 | Method for simultaneously producing glutathione and S-adenosyl methionine at high yield |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101676384B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101781625B (en) * | 2010-01-04 | 2012-04-04 | 苏州大学 | Ethionine resistance Candida utilis and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1357630A (en) * | 2001-11-30 | 2002-07-10 | 中国科学院上海生物化学研究所 | Method of producing adenosylmethionine |
| CN1385537A (en) * | 2002-06-14 | 2002-12-18 | 中国科学院上海生命科学研究院生物化学与细胞生物学研究所 | Process for producing adenosylmethionine by metabolic engineering bacteria |
| CN101225402A (en) * | 2007-01-16 | 2008-07-23 | 上海医药工业研究院 | Pichia yeast genetic engineering bacteria for producing glutathione and recombinant plasmid used for constructing the same |
-
2008
- 2008-09-16 CN CN 200810042978 patent/CN101676384B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1357630A (en) * | 2001-11-30 | 2002-07-10 | 中国科学院上海生物化学研究所 | Method of producing adenosylmethionine |
| CN1385537A (en) * | 2002-06-14 | 2002-12-18 | 中国科学院上海生命科学研究院生物化学与细胞生物学研究所 | Process for producing adenosylmethionine by metabolic engineering bacteria |
| CN101225402A (en) * | 2007-01-16 | 2008-07-23 | 上海医药工业研究院 | Pichia yeast genetic engineering bacteria for producing glutathione and recombinant plasmid used for constructing the same |
Non-Patent Citations (2)
| Title |
|---|
| H.Liu等.Co-production of S-adenosyl-L-methionine and glutathione from spent brewer"s yeast cells.《Process Biochemistry》.2004,第39卷(第12期),全文. * |
| Jian-Ping Lin等.An effective strategy for the co-production of S-adenosyl-L-methionine and glutathione by fed-batch fermentation.《Biochemical Engineering Journal》.2004,第21卷(第1期),全文. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101676384A (en) | 2010-03-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2016361425B2 (en) | Genetically modified yeasts and fermentation processes using genetically modified yeasts | |
| CN107574159A (en) | A kind of mutant for the glutamine transaminage expressed in an active | |
| CN110484572A (en) | A method of improving saccharomyces cerevisiae nerolidol yield | |
| CN110117602A (en) | Grifola frondosus UDP-glucose pyrophosphorylase and its application | |
| CN100368524C (en) | High density fermentation method for GS115/PFK-K5 | |
| CN111575310A (en) | Recombinant saccharomyces cerevisiae expressing caveolin and application thereof | |
| CN104630258A (en) | Saccharomyces cerevisiae gene expression system, and establishment and application thereof | |
| CN102433265B (en) | Recombinant strain for producing reduced glutathione and preparation method for recombinant strain | |
| CN101613707B (en) | Method for producing glutathione by use of metabolic engineering bacteria | |
| CN104593407A (en) | Pichia stipitis gene expression system as well as construction and application thereof | |
| CN101676384B (en) | Method for simultaneously producing glutathione and S-adenosyl methionine at high yield | |
| CN102226154B (en) | Hansenula polymorpha with double screening marker and application thereof | |
| CN102559730B (en) | Method for increasing expression of CP4-EPSPS in Hansenula polymorpha | |
| CN107287197A (en) | Histidine attenuator mutant and histidine operon and their application for solving feedback repression | |
| CN115838645B (en) | Yeast strain for high production of orotic acid and application thereof | |
| CN101487019A (en) | Candida utilis expression vector and construction method thereof | |
| CN1191369C (en) | Process for producing adenosylmethionine by metabolic engineering bacteria | |
| CN111484942A (en) | Method for producing adipic acid by using saccharomyces cerevisiae | |
| CN105861534A (en) | Biological method for improving yield of L-5-methyltetrahydrofolate by virtue of two-plasmid engineering bacteria | |
| CN102911960B (en) | Feedback inhibition weakening method for producing glutathione by bacterial strains | |
| CN103087932A (en) | Recombination strain secreting glutathione and preparation method thereof | |
| CN102120966A (en) | Construction and application of URA3 defective P. pastoris X-33 strain | |
| CN103087934B (en) | Construction method for pichia pastoris bacterial strain of high-yield S-ademetionine | |
| CN102533841B (en) | Method for increasing expression of bacillus thuringiensis(Bt) insecticidalcrystalprotein in hansenula polymorpha | |
| CN111849790A (en) | Recombinant cephalosporium acremonium engineering bacteria and construction method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20171208 Address after: 313000 Zhejiang city of Huzhou province Deqing County Zhongguan town Hengtang Bridge No. 81 Patentee after: Zhejiang biok Biology Technology Co. Ltd. Address before: 313220 Deqing County bell Industrial Zone, Huzhou, Zhejiang Patentee before: Zhejiang Shenghua Biok Biology Co., Ltd. |
|
| TR01 | Transfer of patent right |