CN102911960B - Feedback inhibition weakening method for producing glutathione by bacterial strains - Google Patents
Feedback inhibition weakening method for producing glutathione by bacterial strains Download PDFInfo
- Publication number
- CN102911960B CN102911960B CN201210450216.9A CN201210450216A CN102911960B CN 102911960 B CN102911960 B CN 102911960B CN 201210450216 A CN201210450216 A CN 201210450216A CN 102911960 B CN102911960 B CN 102911960B
- Authority
- CN
- China
- Prior art keywords
- gsh1
- gsh2
- gsh
- glutathione
- feedback inhibition
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention provides a glutathione synthetase-based recombinant plasmid, a construction method and application thereof, and a method for accumulating glutathione. The glutathione synthetase-based recombinant plasmid provided by the invention includes sequences GSH1 and GSH2 as well as two appropriate vector segments; the principle of the method lies in that as GSH1 and GSH2 are connected onto vectors with different promoters, step-by-step expression of GSH1 and GSH2 can be realized through adding inducers at different time to reduce feedback inhibition; with the adoption of the method provided by the invention, the feedback inhibition can be weakened remarkably, the yield of glutathione is improved, the utilization ratio of raw materials is improved, and a base model is established for further studying synthesis of glutathione by a biological method. In addition, the method and the idea can be applied to target products of which the yield improvement is restricted due to the feedback inhibition, and provide a new idea for producing valuable products.
Description
Technical field
The invention belongs to technical field of bioengineering, specifically, is about a strain, with the bacterial strain that has weakened feedback inhibition, to improve the method for gsh semi-invariant.
Background technology
Gsh (γ-L-glutamyl-cysteinyl-glycine, GSH), the biological activity tripeptide compound being comprised of Pidolidone, Cys and glycine is the interior important antioxidant of cell and main non-albumen sulfhydryl compound (> 90%).In biological tissue; gsh keeps the running balance of oxidized form and reduced form by glutathione reductase and the effect such as brings into play the growth of cytoprotective, substance metabolism, Information Regulating, adjusting cell and tissue, resists or induce an illness; therefore, be widely used in the industries such as medicines and health protection, cosmetology, food interpolation.For the production of gsh, experienced extraction process, chemical synthesis, enzyme catalysis method and fermentation method, wherein fermentation method has become the main method of producing gsh.The application of the production methods such as the strain selection based on fermentation method and condition optimizing also makes the production of gsh be improved and extensively in laboratory scale, is tested, but be applied to the few of practice, trace it to its cause, it is mainly the rate-limiting enzyme in glutathione synthesis process, gamma-glutamylcysteine synthetase is easily subject to the feedback inhibition of end product gsh, activity that will feedback inhibition gamma-glutamylcysteine synthetase after end product concentration acquires a certain degree, makes output maintain lower level.
For many years, researchers have used a lot of methods to attempt to improve by weakening the method for feedback inhibition the output of object product, as successfully having built to have the restructuring E.coli of stronger GSH synthesis capability and screen in early days, the people such as Murata obtain a strain GSH1 desensitization mutant strain from E.coliB, cloned its GSH1 gene and expressed in E.coli B RC912, the ability of the synthetic GSH of bacterial strain of acquisition improves greatly.The people such as Liang and Zhao suppresses the synthetic of cytolemma by add the method for tensio-active agent and nysfungin in substratum, makes product secrete out timely, has weakened feedback inhibition, has improved output.But these operations are all based on improving the vigor of enzyme system or reducing the susceptibility of enzyme system to GSH, not from eliminating in essence feedback inhibition.Moreover the membership that adds of some tensio-active agents produces certain toxicity to cell.Therefore, seeking new method weakens or eliminates feedback inhibition and seem particularly important fundamentally to improve the output of object product.
Summary of the invention
The object of the invention is to, provide a kind of glutathione synthetases recombinant plasmid, for the bacterial strain of construction expression glutathione synthetases.
A further object of the invention is, a kind of construction process of glutathione synthetases recombinant plasmid is provided.
A further object of the invention is, a kind of application of glutathione synthetases recombinant plasmid is provided.
A further object of the invention is, a kind of method that feedback inhibition bacterial strain is produced gsh that weakens is provided.
Glutathione synthetases recombinant plasmid provided by the invention comprises GSH1 and GSH2 sequence and two suitable carrier segments; Described GSH1 and GSH2 sequence are respectively as shown in the sequence that Gene ID on NCBI is 242378250 and 253978924.
According to a preferred embodiment of the present invention, in glutathione synthetases recombinant plasmid, GSH1 and GSH2 are connected on different carriers, according to the time of two genetic expressions of difference regulation and control of two carrier promotors, thereby make GSH1 and GSH2 divide out expression, and then make synthetic gamma-glutamyl cysteine (intermediate product in glutathione synthesis process, is catalyzed and synthesized by gamma-glutamylcysteine synthetase) and gsh proceed step by step, eliminate feedback inhibition.
According to a further advantageous embodiment of the invention, described glutathione synthetases recombinant plasmid comprises respectively a kalamycin resistance gene and ampicillin resistance gene, in order to screening-gene recombinant bacterium.
The construction process of glutathione synthetases recombinant plasmid provided by the invention comprises the following steps:
A) pcr amplification obtains GSH1 and GSH2 sequence;
B) GSH1 and GSH2 sequence are cloned into respectively to pET28a and pBAD24.
Glutathione synthetases recombinant plasmid provided by the invention can be used for the bacterial strain of construction expression glutathione synthetases.
Method provided by the invention can be used for accumulating gsh.
The method of accumulation gsh provided by the invention, by fermentation culture glutathione synthetases recombinant bacterial strain provided by the invention, is accumulated gsh.
According to a further advantageous embodiment of the invention, the method for accumulation gsh is also passed through, and after selecting superior strain, by the technology of high density fermentation, accumulates gsh.
Use provided by the invention pair of plasmid can build accumulation gsh intestinal bacteria, can significantly weaken feedback inhibition, improved gsh turnout, improved raw material availability, reduced cost and energy consumption, can be further research biological process synthesizing glutathion and set up a basic model.In addition, the object product that the bacterial strain that the method builds and thinking can be limited output and improve because of feedback inhibition for other, provides new thinking for producing value product.
Accompanying drawing explanation
Fig. 1 is the detected result of the GSH1 of pcr amplification acquisition, and wherein swimming lane 1 is GSH1.
Fig. 2 is the detected result of the GSH2 of pcr amplification acquisition, and wherein swimming lane 1 is GSH2.
Fig. 3 is BL21-GSH1, the electrophorogram after BL21-GSH2 and BL21-GSH12 plasmid PCR, and wherein swimming lane 1,2, the DNA fragmentation of 3 and 4,5, the 6 corresponding GSH1GSH2 of difference and GSH1 and GSH2.
Embodiment
Below in conjunction with specific embodiment, the invention will be further described.Should be understood that following examples are only for the present invention is described but not for limiting scope of the present invention.
It in following examples, is the experimental technique that indicates actual conditions, conventionally according to normal condition, as < < molecular cloning: the scheme that the conditioned disjunction manufacturer described in laboratory manual > > (New York:CoLd Spring Harbor Laboratory Press, 1989) provides is carried out.
In following embodiment of the present invention, the glue of use reclaims test kit, plasmid extraction kit, genome extraction test kit all purchased from Sheng Gong biotech firm.
In following embodiment of the present invention, the pMD-18T SimpLe Vector of use, Hind III, Xba I, BamH I, Taq archaeal dna polymerase, T
4dNA ligase, DNA Marker, all purchased from TAKARA company.
In following embodiment of the present invention, the expression vector pET28a, the pBAD24 that use, bacterial classification E.coli BL21 (DE3), E.coli DH5 α, for life centralab of China Medicine University preserves, wherein the ATCC of bacterial classification E.coli BL21 (DE3) is numbered BAA-1025
tM.
In following embodiment of the present invention, E.coli BL21 (DE3) competent cell of use, E.coli DH5 α competent cell, purchased from Tian Gen biochemical technology company limited.
In following embodiment of the present invention, the formula of the LB substratum of use is: 1% Trypsin, and 0.5% yeast soaks powder, 1%NaCl; The formula of the Medium of shaking flask fermentation using is: 1% Trypsin, 0.5% yeast soaks powder, 1%NaCl.During configuration solid LB plate culture medium, according to above-mentioned formula, add 2% agar powder.
In following embodiment of the present invention, the preparation of competent cell and conversion, according to < < molecular cloning: the method that laboratory manual > > provides is carried out.
embodiment 1the structure of two expression plasmids
1.1 design of primers
According to GSH1 and the GSH2 sequence of NCBI report, following 4 primers of design:
GSH1UP：CGC
GGATCCATGATCCCGGACGTATCACAGGC；
GSH1DOWN：CCC
AAGCTTTCAGGCGTGTTTTTCCAGCCACACC；
GSH2UP：GC
TCTAGAGATGATCAAGCTCGGCATCGT；
GSH2DOWN：ATGAAGCTTTTACTGCTGCTGTAAACGTGC。
GSH1UP and the GSH1DOWN GSH1 coding region that is used for increasing wherein; GSH2UP and the GSH2DOWN GSH coding region that is used for increasing; Underscore on GSH1UP, GSH1DOWN, GSH2UP, GSH2DOWN is illustrated in BamH I, Hind III, XbaI and the Hind III restriction enzyme site of introducing respectively on GSH1UP, GSH1DOWN, GSH2UP, GSH2DOWN.
1.2PCR amplification GSH1 and GSH2 sequence
Extracting obtains intestinal bacteria E.coli BL21 (DE3) genome.
Intestinal bacteria E.coli BL21 (DE3) genome of take is template, and take respectively the GSH1UP of design in step 1.1 and GSH1DOWN and GSH2UP and GSH2DOWN is primer pair, carries out pcr amplification, specific as follows:
The reaction system of amplification GSH1 and GSH2 is: 10 * PCR Buffer, 5 μ L, 2mM dNTPs 5 μ L, 25mM MgSO
42 μ L, each 1 μ L of upstream and downstream primer (10 μ M), E.coli BL21 (DE3) genomic dna 1 μ L, Taq archaeal dna polymerase 1 μ L, adds deionized water, to system cumulative volume be 50 μ L.
The reaction conditions of amplification GSH1: 94 ℃ of 5min; 94 ℃ of 30s, 56 ℃ of 40s, 72 ℃ of 5min, 25 circulations; 72 ℃ of 10min.
The reaction conditions of amplification GSH2: 94 ℃ of 5min; 94 ℃ of 30s, 52 ℃ of 70s, 72 ℃ of 5min, 25 circulations; 72 ℃ of 10min.
Pcr amplification product carries out respectively detected through gel electrophoresis, and detected result as depicted in figs. 1 and 2.According to the result of Fig. 1 and Fig. 2, the size of the product of acquisition is respectively 1500bp and 900bp, meets the expection size of GSH1 and GSH2 product.
The structure of 1.3 expression vectors
1.3.1 build pre-treatment
Use glue to reclaim the PCR product obtaining in test kit purification step 1.2, then, with pMD-18T SimpLe carrier, use T
4dNA ligase, spends the night in 16 ℃ of connections, and reaction system is as follows:
The PCR product of 4 μ L, 1 μ LpMD-18T SimpLe carrier, 5 μ L T
4dNA ligase.
Connect product and transform bacillus coli DH 5 alpha and be coated with the solid LB flat board that contains 60 μ g/mL penbritins, 37 ℃ are cultured to transformant and grow.Wherein E.coli DH5 α is without amicillin resistance bacterial strain, can not on the solid LB flat board that contains penbritin, grow, and therefore, the transformant growing on flat board is the intestinal bacteria that transformed pMD-GSH1 or pMD-GSH2 plasmid.Picking transformant is identified, according to qualification result, is finally obtained two plasmid pMD-GSH1 and pMD-GSH2.
Plasmid pMD-GSH1 or pMD-GSH2, through sequence verification, comprise respectively GSH1, GSH2 coding region (GSH1, GSH2 coding region sequence are respectively as shown in SQ ID NO.1 and SQ ID NO.2), and coding region suddenly change without amino-acid residue.
1.3.2 the structure of expression vector
By double digestion product GSH1 in 1.3.1 and GSH2 gel purification, be connected with the expression vector PBAD24 of Xba I/HindIII double digestion with the expression vector pET28a of BamH I/HindIII double digestion respectively, connection product is transformed into respectively to Host Strains E.coli DH5 α, and the solid LB that coating contains 60 μ g/mL kantlex and penbritin is dull and stereotyped, 37 ℃ are cultured to transformant and grow.Wherein E.coli DH5 α is without amicillin resistance bacterial strain, can not on the solid LB flat board that contains kantlex or penbritin, grow, therefore the transformant, growing on flat board is the intestinal bacteria that transformed pET28a-GSH1 or pBAD24-GSH2 plasmid.Picking transformant is identified, according to qualification result, is finally obtained two plasmid pET28a-GSH1 and pBAD24-GSH2.
Plasmid pET28a-GSH1 and pBAD24-GSH2 are through sequence verification, comprise respectively GSH1 and GSH2 coding region (GSH1, GSH2 coding region sequence are respectively as shown in SQ ID NO.1 and SQ ID NO.2), wherein GSH1, GSH2 coding region be placed in respectively under T7 promotor, Lac operon and araBAD promotor, arabinose operon under, and coding region suddenlys change without amino-acid residue.
embodiment 2the structure of two plasmids
By the intestinal bacteria with plasmid plasmid pET28a-GSH1 and pBAD24-GSH2 that obtain in 1.3.1, two plasmids of extracting are also transformed into Host Strains E.coli BL21 (DE3) together, and be coated with the solid LB flat board that simultaneously contains 60 μ g/mL kantlex and penbritin, 37 ℃ are cultured to transformant and grow.Wherein E.coli BL21 (DE3) is without kantlex and amicillin resistance bacterial strain, can not on the solid LB flat board that contains kantlex and penbritin, grow, therefore the transformant, growing on flat board is the intestinal bacteria that transformed pET28a-GSH1 and pBAD24-GSH2 plasmid.
The some transformants containing pET28a-GSH1 and pBAD24-GSH2 plasmid of the random picking of difference, shake flask fermentation is cultivated, and chooses respectively each two strain of coli strain that gsh semi-invariant is higher, a strain called after BL21-GSH12.
Meanwhile, the pET28a-GSH1 that extracting is obtained and pBAD24-GSH2 transform respectively Host Strains E.coli BL21 (DE3), and the solid LB that coating contains 60 μ g/mL kantlex and penbritin is respectively dull and stereotyped, and 37 ℃ are cultured to transformant and grow.Wherein E.coli BL21 (DE3) is without kantlex and amicillin resistance bacterial strain, can not on the solid LB flat board that contains kantlex or penbritin, grow, therefore, at the transformant containing growing on the LB flat board of kantlex, being the intestinal bacteria that transformed pET28a-GSH1 plasmid, is being the intestinal bacteria that transformed pBAD24-GSH2 plasmid containing transformant on the solid LB flat board of penbritin.
The some transformants containing pET28a-GSH1 and pBAD24-GSH2 plasmid of the random picking of difference, shake flask fermentation is cultivated, and choose respectively each two strain of coli strain that gsh semi-invariant is higher, a strain called after BL21-GSH1, another strain called after BL21-GSH2.
The plasmid of extracting BL21-GSH12 also carries out agarose gel electrophoresis to it, after electrophoresis, two plasmid pET28a-GSH1 and pBAD24-GSH2 are carried out respectively to glue recovery, using two plasmids afterwards as template and respectively with primer GSH1UP and GSH1DOWN, GSH2UP and GSH2DOWN carry out pcr amplification to above-mentioned extract, the product that pcr amplification is obtained is through agarose gel electrophoresis, as shown in Figure 3, obtain length and be respectively 1.5kb, with the fragment of 0.9kb, the expression cassette of confirmation GSH1 and GSH2 all inserts.
According to the above results, BL21-GSH12 contains GSH1 and GSH2 gene.
embodiment 3bL21-GSH1, BL21-GSH2, BL21-GSH12 and E.coli BL21 (DE3) shake flask fermentation gsh
Single bacterium colony by BL21-GSH1, BL21-GSH2, BL21-GSH12 and the E.coliBL21 (DE3) (original bacterium, called after BL21) of grow overnight on 37 ℃ of solid LB flat boards, accesses respectively in liquid LB substratum, and shake-flask culture spends the night.
Get respectively appropriate bacterium liquid and transfer into Medium of shaking flask fermentation, cultivate 10h.Wherein, add inductor between in due course; Add in good time precusor amino acids and in fermentation 3,5,7,9,11h sampling, detect the semi-invariant of tunning GSH-PX activity, detected result is as shown in table 1.
According to the result of table 1, the semi-invariant of the L-5-methyl tetrahydrofolate in BL21-GSH1, BL21-GSH2, BL21-GSH12 and E.coli BL21 (DE3) reaches the highest and best with BL21-GSH12 effect when fermentation 11h.Therefore,, in next embodiment, only choose the highest BL21-GSH12 of shake flask fermentation later stage semi-invariant and carry out ferment tank.
The semi-invariant of table 1BL21-GSH1, BL21-GSH2, BL21-GSH12 and E.coli BL21 (DE3) gsh is with the variation of incubation time
embodiment 4bL21-GSH12 ferment tank gsh
The mono-bacterium colony of BL21-GSH12 that will grow on solid LB (containing 60 μ g/mL kantlex) flat board, is seeded to ferment tank substratum, and shake-flask culture spends the night; Get 1mL and be seeded to 100mL ferment tank substratum, shake-flask culture 2h left and right; Then access in the ferment tank substratum of 1L (2.5L fermentor tank), and add the rare polyoxyethylene glycerol ether of defoamer polyoxy third (i.e. bubble enemy GPE), ferment tank is cultivated, in fermenting process, add the inductor of proper concn in good time, and stream is filled it up with the glycerine of podocyte growth needs, meanwhile, by Feeding ammonia water, controlling pH is 6.4; In fermenting process, add precursor substance halfcystine, fermentation 30h stops fermentation.
Adopt aforesaid method, carry out parallel laboratory test, and sampling detects the gsh semi-invariant in tunning respectively, detected result demonstration, in above-mentioned parallel laboratory test, the semi-invariant of tunning GSH-PX activity reaches 867mg/L, far away higher than the 238mg/L contrasting.
In sum, use double expression plasmid provided by the invention can transform the primary fine bacterial strain of accumulation gsh, the recombinant bacterium fermentation culture obtaining, tunning GSH-PX activity semi-invariant is significantly higher than the primary fine bacterial strain E.coliBL21 (DE3) of accumulation gsh.This explanation adopts biosynthetic means provided by the invention, can significantly weaken feedback inhibition, improved gsh turnout, improved raw material availability, reduced cost and energy consumption, can be further research biological process synthesizing glutathion and set up a basic model.In addition, the object product that the bacterial strain that the method builds and thinking can be limited output and improve because of feedback inhibition for other, provides new thinking for producing value product.
Although, in an embodiment of the present invention, although but the ability that transforms BL21-GSH1, the BL21-GSH2 accumulation gsh obtaining is far below BL21-GSH12, and the throughput lower than E.coli BL21 (DE3), but by plasmid pET28a-GSH1 and pBAD24-GSH2 Transformed E .coli BL21 (DE3) are obtained to recombinant bacterium, and add inductor to improving the method for the output of object product in the regular hour, should belong to scope of the present invention equally.
Finally, it is also to be noted that, what more than enumerate is only specific embodiments of the invention.Obviously, the invention is not restricted to above examples of implementation, can also have many distortion.All distortion that those of ordinary skill in the art can directly derive or associate from content disclosed by the invention, all should think protection scope of the present invention.
Claims (2)
1. one kind is weakened the biosynthetic means that feedback inhibition bacterial strain improves gsh semi-invariant, it is characterized in that: build two kinds of glutathione synthetases coexpression recombinant plasmid transformed accumulation gsh original strain E.coli BL21 (DE3), obtain recombinant bacterium, by fermentation culture recombinant bacterium, and after fermentation culture certain hour, according to two intestinal bacteria Glutatione synthetase gene GSH1 of difference regulation and control of two carrier promotor T7 promotors and araBAD promotor and the expression time of GSH2, with inductor lactose and pectinose, induce respectively two key gene GSH1 in glutathione metabolism and the expression of GSH2, thereby make GSH1 and GSH2 divide out expression, and then make synthetic γ mono-glutamylcysteine and gsh proceed step by step, eliminate feedback inhibition, improve the semi-invariant of gsh, described GSH1 and GSH2 sequence are respectively as shown in the sequence that Gene ID on NCBI is 242378250 and 253978924.
2. coexpression recombinant plasmid as claimed in claim 1, is characterized in that, GSH1 and GSH2 are connected on different carriers, and carrier segments is pET28a and pBAD24.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210450216.9A CN102911960B (en) | 2012-11-12 | 2012-11-12 | Feedback inhibition weakening method for producing glutathione by bacterial strains |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210450216.9A CN102911960B (en) | 2012-11-12 | 2012-11-12 | Feedback inhibition weakening method for producing glutathione by bacterial strains |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102911960A CN102911960A (en) | 2013-02-06 |
| CN102911960B true CN102911960B (en) | 2014-10-08 |
Family
ID=47610540
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210450216.9A Expired - Fee Related CN102911960B (en) | 2012-11-12 | 2012-11-12 | Feedback inhibition weakening method for producing glutathione by bacterial strains |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102911960B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2809326C1 (en) * | 2020-03-25 | 2023-12-11 | СиДжей ЧеилДжеданг Корпорейшн | Variant of glutamate-cysteine ligase and method for obtaining glutathione with its application |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107988290A (en) * | 2017-12-01 | 2018-05-04 | 中国药科大学 | A kind of biological method for improving glutathione cumulant |
| CN109055291A (en) * | 2018-07-31 | 2018-12-21 | 张家港市华天药业有限公司 | For the recombinant bacterium of synthesizing glutathion and the synthetic method of glutathione |
| CN116218934A (en) * | 2019-06-11 | 2023-06-06 | 张家港市华天药业有限公司 | Method for accumulating glutathione |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002033105A2 (en) * | 2000-10-16 | 2002-04-25 | Plant Bioscience Limited | Reducing oxidative stress of plants by increasing glutathione content |
| WO2004003217A1 (en) * | 2002-06-28 | 2004-01-08 | Unisearch Limited | Glutathione production |
| CN101613707A (en) * | 2008-06-27 | 2009-12-30 | 中国科学院上海生命科学研究院 | A kind of method of producing gsh with metabolic engineering bacteria |
| CN101824432A (en) * | 2009-09-21 | 2010-09-08 | 杭州康源饲料科技有限公司 | Genetic modification method for high-yield glutathione strain |
-
2012
- 2012-11-12 CN CN201210450216.9A patent/CN102911960B/en not_active Expired - Fee Related
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002033105A2 (en) * | 2000-10-16 | 2002-04-25 | Plant Bioscience Limited | Reducing oxidative stress of plants by increasing glutathione content |
| WO2004003217A1 (en) * | 2002-06-28 | 2004-01-08 | Unisearch Limited | Glutathione production |
| CN101613707A (en) * | 2008-06-27 | 2009-12-30 | 中国科学院上海生命科学研究院 | A kind of method of producing gsh with metabolic engineering bacteria |
| CN101824432A (en) * | 2009-09-21 | 2010-09-08 | 杭州康源饲料科技有限公司 | Genetic modification method for high-yield glutathione strain |
Non-Patent Citations (3)
| Title |
|---|
| Carboxylase overexpression effects full carboxylation but poor release and secretion of factor IX: Implications for the release of vitamin K-dependent proteins;Kevin W. Hallgren et al.;《Biochemistry》;20021115;第41卷;15045-15055 * |
| Kevin W. Hallgren et al..Carboxylase overexpression effects full carboxylation but poor release and secretion of factor IX: Implications for the release of vitamin K-dependent proteins.《Biochemistry》.2002,第41卷15045-15055. |
| 沈立新等.重组大肠杆菌催化合成谷胱甘肽的研究.《西北大学学报（自然科学版）》.2003,第33卷(第5期),554-557. * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2809326C1 (en) * | 2020-03-25 | 2023-12-11 | СиДжей ЧеилДжеданг Корпорейшн | Variant of glutamate-cysteine ligase and method for obtaining glutathione with its application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102911960A (en) | 2013-02-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2019085445A1 (en) | Recombinant bacterium for producing l-lysine, construction method thereof, and method for producing l-lysine | |
| CN108795789A (en) | A kind of high-yield itaconic acid Yarrowia lipolytica engineered strain and its construction method, zymotechnique and application | |
| CN104087560A (en) | Bacterial laccase mutant protein, recombinant expression plasmid thereof, transformed engineering strain and fermentation preparation method thereof | |
| TW201619374A (en) | A microorganism of genus corynebacterium having an ability to produce L-arginine and a method for producing l-arginine using the same | |
| WO2022174597A1 (en) | Genetically engineered bacterium for producing l-sarcosine, construction method therefor and use thereof | |
| CN105505969A (en) | Method for improving conversion rate of L-threonine and application of method | |
| CN104388371A (en) | Genetic engineering bacterium for high-yield phloroglucinol as well as construction method and application of genetic engineering bacterium | |
| CN106434510A (en) | Genetically engineered bacterium for producing L-aspartic acid through fermentation | |
| CN102154339A (en) | Construction method of gene engineering strain for producing succinic acid escherichia coli | |
| CN102911960B (en) | Feedback inhibition weakening method for producing glutathione by bacterial strains | |
| CN102533626A (en) | Genetic engineering strain for producing succinic acid by using glucose and fermentation acid production method thereof | |
| CN109468288A (en) | A kind of new blue multicopper oxidase of efficient degradation histamine | |
| CN103849639B (en) | A kind of method improving halfcystine utilization ratio biosynthesis of glutathione | |
| CN102776217B (en) | Biosynthesis method for increasing accumulation of L-5-methyltetrahydrofolate | |
| CN114774341A (en) | Gene engineering bacterium for producing orotic acid and construction method and application thereof | |
| CN102864116B (en) | Gene engineering bacterium for producing succinic acid and construction and application thereof | |
| WO2024099089A1 (en) | Genetically engineered strain for producing pseudouridine, construction method therefor and use thereof | |
| CN101613707B (en) | Method for producing glutathione by use of metabolic engineering bacteria | |
| CN104152483A (en) | Application of argJ gene in fermentation production of L-citrulline | |
| CN105861534A (en) | Biological method for improving yield of L-5-methyltetrahydrofolate by virtue of two-plasmid engineering bacteria | |
| CN105483069A (en) | Recombination strain for producing trans-4-hydroxy-L-proline and building and application of recombination strain | |
| JP6991897B2 (en) | Nucleic acids and vectors for controlling gene expression in non-phototrophic C1 metabolizing microorganisms, and transformants thereof | |
| CN109402039A (en) | A kind of reinforcing MutSThe method of type Pichia anomala expression heterologous protein | |
| CN103087934B (en) | Construction method for pichia pastoris bacterial strain of high-yield S-ademetionine | |
| CN107988290A (en) | A kind of biological method for improving glutathione cumulant |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C53 | Correction of patent for invention or patent application | ||
| CB03 | Change of inventor or designer information |
Inventor after: Xu Jiyang Inventor after: Bian Xiaohong Inventor after: Zhao Yucheng Inventor after: Shao Fei Inventor after: Liu Rong Inventor before: Xu Jiyang Inventor before: Bian Xiaohong Inventor before: Zhao Yucheng Inventor before: Shao Fei |
|
| COR | Change of bibliographic data |
Free format text: CORRECT: INVENTOR; FROM: XU JIYANG BIAN XIAOHONG ZHAO YUCHENG SHAO FEI TO: XU JIYANG BIAN XIAOHONG ZHAO YUCHENG SHAO FEI LIU RONG |
|
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20141008 Termination date: 20151112 |
|
| EXPY | Termination of patent right or utility model |