RU2199589C2

RU2199589C2 - Method of detection of west nile fever virus

Info

Publication number: RU2199589C2
Application number: RU2000132967A
Authority: RU
Inventors: А.Г. Прилипов; Д.К. Львов; Е.И. Самохвалов; Г.К. Садыкова; С.В. Альховский; А.Г. Воронина
Original assignee: Научно-исследовательский институт вирусологии им. Д.И. Ивановского РАМН
Priority date: 2000-12-28
Filing date: 2000-12-28
Publication date: 2003-02-27

Abstract

FIELD: molecular biology, virology. SUBSTANCE: method is based on reverse transcription reaction of viral genome site in region of gene encoding leader sequence of virus membrane protein using primer comprising of 23 links with the following nucleotide sequence: GGGCATTCATAAGTGATAGTATC. The following double amplification is carried out using system of primers. For the first amplification oligonucleotides 2F, 22 links and 518R, 23 links with sequence of nucleotides GTAGTTCGCCTGTGTGAGCTGA and TCGGTAGCATTTACCGTTCATCAT are used and for the second amplification oligonucleotides 26 F, 22 links with nucleotides sequence AACTTAGTAGTGTTTGTGAGGA and 518 R, 23 links are used. Virus is detected by the presence of band of size 495 nucleotide pairs in analyzed sample after separation of part of reaction mixture in agarose gel. Method provides high sensitivity and specificity to West Nile fever virus that ensures to detect the presence of viral RNA in analyzed samples definitely. Invention can be used in diagnosis of West Nile fever virus. EFFECT: improved method of virus detection. 1 dwg, 6 ex

Description

Изобретение относится к молекулярной биологии, в частности к методу диагностики вируса лихорадки Западного Нила, основанном на детекции генетического материала возбудителя и приспособленным для массовых анализов с возможной автоматизацией процесса. The invention relates to molecular biology, in particular to a method for the diagnosis of West Nile fever virus, based on the detection of the genetic material of the pathogen and adapted for mass analysis with possible automation of the process.

Вирус лихорадки Западного Нила (ЛЗН) относится к семейству Flaviviridae и является одним из широкораспространенных инфекционных агентов во всем мире и, в частности, в южных регионах России. В настоящее время для диагностики данного возбудителя используются иммуноферментные наборы, позволяющие определять наличие вирусных антигенов в биологических пробах и наличие антител к этим антигенам в сыворотках крови (Львов Д.К., Бутенко А.М., Гайдамович С. Я. , Ларичев В.Ф., Лещинская Е.В., Жуков А.Н., Лазоренко В.В., Алюшин А. М., Петров В. Р. , Триханов С. Т., Хуторецкая Э.В., Шишкина Е.О. и Яшков А.Б. (2000): [Эпидемические вспышки менингита и менингоэнцефалита в Краснодарском крае и Волгоградской области, вызванные вирусом Западного Нила (Предварительное сообщение)]. Вопросы вирусологии т.45, 37-38.). В тоже время совершенно очевидна необходимость создания высокочувствительного диагностического набора для выявления в биологических пробах генетического материала (РНК) вируса ЛЗН. Ближайшим аналогом по литературным данным может быть разработка Lanciotti et. al (Lanciotti, R.S., Kerst, A.J., Nasci, R.S., Godsey, M.S., Mitchell, C.J., Savage, H.M., Komar, N, Panella, N.A., Allen, B. C. , Volpe, K.E., Davis, B.S., and Roehrig, J.Т. (2000): Rapid detection of west nile virus from human clinical specimens, field- collected mosquitoes, and avian samples by a TaqMan reverse transcriptase-PCR assay. J Clin Microbiol 38, 4066-71). Однако описанный метод, хотя и использует полимеразную цепную реакцию (ПЦР), но основан на флюоресцентном методе детекции продуктов реакции. Предложенный ими способ диагностики вируса ЛЗН включает в себя проведение реакции обратной транскрипции с последующей двойной амплификацией с праймерами из неструктурной 3'-концевой части генома вируса либо области генома, кодирующего белок E. West Nile Fever Virus (WNV) belongs to the Flaviviridae family and is one of the widespread infectious agents worldwide and, in particular, in the southern regions of Russia. Currently, for the diagnosis of this pathogen, enzyme immunoassays are used to determine the presence of viral antigens in biological samples and the presence of antibodies to these antigens in blood serum (Lvov D.K., Butenko A.M., Gaidamovich S. Ya., Larichev V. F., Leshchinskaya E.V., Zhukov A.N., Lazorenko V.V., Alyushin A.M., Petrov V.R., Trikhanov S.T., Khutoretskaya E.V., Shishkina E.O. and Yashkov AB (2000): [Epidemic outbreaks of meningitis and meningoencephalitis in the Krasnodar Territory and Volgograd Region caused by the West Nile virus (Anticipate noe message)]. Problems of Virology t.45, 37-38.). At the same time, the need for creating a highly sensitive diagnostic kit for detecting genetic material (RNA) of the LZN virus in biological samples is quite obvious. The closest literary equivalent may be the development of Lanciotti et. al (Lanciotti, RS, Kerst, AJ, Nasci, RS, Godsey, MS, Mitchell, CJ, Savage, HM, Komar, N, Panella, NA, Allen, BC, Volpe, KE, Davis, BS, and Roehrig, J .T. (2000): Rapid detection of west nile virus from human clinical specimens, field-collected mosquitoes, and avian samples by a TaqMan reverse transcriptase-PCR assay. J Clin Microbiol 38, 4066-71). However, the described method, although it uses a polymerase chain reaction (PCR), is based on the fluorescence method for detecting reaction products. Their proposed method for the diagnosis of LZN virus includes a reverse transcription reaction followed by double amplification with primers from the non-structural 3'-terminal part of the virus genome or the region of the genome encoding protein E.

Сущность изобретения заключается в том, что способ выявления вируса основан на получении кДНК с помощью реакции обратной транскрипции участка вирусного генома от 5'-конца вирусной РНК до района гена, кодирующего лидерную последовательность мембранного белка с использованием праймера из 23 звеньев со следующей последовательностью нуклеотидов: GGGCATTCATAAGTGATAGTATC и последующей двойной амплификации с помощью праймеров, имеющих следующие последовательности: праймер 2F, 22 звена: GTAGTTCGCCTGTGTGAGCTGA; праймер 26F, 22 звена: -AACTTAGTAGTGTTTGTGAGGA и праймер 518R, 23 звена: TCGGTAGCATTTACCGTCATCAT. Вирус выявляется, если после разделения части реакционной смеси в агарозном геле в анализируемом образце присутствует полоса размером 495 нуклеотидных пар. The essence of the invention lies in the fact that the method of detecting a virus is based on obtaining cDNA using the reverse transcription reaction of a portion of the viral genome from the 5'end of the viral RNA to the region of the gene encoding the leader sequence of the membrane protein using a primer of 23 units with the following nucleotide sequence: GGGCATTCATAAGTGATAGTATC and subsequent double amplification using primers having the following sequences: primer 2F, 22 units: GTAGTTCGCCTGTGTGAGCTGA; primer 26F, 22 links: -AACTTAGTAGTGTTTGTGAGGA and primer 518R, 23 links: TCGGTAGCATTTACCGTCATCAT. A virus is detected if, after separation of part of the reaction mixture in an agarose gel, a strip of 495 nucleotide pairs in size is present in the analyzed sample.

Предложенный способ включает в себя две основные стадии. Первая - это построение кДНК-копии части генома вируса ЛЗН с помощью обратной транскриптазы. Матрицей для этой реакции служит одноцепочечная РНК вируса ЛЗН, а затравкой - праймер из 23 звеньев со следующей последовательностью: GGGCATTCATAAGTGATAGTATC и комплементарный последовательности участка генома вируса ЛЗН, кодирующей лидер белка М. Результатом этой реакции является гибридная РНК-ДНК молекула, которая служит матрицей для последующей амплификации с внешней парой праймеров. Вторая стадия состоит из двух последовательных амплификаций с двумя различными парами праймеров - внешней и внутренней. Матрицей для первой амплификации (с внешней парой праймеров 2F и 518R) служит гибридная РНК-ДНК молекула, получающаяся в результате реакции обратной транскрипции, а матрицей для второй амплификации (с внутренней парой праймеров 26F и 518R) - фрагмент, полученный в результате первой амплификации. Следует отметить, что использование разных пар праймеров при двойной амплификации существенно улучшает специфичность конечного продукта. По этой же причине для синтеза кДНК цепи используется праймер, отличный от праймеров, используемых для амплификации. Внешней парой являются олигонуклеотиды 2F, 22 звена: GTAGTTCGCCTGTGTGAGCTGA и 518R, 23 звена: TCGGTAGCATTTACCGTCATCA. Внутренней парой являются олигонуклеотиды 26F, 22 звена: AACTTA GTAGTGTTTGTGAGGA и 518R. Реакционную смесь анализируют с помощью электрофореза в агарозном геле. Присутствие в анализируемом образце полосы размером 495 нуклеотидных пар свидетельствует о наличии в исходном материале РНК вируса ЛЗН. The proposed method includes two main stages. The first is the construction of a cDNA copy of part of the genome of the LZN virus using reverse transcriptase. The matrix for this reaction is single-stranded RNA of the LZN virus, and the primer is a primer of 23 links with the following sequence: GGGCATTCATAAGTGATAGTATC and a complementary sequence of the section of the LZN virus genome encoding the leader of protein M. The result of this reaction is a hybrid RNA-DNA molecule, which serves as a matrix for the subsequent amplification with an external pair of primers. The second stage consists of two consecutive amplifications with two different pairs of primers - external and internal. The matrix for the first amplification (with an external pair of primers 2F and 518R) is a hybrid RNA-DNA molecule resulting from the reverse transcription reaction, and the matrix for the second amplification (with an internal pair of primers 26F and 518R) is the fragment obtained as a result of the first amplification. It should be noted that the use of different pairs of primers for double amplification significantly improves the specificity of the final product. For the same reason, a primer other than the primers used for amplification is used to synthesize the cDNA chain. The outer pair are oligonucleotides 2F, 22 links: GTAGTTCGCCTGTGTGAGCTGA and 518R, 23 links: TCGGTAGCATTTACCGTCATCA. The inner pair are oligonucleotides 26F, 22 units: AACTTA GTAGTGTTTGTGAGGA and 518R. The reaction mixture was analyzed by agarose gel electrophoresis. The presence of a band of 495 nucleotide pairs in the analyzed sample indicates the presence of LZN virus in the RNA starting material.

Предложенный метод является высокочувствительным и высокоспецифичным к вирусу лихорадки Западного Нила и позволяет достоверно определять наличие РНК вируса в пробах крови больных, образцах секционного материала и в переносчиках арбовирусных инфекций. The proposed method is highly sensitive and highly specific to West Nile fever virus and allows one to reliably determine the presence of RNA virus in blood samples of patients, samples of sectional material and in carriers of arbovirus infections.

Пример 1. Выбор последовательности праймеров. Example 1. The choice of the sequence of primers.

Учитывая большую вариабельность генома вируса ЛЗН, при его обнаружении необходимо использовать праймеры, соответствующие наиболее консервативным участкам вирусного генома. В качестве таких участков-мишеней предлагается использовать те, которые совпадают по нуклеотидной последовательности в штаммах вируса ЛЗН, принадлежащих к различным филогенетическим группам. Одним из наиболее консервативных участков генома вируса является 5'-нетранслируемая область, область гена core и рrе-М. В связи с изложенным, основой для поиска мишеней стало сопоставление нуклеотидных последовательностей по всей длине генома для вируса ЛЗН, EMBL accession AF196835, D00246, М12294, NC_ 001563, AF206518, AF202541 на компьютере с помощью программы Megalign (DNASTAR). Кроме того, учитывались результаты определения нуклеотидных последовательностей штаммов вируса ЛЗН из коллекции Института вирусологии им. Д.И. Ивановского, содержащей штаммы, филогенетически значительно удаленные друг от друга. Затем на основе этих данных были выбраны потенциальные мишени для праймеров, которые далее проверялись на гомологию со всеми имеющимися данными EMBL GenBank (май 2000 г.) по нуклеотидной последовательности вируса ЛЗН с помощью программы Amplify (Macintosh). В качестве критериев, определяющих пригодность праймеров, учитывались следующие: длина мишени не менее 22 звеньев, отсутствие дупликации праймеров и отжига их друг на друга, отсутствие мест ложной посадки на матрицы геномов различных штаммов вируса ЛЗН. Этим критериям удовлетворяют все отобранные праймеры. Расположение праймеров показано на чертеже. Given the large variability of the genome of the LZN virus, when it is detected, it is necessary to use primers corresponding to the most conservative parts of the viral genome. As such target sites, it is proposed to use those that coincide in nucleotide sequence in strains of the LZN virus belonging to different phylogenetic groups. One of the most conserved regions of the viral genome is the 5'-untranslated region, the region of the core gene and pre-M. In connection with the above, the basis for the search for targets was the comparison of nucleotide sequences along the entire length of the genome for the LZN virus, EMBL accession AF196835, D00246, M12294, NC_ 001563, AF206518, AF202541 on a computer using the Megalign program (DNASTAR). In addition, the results of determining the nucleotide sequences of strains of the LZN virus from the collection of the Institute of Virology named after DI. Ivanovsky containing strains phylogenetically significantly remote from each other. Then, on the basis of these data, potential targets for primers were selected, which were then checked for homology with all available EMBL GenBank data (May 2000) on the nucleotide sequence of the LZN virus using the Amplify program (Macintosh). The following criteria were taken into account as criteria determining the suitability of primers: target length of at least 22 links, lack of duplication of primers and their annealing on each other, absence of places of false landing on the genome matrix of various strains of the LZN virus. All selected primers satisfy these criteria. The location of the primers is shown in the drawing.

Пример 2. Синтез праймеров. Example 2. The synthesis of primers.

Праймеры синтезировали фосфоамидитным методом на автомате-синтезаторе по обычной схеме. Для выделения синтезированных олигонуклеотидов из реакционной смеси использовали обращенно-фазовую хроматографию перед снятием метокситритильной 5'-концевой защитной группы. Полученные праймеры были практически гомогенны по результатам гель-электрофореза в полиакриламидном геле. The primers were synthesized by the phosphoamidite method on an automatic synthesizer according to the usual scheme. Reverse phase chromatography was used to isolate the synthesized oligonucleotides from the reaction mixture before removal of the 5'-terminal methoxytrityl protecting group. The obtained primers were almost homogeneous according to the results of polyacrylamide gel electrophoresis.

Пример 3. Выделение тотальной РНК. Example 3. Isolation of total RNA.

РНК из сыворотки крови, культуры тканей или образцов переносчиков выделяли гуанидинизотиоционатом с последующей экстракцией смесью фенола и хлороформа. Водную фазу, содержащую РНК, осаждали этанолом. RNA from serum, tissue culture or carrier samples was isolated with guanidine isothiocyanate, followed by extraction with a mixture of phenol and chloroform. The aqueous phase containing RNA was precipitated with ethanol.

Пример 4. Синтез кДНК. Example 4. Synthesis of cDNA.

Синтез кДНК осуществлялся с праймером 626R, состоящим из 23 звеньев и имеющим следующую последовательность: GGGCATTCATAAGTGATAGTATC. The cDNA synthesis was carried out with primer 626R, consisting of 23 units and having the following sequence: GGGCATTCATAAGTGATAGTATC.

Следует отметить, что для синтеза кДНК выбирался праймер, отличный от праймеров для внешней и внутренней амплификации, что существенно повышает специфичность предлагаемого метода. It should be noted that for the synthesis of cDNA a primer was selected that is different from the primers for external and internal amplification, which significantly increases the specificity of the proposed method.

Пример 5. Амплификация фрагмента кДНК с внешней парой праймеров. Example 5. Amplification of a cDNA fragment with an external pair of primers.

Амплификацию с праймерами 2F и 518R проводили в объеме 50 мкл при конечной концентрации 200 мкмоль каждого из праймеров. В качестве матрицы в реакционную смесь добавляли 2 мкл предварительно разведенной в 10 раз дистиллированной водой смеси, полученной в результате реакции обратной транскрипции. Реакцию ПЦР проводили при следующих условиях: денатурация - 94^oС, 20 секунд; отжиг - 55^oС, 20 секунд; элонгация - 72^oС, 30 секунд; 25 циклов.Amplification with primers 2F and 518R was carried out in a volume of 50 μl at a final concentration of 200 μmol of each of the primers. As a matrix, 2 μl of a mixture preliminarily diluted with 10 times distilled water, obtained as a result of the reverse transcription reaction, was added to the reaction mixture. The PCR reaction was carried out under the following conditions: denaturation - 94 ^o C, 20 seconds; annealing - 55 ^o C, 20 seconds; elongation - 72 ^o C, 30 seconds; 25 cycles.

Пример 6. Амплификация с внутренней парой праймеров. Полученный в результате первой амплификации продукт служил матрицей для второй амплификации с праймерами 26F и 518R. Условия ПЦР: денатурация - 94^oС, 30 секунд; отжиг - 60^oС, 20 секунд, элонгация - 72^oС, 30 секунд; 35 циклов.Example 6. Amplification with an internal pair of primers. The product obtained from the first amplification served as a matrix for the second amplification with primers 26F and 518R. PCR conditions: denaturation - 94 ^o C, 30 seconds; annealing - 60 ^o C, 20 seconds, elongation - 72 ^o C, 30 seconds; 35 cycles.

Claims

A method for detecting West Nile fever virus, comprising conducting a reverse transcription reaction with virus RNA using a primer and subsequent double amplification using primers, analyzing the reaction mixture by agarose gel electrophoresis and detecting virus RNA according to analysis results, characterized in that as a primer for the reverse transcription reaction with virus RNA, an oligonucleotide of 23 units with the following nucleotide sequence is used: GGGCATTCATAAGTGATAGTATC, complementary regions of the pre-M virus genome, oligonucleotides of 22 and 23 units having the following sequences are used as primers for the first amplification: GTAGTTCGCCTGTGTGAGCTGA and TCGGTAGCATTTACCGTCATCAT, as oligonucleotides of the second amplification, the following AIGTGTTGTTGTTGTTGTGTGTT sequences are used: TCGGTAGCATTTACCGTCATCAT, and virus RNA is detected when there are 495 nucleotide pair bands in the analyzed samples.