RU2720252C1 - Set of primers for identification of rna strains puumala orthohantavirus, common in the republic of tatarstan - Google Patents

Abstract

FIELD: biotechnology.SUBSTANCE: invention represents set of 2 pairs of oligonucleotide-primers for identification of RNA strains Puumala orthohantavirus, having activity of forward and reverse primers in polymerase chain reaction and having the following structure: 39S-F3: 5’-GGCCAAAACATCTATATGTATCC-3’ (23 n.); 69S-B3: 5’-GATATCTCTTTTACCTTCTGGTC-3’ (23 n.); PUUV-S-F704: 5’-AACATCATGAGTCCAGTAATGGG-3’ (23 n.); PUUV-S-R1183: 5’-GTACAGTAGGATTATCCTCTGATC-3’ (24 n.).EFFECT: use of the declared set of primers enables detecting Puumala orthohantavirus in biological materials of the red-flyer and patients suffering haemorrhagic fever with renal syndrome in the Republic of Tatarstan and can be used in virology, epidemiology, medicine, as well as in research activities to study the genome of this virus.1 cl, 4 dwg, 1 tbl

Description

The claimed technical solution relates to biotechnology in general, including genetic engineering and can be used in virology, epidemiology and medicine to detect the genetic material of the orthochantavirus Puumala, the main causative agent of hemorrhagic fever with renal syndrome (HFRS) in the Volga Federal District (PFD) ) RF - in tissue samples of small mouse-like rodents and in clinical samples of patients with HFRS. The claimed technical solution allows reliable identification of Puumala strains belonging to the Russian (RUS) genetic line of the virus and common in the Republic of Tatarstan and in the adjacent territories of the Volga Federal District. The identification of Puumala strains is necessary for mapping their distribution areas and identifying the most dangerous natural foci of infection, which can be used to develop measures to prevent and reduce the incidence of HFRS in the Volga Federal District.

One of the most commonly used in practice highly sensitive and species-specific methods for detecting genomic RNA viruses is the reverse transcription method followed by polymerase chain reaction (RT-PCR).

Further, the applicant provides identification of terms to exclude an ambiguous understanding of the text of the claimed materials.

Puumala orthohantavirus (PUUV) is a virus, a member of the hantavirus family, whose genome consists of three RNA molecules, designated as S (small), M (medium) and L (large) segments.

S-segment - RNA molecule of the PUUV genome containing the gene encoding the nucleocapsid protein of the virus.

Complementarity is the correspondence of nucleotides in the sequences of two chains of nucleic acids, leading to the ability to form double-stranded complexes (structures) due to the formation of adenine-thymine and guanine-cytosine pairs.

cDNA is a single-stranded DNA molecule whose sequence is complementary to the sequence of an RNA molecule.

Amplification is a multiple increase in the number of copies of a DNA site.

PCR amplification - a multiple increase in the number of copies of a DNA site during the polymerase chain reaction (PCR). The template for PCR is cDNA or genomic DNA.

PCR product - a DNA fragment resulting from PCR amplification.

Nested-PCR ("nested" PCR) - PCR amplification, for which the PCR product is used as a matrix. Allows you to increase the sensitivity of PCR by 10,000 times.

An oligonucleotide (oligodeoxyribonucleotide) is a short single-stranded DNA molecule, the length of which can range from several units to several tens of nucleotides.

Primer - an oligonucleotide used for PCR, the sequence of which is complementary to the nucleotide sequence of a portion of DNA adjacent to the target amplification site.

A direct primer is a primer whose sequence is complementary to the nucleotide sequence of a portion of the first strand of a double-stranded DNA molecule bordering the beginning of the target amplification region.

Reverse primer is a primer whose sequence is complementary to the nucleotide sequence of a portion of the second strand of a double-stranded DNA molecule adjacent to the end of the amplification target region.

Primer annealing - the formation of a double-stranded structure due to the binding of the primer to a complementary portion of a single-stranded DNA molecule.

Marker: here is a part of the genome that allows you to uniquely identify the virus.

Flanking region (flanking sequence) is a region (sequence) of a DNA molecule that borders on the target region undergoing PCR amplification.

The identity of nucleotide (amino acid) sequences is the coincidence of nucleotides (amino acid residues) in two sequences, expressed as a percentage.

The specificity of the primer is the ability of the primer to form a double-stranded structure only with a complementary portion of a single-stranded DNA molecule. The more nucleotides in the primer sequence are complementary to the nucleotides in the DNA sequence, the higher the specificity of the primer. The identity value of the nucleotide sequence of the specific primer and the site of its annealing is 100%. The lower the specificity of the primer, the higher the probability of non-binding of the primer to the desired annealing site.

Genetic distance - the mismatch between two nucleotide (amino acid) sequences, expressed as a percentage.

The following is a description of existing methods for identifying the genetic material of RNA viruses identified by the applicant of the prior art.

Total RNA is isolated from samples of biological material containing the causative agent of the viral disease, according to one of the standard methods and is used at the first stage as a matrix for cDNA synthesis using the reverse transcriptase enzyme, or revertase (RNA-dependent DNA polymerase). Next, the obtained cDNA is used as a template for PCR amplification of a cDNA fragment selected as a marker of a viral pathogen (Razzauti M., Plyusnina A., Henttonen H., Plyusnin A. Accumulation of point mutations and reassortment of genomic RNA segments are involved in the microevolution of Puumala hantavirus in a bank vole (Myodes glareolus) population. J. Gen. Virol., 2008, 89, P. 1649-1660.).

For PCR, specific primers are used that are complementary to sequences flanking the target region of the template on both sides. The specificity of the primer is one of the key factors in the amplification of the target DNA region. The presence of nucleotides in the primer sequence that are not complementary to the corresponding nucleotides at the target annealing site can lead to annealing disturbances and a false negative result, as well as to erroneous annealing at undesirable DNA sites and the formation of side (non-target) PCR products (Jaton K., Ninet B. , Bille J., Greub G. False-Negative PCR Result Due to Gene Polymorphism: the Example of Neisseria meningitidis. J. Clin. Microbiol., 2010, 48 (12), P. 4590-4591; Bacich DJ, Sobek KM, Cummings JL, Atwood AA, O'Keefe DS False negative results from using common PCR reagents. BMC Res. Note, 2011, 4: 457; Chemeris A.V., Magdanov E.G., Garafutdinov R.R., Ba hitov V.A. How to eliminate the appearance of false-positive results during the polymerase chain reaction? Herald of biotechnology and physico-chemical biology named after Yu.A. Ovchinnikov, 2012, 8 (3), P. 34-45).

In cases of a low content of viral RNA in a biological object, nested-PCR is carried out for its detection, the matrix for which is the PCR product obtained in the first reaction, and the forward and reverse primer sequences are selected so that the annealing sites are within this product (see Fig 1).

In FIG. 1 shows a scheme for amplification of a genome region using nested-PCR.

Puumala orthochantavirus is the causative agent of hemorrhagic fever with renal syndrome (HFRS) and is characterized by high genetic variability, which is manifested in the accumulation of point nucleotide substitutions in the genome.

At the date of submission of the application materials, 8 PUUV genetic lines are found that are common in Eurasia, the genetic distance between the nucleotide sequences of the S-segment of the genome of which exceeds 15% (Castel G., Chevenet F., Razzauti M., Murri S., Marianneau P., Cosson J.-F., Tordo N., Plyusnin A. Phylogeography of Puumala orthohantavirus in Europe. Viruses, 2019, 11, 679).

J., Lundkvist

., Persson K. et al. Detection and subsequent sequencing of Puumala virus from human specimens by PCR. J. Clin. Microbiol., 1995, 33(2), P.277-282). Идентичность последовательностей этих праймеров и соответствующих участков отжига в геноме штаммов PUUV, циркулирующих в России, как правило, не превышает 90%, т.е. специфичность праймеров может быть недостаточной для выявления штаммов PUUV в Республике Татарстан (РТ), поэтому существует высокая вероятность получения ложноотрицательного результата. Данное обстоятельство становится особенно важным при проведении выявления РНК PUUV в крови или сыворотке больных ГЛПС, поскольку такое определение проводится методом nested-ПЦР, который требует использования двух пар высокоспецифичных праймеров.Identified by the applicant on the date of submission of the application materials, foreign analogues of the primer set that provide PCR amplification of sections of the PUUV S-segment are designed for strains of viral lines detected in Western, Central and Northern Europe (

J., Lundkvist

., Persson K. et al. Detection and subsequent sequencing of Puumala virus from human specimens by PCR. J. Clin. Microbiol., 1995, 33 (2), P.277-282). The sequence identity of these primers and the corresponding annealing sites in the genome of the PUUV strains circulating in Russia, as a rule, does not exceed 90%, i.e. the specificity of the primers may not be sufficient to identify PUUV strains in the Republic of Tatarstan (RT), therefore, there is a high probability of obtaining a false negative result. This circumstance becomes especially important when detecting PUUV RNA in the blood or serum of patients with HFRS, since this determination is carried out by nested-PCR, which requires the use of two pairs of highly specific primers.

The closest domestic analogue of the claimed set of primers are primers used to identify PUUV strains belonging to the Russian genetic line (RUS) in the Samara region, Bashkiria, Udmurtia (Kariwa H., Tkachenko EA, Morozov VG et al. Epidemiological study of hantavirus infection in the Samara Region of European Russia. J. Vet. Med. Sci., 2009, 71 (12), P.1569-1578).

A disadvantage of the known technical solution is that the identity values of the sequences shown in the publication of the primers and the sequences of the corresponding annealing sites in the S-segment of the majority of PUUV strains identified in RT do not exceed 91.0-95.2%, as a result of which there is a high probability of obtaining false negatives PCR amplification results. In addition, these primers were used to determine PUUV RNA in the lung tissue of a bank vole and were not designed to detect PUUV RNA in the blood of patients with HFRS using the nested-PCR method.

At the date of submission of the application materials identified a number of foreign analogues.

So, the invention is known according to patent CN 101294226 (A) - 2008-10-29 "RT-PCR method for testing hantavirus genome" ("RT-PCR method for determining the hantavirus genome"). The essence of the known technical solution is a method for detecting a hantavirus genome, comprising the following steps:

A. Two pairs of primers have been developed that are applicable to all hantaviruses:

and. The sequence of the direct primer HV P1: GATTGAAGATATTGAGTCACC;

HV P2 reverse primer sequence: GTTGTATCCCCATTGATTGTG;

b. HV P3 forward primer sequence: TGAGAAATGTGTATGACATGA ;,

HV P4 reverse primer sequence: ACTACACACTGTTTCAAATGA;

B. Huntaan virus detection method:

a) the selection of total RNA from serum using a set of reagents for the isolation of virus-specific RNA;

b) using a nucleic acid analyzer, determine the concentration of RNA, for all RNA samples, the ratio OD260 / 280 ≥ 1.9 should be satisfied, after which 50 ng of RNA are taken for the RT-PCR reaction;

c) RT-PCR: a gene-specific primer HV P0 5'-ATGCAATATGATGAAAAG-3 'is used for reverse transcription, reaction conditions: reaction for 60 minutes at 37 ° C, 5 minutes at 93 ° C, stop the reaction by cooling to ice for 3 minutes;

PCR using universal primers HV P1 / P2 or HV P3 / P4, reaction conditions: preliminary denaturation for 3 minutes at 94 ° C, denaturation at 94 ° C for 1 minute, annealing for 1 minute at 50 ° C, elongation within 1 minute. at 72 ° C; 35 cycles; and, final elongation at 72 ° C for 5 min;

d) the results of amplification of viral nucleic acid are determined by electrophoresis in 1.5% agarose gel; a specific band corresponds to a 250 bp nucleic acid fragment

A disadvantage of the known technical solution is the mismatch of the nucleotide sequences of the claimed primers with the sequences of the PUUV S-segment and, therefore, the inapplicability of the claimed primers for PCR amplification of sections of the PUUV genome.

The invention is known according to patent CN102382906 (A) - 2012-03-21 "Degenerate RT-PCR detection method of Hantavirus group" ("Method of degenerate RT-PCR for determining the group of hantaviruses"). The essence of the known technical solution is the method of degenerate RT-PCR for a group of hantaviruses, which includes the following steps:

a. RNA isolation: RNA is isolated using a set of reagents for RNA extraction according to the instructions;

b. Reverse transcription: to obtain a template for PCR using a set of reagents for reverse transcription of RNA, reverse transcription of RNA is carried out in accordance with the instructions;

c. PCR: prepare the reaction mixture for PCR of this composition: 10 × PCR buffer 2.5 μl; 1.5 μl of a solution of MgCl ₂ with a concentration of 25 mm; 0.5 μl dNTP solution with a concentration of 10 mm; 0.5 μl of a solution of Taq polymerase with a concentration of 5U / μl; 1 μl of direct primer solution; 1 μl of reverse primer solution; 2 μl of the above matrix for PCR; 16 μl of sterile deionized water;

reaction conditions: preliminary denaturation at 94 ° C for 5 minutes, denaturation at 94 ° C for 30 s, annealing at 52 ° C for 30 s, elongation at 72 ° C for 1 min, 35 cycles, elongation at 72 ° C for 7 minutes. The resulting PCR product is stored at 4 ° C. The concentration of the direct primer G1 solution is 25 mM, the nucleotide sequence of the direct primer GCAACACCAACATGGTTTcartaytayac; the concentration of the solution of the reverse primer G2 is equal to 25 mm ;. The nucleotide sequence of the reverse primer CTTCTTCATTCATATTTCCATGCarnccyttytc;

d. agarose gel electrophoresis: the target product is detected by agarose gel electrophoresis with a concentration of 1-1.5%, electrophoresis conditions: 100 V, 30 min, the results of electrophoresis were analyzed using a visualization system. As a result, a band was found corresponding to the product of PCR amplification of the genome of the hantavirus group of 478 bp in length.

The main disadvantage of the known technical solution is that the sequences of the proposed primers are calculated for the region of the genome of the hantavirus group and do not take into account differences in the sequences of this region of the individual species, in particular PUUV. Thus, the use of these primers can lead to false negative results. In addition, the presence of only one pair of primers does not allow the use of the nested-PCR method and thus does not allow the determination of PUUV virus RNA in patients with HFRS.

The invention is known according to patent CN103484566 (A) - 2014-01-01 "Primer, kit and method for conducting genetic typing on hantavirus by means of PCR direct sequencing method" ("Primers, kit of reagents and method for conducting genetic typing of hantaviruses using the direct method sequencing of PCR products "). The essence of the known technical solution is a pair of primers, consisting of a direct primer: ATTAGCCCWGTCATGAGTGT; and reverse primer: CTTTGACTCYTTTGKYTCCA; where Y is C or T, W is A or T, K is G or T.

2. A method for genotyping a hantavirus using a primer according to claim 1, comprising: (1) isolating the total RNA of a sample of the virus to be tested and obtaining cDNA by reverse transcription; (2) the use of cDNA as the template and primers specified in paragraph 1. The primers are used for PCR amplification and the target amplification product is sequenced; (3) A phylogenetic tree is built on the basis of information about the sequence of the target product and the corresponding fragment of the genome of a strain with a known genotype; (4) Genotyping of test virus samples based on phylogenetic trees.

3. The method used in claim 2, wherein in step (2), the amplified target fragment is sequenced by double-sided sequencing, and the combination of sequences is performed after sequencing is completed.

4. The method used in claim 2, in which, at step (3), the phylogenetic tree is constructed by the neighbor joining method.

5. For the method specified in paragraph 2, use strains with a known genotype: 76-118, A16, C1-2, NC167, Z10, Gou3, K24-V2, L99, R22, Hantaviruses SR11, 160V, Dobrava, Cg- 13891, Cg-Erft, K27, Vranica, AH1, C9717869, Of22819, Bayou, NMH10, NMR11, CC74 and CC107.

6. A set of reagents for genotyping hantaviruses, including PCR buffer, dNTP solution, MgCl ₂ solution, Taq polymerase, primers, negative control, positive control and deionized water, which use the primers that are the claims of the invention and are described in paragraph 1.

7. The reagent kit indicated in paragraph 6, containing a solution of MgCl ₂ with a concentration of 25 mm, and a dNTP solution with a concentration of 10 mm.

8. The reagent kit indicated in paragraph 6, further comprising a nucleic acid preparation and a reagent for extracting the PCR product from the gel.

A disadvantage of the known technical solution is the mismatch of the nucleotide sequences of the claimed primers with the sequences of the PUUV S-segment and, therefore, the inapplicability of the claimed primers for PCR amplification of sections of the PUUV genome.

At the date of submission of the application materials identified a number of domestic counterparts.

So, the invention is known according to patent RU 2199589 "A method for detecting West Nile fever virus." The essence of the known technical solution is a method for detecting West Nile fever virus, which involves conducting a reverse transcription reaction with virus RNA using a primer and subsequent double amplification using primers, analyzing the reaction mixture using agarose gel electrophoresis and detecting virus RNA according to the analysis results, characterized in that an oligonucleotide of 23 units with the following sequence is used as a primer for carrying out a reverse transcription reaction with virus RNA nucleotides: GGGCATTCATAAGTGATAGTATC, a complementary region of the pre-M virus genome, oligonucleotides of 22 and 23 units having the following sequences are used as primers for the first amplification: GTAGTTCGCCTGTGTGAGCTGA and TCGGTAGCATTTACCG the following sequences: AACTTAGTAGTGTTTGTGAGGA and TCGGTAGCATTTACCGTCATCAT, and virus RNA is detected when there are 495 nucleotide-pair bands in the analyzed samples.

A disadvantage of the known technical solution is that the claimed primer pairs are designed to determine the portion of the M-segment of the West Nile fever virus genome, that is, they cannot be used to determine the S-segments of the Puumala hantavirus.

The invention is known according to patent RU 2294963 "A set of oligonucleotide primers for the identification of RNA of the Crimean-Congo virus hemorrhagic fever in field and clinical samples." The essence of the known technical solution is a set of oligonucleotide primers for the identification of RNA of the Crimean Congo virus hemorrhagic fever in field and clinical samples, containing 2 pairs of oligonucleotides with direct and reverse primer activity in the reverse transcription and polymerase chain reactions with the following structure:

5 'gaagccaa (a, g) aagac (t, c) gt (a, g) gaggctc 3' - SP1;

5 'caattgtcttggc (a, g) ca (t, c) ggatt 3' - SP2;

5 'gcacagattgacac (t, c) (g, c) ctttcagc 3' - SP3;

5 'gtccg (t, a) aggtt (a, g) agaatggacttggt 3' - SP4.

A disadvantage of the known technical solution is its purpose for determining the site of the Crimean Congo virus hemorrhagic fever genome, that is, it cannot be used to determine the sites of the Puumala hantavirus genome.

The invention is known according to patent RU 2487167 "A set of oligonucleotide primers and fluorescently-labeled probes for species-specific rapid identification of the Ebola-Sudan virus by polymerase chain reaction." The essence of the known technical solution is a set of oligonucleotide primers and fluorescently labeled probes for species-specific rapid identification of the Ebola-Sudan virus by real-time polymerase chain reaction, including sequences species-specific for the Ebola-Sudan virus:

external:

5 '→ 3'5'CCGTTATTCTCYACRAAGRTSATTAGTGA3'

3 '← 5'5'TTCTCTAGGTCTGTGACAAAACTACTCCC3'

internal:

5 '→ 3'5'TGGGATGCAGTHTTYGARCC3'

3 '← 5'5'ACAACCATCATRTTGCTTGGAAAGGCTT3'

probe:

FAM - TATTGCCCCAGAATCGAAATTTTTCTTTTTCATTGAA-BHQ1.

A disadvantage of the known technical solution is that the known primers are designed to identify the Ebola-Sudan virus by real-time PCR using the fluorescent method for detecting PCR amplification products. In addition, the known primers are designed for the Ebola-Sudan virus genome region and cannot be used to determine the Puumala hantavirus genome regions.

The objective of the claimed technical solution is to develop and create a specific set of primers that make it possible to obtain a PCR amplification product of the PUUV S-segment region for further genetic analysis with the exception of false negative results, as well as high reliability and reproducibility of positive PCR amplification results. In addition, the claimed technical solution allows the determination of PUUV RNA both in the lung tissue of a bank vole and in the blood of patients with HFRS. Thus, the claimed technical solution surpasses analogues known from the prior art that were developed for genetic lines common in European countries and not intended to detect RNA of PUUV strains of the Russian genetic line common in Tajikistan. Also, the claimed technical solution exceeds the analogues known from the prior art developed for PUUV strains of the Russian genetic line, common in other regions of Russia, and not excluding the receipt of a false negative result in determining the RNA of PUUV strains detected in RT, and also not applicable for the detection of RNA of PUUV strains in patients with HFRS using nested-PCR. Thus, the claimed technical solution provides reliable identification of PUUV strains that are common in red-backed vole populations and detected in patients with HFRS in the Republic of Tatarstan, which makes it possible to conduct subsequent mapping of the areas of distribution of PUUV strains in the republic, to identify areas of infection of HFRS patients, to develop methods for the deratization of these territories , as well as the choice of a method for the treatment of HFRS, taking into account the features of the genome of the detected infectious strain of the virus.

The technical result of the claimed technical solution is the development of a set of primers for the identification and identification of the genetic material of PUUV strains that are common in RT, which ensures the reliability and reproducibility of PCR amplification results.

The essence of the claimed technical solution is a set of 2 pairs of primers for the identification of RNA strains of Puumala orthohantavirus with direct and reverse primer activity in the polymerase chain reaction and having the following structure

39S-F3: 5'-GGCCAAAACATCTATATGTATCC-3 '(23 N.)

69S-B3: 5'-GATATCTCTTTTACCTTCTGGTC-3 '(23 N.)

PUUV-S-F704: 5'-AACATCATGAGTCCAGTAATGGG-3 '(23 n.)

PUUV-S-R1183: 5'-GTACAGTAGGATTATCCTCTGATC-3 '(24 N.)

The claimed technical solution is illustrated in FIG. 1 - FIG. 4.

In FIG. 1 shows a scheme for amplification of a genome region using nested-PCR.

In FIG. Figure 2 shows a portion of the cDNA nucleotide sequence of the S-segment of the Puu / Kazan strain containing fragments amplified in the 1st and 2nd rounds of nested-PCR. The numbers on the left and right indicate the positions in the sequence. Bold sections of the annealing of the claimed primers are highlighted, their designation is shown above.

In FIG. Figure 3 shows the results of electrophoretic separation of the products of the 1st round of PCR carried out using primers 39S-F3 and 69S-B3 (1.0% agarose gel). As a matrix, cDNAs synthesized on RNA isolated from the lung tissue of bank voles were used.

The positions in FIG. 3 indicate:

1 - Marker of fragment lengths.

2 - Negative control.

3 - Negative control - PCR product obtained as a result of PCR amplification of the non-viral cDNA region.

4 - Positive control - PCR product obtained as a result of PCR amplification of the cDNA region of the previously identified PUUV strain.

5-9 — PCR product obtained by PCR amplification of a cDNA region synthesized on RNA isolated from the lung tissue of red-backed voles.

In FIG. 4 shows the results of electrophoretic separation of products of the 2nd round of nested-PCR, carried out using primers PUUV-S-F704 and PUUV-S-R1183 (1.0% agarose gel). The amplification products of the first round were used as a matrix. Primers for the 1st round nested-PCR: 39S-F3 and 69S-B3; matrix - cDNA synthesized on RNA isolated from the blood of patients with HFRS.

The positions in FIG. 4 denote:

1 - Marker of fragment lengths.

2 - Negative control.

3 - Negative control - PCR product obtained as a result of PCR amplification of the non-viral cDNA region.

4 - Positive control - PCR product obtained as a result of PCR amplification of the cDNA region of the previously identified PUUV strain.

10-20 - PCR product obtained as a result of the second round of nested-PCR amplification of a cDNA region synthesized on RNA isolated from the blood of patients with HFRS.

The applicant further provides an example of a specific implementation of the claimed technical solution.

As part of the claimed technical solution, the applicants developed a scheme for the selection of primers specific for the regions of the genome of PUUV strains detected in populations of red voles and in patients with HFRS in the Republic of Tatarstan, taking into account the sequences of similar regions of the genome of PUUV strains circulating in Western, Central and Northern Europe, hosted in the GenBank database. The primers were tested using biological material from the bank voles of a number of populations in the Republic of Tatarstan, as well as clinical material (whole blood, blood serum) of patients with HFRS.

The method of designing the claimed oligonucleotide primers.

The calculation of the primer sequences was based on the results of a comparative analysis of the nucleotide sequences of the S-segment of PUUV strains distributed in a number of European countries and the strains previously identified by the applicants in the red-backed vole populations in the Republic of Tatarstan placed in the GenBank database.

In FIG. Figure 2 shows a portion of the cDNA nucleotide sequence of the S-segment of the Puu / Kazan strain containing fragments amplified in the 1st and 2nd rounds of nested-PCR. The numbers on the left and right indicate the positions in the sequence. Bold sections of the annealing of the claimed primers are highlighted, their designation is shown above.

Testing of the developed primers was carried out using a large number of samples containing viral RNA and isolated from the lung tissue of a red field vole and blood of patients with HFRS, identification and sequencing of sections of the PUUV S-segment in which was performed by the applicants earlier.

Characterization of a set of primers and plot amplified genomic RNA PUUV.

Primer hybridization sites flank fragment S of the PUUV segment. In the first round of nested-PCR, a fragment of 760 bp in length corresponding to pos. 560-1319 in the sequence of the S-segment. In the second round, a fragment of 525 bp in length corresponding to pos. 682-1206 (Table 1).

Table 1

The structure of the set of declared primers for the identification of the S-segment of the genome of Puumala orthohanatavirus

Primer designation Primer sequence, 5 '→ 3' Localization in sequence
S-segment PUUV, nucleotides Amplicon length
bp 39S-F3 GGCCAAAACATCTATATGTATCC 560-582 760 69S-B3 GATATCTCTTTTACCTTCTGGTC 1297-1319 PUUV-S-F704 AACATCATGAGTCCAGTAATGGG 682-704 525 PUUV-S-R1183 GTACAGTAGGATTATCCTCTGATC 1183-1206

From the data shown in Table 1, we can conclude that the applicants have developed a set of primers that can reliably identify various genetic variants of Puumala orthohantavirus in biological material and in clinical samples.

Below the applicants are examples 1-5, which presents an algorithm for identifying PUUV in biological material.

Example 1. Isolation of total RNA from biological material.

Isolation of total RNA from the lung tissue of a bank vole and whole blood / serum of HFRS patients is carried out, for example, using TRIzol reagent (Life Technologies, USA) according to the manufacturer's recommendations (https://www.thermofisher.com/order/catalog/product/15596026 # / 15596026).

Example 2. Synthesis of cDNA.

The cDNA synthesis is carried out, for example, using the RevertAid Reverse Transcriptase (Thermo Fisher Scientific, USA) according to the manufacturer's protocol (https://www.thermofisher.com/order/catalog/product/EP0441#/EP0441).

Example 3. Carrying out the 1st round of RT-nested-PCR.

To carry out the 1st round of RT-nested-PCR, the reaction mixture is prepared:

cDNA 1.0 μl 10 × Taq Turbo Buffer (Eurogen, Russia) 2.5 μl MgCl ₂ , 25 mm 2.5 μl Solution dNTPs (25 mm) 1.0 μl primer 39S-F3 (20 μm) 0.25 μl 69S-B3 primer (20 μM) 0.25 μl Taq DNA polymerase (Eurogen, Russia) 1 unit H ₂ O up to 25 μl

PCR is carried out, for example, in a C1000 ThermalCycler thermal cycler (Bio-Rad, USA) according to the following program:

94 ° C - 3 min

35 cycles: 94 ° C - 30 sec

52 ° C - 30 sec

72 ° C - 50 sec

72 ° C - 5 min

4 ° C - ∞

Example 4. Carrying out the 2nd round of RT-nested-PCR.

For the 2nd round of RT-nested-PCR, the reaction mixture is prepared:

reaction mixture after round 1 0.1 μl 10 × Taq Turbo Buffer (Eurogen, Russia) 2.5 μl MgCl ₂ , 25 mm 2.5 μl Solution dNTPs (25 mm) 1.0 μl PUUV-S-F704 primer (20 μM) 0.25 μl PUUV-S-R1183 primer (20 μM) 0.25 μl Taq DNA polymerase (Eurogen, Russia) 1 unit H ₂ O up to 25 μl

PCR is carried out, for example, in a C1000 ThermalCycler thermal cycler according to the following program:

94 ° C - 3 min

35 cycles: 94 ° C - 30 sec

53 ° C - 30 sec

72 ° C - 35 sec

72 ° C - 5 min

4 ° C - ∞

Example 5. Detection of amplification products.

The separation of amplification products is carried out by electrophoresis in a 1.0% agarose gel. DNA is visualized by ethidium bromide staining and subsequent UV irradiation using, for example, GelDoc XR + gel documentation system (Bio-Rad).

The results are shown in FIG. 3 and 4.

In FIG. Figure 3 shows the results of electrophoretic separation of the products of the 1st round of PCR carried out using primers 39S-F3 and 69S-B3 (1.0% agarose gel). As a matrix, cDNAs synthesized on RNA isolated from the lung tissue of bank voles were used.

It was shown that for all the studied samples, only one PCR product was obtained, the length of which corresponds to the expected one (see 5–9). Nonspecific reaction products are absent.

In FIG. 4 shows the results of electrophoretic separation of products of the 2nd round of nested-PCR, carried out using primers PUUV-S-F704 and PUUV-S-R1183 (1.0% agarose gel). The amplification products of the first round were used as a matrix. Primers for the 1st round nested-PCR: 39S-F3 and 69S-B3; matrix - cDNA synthesized on RNA isolated from the blood of patients with HFRS.

It was shown that for all the studied samples, only one PCR product was obtained, the length of which corresponds to the expected one (see 10-22). Nonspecific reaction products are absent.

Thus, the applicant has shown that the designed primers can be used both for routine PCR and nested PCR. Due to the close melting points, each of the two forward primers can be used to perform PCR paired with each of the two reverse primers. It was shown that the use of this set of primers in RT-PCR and RT-nested-PCR for the detection of Puumala orthochantavirus provides reproducible synthesis of DNA fragments of the expected length corresponding to the target part of the genome. The specificity of the obtained PCR products in all cases was confirmed using the direct Sanger sequencing method.

From the above it can be concluded that the applicants achieved the stated objectives and the claimed technical results, created a specific set of oligonucleotides with activity of direct (F) and reverse (R) primers, making it possible to obtain the nucleotide sequence of the fragment of the S-segment of PUUV for further genetic analysis. A set of primers has been developed to identify and identify the genetic material of PUUV.

The claimed technical solution meets the criterion of "novelty", presented to the invention, since the investigated prior art has not identified technical solutions that have the claimed combination of distinctive features, ensuring the achievement of the stated results.

The claimed technical solution meets the criterion of "inventive step" for inventions, since the applicant hasn’t identified technical solutions characterized by a specific set of oligonucleotides developed by the applicants that have direct (F) and reverse (R) primers that make it possible to obtain a nucleotide sequence fragment PUUV S-segment for further genetic analysis and a set of primers to identify and identify the gene Cesky PUUV material.

The claimed technical solution meets the criterion of "industrial applicability" presented to the invention, as it can be implemented using standard equipment and well-known techniques.

Sequence Listing - Rule 13ter

SEQ ID NO: 1 gg cca aaa cat cta tat gta tcc 23

SEQ ID NO: 2 ga tat ctc ttt tac ctt ctg gtc 23

SEQ ID NO: 3 aac atc atg agt cca gta atg gg 23

SEQ ID NO: 4 gta cag tag gat tat cct ctg atc 24

<110> Federal State Autonomous Educational Institution of Higher Education "Kazan (Volga) Federal University" (FSAEI HE KFU) <120> A set of primers for the identification of RNA strains of Puumala orthohantavirus, common in the Republic of Tatarstan <140> Current application <141> 11/14/2019 <160> 1 <210> SEQ ID NO: 1 <211> 23 <212> Nucleotide <213> Puumala orthohantavirus <400> gg cca aaa cat cta tat gta tcc

<110> <120> <140> Current application <141> 11/14/2019 <160> <210> SEQ ID NO: 2 <211> 23 <212> Nucleotide <213> Puumala orthohantavirus <400> ga tat ctc ttt tac ctt ctg gtc

<110> <120> <140> Current application <141> 11/14/2019 <160> <210> SEQ ID NO: 3 <211> 23 <212> Nucleotide <213> Puumala orthohantavirus <400> aac atc atg agt cca gta atg gg

<110> <120> <140> Current application <141> 11/14/2019 <160> <210> SEQ ID NO: 4 <211> 24 <212> Nucleotide <213> Puumala orthohantavirus <400> gta cag tag gat tat cct ctg atc

Claims (5)

A set of 2 pairs of oligonucleotides for the identification of RNA strains of Puumala orthohantavirus with direct and reverse primer activity in the polymerase chain reaction and having the following structure: 39S-F3: 5'-GGCCAAAACATCTATATGTATCC-3 '(23 N.) 69S-B3: 5'-GATATCTCTTTTACCTTCTGGTC-3 '(23 N.) PUUV-S-F704: 5'-AACATCATGAGTCCAGTAATGGG-3 '(23 n.) PUUV-S-R1183: 5'-GTACAGTAGGATTATCCTCTGATC-3 '(24 N.).

Images