CN105936946A - One step method inverse transcription PCR kit for detecting and differentiating Zika viruses and detection method thereof - Google Patents
One step method inverse transcription PCR kit for detecting and differentiating Zika viruses and detection method thereof Download PDFInfo
- Publication number
- CN105936946A CN105936946A CN201610481524.6A CN201610481524A CN105936946A CN 105936946 A CN105936946 A CN 105936946A CN 201610481524 A CN201610481524 A CN 201610481524A CN 105936946 A CN105936946 A CN 105936946A
- Authority
- CN
- China
- Prior art keywords
- zika virus
- pcr
- fluorescence
- detection
- probe
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a primer, probe, and kit for detecting and differentiating Zika viruses through one step method inverse transcription PCR, a detection method and applications thereof. The PCR kit can be sensitively, specifically, efficiently, and rapidly detect and differentiate two genotypes of Zika viruses namely Asia type and Africa type at the same time. The principle of the kit is that on the basis of an inverse transcription PCR technology, a one step method FRET-PCR system, which can simultaneously detect and differentiate two Zika viruses, is established. The system is built on the basis of two genotypes of Zika viruses and whole gene sequences of other pathogens having a high homology with two genotypes of Zika viruses; a relatively conservative section is selected to design the primer and probe, through specific amplification, positive samples can be detected and screened from clinical samples sensitively and rapidly; then according to the difference of melting temperature (TM) values in a high resolution melting curve, the Asia type and Africa type of Zika viruses can be differentiated credibly; operation of the kit and the detection method is convenient and efficient, and the kit and method are suitable for detecting a large amount of samples.
Description
Technical field
The present invention relates to bioscience technical field, be specifically related to the detection of one-step method reverse transcriptional PCR and the test kit of typing zika virus and detection method thereof.
Background technology
Zika virus disease is also referred to as stockaded village's card heat (Zika fever), it is by zika virus (Zika virus, ZIKAV) cause and pass through yellow-fever mosquito and (mainly include Aedes aegypti Aedes aegypti, Aedes albopictus Aedes albopictus, aedes africanus Aedes Africana) etc. hematophagus carry out the acute viral arthropod borne infection propagated.This disease can also be broadcast to fetus or baby by anemia of pregnant woman in pregnancy or production process, or by spreading through sex intercourse or Transfusion Transmission.The incubation period that zika virus infects is about 3-12 days, with heating, erythra, violent arthralgia, myalgia and conjunctivitis as main clinic symptoms, children's's cases of infection it may also occur that nervous system, eye and audition etc. change, and infection of pregnant women zika virus may cause the even foetal death of neonate microcephalus.Zika virus is distributed widely in that the African continent is northern and many countries in Southeast Asia, including India, Malaysia, Philippine, Thailand, Vietnam, Pakistan and Indonesia, popular on East Africa seashore, island, the Indian Ocean, America and island, Caribbean in recent years.By in January, 2016, on Africa, Asia, America and Pacific Islands, at least 45 countries all find the evidence that zika virus is propagated, having 23 countries and regions the most in South America just popular, and Prevalent district presents the trend of constantly expansion, cases of infection number the most constantly rises.Ending on February 28th, 2016, there are 8 example Introduced cases zika virus cases of infection in China.In recent years, along with quickening and the aggravation of global warming of globalization process, condition is created by Prevalent district to the propagation of Non-epidemic areas for this virus；Simultaneously, due to stockaded village's card heat and dengue fever (Dengue fever), jaundice scorchingly hot (Yellow fever), Chikungunya fever (Chikungunya fever), Japanese encephalitis (Japanese encephalitis) clinical symptoms similar and communication media is similar so that much stockaded villages' card heat is misdiagnosed as dengue fever and Chikungunya fever.There is no medicine at present and can prevent and treat stockaded village's card heat.
Zika virus belongs to flaviviridae, Flavivirus, single strand plus RNA virus.Zika virus full genome length is about 11Kb, diameter 40～70nm, has peplos, comprises 10794 nucleotide, encode 3419 aminoacid, 3 structural protein of zika virus gene code: capsid protein (C), film precursor protein (prM) and envelope protein (M), and 7 non-structural proteins (NS1, NS2a, NS2b, NS3, NS4a, NS4b and NS5).Showing according to molecular biology and bioinformatic analysis, zika virus is primarily present two genotype: zika virus Africa type (Zika virus African genotype) and zika virus Asian type (Zika virus Asian genotype).The detection method of zika virus mainly has at present:
(1) virus purification is cultivated.By isolated zika virus in infecting body, judge after then this virus inoculation is cultivated in the cell lines such as C6/36, BHK-21, Verona, Hela cell and primary hamster kidney cell or the animal such as neonatal rat, mosquito propagation.This detection method has advantages such as highly sensitive, high specificity, but highly pathogenic due to zika virus, culture environment, operator, condition of culture and instrument and equipment etc. there are is higher requirement；
(2) Serology test.The method antigen and the theory of antibodies, judged by the serum antibody (or antigen) of coated antigen (or antibody) detection human or animal.At present, the research of zika virus antigen Serology test is less, and antibody detection method is more, mainly includes immunochromatographic method, immunofluorescence, enzyme linked immunosorbent assay (ELISA), Hemagglutination Inhibition, virus neutralization tests etc..Wherein, immunochromatography, immunofluorescence and ELISA are current laboratory diagnosis and the most widely used Serology test of commercial kit.Owing to zika virus specific antibody typically just need to produce behind organism infection virus 5 sky, in addition, between the zika virus of different genotype, and between zika virus and other the most close pathogen (such as: the flaviviridaes such as dengue virus, West Nile fever virus, yellow fever virus), cross reaction (Zhang Shuo, Li Dexin can occur.Zika virus and zika virus are sick.Virus journal, volume 2016,32, the 1st phase), thus impact is made a definite diagnosis.These all make the method cannot be applicable to stockaded village's card heat concentrate outburst time detect fast and accurately and diagnose；
(3) molecular biology method.The method is mainly by judging with or without the RNA of zika virus in polymerase chain reaction (PCR) method detection sample.Molecular biology method has that required samples sources various (such as: virus-culturing fluid, blood, mosquito specimen etc.), sample consumption be few, detection quick and precisely, the feature such as highly sensitive, high specificity so that it is become one of current most widely used clinical testing procedure.That wherein apply it is crucial that guarantee in RNA the pollution without RNase and genomic DNA.Wherein, inverse transcription polymerase chain reaction technology (Reverse-Transcription Polymerase Chain Reaction, RT-PCR), the molecular biology method based on real-time fluorescence RT-PCR, for zika virus infect diagnosis, prevent and control to provide quick, accurate and effective diagnostic method.Use the RT-PCR detection method of routine, typically in the infected's peripheral blood, can detect that viral nucleic acid in morbidity in latter 4 days；And apply sensitiveer real-time fluorescence RT-PCR technology, viral nucleic acid can be can detect that after infecting the same day or falling ill 7.Therefore, to being in the doubtful case of pyrogenic stage, first-selected test in laboratory method is real-time fluorescence RT-PCR, and PCR primer can be carried out sequencing, accurately determines whether the genotype of the zika virus that zika virus infects or infects.
But, existing zika virus PCR detection method can not detect or distinguish two kinds of genotype of zika virus nucleic acid real-time, special and delicately.Zika virus is divided into Africa type and Asian type, zika virus Africa type is mainly popular in African Territories, and zika virus Asian type is mainly popular in East Asia and south east asia, therefore there is the difference on gene level in the zika virus of two kinds of genotype, if the zika virus simultaneously detecting two kinds of genotype need to select from the complete genome sequence of two kinds of genotype zika viruses conserved sequence and dexterously design primer can expand the zika virus of two kinds of genotype simultaneously, but other the most close virus will not be expanded；Meanwhile, if to reach to distinguish the purpose of two kinds of zika virus genotype, need positive or suspicious specimen by judging after the gene sequencing to PCR primer.Therefore, setting up quick, convenient, the inspection method accurately of zika virus, be conducive to understanding the biological characteristics of zika virus, clinical diagnosis, and be applied to the detection work that zika virus infects, to preventing, its incoming China is significant.
Announced Chinese patent application (application number: 201610099248.7) and provided a kind of fluorescence RT-PCR forward, reverse primer and fluorogenic oligonucleotide probe, test kit and detection method for Asian type zika virus, in order to quick, efficiently, qualitatively detection sample in Asian type zika virus.The technical scheme of this patent application: 1) zika virus Asian type can only be detected；2) it is that the fluorescence reverse transcription PCR utilizing hydrolysis probes (fluorogenic oligonucleotide probe) detects, thus only have amplification curve there is no melting curve when carrying out associated sample detection, thus the yin and yang attribute of sample can only be judged by the presence or absence of amplification curve, cannot efficiently reduce or avoid false positive results, the Feasible degree of its testing result has much room for improvement；3) minimum detectability of its test kit is 1 × 103Copy/mL.
Summary of the invention
It is an object of the invention to provide a kind of High sensitivity, special, can efficiently and rapidly detect and primer, probe and the test kit of two kinds of zika virus genotype of typing, and its detection method and application.The design principle of the present invention is: based on reverse transcriptional PCR technology, set up a set of be applicable to detect simultaneously with two kinds of zika viruses of typing one-step method FRET-PCR system.This system is based on two kinds of genotype of zika virus and the complete genome sequence of other related diseases substances that homology is higher therewith, select relatively conservative block design primer and probe, expand through specifically, can detect and filter out positive sensitive, rapidly from clinical sample, and then according to melting temperature T in high-resolution melting curvemThe difference of value, thus distinguish zika virus Asian type and zika virus Africa type with a high credibilityly.
To achieve these goals, technical scheme is as follows:
The invention provides the test kit of a kind of reverse transcriptional PCR detection zika virus, including primer, probe and FRET-PCR standard substance, wherein:
Described primer is forward primer and downstream primer；Described forward primer has the nucleotide sequence of SEQ ID No.1；Described downstream primer has the nucleotide sequence of SEQ ID No.2；
Described probe is 6-FAM probe and LCRed640 probe；Described 6-FAM probe has the nucleotide sequence of SEQ ID No.3；Described LCRed640 probe has the nucleotide sequence of SEQ ID No.4；
Further, described test kit includes: above-mentioned primer, 6-FAM probe and LCRed640 probe, and PCR buffer, hot start Taq polymerase, dNTP and FRET-PCR standard substance；Can also include PCR negative control, alternatively, described PCR negative control is distilled water.
Further, described FRET-PCR standard substance include DNA plasmid standard substance and RNA standard substance.Wherein, described DNA plasmid standard substance are the recombiant plasmid that the nucleotide fragments with SEQ ID No.5 and SEQ ID No.6 sequence inserts pUC57 vector construction；Described RNA standard substance are the RNA nucleotide obtained by vitro transcription by the plasmid containing SEQ ID No.5 and SEQ ID No.6 sequence and T7 promoter sequence.
Further, the concentration of described DNA plasmid standard substance and RNA standard substance template is 100 gene copies/microlitre.
The invention provides the reverse transcriptional PCR augmentation detection system of the test kit of a kind of reverse transcriptional PCR detection zika virus, reverse transcriptional PCR amplification object includes RNA standard substance or RNA template, the negative control of RNA extraction and RT-PCR negative control；
Reverse transcriptional PCR augmentation detection system includes following amplification system: volume ratio is sample RNA template or RNA standard substance, 1x PCR buffer, the forward primer of 1 μM, 1 μM of downstream primer, the 6-FAM probe of 0.2 μM, the LCRed640 probe of 0.2 μM, the commercialization Taq enzyme of 2 units, 200 μMs of dNTP, the commercialization reverse transcription of 0.14 unit, commercialization RNase inhibitor of 20 units of amplification system cumulative volume 50%；Preferably, the cumulative volume of described amplification system is 20 μ l or 40 μ l.
Further, the reaction condition of described reverse transcriptional PCR amplification system includes: reverse transcription, denaturation, the rigorous circulation of height of 18 lapses of temperature, 30 deficient rigorous fluorescence obtain circulation and 1 down cycles, wherein:
Reverse transcription: 1x15min@55 DEG C；Denaturation: 1x2min@95 DEG C；The rigorous circulation of height of 18 lapses of temperature: 6x1sec@95 DEG C, 12sec@72 DEG C, 30sec@72 DEG C；9x1sec@95 DEG C, 12sec@70 DEG C, 30sec@72 DEG C；3x1sec@95 DEG C, 12sec@68 DEG C, 30sec@72 DEG C；Owe rigorous fluorescence for 30 and obtain circulation: 67 DEG C of and 30sec@of 30x1sec@95 DEG C, 8sec@55-58 DEG C, 30sec@72 DEG C；Down cycles: 1x1sec@40 DEG C.
The invention provides the real time fluorescent quantitative FRET-PCR augmentation detection system of the test kit of a kind of reverse transcriptional PCR detection zika virus, real time fluorescent quantitative FRET-PCR amplification object includes DNA plasmid standard substance, PCR negative control；
Real time fluorescent quantitative FRET-PCR augmentation detection system includes following amplification system: volume ratio is sample DNA templates or DNA plasmid standard substance, 1x PCR buffer, 1 μM of forward primer, 1 μM of downstream primer, the 6-FAM probe of 0.2 μM, the LCRed640 probe of 0.2 μM, the commercialization Taq enzyme of 2 units, 200 μMs of dNTP of amplification system cumulative volume 50%, preferably, the cumulative volume of described amplification system is 20 μ l or 40 μ l.
Further, the pcr amplification reaction condition of described real time fluorescent quantitative FRET-PCR augmentation detection system includes: denaturation, the rigorous circulation of height of 18 lapses of temperature, 30 deficient rigorous fluorescence acquisition circulations, 1 melting continuing fluorescence acquisition circulate and 1 down cycles, wherein:
Denaturation: 1x2min@95 DEG C；The rigorous circulation of height of 18 lapses of temperature: 6x1sec@95 DEG C, 12sec@72 DEG C, 30sec@72 DEG C；9x1sec@95 DEG C, 12sec@70 DEG C, 30sec@72 DEG C；3x1sec@95 DEG C, 12sec@68 DEG C, 30sec@72 DEG C；Owe rigorous fluorescence for 30 and obtain circulation: 67 DEG C of and 30sec@of 30x1sec@95 DEG C, 8sec@55-58 DEG C, 30sec@72 DEG C；1 melting circulation: 85 DEG C of persistent collection fluorescence of 1x1sec@95 DEG C, 10sec@40 DEG C ,@；Down cycles: 1x1sec@40 DEG C.
The invention also discloses a kind of detection and the detection method of typing zika virus, it is characterised in that comprise the following steps:
Step 1: prepare detection sample RNA template；
Step 2: according to description of product preparation primer and probe；Preparation is described above for detecting the one-step method reverse transcriptional PCR reaction system with typing zika virus and the PCR reaction system for plasmid standard, expands the RNA template to be checked described in step 1 and standard substance；Its reaction condition includes: reverse transcription, denaturation, the rigorous circulation of height of 18 lapses of temperature, 30 deficient rigorous fluorescence obtain circulation and 1 down cycles；Reverse transcription: 1x15min@55 DEG C；Denaturation: 1x2min@95 DEG C；The rigorous circulation of height of 18 lapses of temperature: 6x1sec@95 DEG C, 12sec@72 DEG C, 30sec@72 DEG C；9x1sec@95 DEG C, 12sec@70 DEG C, 30sec@72 DEG C；3x1sec@95 DEG C, 12sec@68 DEG C, 30sec@72 DEG C；Owe rigorous fluorescence for 30 and obtain circulation: 67 DEG C of and 30sec@of 30x1sec@95 DEG C, 8sec@55-58 DEG C, 30sec@72 DEG C；Down cycles: 1x1sec@40 DEG C；Fluorescence signal is collected when the annealing of each circulation；Described fluorescent probe and standard probe corresponding target fluorescent passage, zika virus Africa type standard substance fluorescence channel and zika virus Asian type standard substance fluorescence channel respectively；
Step 3: after reaction terminates, read and record sense channel amplification curve and melting temperature TmValue；Described sense channel includes target fluorescent passage, zika virus Africa type standard fluorescence passage and zika virus Asian type standard fluorescence passage, melting temperature T of described target fluorescent passagem-1, melting temperature T of described Africa type standard fluorescence passagem-AF, melting temperature T of described Asian type standard fluorescence passagem-AS, carries out the judgement of testing result according to herein below:
1) all there are amplification curve, and melting temperature T when target fluorescent passage and standard fluorescence passagem-1 and Tm-AF is consistent (± 1C °), then detection sample is zika virus Africa type virus-positive；
2) all there are amplification curve, and melting temperature T when target fluorescent passage and standard fluorescence passagem-1 and Tm-AS is consistent (± 1C °), then detection sample is zika virus Asian type virus-positive；
3) there are amplification curve and melting temperature T when target fluorescent passage without amplification curve and melting temperature, standard fluorescence passage simultaneouslymValue, then detection sample is that zika virus is negative；
4) when target fluorescent passage has amplification curve but without melting temperature, standard fluorescence passage has amplification curve and melting temperature simultaneously, is repeated once experiment, and result is identical, then detection sample is that zika virus is negative；
5) without amplification curve but having melting temperature when target fluorescent passage, standard fluorescence passage has amplification curve and melting temperature, and T simultaneouslym-1 and Tm-AF is consistent (± 1C °), is repeated once experiment, and result is identical, then detection sample is that zika virus Africa type is positive；
6) without amplification curve but having melting temperature when target fluorescent passage, standard fluorescence passage has amplification curve and melting temperature, and T simultaneouslym-1 and Tm-AS is consistent (± 1C °), is repeated once experiment, and result is identical, then detection sample is that zika virus Asian type is positive.
The test kit of present invention reverse transcriptional PCR recited above detection zika virus and detection method application in detection zika virus nucleic acid thereof.
Technical scheme has reached following beneficial effect:
Present invention provide for detection and the one-step method reverse transcriptional PCR primer of 2 kinds of genotype of typing zika virus and the test kit of probe and detection method, reached rapidly and efficiently by FRET (fluorescence resonance energy transfer) (FRET) probe techniques, detect conveniently, accurately, specifically and zika virus nucleic acid in typing measuring samples, thus whether judgement sample exists zika virus disease and determines its zika virus genotype infected.
1) present invention establishes according to interval conservative in 2 kinds of genotype nucleotide sequences of zika virus and a kind of can detect 2 kinds of zika virus genotype and the reverse transcriptional PCR system of typing simultaneously, wherein, first from NCBI, obtain the complete genome sequence of 2 kinds of zika virus genotype and other related diseases substances that homology is higher therewith, the interval wherein zika virus guarded relatively is selected to devise pair of primers and a pair probe dexterously, to expand and to pass through the T of high-resolution melting curve analysis specificallymThe difference of value, distinguishes the zika virus of 2 kinds of genotype such that it is able to efficiently and the most simultaneously detect and the zika virus of two kinds of genotype of typing；
2) efficiently and the most simultaneously detecting and on the basis of the zika virus of two kinds of genotype of typing, the present invention selects zika virus conservative region as purpose fragment design primer and probe dexterously, also assure that this system does not expand the microorganism of other non-zika virus, especially close with its homology virus in other Flavivirus, such as dengue virus (Dengue virus), yellow fever virus (Yellow fever virus) Chikungunya virus (Chikungunya virus), encephalitis b virus (Japanese enchephalitis virus), West Nile fever virus (West Nile virus) etc.；And it is similar with its clinical manifestation and communication media is identical, often by the infectious disease of mistaken diagnosis, such as malaria etc., so that the detection of zika virus has higher accuracy；
3) the present patent application passes through hybridization probe (FRET (fluorescence resonance energy transfer) principle, FRET:Fluorescence Resonance Energy Transfer) fluorescent quantitation reverse transcriptional PCR method carries out detecting, this detection PCR system not only has amplification curve and has melting curve simultaneously, therefore only there is amplification curve simultaneously and melting curve is just judged to positive, so improve the credibility of testing result, greatly reduce false-positive result；
4) detection kit provided by the present invention and detection method can highly sensitive, quick and precisely, specifically detect and the zika virus of two kinds of genotype of typing, it is particularly suited for the unconspicuous zika virus of clinical symptoms to infect in early days or convalescent period, in the period that the content of body inner virus is relatively low, be the first-selected test in laboratory method to the suspicious zika virus cases of infection being in pyrogenic stage.The present invention has highly sensitive reverse transcription FRET-PCR system, in the detection of this system amplification efficiency, can effectively expand minimum 10-7The RNA nucleic acid (the RNA nucleic acid standards of preparation from chick embryo allantoic liquid) of bird flu virus H1N1；In addition, the sample nucleic (100 copies/mL) that its real-time fluorescence RT-PCR system can copy in the sample lowest detection to 1 of every 10 μ l, it is thus possible in time, diagnose rapidly, infectious disease be monitored and controlled, especially as stockaded village's card this acute infectious disease of heat；
5) detection kit provided by the present invention and detection method, simple operation is efficient, be suitable for detect great amount of samples, for zika virus infect outburst time the large quantities of clinical sample of diagnosis quickly and accurately, and control as soon as possible this virus infection provide solid foundation.
Accompanying drawing explanation
Fig. 1 is the schematic diagram of the amplification curve of zika virus Africa of the present invention type.In figure, each concentration is followed successively by 1 × 104/ reaction, 1 × 103/ reaction, 1 × 102/ reaction, 1 × 101/ reaction, 1 × 100The zika virus Africa type plasmid standard of/reaction, each 2 are repeated data, and NC is negative control sample, and abscissa Cycle represents that PCR reacts amplification cycles number, and vertical coordinate Fluorescence (498-640) represents the fluorescence intensity at 640nm.
Fig. 2 is the schematic diagram of the melting curve of zika virus Africa of the present invention type.In figure, each curve is 1 × 104/ reaction, 1 × 103/ reaction, 1 × 102/ reaction, 1 × 101/ reaction, 1 × 100The zika virus Africa type plasmid standard of/reaction and the melting curve of negative control, each 2 are repeated data, and abscissa Temperature represents that PCR reacts melting temperature TmValue, vertical coordinate-(d/dT) Fluorescence (498-640) represents that the second order of the fluorescence intensity at 640nm bears derivative.
Fig. 3 is the schematic diagram of the amplification curve of zika virus Asian type of the present invention.In figure, each concentration is followed successively by 1 × 104/ reaction, 1 × 103/ reaction, 1 × 102/ reaction, 1 × 101/ reaction, 1 × 100The zika virus Asian type plasmid standard of/reaction, each 2 are repeated data, and NC is negative control sample, and abscissa Cycle represents that PCR reacts amplification cycles number, and vertical coordinate Fluorescence (498-640) represents the fluorescence intensity at 640nm.
Fig. 4 is the schematic diagram of the melting curve of zika virus Asian type of the present invention.In figure, each curve is 1 × 104/ reaction, 1 × 103/ reaction, 1 × 102/ reaction, 1 × 101/ reaction, 1 × 100The zika virus Asian type plasmid standard of/reaction and the melting curve of negative control, each 2 are repeated data, and abscissa Temperature represents that PCR reacts melting temperature TmValue, vertical coordinate-(d/dT) Fluorescence (498-640) represents that the second order of the fluorescence intensity at 640nm bears derivative.
Fig. 5 is the schematic diagram of the melting curve of two kinds of genotype zika virus plasmids of the present invention.In figure, curve is 1 × 103The zika virus Africa type of/reaction and zika virus Asian type plasmid standard and the high-resolution melting curve of negative control, each 3 are repeated data, and abscissa Temperature represents that PCR reacts melting temperature TmValue, vertical coordinate-(d/dT) Fluorescence (498-640) represents that the second order of the fluorescence intensity at 640nm bears derivative.
Fig. 6 is the schematic diagram of the amplification curve of reverse transcriptional PCR system in the present invention.In figure, each concentration is followed successively by 1 × 10-3/ reaction, 1 × 10-4/ reaction, 1 × 10-5/ reaction, 1 × 10-6/ reaction, 1 × 10-7The Influenza Virus RNA nucleic acid standards of/reaction, each 3 are repeated data, and NC is negative control sample, and abscissa Cycle represents that PCR reacts amplification cycles number, and vertical coordinate Fluorescence (498-640) represents the fluorescence intensity at 640nm.
Fig. 7 is the schematic diagram of the melting curve of reverse transcriptional PCR system in the present invention.In figure, each curve is 1 × 10-3/ reaction, 1 × 10-4/ reaction, 1 × 10-5/ reaction, 1 × 10-6/ reaction, 1 × 10-7The Influenza Virus RNA nucleic acid standards of/reaction and the melting curve of negative control, each 2 are repeated data, and abscissa Temperature represents that PCR reacts melting temperature TmValue, vertical coordinate-(d/dT) Fluorescence (498-640) represents that the second order of the fluorescence intensity at 640nm bears derivative.
Fig. 8 is the schematic diagram of two kinds of zika virus genotype agarose gel electrophoresiies of the present invention.In figure, each swimming lane is followed successively by: swimming lane-1: standard substance；Swimming lane-2: zika virus Africa type (Zika virus Asian genotype, ZIKV-Asian)；Swimming lane-3: zika virus Asian type (Zika virus African genotype, ZIKV-African).Wherein, standard substance (Ladder) each stripe size is followed successively by 100bp, 200bp, 300bp, 400bp, 500bp, 600bp, 700bp, 800bp, 900bp, and 1000bp.
Detailed description of the invention
In order to illustrate technical scheme and technical purpose, below in conjunction with the accompanying drawings and the present invention is described further by detailed description of the invention.
Present invention provide for detection and the one-step method reverse transcriptional PCR primer of 2 kinds of genotype of typing zika virus and the test kit of probe and detection method, by Fluorescence Resonance Energy transfer (FRET) probe techniques reach quick, convenient, accurately, specifically detection and typing measuring samples in zika virus nucleic acid, thus whether judgement sample exists zika virus disease and determine its zika virus genotype infected.
Embodiment 1
The present embodiment 1 provides a kind of test kit for detection with the one-step method reverse transcription FRET-PCR of 2 kinds of genotype of typing zika virus, including primer and probe, and PCR buffer, hot start Taq polymerase, dNTP, FRET-PCR standard substance and distilled water PCR negative control；
Wherein, described primer is forward primer and downstream primer；Described probe is 6-FAM probe and LCRed640 probe；The nucleotide sequence of described primer and probe is as follows:
Forward primer: 5 '-AGCTATTATGCCGCCACCATCC-3 ' (SEQ ID No.1)；
Downstream primer: 5 '-CAGAGTGTCACACGGCTCAGCC-3 ' (SEQ ID No.2)
6-FAM probe: 5 '-CCATGCTGGTGCAAAGCTATGG-FAM-3 ' (SEQ ID No.3)
LCRed640 probe: 5 '-LCRed640-TGGAACATAGTTCGTCTCAAGAGTGG-phosphate groups-3 (SEQ ID No.4)
Wherein 6-FAM probe is donor probe, is marked with donor dye FAM at its 3 ' end；LCRed640 probe is acceptor probe, its 5 ' end be marked with acceptor dye LCRedit640. donor dye by instrument in the suitable exciter filter that carries excite, and release energy and excite acceptor dye, acceptor dye launches the fluorescence of different wave length after exciting, the quantity of the target DNA that its fluorescence volume produces to PCR is in being directly proportional.
Described FRET-PCR standard substance are the recombiant plasmid that the zika virus Africa type obtained by commercialization gene chemical synthesis company (Jin Sirui biotechnology, Nanjing of China) and the conservative interval nucleotide fragments of Asian type insert pUC57 vector construction.The concentration of described DNA plasmid standard substance is 100 gene copies/microlitre.
Wherein, described zika virus Asian type (Zika virus Asian genotype) specific and conserved sequence has a sequence of SEQ ID No.5:
ggatgtggcagagggggctggagctattatgccgccaccatccgcaaagtgcaggaggtgagaggatacacaaagggaggtcccggtcatgaagaacccatgctggtgcaaagctatgggtggaacatagttcgtctcaagagtggagtggacgtcttccacatggcggctgagccgtgtgacactctgctgtgtgacataggtgagtcatcatctagtcctgaagtggaaga
Described zika virus Africa type (Zika virus African genotype) specific and conserved sequence has a sequence of SEQ ID No.6:
ggatgtggcagagggggctggagttactacgccgccaccatccgcaaagttcaagaagtgaaaggatacacaaaaggaggccctggtcatgaagaacccgtgttggtgcaaagctatgggtggaacatagtccgtcttaagagtggggtggacgtctttcatatggcggctgagccgtgtgacacgttgctgtgtgacataggtgagtcatcatctagtcctgaagtggaaga
When using the test kit described in this example that detection sample is detected, mainly comprise the steps that
Step A: the extraction of measuring samples RNA: described sample RNA can take High Pure RNA Isoaltion Kit (Roche, the Germany) test kit that company of Roche Diagnistics produces, and extracts according to test kit description.
Step B: with the measuring samples RNA of step A as template, preparation one-step method reverse transcription FRET-PCR reaction system, carry out amplified reaction, wherein reaction system is as follows: reverse transcriptional PCR augmentation detection system includes the amplification system of 20 μ l, the testing sample RNA template of 10 μ l or in vitro transcription RNA sample, 1xPCR buffer, 1 μM of forward primer, 1 μM of downstream primer, the 6-FAM probe of 0.2 μM, the LCRed640 probe of 0.2 μM, the commercialization Taq enzyme of 2 units, 200 μMs of dNTP, the commercialization reverse transcription of 0.14 unit, the commercialization RNase inhibitor of 20 units.
Wherein, described reaction condition includes: reverse transcription, denaturation, the rigorous circulation of height of 18 lapses of temperature, 30 deficient rigorous fluorescence obtain circulation and 1 down cycles；Reverse transcription: 1x15min@55 DEG C；Denaturation: 1x2min@95 DEG C；The rigorous circulation of height of 18 lapses of temperature: 6x1sec@95 DEG C, 12sec@72 DEG C, 30sec@72 DEG C；9x1sec@95 DEG C, 12sec@70 DEG C, 30sec@72 DEG C；3x1sec@95 DEG C, 12sec@68 DEG C, 30sec@72 DEG C；Owe rigorous fluorescence for 30 and obtain circulation: 67 DEG C of and 30sec@of 30x1sec@95 DEG C, 8sec@55-58 DEG C, 30sec@72 DEG C；Down cycles: 1x1sec@40 DEG C.
Step C: interpretation of result
1) read and record sense channel amplification curve and melting temperature TmValue；Described sense channel includes target fluorescent passage, zika virus Africa type standard fluorescence passage and zika virus Asian type standard fluorescence passage, melting temperature T of described target fluorescent passagem-1, melting temperature T of described Africa type standard fluorescence passagem-AF, melting temperature T of described Asian type standard fluorescence passagem-AS。
2) quality control
Negative control: without amplification curve and without melting temperature；
Positive control: have amplification curve, has melting temperature T simultaneouslym-AF and Tm-AS；
Two above condition needs to meet in once experiment simultaneously, and otherwise this experiment is invalid, needs to re-start experiment.
3) result interpretation
A) all there are amplification curve, and melting temperature T when target fluorescent passage and standard fluorescence passagem-1 and Tm-AF is consistent (± 1C °), then detection sample is zika virus Africa type virus-positive；
B) all there are amplification curve, and melting temperature T when target fluorescent passage and standard fluorescence passagem-1 and Tm-AS is consistent (± 1C °), then detection sample is zika virus Asian type virus-positive；
C) there are amplification curve and melting temperature T when target fluorescent passage without amplification curve and melting temperature, standard fluorescence passage simultaneouslymValue, then detection sample is that zika virus is negative；
D) when target fluorescent passage has amplification curve but without melting temperature, standard fluorescence passage has amplification curve and melting temperature simultaneously, is repeated once experiment, and result is identical, then detection sample is that zika virus is negative；
E) without amplification curve but having melting temperature when target fluorescent passage, standard fluorescence passage has amplification curve and melting temperature, and T simultaneouslym-1 and Tm-AF is consistent (± 1C °), is repeated once experiment, and result is identical, then detection sample is that zika virus Africa type is positive；
F) without amplification curve but having melting temperature when target fluorescent passage, standard fluorescence passage has amplification curve and melting temperature, and T simultaneouslym-1 and Tm-AS is consistent (± 1C °), is repeated once experiment, and result is identical, then detection sample is that zika virus Asian type is positive；
Embodiment 2
The present embodiment 2 verifies sensitivity, specificity and the amplification efficiency of one-step method reverse transcription FRET-PCR detection method in the present invention by being loaded with the plasmid standard of zika virus Africa type and zika virus Asian type.
1) determination of detection method sensitivity
The preparation of step A:DNA plasmid standard
DNA sequence by Jin Sirui (Jin Sirui biotechnology, Nanjing of China) synthesis 2 genotype (ZIKV-Asian, ZIKV-African) purpose fragments of zika virus.According to molecular weight and the absolute weight of synthetic, the absolute number of calculating gene copy contained by synthetic.Subsequently, synthetic is diluted, prepares the dilution reagent of each reaction containing 1 × 104Copy, 1 × 103Copy, 1 × 102Copy, 1 × 101Copy, 1 × 100The genes of interest of copy is as standard substance.With the present system amplification diluent containing different genes concentration, determine that the present invention detects the sensitivity of this gene.The DNA plasmid standard substance providing 2 genotype of zika virus, concentration to be 100 gene copies/microlitre in test kit of the present invention.
Step B: with step A obtain DNA plasmid sample for amplification template, prepare the FRET-PCR amplification system of 20 μ l, including the sample DNA templates of 10 μ l, 1xPCR buffer, 1 μM of forward primer, 1 μM of downstream primer, the 6-FAM probe of 0.2 μM, the LCRed640 probe of 0.2 μM, the commercialization Taq enzyme of 2 units, 200 μMs of dNTP.
Step C: the reaction system in step B is carried out PCR amplification, described PCR amplification arranges reaction condition and includes: denaturation, the rigorous circulation of height of 18 lapses of temperature, 30 owe rigorous fluorescence obtain circulation, 1 continue meltings circulation and 1 down cycles that fluorescence obtains；Denaturation: 1x2min@95 DEG C；The rigorous circulation of height of 18 lapses of temperature: 6x1sec@95 DEG C, 12sec@72 DEG C, 30sec@72 DEG C；9x1sec@95 DEG C, 12sec@70 DEG C, 30sec@72 DEG C；3x1sec@95 DEG C, 12sec@68 DEG C, 30sec@72 DEG C；Owe rigorous fluorescence for 30 and obtain circulation: 67 DEG C of and 30sec@of 30x1sec@95 DEG C, 8sec@55-58 DEG C, 30sec@72 DEG C；1 melting circulation: 85 DEG C of persistent collection fluorescence of 1x1sec@95 DEG C, 10sec@40 DEG C ,@；Down cycles: 1x1sec@40 DEG C.
Repeat above-mentioned detection twice.
Experimental result (Fig. 1 to Fig. 4) shows, the one-step method reverse transcription FRET-PCR that the present invention is set up has high sensitivity, it is possible not only to expand 2 kinds of zika viruses (zika virus Africa type and zika virus Asian type), and the minimum zika virus DNA plasmid standard substance that single copy can be detected；Additionally, twice retest result is basically identical, illustrate that this method has repeatability.
2) reverse transcriptional PCR of the present invention is specific determines
The specificity of the present invention is guaranteed in terms of three:
A) verify that it will not expand other pathogen nucleic acid that non-stockaded village card calentura substance is especially close to its homology or Clinical symptoms is similar by blast search:
BLAST (www.blast.ncbi.nlm.nih.gov/Blast.cgi) search in NCBI (www.ncbi.nlm.nih.gov) of the primer of design and probe, confirm that the primer of present invention design can expand all of zika virus genotype (zika virus Africa type, zika virus Asian type) specifically, and do not expand other non-stockaded village card calentura substance especially close to its homology (dengue virus, Chikungunya virus, Ebola virus, encephalitis b virus etc.) or pathogen nucleic acid of Clinical symptoms similar (malaria etc.).Being confirmed by BLAST, the probe of RT-PCR of the present invention and primer can expand and detect the nucleic acid of two kinds of zika virus genotype specifically but not expand the nucleic acid of other correlated virus；
B) by T in high-resolution melting curvemThe difference of value verifies that it can distinguish two kinds of genotype (ZIKV-Asian, ZIKV-African) of zika virus:
The preparation of step A:DNA plasmid standard
DNA sequence by Jin Sirui (Jin Sirui biotechnology, Nanjing of China) synthesis 2 genotype (ZIKV-Asian, ZIKV-African) purpose fragments of zika virus.According to molecular weight and the absolute weight of synthetic, the absolute number of calculating gene copy contained by synthetic.Subsequently, synthetic is diluted, prepares the dilution reagent of each reaction containing 1 × 104Copy, 1 × 103Copy, 1 × 102Copy, 1 × 101Copy, 1 × 100The genes of interest of copy is as standard substance.
Step B: with step A obtain DNA sample for amplification template, prepare the FRET-PCR amplification system of 20 μ l, including the sample DNA templates of 10 μ l, 1xPCR buffer, 1 μM of forward primer, 1 μM of downstream primer, the 6-FAM probe of 0.2 μM, the LCRed640 probe of 0.2 μM, the commercialization Taq enzyme of 2 units, 200 μMs of dNTP.
Step C: the reaction system in step B is carried out PCR amplification, described PCR amplification arranges reaction condition and includes: denaturation, the rigorous circulation of height of 18 lapses of temperature, 30 owe rigorous fluorescence obtain circulation, 1 continue meltings circulation and 1 down cycles that fluorescence obtains；Denaturation: 1x2min@95 DEG C；The rigorous circulation of height of 18 lapses of temperature: 6x1sec@95 DEG C, 12sec@72 DEG C, 30sec@72 DEG C；9x1sec@95 DEG C, 12sec@70 DEG C, 30sec@72 DEG C；3x1sec@95 DEG C, 12sec@68 DEG C, 30sec@72 DEG C；Owe rigorous fluorescence for 30 and obtain circulation: 67 DEG C of and 30sec@of 30x1sec@95 DEG C, 8sec@55-58 DEG C, 30sec@72 DEG C；1 melting circulation: 85 DEG C of persistent collection fluorescence of 1x1sec@95 DEG C, 10sec@40 DEG C ,@；Down cycles: 1x1sec@40 DEG C.
Repeat above-mentioned detection three times.
As Figure 1-5, present system can the zika virus DNA of two kinds of serotypes of amplification special, efficient for result；Meanwhile, the present invention can be by the African types of two kinds of zika viruses of different differentiation of Tm value in high-resolution melting curve and Asian type, and zika virus Africa type has bimodal, i.e. two Tm values (54.1 DEG C；64.8℃)；And zika virus Asian type is unimodal, i.e. there is a Tm (53.8 DEG C) value.Therefore, the one-step method reverse transcription FRET-PCR set up in the present invention can distinguish zika virus Africa type and zika virus Asian type by the different of Tm value in high-resolution melting curve.
C) verify that it can distinguish the specificity between two kinds of genotype (ZIKV-Asian, ZIKV-African) of zika virus by agarose gel electrophoresis:
The PCR primer produced in above-mentioned b) part is carried out concentration is 3% agarose gel electrophoresis, and the most each hole applied sample amount is 10 μ l, and each band of standard substance is followed successively by 100bp, 200bp from small to large, 300bp, 400bp, 500bp, 600bp, 700bp, 800bp, 900bp, and 1000bp.
Result as shown in Figure 8, swimming lane-1: standard substance；Swimming lane-2: zika virus Africa type (Zika virus Asian genotype, ZIKV-Asian)；Swimming lane-3: zika virus Asian type (Zika virus African genotype, ZIKV-African), two kinds of genotype of zika virus show the stripe size of 167 base pairs (bp).
3) determination of reverse transcriptional PCR system efficiency in the present invention:
The preparation of step A:RNA standard substance
Infecting after Embryo Gallus domesticus with bird flu virus H1N1 and collect its allantoic fluid, extract after test kit (High Pure RNA Isolation Kit, Roche, Germany) carries out RNA nucleic acid extraction by business RNA, use TE buffer, PH is 8.0 to carry out 10-3, 10-4, 10-5, 10-6, 10-7, 10-8As the standard substance of detection reverse transcriptional PCR system effectiveness after gradient dilution.
nullStep B: with the acquisition RNA of step A as template，Preparation one-step method reverse transcription FRET-PCR reaction system，Carry out amplified reaction，Wherein reaction system is as follows: reverse transcriptional PCR augmentation detection system includes the amplification system of 20 μ l，The sample RNA template of 10 μ l、1xPCR buffer、1 μM of influenza forward primer (5 '-GCACTTGATATTGTGGATTCTTGATCGTCTT-3 ')、1 μM of influenza downstream primer (5 '-GACAAAATGACCATCGTCAACATCCACA-3 ')、The influenza 6-FAM probe of 0.2 μM (5 '-CTACGGAAGGAGTGCCTGAGTCTATG-6-FAM-3 ')、The influenza LCRed640 probe of 0.2 μM (5 '-LCRED640-GGGAAGAATATCGGCAGGAACAGCAGA-PHOSPHATE-3 ')、The commercialization Taq enzyme of 2 units、200μM dNTP、The commercialization reverse transcription of 0.14 unit、The commercialization RNase inhibitor of 20 units.
Step C: expand the PCR reaction system of preparation in step B, wherein amplification condition includes that reverse transcription, denaturation, the rigorous circulation of height of 18 lapses of temperature, 30 deficient rigorous fluorescence obtain circulation and 1 down cycles.Reverse transcription: 1x15min@55 DEG C；Denaturation: 1x2min@95 DEG C；The rigorous circulation of height of 18 lapses of temperature: 6x1sec@95 DEG C, 12sec@72 DEG C, 30sec@72 DEG C；9x1sec@95 DEG C, 12sec@70 DEG C, 30sec@72 DEG C；3x1sec@95 DEG C, 12sec@68 DEG C, 30sec@72 DEG C；Owe rigorous fluorescence for 30 and obtain circulation: 67 DEG C of and 30sec@of 30x1sec@95 DEG C, 8sec@55-58 DEG C, 30sec@72 DEG C；Down cycles: 1x1sec@40 DEG C.
Result such as Fig. 6 and Fig. 7, it shows that the reverse transcription FRET-PCR system of the present invention has higher sensitivity, can detect in reaction system minimum 10-7The bird flu virus RNA molecule of copy.
Embodiment 3
After the present embodiment 3 utilizes gene chemical synthesis purpose nucleic acid fragment the plasmid that imports to transcribe synthesis viral RNA nucleic acid in vitro by commercial kit, one-step method reverse transcription FRET-PCR detection method in the present invention is verified, in the present embodiment 3 as a example by detection zika virus Asian type, concrete operations flow process is as follows:
Step A: by Jin Sirui (Jin Sirui biotechnology, Nanjing of China) synthesis contains zika virus Asian type purpose sheet segment DNA (SEQ ID No.5) and the plasmid of T7 promoter criticizes pUC57, with suitable restricted enzyme (Sac I, precious biological, Dalian) plasmid is carried out enzyme action；Target DNA concentration is improved by PCR amplification；With commercialization transcript reagent box (Kit,by lifeThe U.S.)) pcr amplification product transcribed and obtains RNA product；After having transcribed, it is used for reverse transcriptional PCR after being diluted by transcription product and expands.
1) dilution of plasmid
Micro centrifugal pipe 4000 containing synthetic plasmid being left the heart 2 minutes, is subsequently adding 40 μ l TE buffer, PH is 8.0 solution being made into that plasmid concentration is 100ng/ μ l；
2) enzyme action of plasmid
With commercialization restricted enzyme SacI (Sac I, precious biology, Dalian), plasmid being carried out enzyme action, its reaction system is 20 μ l, and each agent formulations forms such as following table；Put in 37 DEG C of environment after each reactant liquor is mixed and hatch 1 hour；Then reaction system mixed liquor is put into heating in 56 DEG C of environment makes restricted enzyme catch fire in 20 minutes, thus terminates endonuclease reaction；
| Sac I | 1μl |
| 10×L Buffer | 2μl |
| DNA (plasmid) | 5μl |
| Aquesterilisa | 12μl |
| Reaction system | 20μl |
3) PCR expands digestion products
From linear plasmid, expand one section with following primer and contain T7 transcripting promoter and target DNA fragment, the fragment of a length of 733 base pairs (bp), thus transcribe the sufficient concentrations of target DNA of offer, more than or equal to 1 μ g/ μ l for follow-up；
P-forward primer: 5 '-AGCTATTATGCCGCCACCATCC-3 '
P-downstream primer: 5 '-CAGAGTGTCACACGGCTCAGCC-3 '
4) in vitro transcription
All related reagents (taking out when RNA Polymerase Enzyme Mix being placed in be used in-20 DEG C of refrigerators) in solubilising reagent box at ambient temperature；
At room temperature mix each reagent in following table and blow and beat mixing up and down by pipettor；
| Amount (consumption) | Component (composition) |
| 7μl | Nuclease-free Water |
| 2μl | ATP solution |
| 2μl | CTP solution |
| 2μl | GTP solution |
4 hours are hatched in 37 DEG C of environment；Add 1 μ l TURBO DNase, hatch in 37 DEG C of environment 15 minutes after mixing, thus remove the nucleic acid DNA in reaction system, thus finally obtain the zika virus RNA nucleic acid of in vitro transcription.
Above-mentioned transcription product TE buffer (PH8.0) is carried out 10-3, 10-4, 10-5Dilution；The RT-PCR system that can detect all zika virus genotype set up by the present invention expands the transcription product diluent (nucleic acid RNA) obtained by said method
Step B: with the in vitro transcription zika virus RNA of the acquisition of step A as template, preparation one-step method reverse transcription FRET-PCR reaction system, carry out amplified reaction, wherein reaction system is as follows: reverse transcriptional PCR augmentation detection system includes the amplification system of 20 μ l, the RNA standard substance of 10 μ l, 1xPCR buffer, 1 μM of forward primer, 1 μM of downstream primer, the 6-FAM probe of 0.2 μM, the LCRed640 probe of 0.2 μM, the commercialization Taq enzyme of 2 units, 200 μMs of dNTP, the commercialization reverse transcription of 0.14 unit, commercialization RNase inhibitor of 20 units.Its reaction condition is shown in embodiment 1 step B.
Step C: interpretation of result
Result shows, transcription product amplified fluorescence curve has at 640nm at the appearance of fluorescence and enhancing, and melting curve and has single, stable melting peaks and TmValue.Therefore, the reverse transcriptional PCR system that the present invention is set up can effective cloning RNA, i.e. can expand zika virus RNA nucleic acid in clinical sample quickly and efficiently.
The inventive method can not only detect zika virus quickly, easily and accurately, simultaneously can determine its genotype by typing, for the countries and regions of especially zika virus outbreak of epidemic in world wide in control, prevent the infection of zika virus to provide technical support.
The ultimate principle of the present invention, principal character and advantages of the present invention have more than been shown and described.Skilled person will appreciate that of the industry; the present invention is not restricted to the described embodiments; the principle that the present invention is simply described described in above-described embodiment and description; without departing from the spirit and scope of the present invention; the present invention also has various changes and modifications, and claimed scope is defined by appending claims, description and equivalent thereof.
。
Claims (10)
1. an one-step method reverse transcriptional PCR detects the primer with typing zika virus and probe, it is characterised in that described primer includes
Trip primer and downstream primer, described probe includes 6-FAM probe and LCRed640 probe, wherein:
Described forward primer has the nucleotide sequence of SEQ ID No.1；
Described downstream primer has the nucleotide sequence of SEQ ID No.2；
Described 6-FAM probe has the nucleotide sequence of SEQ ID No.3；
Described LCRed640 probe has the nucleotide sequence of SEQ ID No.4.
2. an one-step method reverse transcriptional PCR detection and the test kit of typing zika virus, it is characterised in that include such as claim 1 institute
The primer stated and probe, and FRET-PCR standard substance.
A kind of one-step method reverse transcriptional PCR the most as claimed in claim 2 detection and the test kit of typing zika virus, it is characterised in that
Described test kit also includes: PCR buffer, hot start Taq polymerase and dNTP.
4. a kind of one-step method reverse transcriptional PCR detection as described in claim 2 or 3 and the test kit of typing zika virus, its feature
Being, described FRET-PCR standard substance include DNA plasmid standard substance and RNA standard substance；Wherein, described DNA plasmid standard
Product are the restructuring that the nucleotide fragments with SEQ ID No.5 and SEQ ID No.6 sequence inserts pUC57 vector construction
Plasmid；Described RNA standard substance are will to lead to containing the plasmid of SEQ ID No.5 and SEQ ID No.6 sequence and T7 promoter sequence
Cross the RNA nucleotide that in vitro transcription obtains.
5. a reverse transcriptional PCR augmentation detection system for the test kit of the detection of one-step method reverse transcriptional PCR and analysis zika virus, its feature
Being, described reverse transcriptional PCR augmentation detection system includes following amplification system: volume ratio is amplification system cumulative volume 50%
Sample RNA template or RNA standard substance, 1x PCR buffer, 1 μM of forward primer as claimed in claim 1,1 μM
Downstream primer as claimed in claim 1,0.2 μM of 6-FAM probe as claimed in claim 1,0.2 μM such as claim
LCRed640 probe described in 1, the commercialization Taq enzyme of 2 units, 200 μMs of dNTP, 0.14 unit commercialization anti-
The commercialization RNase inhibitor of transcriptase and 20 units.
The reverse transcriptional PCR of the test kit of a kind of one-step method reverse transcriptional PCR the most as claimed in claim 5 detection and analysis zika virus expands
Increase detection system, it is characterised in that the reaction condition of described reverse transcriptional PCR amplification system includes: reverse transcription, denaturation,
The rigorous circulation of height of 18 lapses of temperature, 30 deficient rigorous fluorescence obtain circulation and 1 down cycles, wherein:
Reverse transcription: 1x15min@55 DEG C；Denaturation: 1x2min@95 DEG C；The rigorous circulation of height of 18 lapses of temperature:
6x1sec@95 DEG C, 12sec@72 DEG C, 30sec@72 DEG C；9x1sec@95 DEG C, 12sec@70 DEG C, 30sec@72 DEG C；
3x1sec@95 DEG C, 12sec@68 DEG C, 30sec@72 DEG C；Owe rigorous fluorescence for 30 and obtain circulation: 30x1sec@95 DEG C,
67 DEG C of and 30sec@of 8sec@55-58 DEG C, 30sec@72 DEG C；Down cycles: 1x1sec@40 DEG C.
7. the real time fluorescent quantitative FRET-PCR augmentation detection body of the test kit of an one-step method reverse transcriptional PCR detection and typing zika virus
System, it is characterised in that described real time fluorescent quantitative FRET-PCR augmentation detection system includes following amplification system: volume ratio is
The sample DNA templates of amplification system cumulative volume 50% or DNA plasmid standard substance, 1x PCR buffer, 1 μM of forward primer,
1 μM of downstream primer, the 6-FAM probe of 0.2 μM, the LCRed640 probe of 0.2 μM, the commercialization Taq enzyme of 2 units,
With 200 μMs of dNTP.
The real time fluorescent quantitative of the test kit of a kind of one-step method reverse transcriptional PCR the most as claimed in claim 7 detection and typing zika virus
FRET-PCR augmentation detection system, it is characterised in that the PCR of described real time fluorescent quantitative FRET-PCR augmentation detection system
Amplification reaction condition includes: denaturation, the rigorous circulation of height of 18 lapses of temperature, 30 owe rigorous fluorescence obtain circulation, 1
The individual melting circulation continuing fluorescence acquisition and 1 down cycles, wherein:
Denaturation: 1x2min@95 DEG C；The rigorous circulation of height of 18 lapses of temperature: 6x1sec@95 DEG C, 12sec@72 DEG C,
30sec@72℃；9x1sec@95 DEG C, 12sec@70 DEG C, 30sec@72 DEG C；3x1sec@95 DEG C, 12sec@68 DEG C,
30sec@72℃；Owe rigorous fluorescence acquisition for 30 to circulate: 30x1sec@95 DEG C, 8sec@55-58 DEG C, 30sec@67 DEG C
and 30sec@72℃；1 melting circulation: 85 DEG C of persistent collection fluorescence of 1x1sec@95 DEG C, 10sec@40 DEG C ,@；Fall
Temperature circulation: 1x1sec@40 DEG C.
9. a detection and the detection method of typing zika virus, it is characterised in that comprise the following steps:
Step 1: prepare detection sample RNA template；
Step 2: prepare primer as claimed in claim 1 and probe；Being used for as described in entitlement requests 5 detects and divides in preparation
The one-step method reverse transcriptional PCR augmentation detection system of type zika virus, enters the RNA template to be checked described in step 1 and standard substance
Row amplification；Its reaction condition includes: reverse transcription, denaturation, the rigorous circulation of height of 18 lapses of temperature, 30 owe rigorous glimmering
Light obtains circulation and 1 down cycles；Reverse transcription: 1x15min@55 DEG C；Denaturation: 1x2min@95 DEG C；18 temperature
The rigorous circulation of height successively decreased: 6x1sec@95 DEG C, 12sec@72 DEG C, 30sec@72 DEG C；9x1sec@95 DEG C, 12sec@70 DEG C,
30sec@72℃；3x1sec@95 DEG C, 12sec@68 DEG C, 30sec@72 DEG C；Owe rigorous fluorescence acquisition for 30 to circulate:
67 DEG C of and 30sec@of 30x1sec@95 DEG C, 8sec@55-58 DEG C, 30sec@72 DEG C；Down cycles: 1x1sec@40 DEG C；
Fluorescence signal is collected when the annealing of each circulation；Described fluorescent probe and standard probe corresponding target fluorescent passage, stockaded village's card respectively
Virus Africa type standard substance fluorescence channel and zika virus Asian type standard substance fluorescence channel；
Step 3: after reaction terminates, read and record sense channel amplification curve and melting temperature TmValue；Described sense channel bag
Include target fluorescent passage, zika virus Africa type standard fluorescence passage and zika virus Asian type standard fluorescence passage, described target
Melting temperature T of fluorescence channelm-1, melting temperature T of described Africa type standard fluorescence passagem-AF, described Asian type standard fluorescence
Melting temperature T of passagem-AS, carries out the judgement of testing result according to herein below:
1) all there are amplification curve, and melting temperature T when target fluorescent passage and standard fluorescence passagem-1 and Tm-AF consistent (± 1
DEG C), then detection sample is zika virus Africa type virus-positive；
2) all there are amplification curve, and melting temperature T when target fluorescent passage and standard fluorescence passagem-1 and Tm-AS consistent (± 1
DEG C), then detection sample is zika virus Asian type virus-positive；
3) there are amplification curve and melting temperature when target fluorescent passage without amplification curve and melting temperature, standard fluorescence passage simultaneously
TmValue, then detection sample is that zika virus is negative；
4) when target fluorescent passage has amplification curve but without melting temperature, standard fluorescence passage have simultaneously amplification curve and melt temperature
Degree, is repeated once experiment, and result is identical, then detection sample is that zika virus is negative；
5) without amplification curve but having melting temperature when target fluorescent passage, standard fluorescence passage has amplification curve simultaneously and melts temperature
Degree, and Tm-1 and Tm-AF is consistent (± 1 DEG C), is repeated once experiment, and result is identical, then detection sample is that zika virus is non-
Continent type is positive；
6) without amplification curve but having melting temperature when target fluorescent passage, standard fluorescence passage has amplification curve simultaneously and melts temperature
Degree, and Tm-1 and Tm-AS is consistent (± 1 DEG C), is repeated once experiment, and result is identical, then detection sample is that zika virus is sub-
Continent type is positive.
10. the application in detection zika virus nucleic acid of any one as described in claim 1,2,5,7 or 9.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610481524.6A CN105936946A (en) | 2016-06-27 | 2016-06-27 | One step method inverse transcription PCR kit for detecting and differentiating Zika viruses and detection method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610481524.6A CN105936946A (en) | 2016-06-27 | 2016-06-27 | One step method inverse transcription PCR kit for detecting and differentiating Zika viruses and detection method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105936946A true CN105936946A (en) | 2016-09-14 |
Family
ID=56872695
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610481524.6A Pending CN105936946A (en) | 2016-06-27 | 2016-06-27 | One step method inverse transcription PCR kit for detecting and differentiating Zika viruses and detection method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105936946A (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106841601A (en) * | 2016-12-30 | 2017-06-13 | 广州市达瑞生物技术股份有限公司 | The preparation of zika virus multiple clips fusion protein and IgG/IgM antibody assay kits |
| WO2017164741A3 (en) * | 2016-03-24 | 2017-11-23 | Stichting Sanquin Bloedvoorziening | Detection of zika virus nucleic acid |
| CN107937615A (en) * | 2017-12-20 | 2018-04-20 | 广东省农业科学院动物卫生研究所 | For distinguishing the primer and probe of Latex agglutination test street strain and vaccine strain |
| CN108690884A (en) * | 2017-04-07 | 2018-10-23 | 宣捷干细胞生技股份有限公司 | Hereby block viral primer and probe combinations and its kit for detecting |
| CN108950077A (en) * | 2018-08-07 | 2018-12-07 | 中华人民共和国苏州出入境检验检疫局 | The qPCR detection method of zika virus |
| CN110229931A (en) * | 2019-05-07 | 2019-09-13 | 山东国际旅行卫生保健中心 | Zika virus detection kit and its detection method based on high-resolution melting curve |
| CN111424024A (en) * | 2020-05-22 | 2020-07-17 | 扬州大学 | Preparation and use methods of low-temperature cellulase |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104328222A (en) * | 2014-11-17 | 2015-02-04 | 扬州大学 | Kit capable of detecting and parting dengue viruses by reverse transcription PCR and detection method of kit |
| CN104513865A (en) * | 2014-11-25 | 2015-04-15 | 扬州大学 | Kit and detection method for inverse transcription PCR detection of chikungunya virus |
| CN105506188A (en) * | 2016-02-23 | 2016-04-20 | 深圳市易瑞生物技术有限公司 | Fluorescent RT-PCR (reverse transcription-polymerase chain reaction) primer, fluorescent probe, kit and method for detecting Asia-type Zika viruses |
-
2016
- 2016-06-27 CN CN201610481524.6A patent/CN105936946A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104328222A (en) * | 2014-11-17 | 2015-02-04 | 扬州大学 | Kit capable of detecting and parting dengue viruses by reverse transcription PCR and detection method of kit |
| CN104513865A (en) * | 2014-11-25 | 2015-04-15 | 扬州大学 | Kit and detection method for inverse transcription PCR detection of chikungunya virus |
| CN105506188A (en) * | 2016-02-23 | 2016-04-20 | 深圳市易瑞生物技术有限公司 | Fluorescent RT-PCR (reverse transcription-polymerase chain reaction) primer, fluorescent probe, kit and method for detecting Asia-type Zika viruses |
Non-Patent Citations (1)
| Title |
|---|
| 狄弘玮等: "寨卡病毒基因序列分析及核酸检测方法", 《第二军医大学学报》 * |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017164741A3 (en) * | 2016-03-24 | 2017-11-23 | Stichting Sanquin Bloedvoorziening | Detection of zika virus nucleic acid |
| CN106841601A (en) * | 2016-12-30 | 2017-06-13 | 广州市达瑞生物技术股份有限公司 | The preparation of zika virus multiple clips fusion protein and IgG/IgM antibody assay kits |
| CN108690884A (en) * | 2017-04-07 | 2018-10-23 | 宣捷干细胞生技股份有限公司 | Hereby block viral primer and probe combinations and its kit for detecting |
| CN107937615A (en) * | 2017-12-20 | 2018-04-20 | 广东省农业科学院动物卫生研究所 | For distinguishing the primer and probe of Latex agglutination test street strain and vaccine strain |
| CN107937615B (en) * | 2017-12-20 | 2021-06-25 | 广东省农业科学院动物卫生研究所 | Primers and probes for distinguishing wild strains and vaccine strains of swine Japanese encephalitis virus |
| CN108950077A (en) * | 2018-08-07 | 2018-12-07 | 中华人民共和国苏州出入境检验检疫局 | The qPCR detection method of zika virus |
| CN110229931A (en) * | 2019-05-07 | 2019-09-13 | 山东国际旅行卫生保健中心 | Zika virus detection kit and its detection method based on high-resolution melting curve |
| CN111424024A (en) * | 2020-05-22 | 2020-07-17 | 扬州大学 | Preparation and use methods of low-temperature cellulase |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105936946A (en) | One step method inverse transcription PCR kit for detecting and differentiating Zika viruses and detection method thereof | |
| CN111041129B (en) | Primer-probe combination for detecting 6 respiratory viruses, kit and application | |
| CN106367533B (en) | For detecting the nucleic acid, real-time fluorescence RPA kit and method of zika virus | |
| CN104513865B (en) | Reverse transcription PCR detects test kit and the detection method thereof of Chikungunya virus | |
| CN108330210B (en) | Zika virus, dengue virus and chikungunya virus nucleic acid detection kit and application thereof | |
| CN105838713A (en) | Method for detecting fluorogenic quantitative PCR of Zika virus, primers and kit | |
| Neeraja et al. | Rapid detection and differentiation of dengue virus serotypes by NS1 specific reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay in patients presenting to a tertiary care hospital in Hyderabad, India | |
| CN101696454B (en) | RT-LAMP primer for visually detecting wild strains of classical swine fever virus | |
| WO2016078553A1 (en) | Kit for detecting and typing dengue viruses by reverse transcription pcr and detection method thereof | |
| Estrela et al. | Ten-minute direct detection of Zika virus in serum samples by RT-LAMP | |
| CN106086242A (en) | A kind of test kit detected for Flavivirus fast typing and virus load | |
| CN107619885A (en) | A kind of fluorescence RT RAA primers, probe and detection method for being used to detect dengue virus | |
| Hui et al. | Micro-droplet digital polymerase chain reaction and real-time quantitative polymerase chain reaction technologies provide highly sensitive and accurate detection of Zika Virus | |
| CN103255232B (en) | Dual fluorescence RT (Reverse Transcription)-PCR (Polymerase Chain Reaction) detection kit and method for avian influenza H7N9 virus | |
| CN110527747B (en) | Kit for detecting wild strains of classical swine fever viruses | |
| Sun et al. | Rapid and sensitive detection of hepatitis C virus in clinical blood samples using reverse transcriptase polymerase spiral reaction | |
| CN107287352A (en) | The probe primer group and its method of duck enteritis virus and duck hepatitis virus quick detection | |
| CN102154519A (en) | General TaqMan real-time fluorescent quantitative polymerase chain reaction (PCR) detection kit for dengue virus | |
| CN105463131A (en) | Human bocavirus LAMP (loop-mediated isothermal amplification) detection kit | |
| CN102108420A (en) | Fluorescence quantitative polymerase chain reaction (PCR) kit for detecting dengue virus type 1 | |
| CN107574265A (en) | A kind of primer sets, kit and detection method for being used to detect zika virus | |
| CN108411042A (en) | A kind of fluorescence quantification PCR primer and kit of detection japanese encephalitis virus | |
| CN107267666A (en) | A kind of fluorescent quantitation RT PCR detection kits based on pig atypia pestivirus raq gene | |
| CN104894112B (en) | A kind of Japanese B encephalitis virus real-time fluorescence isothermal amplification detection kit and its primer and probe | |
| CN112195272A (en) | Kit for detecting porcine Japanese encephalitis virus by combining centrifugal microfluidic chip with loop-mediated isothermal amplification technology |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160914 |
|
| RJ01 | Rejection of invention patent application after publication |