CN108411042A - A kind of fluorescence quantification PCR primer and kit of detection japanese encephalitis virus - Google Patents
A kind of fluorescence quantification PCR primer and kit of detection japanese encephalitis virus Download PDFInfo
- Publication number
- CN108411042A CN108411042A CN201810496132.6A CN201810496132A CN108411042A CN 108411042 A CN108411042 A CN 108411042A CN 201810496132 A CN201810496132 A CN 201810496132A CN 108411042 A CN108411042 A CN 108411042A
- Authority
- CN
- China
- Prior art keywords
- japanese encephalitis
- encephalitis virus
- pcr
- kit
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Virology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides a kind of fluorescence quantification PCR primers and kit of detection japanese encephalitis virus, and primer includes sense primer 1 and downstream primer 1, and nucleotide sequence is as follows：Sense primer 1：gggaaagggagaagtccatagcaat；Downstream primer 1：tgagccagtagccttcacttcatag.Kit of the present invention can be detected after TRIzol reagents are added by inactivation of virus in common lab, safe ready；Japanese encephalitis virus can be quantified and detected, can be detected when viral copy number is 100 or more, high sensitivity；It can be used for detecting the sample such as the virus in blood, cerebrospinal fluid of japanese encephalitis virus the infected, it can also be used to which the detection of virus titer in the basic research of japanese encephalitis virus and vaccine development, production process has a good application prospect.
Description
Technical field
The invention belongs to detect the kit field of japanese encephalitis virus, more particularly, to a kind of detection japanese encephalitis virus
PCR kit for fluorescence quantitative.
Background technology
Japanese encephalitis virus (Japanese encephalitis virus, JEV) is also known as epidemic encephalitis B virus
(Epidemic encephalitis B virus) is the pathogen of encephalitis B (Japanese Type-B encephalitis, abbreviation encephalitis).
Encephalitis B is to cause the viral disease of mankind's central nervous system infection by killing propagation, case fatality rate is up to 20%~
30%, sequelae is heavier.China is the most country of encephalitis B number of the infected, accounts for the world and always falls ill 80% or more of number.
In animal, pig is the major source of infection of this disease, and it is in the chain of pig-mosquito-people to have amplification effect, JEV infection to JEV, while Japanese
Encephalitis is also one of great epidemic disease of pig breeding industry.
Japanese encephalitis virus geneome RNA overall length about 11kb encodes 3 kinds of structural proteins, i.e. C protein (capsid/core egg
In vain), prM/M (film precursor protein/memebrane protein) and E protein (membrane glycoprotein), 7 kinds of non-structural proteins, i.e. NS1, NS2a,
NS2b, NS3, NS4a, NS4b and NS5.E gene sizes are 1500bp, encode 500 amino acid residues.E protein is virion surface
Important component, merge with the virulence of virus, host range, tissue tropism, film, protective immunity, hemagglutination and serum spy
It is anisotropic related.NS5 is the largest conservative protein, and molecular weight 105kDa is basic protein, is considered to have RNA polymerases
Effect.In view of the conservative of NS5 gene orders, we choose the partial sequence design primer on NS5 genes, carry out encephalitis B
The detection of virus.
The diagnosis of encephalitis B case relies primarily on the evidence of three aspect of epidemiology, Clinical symptoms and laboratory examination.
Laboratory examination includes reverse passive hemagglutination Inhibition test, indirect immunofluorescence, enzyme-linked immunosorbent assay and virus purification etc.
Method.However, these cannot provide strong diagnostic evidence mainly for the detection method of antibody in disease early stage.Especially
It is that the above method is both needed to measure and compare the serum antibody titer of acute stage and convalescence, and time span is long, is unfavorable for patient's
Early diagnosis and therapy.RT-RCR methods are although sensitive and can be detected to virus in early stage, but because of its complex steps and
It is be easy to cause pollution, thereby using being restricted.
Real-Time Fluorescent Quantitative PCR Technique is to be grown up based on traditional round pcr the mid-90 in last century.With biography
The round pcr of system is compared, and Real_time quantitative detection method not only realizes the quantitative analysis of low copy number target polynucleotide, but also
Has many advantages, such as the possibility smaller of stronger specificity and accuracy, the degree of automation higher and pollution.Real-time fluorescence PCR skill
Art can carry out qualitative and quantitative analysis by the analysis to amplification curve and cycle threshold (Ct) to detection sample.In real time
Fluorescent PCR is the overall process of dynamic detection DNA cloning that DNA cloning and detection process combine together, and eliminates PCR post-processings
Process substantially reduces the interpretation of result time, quick and easy.Since real-time fluorescence PCR takes a kind of closed detection pattern,
To the false positive for reducing Aerosol Pollution He thereby resulting in.Therefore, the technology is in the detection of target polynucleotide sample and fixed
In amount analysis, traditional PCR method is gradually replaced, very extensive application is obtained.
One of detection pattern of quantitative fluorescent PCR is SYBR Green I detection patterns.SYBR Green I are a kind of energy
Luminous fluorescent dye is combined with double-stranded DNA.After it is combined with double-stranded DNA, fluorescence greatly enhances.Therefore, SYBR Green I
Fluorescence signal intensity it is related to the quantity of double-stranded DNA, double-stranded DNA existing for PCR system can be detected according to fluorescence signal
Quantity, versatility is good, and price is relatively low.Since SYBR Green I are combined with all double-stranded DNAs, by drawing
False positive can influence quantitative accuracy caused by the amplified production of object dimer, single-stranded secondary structure and mistake.Pass through survey
The variation of fluorescence can help to reduce the influence of nonspecific products after amount raising temperature, and the equal of product is analyzed by melting curve
One property contributes to analysis to obtain quantitative result by SYBR Green I.
Beam state et al. once utilized TaqMan probe fluorescence quantifying PCR method to detect the japanese encephalitis virus (patent No.：CN
100368557C).But TaqMan probe fluorescent quantitative PCR detection method cost is too high, does not utilize and is widely used.In addition,
Presence of the TaqMan probe fluorescent quantitative PCR detection method based on target sequence in amplification procedure and send out reporter gene fluorescence letter
Number, and japanese encephalitis virus easily morphs, and if target sequence mutates, TaqMan probe fluorescence quantitative PCR detection side
Method will lose meaning.Therefore, SYBR Green I fluorescent quantitations PCR detection method is more suitable for all variants of japanese encephalitis virus
Detection and quantitative analysis.
Invention content
In view of this, the present invention is directed to propose a kind of PCR kit for fluorescence quantitative of detection japanese encephalitis virus, the reagent
Box can quickly detect japanese encephalitis virus RNA copy numbers in the biological sample, be a kind of reverse transcription quantitative PCR kit.
In order to achieve the above objectives, the technical proposal of the invention is realized in this way：
A kind of fluorescence quantification PCR primer of detection japanese encephalitis virus, including sense primer 1 and downstream primer 1, nucleosides
Acid sequence is as follows：
Sense primer 1：gggaaagggagaagtccatagcaat；
Downstream primer 1：tgagccagtagccttcacttcatag.
The invention also includes a kind of PCR kit for fluorescence quantitative for the detection japanese encephalitis virus including above-mentioned primer.
Further, the kit further includes RNA extraction agents, reverse transcriptase, Taq archaeal dna polymerases, standard positive
DNA masterplates, reverse transcription reaction liquid, fluorescent quantitation reaction solution.
Further, the standard positive DNA masterplates are the cloned plasmids of the gene order containing japanese encephalitis virus NS5
PGEM-NS5, the nucleotide sequence such as SEQ ID NO of the gene order of the japanese encephalitis virus NS5:Shown in 1.
Further, the preparation method of the cloned plasmids pGEM-NS5 includes the following steps：
S1. japanese encephalitis virus is cultivated, extraction viral RNA carries out reverse transcription reaction and prepares virus cDNA, reacted as PCR
Masterplate；
S2. PCR reactions are carried out using sense primer 2 and downstream primer 2, expands NS5 genetic fragments；
S3. it utilizes agarose gel electrophoresis purifying to recycle above-mentioned PCR reaction products, is connected respectively to cloning vector matter
On grain pGEM-T, construction recombination plasmid；
S4. by recombinant plasmid transformed competence colibacillus cell, positive colony culture is chosen, extracts plasmid, correctly clone's matter is sequenced
Grain is named as pGEM-NS5.
Further, above-mentioned steps S2 middle and upper reaches primer 2 and the nucleotide sequence of downstream primer 2 are as follows：
Sense primer 2：gggaaagggagaagtccatagcaat；
Downstream primer 2：cagcagtattcgtgaaagtgttaag.
Further, the concentration of the cloned plasmids pGEM-NS5 in the kit is respectively 107Copy number/μ L, 106It copies
Shellfish number/μ L, 105Copy number/μ L, 104Copy number/μ L or 103Copy number/μ L.
Further, the RNA extraction agents are TRIzol.TRIzol is strong denaturant, it both can be from biological sample
Middle extracting and purifying goes out the RNA of japanese encephalitis virus, can also inactivate japanese encephalitis virus that may be present in biological sample.
Further, the reverse transcriptase is SuperScript III Reverse Transcriptase.
Further, the reverse transcription reaction liquid includes 1 μ L oligo (dT)20, 4 μ L, 5 × the first chain buffer solutions, 1 μ L
10mM dNTP mixed liquors, 1 μ L 0.1M DTT.
Further, the fluorescent quantitation reaction solution includes 10 × Buffer of Taq archaeal dna polymerases, dNTP mixtures, 1
μ L sense primers 1,1 μ L downstream primers 1,25 μ L Platinum SYBR Green qPCR SuperMix-UDG with ROX.
The application method of mentioned reagent box includes the following steps：
S1. the extraction of viral RNA：It will be cultivated after BHK-21 cell inoculation viruses, take cells and supernatant, be added to RNA pumpings
It carries in reagent, chloroform is then added, shake rear centrifuging and taking upper solution, isopropanol is added, is centrifuged after being placed at room temperature for, with 75% second
Alcohol washes RNA precipitate, is dried after centrifugation, is dissolved in the deionized water of DEPC processing and obtains RNA solution；
S2. reverse transcription reaction：Reverse transcription reaction liquid, RNA solution, reverse transcriptase mixing progress reverse transcription reaction are obtained inverse
Transcription product；
S3. quantitative fluorescent PCR reacts：By fluorescence quantitative PCR reaction solution, reverse transcription product, standard positive DNA masterplates, Taq
Archaeal dna polymerase mixing carries out PCR reactions；
S4. it reads positive criteria and detects the copy number of sample.
Mentioned reagent box is preparing the purposes in detecting japanese encephalitis virus reagent.
The fluorescence quantification PCR primer and kit of detection japanese encephalitis virus of the present invention exist below beneficial to effect
Fruit：
The kit of the present invention can be detected after TRIzol reagents are added by inactivation of virus in common lab, be pacified
It is complete convenient.The kit of the present invention can quantify japanese encephalitis virus and detect, and can be detected when viral copy number is 100 or more
It arrives, high sensitivity.It can be used for detecting the sample such as the virus in blood, cerebrospinal fluid of japanese encephalitis virus the infected, it can also be used to
The detection of virus titer, has a good application prospect in the basic research of japanese encephalitis virus and vaccine development, production process.
Description of the drawings
Fig. 1 is quantitative fluorescent PCR canonical plotting；
Fig. 2 is the solubility curve figure of amplified production.
Specific implementation mode
In addition to being defined, technical term used in following embodiment has universal with those skilled in the art of the invention
The identical meanings of understanding.Test reagent used in following embodiment is unless otherwise specified conventional biochemical reagent；It is described
Experimental method is unless otherwise specified conventional method.
With reference to embodiment and attached drawing, the present invention will be described in detail.
Embodiment 1：Kit main agents and dosage
RNA extraction agents：TRIzol reagents；Reverse transcriptase：SuperScript III Reverse
Transcriptase；Taq archaeal dna polymerases：Taq archaeal dna polymerases；Reverse transcription reaction liquid：oligo(dT)201 μ L, 5 × the first
4 μ L, 10mM dNTP mixed liquors of chain buffer solution, 1 μ L, 0.1M DTT, 1 μ L；Fluorescence quantitative PCR reaction solution：Sense primer 1 and downstream
1 25 μ L, DEPC water of each 1 μ L, Platinum SYBR Green qPCR SuperMix-UDG with ROX of primer, 22 μ L；Mark
Zhunyang property DNA masterplates：The aqueous solution of plasmid pGEM-NS5, concentration are respectively 107Copy/μ L, 106Copy/μ L, 105Copy/μ L,
104Copy/μ L, 103Copy/μ L；RNase inhibitor；Chloroform；Propyl alcohol；75% ethyl alcohol；DEPC water, wherein sense primer 1 is under
Primer 1 is swum, nucleotide sequence is as follows：Sense primer 1：gggaaagggagaagtccatagcaat；Downstream primer 1：
tgagccagtagccttcacttcatag。
Wherein, Taq archaeal dna polymerases are purchased from Fementas companies, dNTP, SuperScript III Reverse
Transcriptase, TRIzol reagent, SYBR Green qPCR SuperMix-UDG with ROX reagents and RNA enzyme inhibit
Agent is purchased from Invitrogen companies, and chloroform, isopropanol, 75% ethyl alcohol and DEPC water are commercial product.
Embodiment 2：The preparation of standard positive DNA masterplates
(1) extraction of japanese encephalitis virus RNA
Certain time after the BHK-21 cell inoculation viruses of culture takes 100 μ L cells and supernatants, is added to 1mL TRIzol
It in reagent, shakes up, stands 5 minutes.0.2mL chloroforms are added, acutely shaking 15 seconds, are then centrifuged 15 minutes with 12000g room temperature.
Upper solution is taken, 0.5mL isopropanols are added, are placed at room temperature for 10 minutes.12000g room temperature centrifuges 15 minutes, carefully outwells liquid.
RNA precipitate is washed with 75% ethyl alcohol of 1mL, 12000g room temperature centrifuges 5 minutes.Liquid carefully is outwelled, is dried at room temperature.RNA is dissolved in 50
In the deionized water of μ L DEPC processing.
(2) reverse transcription PCR expands NS5 genetic fragments
Reverse transcription reaction, prepares japanese encephalitis virus cDNA masterplates, and reverse transcription reaction condition is as follows：Reverse transcription reaction liquid 11
μ L, 7 μ L of RNA solution, 1 μ L, SuperScript III RT1 μ L of RNase inhibitor, mixing, 25 DEG C are reacted 5 minutes, and then 50
DEG C reaction 30 minutes.
The nucleotide sequence such as SEQ ID NO of PCR reaction amplification NS5 genetic fragments:Shown in 1.
Primer：The nucleotides sequence of NS5 genetic fragment upstream and downstream primers is classified as：
Sense primer 2：gggaaagggagaagtccatagcaat；
Downstream primer 2：cagcagtattcgtgaaagtgttaag.
PCR reaction compositions：2 μ L, 10 × PCR buffer solution of japanese encephalitis virus cDNA masterplates, 5 μ L, deionized water 36 μ L, 10
× dNTP5 μ L, 0.5 μ L of sense primer, 0.5 μ L, Taq archaeal dna polymerase of downstream primer, 1 μ L.
PCR reaction conditions：95 DEG C 5 minutes；95 DEG C 30 seconds, 60 DEG C 30 seconds, 72 DEG C 1 minute totally 30 cycle；72 DEG C 5 points
Clock.
(3) the NS5 genetic fragments that above-mentioned PCR reactions amplification obtains are recycled in agarose gel electrophoresis purifying, by following condition
It is connected on pGEM-T carriers：1 μ L, NS5 genetic fragment of pGEM-T1 μ L, 10 × T4DNA ligase buffer solution, 7 μ L, T4DNA companies
1 μ L of enzyme are met, 4 DEG C of reactions are overnight.
(4) connection product converts DH5a competent cells, chooses positive colony culture, and correctly clone's matter is sequenced in upgrading grain
Grain is named as pGEM-NS5.
(5) preparation of standard positive DNA masterplates：It is respectively 10 that plasmid pGEM-NS5, which is made into concentration,7Copy/μ L, 106It copies
Shellfish/μ L, 105Copy/μ L, 104Copy/μ L, 103The aqueous solution of copy/μ L, the standard positive DNA masterplates as in kit.
Embodiment 3：The PCR kit for fluorescence quantitative of japanese encephalitis virus detects japanese encephalitis virus titre
(1) extraction of japanese encephalitis virus RNA
Certain time after the BHK-21 cell inoculation viruses of culture takes 100 μ L cells and supernatants, is added to 1ml TRIzol
It in reagent, shakes up, stands 5 minutes.0.2mL chloroforms are added, acutely shaking 15 seconds, are then centrifuged 15 minutes with 12000g room temperature.
Upper solution is taken, 0.5mL isopropanols are added, are placed at room temperature for 10 minutes.12000g room temperature centrifuges 15 minutes, carefully outwells liquid.
RNA precipitate is washed with 1mL75% ethyl alcohol, 12000g room temperature centrifuges 5 minutes.Liquid carefully is outwelled, is dried at room temperature.RNA is dissolved in 50 μ
In the deionized water of L DEPC processing.
(2) reverse transcription reaction
Japanese encephalitis virus cDNA masterplates are prepared, reverse transcription reaction condition is as follows：11 μ L of reverse transcription reaction liquid, RNA solution 7
μ L, 1 μ L, SuperScript III RT1 μ L of RNase inhibitor, mixing, 25 DEG C are reacted 5 minutes, then react 30 points for 50 DEG C
Clock.
(3) quantitative fluorescent PCR reacts
49 μ L of fluorescence quantitative PCR reaction solution, reverse transcription product, positive criteria template 1 μ L, 95 DEG C 10 minutes；95 DEG C 15 seconds,
60 DEG C 30 seconds, totally 40 cycle.
It obtains standard curve and reads the copy number of detection sample：
1 template copy numbers of table and recurring number Ct value correspondences
| Template copy numbers | 107 | 106 | 105 | 104 | 103 |
| Ct values | 18 | 21 | 24 | 27 | 30 |
With Log (template copy numbers) for abscissa, recurring number Ct values are that ordinate draws standard curve, gained standard curve
Equation is：Y=-3.408x+14.348 R2=0.998 (showing that linear relationship is good) Eff%=96.5, as shown in Figure 1.
Solubility curve is the curve for judging whether amplified production is single, and other peaks occur should consider whether as primer dimerization
Body (is generally between 60~75 DEG C), or is the peak of contaminating genomic DNA (after 90 DEG C).As shown in Fig. 2, solubility curve
For simple spike, there is the feature solubility curve of japanese encephalitis virus non-structural protein NS5 genes after 75 DEG C, illustrate without other
Pollution and primer dimer.
Embodiment 4：Specificity experiments
Using embodiment 3 method respectively to influenza A virus, influenza B virus RNA, HCV RNA,
Human cytomegalovirus RNA, measles virus RNA, the progress RT-PCR detections of japanese encephalitis virus positive reference substance, the result is shown in Figure 1, only
Japanese encephalitis virus RNA is the positive, remaining is feminine gender.The result shows that detection kit specificity of the invention is high, it can be accurate
Ground specifically detected japanese encephalitis virus.
Embodiment 5：Sensitivity experiment
Positive reference substance (the cloned plasmids pGEM-NS5 built) is taken, its concentration is measured and calculates copy number, according to
10 times of concentration gradient dilution, chooses 1.0 × 100~1.0 × 106The concentration of copy/μ L carries out sensitivity experiment as sample,
It is detected with the kit of the present invention and detection method.
Testing result shows this kit a concentration of to the minimum detectability of japanese encephalitis virus 1.0 × 100Copy/μ L；
The standard curve of 10 times of gradient dilutions, slope 3.408, coefficient R2It is 0.998, high sensitivity.
Embodiment 6：Repetitive test
Take positive reference substance (the cloned plasmids pGEM-NS5 built) in kit and negative controls (negative right
It is the ddH by sterilization treatment according to template2O), with the kit and detection method of the present invention, 10 experiments, detection are continuously repeated
As a result show that the positive reference substance Ct value coefficient of variation is respectively less than 5%, negative controls are without amplification.
Above example shows that kit of the invention has good accuracy, high sensitivity, repeatability strong, easy to use
The characteristics of.
The foregoing is merely illustrative of the preferred embodiments of the present invention, is not intended to limit the invention, all essences in the present invention
With within principle, any modification, equivalent replacement, improvement and so on should all be included in the protection scope of the present invention god.
Sequence table
<110>TanJin Agricultural College
<120>A kind of fluorescence quantification PCR primer and kit of detection japanese encephalitis virus
<160> 1
<170> SIPOSequenceListing 1.0
<210> 2
<211> 154
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
gggaaaggga gaagtccata gcaatcagga gaaaatcaag aagagaatcc agaagcttaa 60
agaagaattc gccacaacgt ggcacaaaga ccctgagcat ccataccgca cttggacata 120
ccacggaagc tatgaagtga aggctactgg ctca 154
Claims (10)
1. a kind of fluorescence quantification PCR primer of detection japanese encephalitis virus, it is characterised in that：Draw including sense primer 1 and downstream
Object 1, nucleotide sequence is as follows：
Sense primer 1：gggaaagggagaagtccatagcaat；
Downstream primer 1：tgagccagtagccttcacttcatag.
2. a kind of PCR kit for fluorescence quantitative of the detection japanese encephalitis virus including primer described in claim 1.
3. the PCR kit for fluorescence quantitative of detection japanese encephalitis virus according to claim 2, it is characterised in that：It is described
Kit further include RNA extraction agents, reverse transcriptase, Taq archaeal dna polymerases, standard positive DNA masterplates, reverse transcription reaction liquid,
Fluorescent quantitation reaction solution.
4. the PCR kit for fluorescence quantitative of detection japanese encephalitis virus according to claim 3, it is characterised in that：It is described
Standard positive DNA masterplates are the cloned plasmids pGEM-NS5 of the gene order containing japanese encephalitis virus NS5, the encephalitis B
The nucleotide sequence of the gene order of virus N S5 such as SEQ ID NO:Shown in 1.
5. the PCR kit for fluorescence quantitative of detection japanese encephalitis virus according to claim 4, it is characterised in that：It is described
The preparation method of cloned plasmids pGEM-NS5 includes the following steps：
S1. japanese encephalitis virus is cultivated, extraction viral RNA carries out reverse transcription reaction and prepares virus cDNA, reacts mould as PCR
Version；
S2. PCR reactions are carried out using sense primer 2 and downstream primer 2, expands NS5 genetic fragments, sense primer 2 and downstream are drawn
The nucleotide sequence of object 2 is as follows：
Sense primer 2：gggaaagggagaagtccatagcaat；
Downstream primer 2：cagcagtattcgtgaaagtgttaag；
S3. it utilizes agarose gel electrophoresis purifying to recycle above-mentioned PCR reaction products, is connected respectively to cloning vector plasmids
On pGEM-T, construction recombination plasmid；
S4. by recombinant plasmid transformed competence colibacillus cell, positive colony culture is chosen, extracts plasmid, correct cloned plasmids life is sequenced
Entitled pGEM-NS5.
6. the PCR kit for fluorescence quantitative of detection japanese encephalitis virus according to claim 5, it is characterised in that：It is described
The concentration of cloned plasmids pGEM-NS5 in kit is respectively 107Copy number/μ L, 106Copy number/μ L, 105Copy number/μ L,
104Copy number/μ L or 103Copy number/μ L.
7. the PCR kit for fluorescence quantitative of detection japanese encephalitis virus according to claim 3, it is characterised in that：It is described
RNA extraction agents are TRIzol；The reverse transcriptase is SuperScript III Reverse Transcriptase.
8. the PCR kit for fluorescence quantitative of detection japanese encephalitis virus according to claim 3, it is characterised in that：It is described
Reverse transcription reaction liquid includes 1 μ L oligo (dT)20, 4 μ L, 5 × the first chain buffer solutions, 1 μ L 10mMdNTP mixed liquors, 1 μ L
0.1M DTT。
9. the PCR kit for fluorescence quantitative of detection japanese encephalitis virus according to claim 3, it is characterised in that：It is described
Fluorescent quantitation reaction solution includes 1 μ L sense primers 1,1 μ L downstream primers 1,25 μ L Platinum SYBR Green qPCR
SuperMix-UDG with ROX。
10. the application method of the PCR kit for fluorescence quantitative of the detection japanese encephalitis virus described in claim 3-9, feature
It is：The application method includes the following steps：
S1. the extraction of viral RNA：It will be cultivated after BHK-21 cell inoculation viruses, take cells and supernatant, be added to RNA extracting examinations
In agent, chloroform is then added, shakes rear centrifuging and taking upper solution, isopropanol is added, centrifuges after being placed at room temperature for, is washed with 75% ethyl alcohol
RNA precipitate dries after centrifugation, is dissolved in the deionized water of DEPC processing and obtains RNA solution；
S2. reverse transcription reaction：Reverse transcription reaction liquid, RNA solution, reverse transcriptase mixing are subjected to reverse transcription reaction and obtain reverse transcription
Product；
S3. quantitative fluorescent PCR reacts：By fluorescence quantitative PCR reaction solution, reverse transcription product, standard positive DNA masterplates, Taq DNA
Polymerase mixing carries out PCR reactions；
S4. it reads positive criteria and detects the copy number of sample.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810496132.6A CN108411042A (en) | 2018-05-22 | 2018-05-22 | A kind of fluorescence quantification PCR primer and kit of detection japanese encephalitis virus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810496132.6A CN108411042A (en) | 2018-05-22 | 2018-05-22 | A kind of fluorescence quantification PCR primer and kit of detection japanese encephalitis virus |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108411042A true CN108411042A (en) | 2018-08-17 |
Family
ID=63140307
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810496132.6A Pending CN108411042A (en) | 2018-05-22 | 2018-05-22 | A kind of fluorescence quantification PCR primer and kit of detection japanese encephalitis virus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108411042A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111826366A (en) * | 2020-06-05 | 2020-10-27 | 华南理工大学 | Direct-amplification type hot-start DNA polymerase and preparation method and application thereof |
| CN112195272A (en) * | 2020-09-08 | 2021-01-08 | 华南农业大学 | Kit for detecting porcine Japanese encephalitis virus by combining centrifugal microfluidic chip with loop-mediated isothermal amplification technology |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040126387A1 (en) * | 1999-12-01 | 2004-07-01 | Callahan Johnny Dale | Serotype and dengue group specific flurogenic probe based PCR (TaqMan) assays against the respective C and NS5 genomic and 3' non-coding regions of dengue virus |
| KR100942388B1 (en) * | 2009-05-11 | 2010-02-17 | 대한민국 | A primer set, internal control rna and rt-pcr kit using said primer set and internal control rna and pcr method using said rt-pcr kit thereby |
| CN101724714A (en) * | 2009-12-30 | 2010-06-09 | 中国农业科学院哈尔滨兽医研究所 | Loop mediated isothermal amplification kit for detecting encephalitis B virus |
| CN102102132A (en) * | 2010-10-13 | 2011-06-22 | 郑州后羿制药有限公司 | SYBR GreenI real-time quantitative polymerase chain reaction (PCR) detection method for S gene of transmissible gastroenteritis virus of swine |
| CN103103294A (en) * | 2013-02-19 | 2013-05-15 | 广东出入境检验检疫局检验检疫技术中心 | Primers for detection of porcine Japanese encephalitis virus and visual kit |
| CN103695561A (en) * | 2013-11-29 | 2014-04-02 | 华南农业大学 | RT-LAMP (Reverse Transcription Loop-mediated Isothermal Amplification) nucleic acid test strip kit for detecting Japanese B encephalitis virus and application of kit |
-
2018
- 2018-05-22 CN CN201810496132.6A patent/CN108411042A/en active Pending
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040126387A1 (en) * | 1999-12-01 | 2004-07-01 | Callahan Johnny Dale | Serotype and dengue group specific flurogenic probe based PCR (TaqMan) assays against the respective C and NS5 genomic and 3' non-coding regions of dengue virus |
| KR100942388B1 (en) * | 2009-05-11 | 2010-02-17 | 대한민국 | A primer set, internal control rna and rt-pcr kit using said primer set and internal control rna and pcr method using said rt-pcr kit thereby |
| CN101724714A (en) * | 2009-12-30 | 2010-06-09 | 中国农业科学院哈尔滨兽医研究所 | Loop mediated isothermal amplification kit for detecting encephalitis B virus |
| CN102102132A (en) * | 2010-10-13 | 2011-06-22 | 郑州后羿制药有限公司 | SYBR GreenI real-time quantitative polymerase chain reaction (PCR) detection method for S gene of transmissible gastroenteritis virus of swine |
| CN103103294A (en) * | 2013-02-19 | 2013-05-15 | 广东出入境检验检疫局检验检疫技术中心 | Primers for detection of porcine Japanese encephalitis virus and visual kit |
| CN103695561A (en) * | 2013-11-29 | 2014-04-02 | 华南农业大学 | RT-LAMP (Reverse Transcription Loop-mediated Isothermal Amplification) nucleic acid test strip kit for detecting Japanese B encephalitis virus and application of kit |
Non-Patent Citations (2)
| Title |
|---|
| S R SANTHOSH 等: "Development and evaluation of SYBR Green I-based one-step real-time RT-PCR assay for detection and quantitation of Japanese encephalitis virus", 《J VIROL METHODS》 * |
| 刘卫滨 等: "乙型脑炎病毒TaqMan PCR检测方法的建立及初步应用", 《中华微生物学和免疫学杂志》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111826366A (en) * | 2020-06-05 | 2020-10-27 | 华南理工大学 | Direct-amplification type hot-start DNA polymerase and preparation method and application thereof |
| CN111826366B (en) * | 2020-06-05 | 2022-08-02 | 广州英赞生物科技有限公司 | Direct-amplification type hot-start DNA polymerase and preparation method and application thereof |
| CN112195272A (en) * | 2020-09-08 | 2021-01-08 | 华南农业大学 | Kit for detecting porcine Japanese encephalitis virus by combining centrifugal microfluidic chip with loop-mediated isothermal amplification technology |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP4012050B1 (en) | Composition, kit and method for detecting and typing viruses causing respiratory tract infection and application of composition, kit and method | |
| Collins et al. | Detection of highly pathogenic and low pathogenic avian influenza subtype H5 (Eurasian lineage) using NASBA | |
| Collins et al. | Rapid and sensitive detection of avian influenza virus subtype H7 using NASBA | |
| CN101818207B (en) | Detection method and detection kit of influenza A virus, H1N1 and H3N2 subtype influenza virus | |
| CN107365849B (en) | Kit for canine granulosa and echinococcus multilocularis based on POCKIT Micro fluorescent PCR platform and application | |
| CN103757139B (en) | Canine distemper virus and canine parvovirus duplex TaqMan-MGB fluorescent quantitative PCR (polymerase chain reaction) detection kit and detection method thereof | |
| Borm et al. | A universal avian endogenous real-time reverse transcriptase–polymerase chain reaction control and its application to avian influenza diagnosis and quantification | |
| EP1761645A1 (en) | Diagnostic primers and method for detecting avian influenza virus subtype h5 and h5n1 | |
| CN107529559B (en) | Multiple fluorescence PCR detection kit for hand-foot-and-mouth disease virus and application | |
| Collins et al. | A method to detect major serotypes of foot-and-mouth disease virus | |
| Tercero et al. | A strand-specific real-time quantitative RT-PCR assay for distinguishing the genomic and antigenomic RNAs of Rift Valley fever phlebovirus | |
| CN109517927A (en) | A kind of A type, influenza B virus rapid typing detection reagent box and its application | |
| CN110938709A (en) | Visual nucleic acid detection kit and method for enteroviruses based on recombinase polymerase amplification technology | |
| Guionie et al. | Laboratory evaluation of a quantitative real-time reverse transcription PCR assay for the detection and identification of the four subgroups of avian metapneumovirus | |
| Sidoti et al. | Development of real time RT-PCR assays for detection of type A influenza virus and for subtyping of avian H5 and H7 hemagglutinin subtypes | |
| CN108411042A (en) | A kind of fluorescence quantification PCR primer and kit of detection japanese encephalitis virus | |
| Tong et al. | Rapid detection of Decapod iridescent virus 1 (DIV1) by recombinase polymerase amplification | |
| CN113186226B (en) | RNA virus nucleic acid detection reference standard and application thereof | |
| CN102071263B (en) | Nested fluorescence reverse transcription-polymerase chain reaction (RT-PCR) detection reagent for avian influenza virus (AIV) H5 subtype and detection kit | |
| CN101487064B (en) | Method and special reagent kit for detecting five zoonosis virus | |
| CN101724712B (en) | Animal insect-borne disease multi-RT-PCR distinguishing and detecting reagent as well as preparation method and application | |
| CN105316431B (en) | Differentiate the quick detection primer groups of GeXP, kit and its application of three kinds of H5 subtype avian influenza virus combination of infection people simultaneously | |
| Liu et al. | Development of reverse transcription loop-mediated isothermal amplification for rapid detection of Batai virus in cattle and mosquitoes | |
| CN111004867B (en) | Influenza A virus detection primer, probe and kit thereof | |
| CN111363849A (en) | Novel coronavirus nucleic acid detection kit and detection method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180817 |
|
| RJ01 | Rejection of invention patent application after publication |