RU2192011C1 - Kit "mikrovirus" for detection of hiv dna integrated in chromosomes of infected cells - Google Patents

Abstract

FIELD: medicine, molecular biology. SUBSTANCE: invention proposes kit "MICROVIRUS" for detection of human immunodeficiency virus (HIV) DNA integrated in chromosomes of infected cells that involves oligonucleotides probes for detection of HIV-1 and HIV-2; washing out solution for hybridization; buffer-detector; streptavidine; alkaline phosphatase; NBT-BCIP-reagent; proteinase K; reaction buffer; saline mixture for washing out solution. Method ensures both to determine the presence of HIV viruses and to differentiate HIV-1 or HIV-2. EFFECT: improved method of detection. 2 cl

Description

 The invention relates to medicine and, in particular, relates to the detection of infectious and oncogonous viruses integrated into the chromosomes of infected cells. Such detection is made in biopsy histological preparations.

 Among viruses that are infectious to humans and animals, there are a large number of those that, during the infectious cycle, include their genetic material (i.e., DNA molecule) in the chromosome of an infected cell, after which the genetic information of the virus is transmitted to the offspring of the infected cell. According to this scheme, the infection cycle of the human immunodeficiency virus (causes AIDS), papilloma viruses (causes infectious papilloma, candidiasis and a number of malignant tumors) and human polyomas is built, integration is often observed with various types of herpes viruses, including the so-called Epstein-Barr virus or herpes-4 (causes infectious mononucleosis and a number of malignant tumors), etc. These groups of viruses are highly important because the diseases they cause are widespread and pose a significant danger, and their diagnosis and clinical prognosis are currently imperfect; the test kit proposed by the author is able to significantly solve this problem by specific determination of viruses in infected cells.

 The primary method for determining viral DNA currently in use is the polymerase chain reaction (PCR) method. Its fundamental drawback is the inability to determine in which cells or tissues of the patient the virus is present (i.e., only the fact of the presence of the virus in the patient’s blood or biopsy material can be determined).

 The present invention is to create a kit that allows not only to detect the integrated virus, but also to determine the type of this virus in infected cells.

To solve this problem, a set is proposed that includes:
specific oligonucleotide probes corresponding to a particular type of virus
HIV-1:
1) aaattgggcctgaaaatccatacaatactc
2) oligonucleotide probes characterized by the following parameters:
length - 25-50 nucleotides,
localization - homology with a part of the prt-pol HIV genome,
G-C composition - 30-70% of HC steam.

HIV-2:
oligonucleotide probes characterized by the following parameters:
length - 25-50 nucleotides,
localization - homology with a part of the prt-pol HIV genome,
G-C composition - 30-70% of HC steam.

 Hybridization flushing solution, 1 bottle, 10 ml.

 Reagent detector, 1 bottle, 10 ml.

 Streptavidin, 2 ml, 1 bottle.

 Alkaline phosphatase, 1 ml, 1 vial.

 NBT-BCIP - reagent, 200 μl, 1 dark Eppendorf tube.

 Proteinase K, 5 mg, lyophilized, 1 vial.

 The reaction buffer, 1 bottle of 10 ml.

 A mixture of salts for washing solution - 1 l, packaging in polyethylene.

 Control preparations (3 pcs.).

 This test kit is designed to detect infectious and oncogenic viruses integrated into the chromosomes of infected cells; such detection is made in biopsy histological preparations. Detection method: specific hybridization of elements of the viral genome with oligonucleotide probes modified with biotin, followed by addition of streptavidin and alkaline phosphatase complex to probes. As a result of this, in the presence of the virus, a colored alkaline phosphatase product is formed, which is recorded using a light microscope.

 The MICROVIRUS test kit has universal components for determining various types of viruses and specific oligonucleotide probes for each specific virus. Thus, the MICROVIRUS kit exists in different versions for different viruses; for example, MIKROVIRUS is an HIV universal for the determination of both types of human immunodeficiency viruses, MIKROVIRUS HIV-1 and MIKROVIRUS HIV-2 for HIV-1 and HIV-2 viruses, respectively.

In the pathoanatomical study of patients who died as a result of various infectious diseases, there is a need to answer the question of whether these patients were infected with HIV and whether the infection, which was the direct cause of death, was only secondary, that is, did it develop against the background primary HIV infection. Conventional methods are not suitable for such a study, since all of them are based on the analysis of the spectra of antibodies, viral proteins or viral DNA (RNA) in blood serum. The proposed method is based on the microscopic detection of integrated DNA in the cell nuclei directly in the tissues, namely in the brain and lymph nodes. The presence of the virus in these tissues is well known, this fact is published:
Torres-Munoz J., Stockton P., Tacoronte N., Roberts B., Maronpot RR, Petito CK Detection of HIV-1 gene sequences in hippocampal neurons isolated from postmortem AIDS brains by laser capture microdissection. J. Neuropathol Exp Neurol. 2001 Sep; 60 (9): 885-92.

 Li Y, Kappes J.C., Conway J.A., Price R.W., Shaw G.M., Hahn B.H .. Molecular characterization of human immunodeficiency virus type 1 cloned directly from uncultured human brain tissue: identification of replication-competent and -defective viral genomes. J. Virol. 1991 Aug; 65 (8): 3973-85.

The principle of operation of the proposed kit is based on the following:
- denaturation of DNA in cell nuclei (on microscopic sections) and subsequent renaturation with a specific oligonucleotide probe - such renaturation occurs only if there is viral DNA in the cell;
- accession to a specific oligonucleotide probe modified with biotin, a complex of streptavidin and alkaline phosphatase;
- obtaining a colored alkaline phosphatase product and its registration using a light microscope.

The principle of specific denaturation-renaturation is a fundamental principle of the physical chemistry of nucleic acids. It is generally described in all nucleic acid manuals, for example, MOLECULAR BIOLOGY. The structure and biosynthesis of nucleic acids, ed. A. S. Spirin, 1990. In the application to the immunodeficiency virus, the use of this method is not described, the closest is its description in relation to the human papilloma virus (HPV):
Boshart M. et al. A new type of papillomavims DNA, its presence in genital cancer biopsies ... EMBO J. 1984, 3, 1151-1157.

 Lorincz A.T. et al. A new type of papillomavirus associated with cancer. .. Virology 1987, 159, 187-190.

The principle of using a biotin modification with subsequent attachment of the enzyme and obtaining a colored product is also generally accepted; as applied to the immunodeficiency virus, the use of this method is also not described, its closest description is also in relation to human papillomavirus (HPV):
Brigati DJ et al. Detection of viral genomes in cultured cells and paraffin-embedded tissue ... Virology 1983, 126, 32-50.

Differences of the MICROVIRUS kit:
- streptavidin and alkaline phosphatase are included in the MICROVIRUS kit separately, this makes it possible to change their ratio to optimize the definition of the virus;
- the use of short oligonucleotide probes (length - 30 nucleotides) makes it possible to use one washing solution for hybridization, which speeds up the determination;
- the MICROVIRUS kit allows not to carry out additional staining of cells, which creates the optimal ratio of signal to background and protects against masking a specific signal with an additional cell dye;
- the chemical synthesis and modification of specific probes used for the MICROVIRUS kit compares favorably with enzymatic ones, since they allow one to achieve a higher regularity of probe modification, i.e. higher specificity and reproducibility of the results; modification is carried out according to standard methods using the commercial preparation "Biotin-xx-NHS" manufactured by Sigma;
- The MICROVIRUS kit is intended for diagnostic purposes.

 In addition, the MICROVIRUS kits for HIV include new oligonucleotide probes having an original nucleotide sequence.

 Specific example 1.

 USE OF THE KIT.

Prepare paraffin sections of histological material with a thickness of 4-6 microns. It is necessary to use highly adhesive glass, pre-treated with a solution of polylysine or silane. The slices are dried in an upright position for 18 hours at a temperature of 60-80 ^o C. If necessary, store the finished slices at 4 ^o C. Before dewaxing, the slices are kept at a temperature of 60-80 ^o C for 5-15 minutes and dewaxing is carried out by processing:
- Xylene 10 min *
- Xylene 2 min *
- 100% alcohol 1 min
- 100% alcohol 1 min
- 96% alcohol 1 min
- 70% alcohol 1 min
- 50% alcohol 1 min
- Distilled water 1 min
* Attention: xylene must be changed after every 10 glasses.

Then the glasses are dried for 5-10 minutes at a temperature of 37 ^° C, 100 μl of a proteinase K solution in working dilution are applied to each slice, and incubated at 37 ^° C for 15 minutes in a moist chamber.

To prepare a proteinase K solution concentrate, 5 mg of lyophilized proteinase K is dissolved in 2 ml of a washing solution. The resulting solution is a 10x concentrate, it should be divided into aliquots of 100-300 μl and stored frozen at -20 ^o C. The shelf life of the frozen solution is 1 year, repeated freezing is not allowed. To prepare a proteinase K solution in working dilution, it is necessary to defrost a 10x concentrate and dilute it 10 times with a washing solution. At room temperature, the working solution is stable for 1 hour, storage of the working solution is not allowed.

Then, at room temperature, the proteinase K solution is drained from the sections, washed with distilled water and dehydrated according to the following scheme:
- H ₂ O distilled - 1 min
- 50% alcohol - 1 min
- 70% alcohol - 1 min
- 96% alcohol - 1 min
Slices are dried at a temperature of 37 ^o C for 5-10 minutes If necessary, prepared sections can be stored at 4 ^o C for up to 1 week.

For hybridization and detection, 50 μl of the probe DNA solution is applied to the slice and carefully covered with coverslip without bubbles. Glasses are incubated at a temperature of 95 ± 3 ^o With 10 minutes Then the sections (without removing the coverslips) are placed in a moist chamber for incubation at 37 ^{° C.} for 90-120 minutes. After incubation, coverslips are carefully removed from the sections, 100 μl of the washing solution for hybridization are applied to the sections, and incubated for 2 minutes. The solution is drained from the glasses, the washing solution for hybridization is again applied to the slice and incubated in a humid chamber at 37 ^° C for 10 minutes.

Next, the sections are washed 3 times with a washing solution for 1 min at room temperature, the reagent detector is applied to the sections, 100 μl each and incubated in a humid chamber at 37 ^° C for 30 minutes. To prepare the reagent detector, a streptavidin solution, 1: 5 by volume and an alkaline phosphatase solution, 1:10 by volume, are added to the buffer detector, carefully mixed and kept at 37 ^° C for 30 minutes. After this, the finished reagent detector can be applied to the slices.

The sections are washed 3 times with a washing solution for 1 minute, a solution of NBT-BCIP reagent 100 μl per section is applied and incubated in a humid chamber in the dark at 37 ^° C for 30 minutes.

 To prepare the NBT-BCIP reagent, prepare a 2% solution of NBT-BCIP in the reaction buffer (protect the prepared solution from direct sunlight).

Next, the sections are washed 3 times with a washing solution for 1 minute. and distilled water for 1 min. Then the sections are dehydrated:
96% alcohol 1 min
100% alcohol 1 min
100% alcohol anhydrous 1 min
xylene 1 min
Sections are enclosed in Canadian balsam (or other medium) under a coverslip. The drug is ready for examination under a light microscope.

 Concrete example 2.

 COMPOSITION OF THE SET.

 a) Oligonucleotide samples for HIV detection, universal and type-specific, 1 ml solutions, Eppendorf tubes, 2-5 pcs.

Solution: formamide 50%
SSC 0.5x, pH 7.0;
b) Flushing solution for hybridization, 1 bottle, 10 ml.

c) Reagent detector, 1 bottle, 10 ml. Sigma, A4955
g) Streptavidin, 1 mg / ml, solution in the detector buffer, 2 ml, 1 bottle.

 e) Alkaline phosphatase, 1 mg / ml, solution in the detector buffer, 1 ml, 1 vial.

 f) NBT-BCIP reagent, 200 μl, Sigma B 1911, 1 dark Eppendorf tube.

 g) Proteinase K, 5 mg, lyophilized, 1 vial.

 h) Reaction buffer, 1 bottle of 10 ml.

 i) A mixture of salts for the washing solution - 1 l, packaging in polyethylene.

 j) Control preparations (3 pcs.) p

Claims (2)

1. A kit for indicating HIV DNA integrated into the chromosomes of infected cells, characterized in that it contains oligonucleotide probes corresponding to an HIV-1 virus, including aaattgggcctgaaaatccatacaatactc probe and oligonucleotide probes with the following parameters: length - 25-50 nucleotides, localization - homology with sections of the HIV-1 prt-pol genome, G-C composition - 30-70% G-C pairs; HIV-2, including oligonucleotide probes with the following parameters: length - 25-50 nucleotides, localization - homology with sections of the HIV-2 prt-pol genome, G-C composition - 30-70% G-C pairs; flushing solution for hybridization, 10 ml of formamide 50% SSC 0.5x, pH 7.0; reagent detector, Sigma, A-4955, 10 ml; streptavidin, 2 ml; alkaline phosphatase, 1 ml; NBT-BCIP reagent, Sigma, B1911, 200 μl; Proteinase K lyophilized, 5 mg; reaction buffer, 10 ml: Tris-Hcl 50 mm, pH 9.5, NaCl, 100 mm, MgCl ₂ , 1 mm, NaN ₃ , 0.1%, levamisole, 0.1 mm; a mixture of salts for a washing solution of 1 l: Tris-HC1 50 mm, pH 8.0, NaCl, 150 mm.  2. The kit according to claim 1, characterized in that it is intended for the determination of HIV-1 and HIV-2 viruses.