WO1989002934A1

WO1989002934A1 - Human papillomavirus type diagnosis with nucleotide probes

Info

Publication number: WO1989002934A1
Application number: PCT/US1988/003367
Authority: WO
Inventors: Dennis E. Schwartz; Trevor H. Adams
Original assignee: Microprobe Corporation
Priority date: 1987-10-02
Filing date: 1988-09-30
Publication date: 1989-04-06
Also published as: EP0338067A1; EP0338067A4; JPH02501442A; AU2785589A

Abstract

A rapid in situ hybridization assay for detecting the presence of Human Papillomavirus (HPV) in a non-frozen cellular smear fixed on a slide or other support in the absence of aldehyde-based cross-linking reagents. The assay can be conducted in less than four hours and utilizes readibly detectable nucleic acid probes, typically labelled by nick-translation with biotin, for binding to an avidin or streptavidin labelled enzyme, or with an isotope for visual detection.

Description

HUMAN PAPILLOMAVIRUS TYPE DIAGNOSIS WITH NUCLEOTIDE PROBES

FIELD OF THE INVENTION The present invention relates generally to the diagnosis of viral infections and, more specifically, to the detection of Human Papillomavirus using nucleic acid in situ hybridization assays. BACKGROUND OF THE INVENTION Prior to the 1940's, the leading cause of cancer death in women was cervical carcinoma. In 1943, Papariicolaou demonstrated that the cytology of stained exfoliated cells could be used for the detection of the early and late forms of cervical carcinoma. Since 1954, the "Pap smear" has been used as a cancer screen¬ ing method and has been largely responsible for de- creasing the mortality rate in women by cervical cancer in the Western World, such that it now ranks behind carcinoma of the breast, bowel, gastrointestinal tract, and ovary.

Cervical cancer is the result of a spectrum of morphological changes. The pre-invasive forms are mild dysplasia, severe dysplasia, and carcinoma in situ (these forms are also termed cervical intraepithelial neoplasia [CIN] and graded in their order of increasing severity as CIN I, CIN II and CIN III) . The subsequent invasive forms are micro-invasive carcinoma and inva¬ sive carcinoma.

The Pap smear detects both pre-invasive and invasive forms of cervical cancer in a test which is inexpensive, easy to use, and for which cells are read- ily obtained. This test rarely gives false-positive results, but unfortunately gives high false-negative results; approximately 10-20% of abnormal Pap smears are incorrectly reported as normal (Benedet, John L. , and Murphy, Katherine J. , "Cervical Cancer Screening," Postgraduate Medicine, 78:69-79 (1985)).

Since the late 1970*ε, evidence has been mounting that the primary etiological agent of cervical cancer is Human Papillo avirus (HPV) (Durst, M. , Giss- ann, L. , Ikemberg, H. , and zur Hausen, H.A. , "Papil¬ lomavirus DNA from a Cervical Carcinoma and Its Preva¬ lence in Cancer Biopsy Samples from Different Geograph¬ ic Regions," Proc. Nat. Acad. Sci., 80:38812-38815

(1983), Boshart, M. , Gissmann, L. , Ikenberg, H. , Klein- heinz, A., Scheurl n, W. , and zur Hausen, H.A. , "New Type of Papillomavirus DNA: Its Presence in Genital Cancer Biopsies and in Cell Lines Derived from Cervical Cancer," EMBO J. , 3:1151-1157 (1984), and Kreider,

J.Wo, Howett, M.K. , Wolfe, S.A. , Bartlett, G.L., Zaino, R.J., Sedlacek, T.V., and Mortel, R. , "Morphological Transformation In Vivo of Human Uterine Cervix with Papillomavirus from Condylo ata Acuminata," Nature, 317:639-641 (1985)). More than 46 types of HPV have now been characterized, but at present only Types 6, 11, 16, 18, 31, 33, and 35 have been detected in the cervix. Of these. Types 6 and 11 are found in over 60% of cervical warts (Kreider, J.W. , et al. , supra, and Gissmann, L. , Wolnik, L. , Ikenbert, H. Koldovsky, U. , Schnurch, H.G. , and zur Hausen, H. , "Human Papilloma¬ virus Types 6 and 11 DNA Sequences in Genital and Laryngeal Papillomas and in Some Cervical Cancers," Proc. Natl. Acad. Sci., 80:560-563 (1983)), whereas Types 16 and 18 are found in over 90% of tissues char¬ acterized as being pre-invasive or invasive forms of cervical cancer (Durst, M., et al. , supra, Boshart, M. , et al., supra, McCance, D. . , and Clarkson, P.K. , "Prevalence of Human Papillomavirus Type 16 DNA Se- quences in Cervical Intraepithelial Neoplasia and Inva¬ sive Carcinoma of the Cervix," British Journal of Ob¬ stetrics and Gynecology, 92:1101-1105 (1985), and Pater, M.M. , Dunne, J., Hogan, G. , Ghatage, Prafull, and Pater, A. , "Human Papillomavirus Types 16 and 18 Sequences in Early Cervical Neoplasia," Virology, 155:13-18 (1986)). HPV Types 31, 33, and 35 (and other related/unclassified HPV types) are found in the remaining 10% of cervical cancers (Lorincz, A.T. , Lan¬ caster, W.D., Kurman, R.J., Jenson, A.B., and Temple, G.F., "Characterization of Human Papillomaviruses in Cervical Neoplasias and Their Detection in Routine Clinical Screening," "Viral Etiology of Cervical Can¬ cer," Cold Spring Harbor Laboratory Publications, Cold Spring Harbor, Branbury Report, 21:225-237 (1986) and Cole, S.T., and Streeck, R.E., "Genome Organization and Nucleotide Sequence of Human Papillomavirus Type 33, Which is Associated with Cervical Cancer," J. Virology, 58.3:991-995 (1986)). One current hypothesis is that HPV-6 and HPV-11 are associated with benign growths (wart lesions) within the cervix (or vulva or vagina) , whereas HPV Types 16, 18, 31, 33, and 35, and the re- lated or as yet unclassified HPV types are implicated as etiological agents of cervical cancer.

Cervical cancer may be a sexually transmitted disease. The disease is absent in sexually inactive women, but does occur with high frequency among sexual- ly active women, particularly those who are sexually active at an early age and who have or have had multi¬ ple sex partners. Consistent with these observations, HPV-induced warts are observed, although rarely, on the penile shaft or urethra of males, and HPV is found in sperm (Ostrow, R.S., Zachow, K.R. , Niimura, M. , Okaga- ki, T., Muller, S., Bender, M. , and Faras, A.J. , "De¬ tection of Papillomavirus DNA in Human Semen," Science, 231:731-733 (1986)).

Techniques for the detection of HPV in human cells use either antibodies or DNA probes. Antibodies have been difficult to develop since there is no cul¬ ture system for propagating HPV, and thus no readily available method for preparing the viral proteins. HPV proteins recently have been prepared in E^ coli expres¬ sion systems, thus allowing the generation of HPV-spe- cific polyclonal or monoclonal antibodies (Matlashew- ski, G. , Banks, L. , Wu-Liao, J. , Spence, P., Pirn, D. , and Crawford, L. , "The Expression of Human Papilloma¬ virus Type 18 E6 Protein in Bacteria and the Production of Anti-E6 Antibodies," J. Gen. Virol., 67:1909-1916 (1986) ) . However, it is recognized that antibodies may never be adequate for the diagnosis of HPV infections since detectable HPV antigens are typically not found in the later stages of HPV infection (Nakajima, T., et al. , "The Frequency of Papillomavirus Infection in Cer¬ vical Precancerous Lesions in Japan: An Immunoperoxi- dase Study," Jpn. J. Cancer Res., 77:891-895 (1986)). In contrast, it has been alleged that HPV can be de¬ tected by DNA probes at all stages of infection; thus, this is becoming a preferred diagnostic method (Schneider, A., Kraus, H. , Schumann, R. , and Gissmann, L. , "Papillomavirus Infection of the Lower Genital

Tract: Detection of Viral DNA in Gynecological Swabs," Int. J. Cancer, 35:443-448 (1985) and Burk, R.D., Kadish, A.S., Calderin, S., and Romney, S.L., "Human Papillomavirus Infection of the Cervix Detected by Cer- vicovaginal Lavage and Molecular Hybridization: Corre¬ lation with Biopsy Results and Papanicolaou Smear," Am. J- Obstet. Gynecol., 154:982-989 (1986)).

Recent DNA probe-based studies have indicated a wide and disturbing variance in HPV infection within the U.S. population. An investigation conducted in the Seattle, Washington, U.S.A., area indicates an HPV in¬ cidence of 6% and 13%, within suburban upper class wom¬ en and urban lower class women, respectively. At present, no such studies have been reported on the prevalence of HPV infections within male populations.

The strong association of cervical cancer with specific HPV viral types indicates a need for a nucleic acid probe-based diagnostic test that distin¬ guishes between the benign and oncogenic forms of this virus. First, a DNA probe test could be used as a sec¬ ondary test, after a positive Pap smear, to identify the type of HPV within a clinical sample. Second, such a test could be used in conjunction with the Pap smear as a screening tool for the routine concurrent detec¬ tion of abnormal and HPV infected cervical cells. Fi¬ nally, the DNA probe test could ultimately displace the Pap smear test, if HPV is proven unequivocally to be the etiological agent of cervical cancer and a rapid, reliable and economical HPV assay capable of utilizing a cervical smear format were commercially available.

Some proponents in the medical community con- tend that a test for the presence and type of HPV with¬ in cervical cells could have a dramatic impact on the early detection of cervical cancer and on the choice of therapeutic treatments for these cancers. In addition, a rapid diagnostic HPV test would allow the detection and typing of HPV infections within the male popula¬ tion. For both men and women, a specific and sensitive test for HPV could significantly curb the spread of this viral infection through appropriate counseling and/or through the use of emerging therapeutic agents.

SUMMARY OF THE INVENTION The present invention provides a rapid in situ hybridization assay for detecting the presence of or typing of Human Papillomavirus (HPV) in a biological sample, such as a non-frozen cellular smear that has been fixed on a support in the absence of aldehyde- based cross-linking reagents, the assay including the steps of: combining the nucleic acids from the fixed biological sample with at least one detectable probe, preferably nick-translated with a detectable nucleotide of about 50 or more nucleotides, or analogs thereof, wherein the probe is capable of specifically hybridiz¬ ing with a substantially complementary region from one or more HPV types; and detecting the presence or absence of probe hybridization complexes.

Importantly, the entire assay can be complet¬ ed in less than about 4 hours, preferably about 2 hours, and most preferably less than about 2 hours. The assay is particularly useful for the detection of one, two or more different HPV types, including 6, 11, 16, 18, 31, 33, and 35.

The biological sample, for example a cervical smear, is typically first fixed, such as by treatment in an alcohol bath, onto a support, such as a glass slide. Preferably, the assay utilizing a cervical smear sample fixed on a glass slide will comprise the steps of: (i) inactivating competing endogenous enzyme activity; (ii) denaturing nucleic acids in the sample; (iii) hybridizing a detectable probe to the target nucleic acids, wherein the probe comprises a sequence of 200 to 600 or more nucleotides complementary to one HPV type DNA or mRNA; (iv) washing the sample to remove unbound probes; (v) incubating the sample with the detection agents; and (vi) visually inspecting the sample, such as with the aid of a microscope.

The assay of the present invention may be provided in kit form. For example, a typical kit will include a first probe reagent component comprising a biotin-labelled probe of at least 50 nucleotides com- plementary to a nucleic acid sequence of HPV types 6 or 11 and/or a second probe of at least about 50 nucleo¬ tides complementary to nucleic acids sequence of HPV types 16, 18, 31, 33, or 35; a denaturation reagent for converting double stranded DNA to single stranded DNA; and a hybridization reaction mixture. The kit can also include an avidin-labelled or streptavidin-labelled enzyme and a substrate for the enzyme. Other features and advantages of the inven¬ tion will become apparent from the following detailed description, which describes the present invention by way of example.

BRIEF DESCRIPTION OF THE FIGURE Figure 1 shows partial nucleotide sequence comparisons between a Human Papillomavirus (HPV) Type associated with benign cervical warts (HPV-6) and two HPV Types believed to be the etiologic agents of cervi¬ cal carcinoma (HPV-16 and HPV-33) . About 700 nucleo¬ tides of sequence at the 5' end of each HPV genome are shown as follows: Figure la shows HPV-6 compared with HPV-11; Figure lb shows HPV-6 compared with HPV-16; Figure lc shows HPV-6 compared with HPV-33; and Figure Id shows HPV-16 compared with HPV-33.

DETAILED DESCRIPTION In accordance with the present invention, nucleic acid probes of at least about 50 nucleotides are used in rapid, reliable and economical in situ hy¬ bridization assays for detecting the existence and type of HPV present in biological samples, such as cervical or other cellular smears. The assays can be stream- lined such that the entire test can be conducted under preselected hybridization conditions with a non- isotopic format in less than about four hours, and as little as about two hours or less, with few steps. In addition, all steps may be performed at room tempera- ture, thus alleviating the need for temperature-con¬ trolled incubators.

The in situ hybridization tests of the pres¬ ent invention, when using, e.g. , unstained smears of cervical cells, are often more sensitive than the Southern blot "gold standard," particularly when con¬ ducted on slides, which allows for the detection of a ^•few positive cells in a milieu of negative cells. Furthermore, these assays can be conducted in large batches in short time periods, rather than the several days typically required in hybridization formats using the Southern blot or dot blot methods. In a preferred embodiment, the biological sample to be tested includes cell smears obtained by standard techniques, such as scraping (e.g., a cervical smear) or biopsy samples converted to smears (such as with the Cyto-Trac system. Medical Packaging Corpora- tion. Panorama City, CA) . Sources of cells include cervical, vaginal, vulval, oral, prostate, lung, rectal or any body tissue suspected of containing HPV.

Typically, cellular smear samples are col¬ lected and fixed to a support, such as a glass surface (e.g., a glass slide), plastics (e.g., polycarbonate), or other transparent inert substrates. Fixing agents may be precipitants, such as picric and mecuric acid, ethanol, ethanol/acetic acid, methanol and methanol- acetone mixtures. Most preferred precipitating fixa- tion solutions include ethanol and Carnoy's B solution. Standard aldehyde-based fixation is generally unnecessary.

Pretreatment of the cells to increase probe diffusion may be helpful, and can include acid treat- ment or protease treatment. When utilizing an enzyme as the detecting agent, this pretreatment may also serve to inactivate endogenous enzyme activity.

Various in situ hybridization protocols for detecting viral infections are known in the art, and can be utilized in accordance with the teachings of the present invention to assay for HPV in the cellular smears. The following two review articles provide an overview of in situ hybridization technology: Singer, R.H. , et al., Biotechniques, 4(3):230-250 (1986), and Haase, A., et al., Methods in Virology, Vol. VII, pp. 189-226 (1984) , and are both incorporated by reference herein. Target polynucleotides can be obtained from a wide variety of sources, depending upon the particular HPV type to be detected. By way of example, such probes can be any HPV specific nucleic acid sequences integrated or otherwise present in a biological sample, including mutations of the wild-type virus populations, regardless of whether they are phenotypically expres¬ sed.

Probes are DNA or RNA polynucleotides or oligonucleotides, or their analogs, which have suffi¬ cient complementarity with the target polynucleotides so that stable binding occurs between target and probe. Homoduplexing is preferred, i.e., a perfect base match, but such is often not achieved when using cocktails of long probes and/or when detecting multiple HPO types. The degree of homology required for detectable binding varies with the stringency of the hybridization medium- and/or wash medium.

The lengths of the probes which are useful for the given invention are at least 15 bases, but may be 50 to 100 bases long, preferably 200 to 600 bases or more. Essentially whole HPV virus genomes of about 8,000 nucleotides, with or without plasmid vector se¬ quences, are commonly utilized for nick-translation in the presence of labelled nucleotides to yield an aver¬ age probe length of about 400 bases.

DNA probes may be cloned in bacterial host cells following insertion into appropriate replication vectors, such as pBr322 or M13, or vectors containing R A polymerase specific promoters, such as the SP6 promoter, and purified from the host cell by cell lysis, DNA extraction. Further purification, if desired, may be achieved by digestion with selected restriction enzymes, and further separation by gel or column fractionation techniques.

The probes used in the present invention may also be synthesized, chemically or enzymatically, using commercially available methods and equipment. For example, the solid phase phosphoramidite methods are particularly useful for producing smaller probes. (See, Caruthers, et al., Cold Spring Harbour Symp. Quant. Biol., 47:411-418, 1982, and Adams, et al., J. Am. Chem. Soc, 105:661, 1983, both of which are incorporated herein by reference) . DNA probes can also be synthesized, for example, by reverse transcription of mRNA or produced by nick-translation of cloned HPV genes.

Nucleotide analogs within HPV specific se¬ quences that can be inserted during chemical or enzymatic synthesis include: l-(2-deoxy-a-D-ribo- furanosyl)-2-pyrimidinone, 2'-deoxyinosine, 2'-deoxy-7-deazaguanosine, 2'-deoxy-5-substituted uri- dine, or the appropriately blocked phosphoramidites thereof. These can be substituted for naturally occur¬ ring nucleotides, e.g., during labelling or synthesis of the probe, yet maintain acceptable hybridization specificity of the probe. Other analogs having similar functionality can, of course, be produced in accordance with well known teachings in the art.

When synthesizing a probe for a specific tar¬ get, the choice of sequence will determine the speci- ficity of the test. For example, by comparing DNA se¬ quences from several virus isolates, one can select a sequence for virus detection that is either type speci¬ fic or genus specific. Comparisons of DNA regions and sequences can be achieved using commercially available computer programs. Generally, the more unique the sequence selected to be probed, the less background noise will be generated.

Probes may be labeled by any one of several methods typically used to detect the presence of hybrid polynucleotides. A common method of detection is the use of autoradiography with ³H, ¹²⁵I, ³⁴s, ¹⁴C, or ³²P labeled probes or the like. Other labels include directly conjugated fluorophores, chemiluminescent agents, enzymes, and enzyme substrates. Alternatively, the same components may be indirectly bonded through a ligand-antiligand complex, such as antibodies reactive with a liquid conjugated with label. The choice of label depends on sensitivity required, ease of conjugation with the probe, stability requirements, and available instrumentation.

The choice of label dictates the manner in which the label is incorporated into the probe. Radio¬ active probes are typically made using commercially available nucleotides containing the desired radioac¬ tive isotope. The radioactive nucleotides can be in¬ corporated into probes, for example, by using DNA synthesizers, by nick-translation, by tailing of radioactive bases to the 3' end of probes with terminal transferase, by copying M13 plasmids having specific inserts with the Klenow fragment of DNA polymerase in the presence of radioactive dNTP's, or by transcribing RNA from templates using RNA polymerase in the presence of radioactive rNTP's.

Non-radioactive probes can be labeled direct¬ ly with a signal (e.g., fluorophore, chemiluminescent agents or enzyme) or labelled indirectly by conjugation with a ligand. This ligand then binds to a receptor molecule which is either inherently detectable or covalently bound to a detectable signal, such as an enzyme or photoreactive compound. Ligands and antiligands may be varied widely. Where a ligand has a natural "antiligand", namely ligands such as biotin (which is recognized by avidin or streptavidin) , thyroxine, and cortisol, it can be used in conjunction with labeled, naturally occurring receptors. Alternatively, any haptenic or antigenic compound can be used in combination with a suitably labelled antibody. A preferred labelling method utilizes biotin labelled analogs of polynucleotides, as disclosed in Langer, P. and Waldrop, A. (Proc. Nat. Acad. Sci. U.S.A. 78: 6633-6637 1981) , which is incorporated herein by reference. Another preferred labelling method utilizes a direct conjugation of enzyme (e.g., horseradish peroxidase or alkaline phosphatase) to the DNA in DNA probe (either double-stranded or single- stranded) . See, Reng, M. and Kurz, C. "A Colorimetric Method for DNA Hybrization," Nucl. Acids Res. , 12:3435-3444 (1984), which is incorporated herein by reference.

Enzymes of interest as labels will primarily be hydrolases, particularly phosphatases, esterases, ureases and glycosidases, or oxidoreductases, particu¬ larly peroxidases. Fluorescent compounds include fluorescein and its derivatives, rhodamine and its derivatives, dansyl, umbelliferone, etc. Chemilumines- cers include luciferin, and 2,3-dihydrophthalazinedion- es, e.g., luminol.

The amount of labeled probe present in the hybridization solution may vary widely, depending upon the nature of the label, the amount of the labeled probe that can reasonably bind to the cellular target nucleic acid, and the precise stringency of the hybrid¬ ization medium and/or wash medium. Generally, substan- tial probe excesses over the stoichiometric amount of the target will be employed to enhance the rate of binding of the probe to the target nucleic acids.

Prior to adding the hybridization solution and the labelled probe to the cells, potentially competing endogenous enzyme activity (i.e., those with overlapping activity to the signal detection system of the probe) may be inactivated. Typically, this is accomplished by mixtures of ethanol and acetic acid, but any of a variety of well known inhibiting agents m y be utilized.

Hybridization solutions and procedures are generally described by Gall and Pardue (1969) , Proc. Natl. Acad. Sci., U.S.A., 63:378-383; John, Burnsteil and Jones (1969) Nature, 223:582-587; and "Nucleic Acid Hybridization: A Practical Approach", Eds. Hames, B. and Higgins, S. IRL Press (1985) Washington, D.C., all of which are incorporated herein by reference. As im¬ provements are made in hybridization techniques, they can readily be applied.

Various hybridization solutions may be em¬ ployed provided they provide rapid hybridization in accordance with the present invention, i.e., typically less than two to three hours, preferably less than one hour, and most preferably, 20 to 30 minutes. These solutions can comprise from about 20 to 60% volume, preferably about 30%, of a polar organic solvent. A common stringent hybridization solution employs about 50% formamide, about 0.5 to IM sodium chloride, about 0.05 to 0.1M buffers, such as sodium.citrate, Tris, HEPES or PIPES, about 0.05 to 0.2% nonionic or ionic detergent, such as Tween 20 or sodium dodecylsulfate, or minor amounts of EDTA, Ficoll (about 300-500 kilodaltons) , polyvinylpyrrolidone (about 250-500 kdal) , and serum albumin. Also included in the typical hybridization solution will be unlabelled carrier nucleic acids from about 0.1 to 5 mg/ml, fragmented DNA, e.g., calf thymus or salmon sperm DNA, and/or yeast tRNA or partially fragmented rRNA, and optionally from about 0.5 to 2% wt./vol. glycine. Other additives may also be included, such as volume exclusion agents, which include a variety of water-soluble or swellable agents, such as anionic polymers of polyacrylate or polymethacrylate, charged saccharide polymers, such as dextran sulfate (preferably, about 10%) , and tetra- alkylammonium salts or triethlamine salts. (See Melchor, W. B. and Von Hippel, P. H. , "Alteration of the Relative Stability of dA.dT and dG.dC Base Pairs in DNA," Proc. Nat. Acad. Sci. USA, 70: 298-302 (1973) and Orosz and Wetmar, Biopolymers, 16:1183-1199 (1977), which are both incorporated herein by reference.)

Stringent hybridization conditions are pre¬ ferred either during the hybridization or wash step. The precise degree of stringency typically is controlled by ionic strength, partially denaturizing solvents and temperature. The stringency of hy¬ bridization or washing is conveniently varied by changing the polarity of the reactant solution through manipulation of the concentration of a partially denaturizing solvent, such as formamide, within the range of about 20% to 50%, typically the higher percentages. Stringency can also be conveniently varied by changing salt concentration, up to 0.5 M or higher, preferably 10 mM to 150 mM. Strigency can also be varied by changing temperatures, which will normally be in the range of about 20* to 75^βC, but the present invention preferably utilizes temperatures from about 20^β to 37^βC. By experimentation, following the teachings of the present invention, one can define conditions which permit hybridization at room temperature within a particular assay format.

After the cells fixed to the support have been contacted with a hybridization solution, the cello are then typically introduced into a wash solution having predetermined concentrations of salts, buffers, and detergents. The time period for the wash may vary from five minutes to an hour or more. Typically, it is the wash solution that most often determines the stringency and facilitates dissociation of mismatched duplexes. After washing the hybridization complex at room temperature with dilute buffered sodium chloride solution, the complex may be assayed for the presence of duplexes (e.g. , bound probe) in accordance with the nature of the label. This detecting step will typically be completed in from one to three hours, but may be completed in 15 to 30 minutes depending on the detection system.

Where the label is radioactive, the support is dried and exposed to X-ray film. In the alterna- tive, a nuclear track emulsion is.coated upon the sup¬ port in the dark, allowed to develop, washed, stained, and viewed under a microscope (Haase, et al., Methods of Virology, Vol. VII, pp. 209-210).

Enzymatic detection is typically performed in conjunction with biotin, such as biotinylated peroxi¬ dase or alkaline phosphotase. Enzyme-conjugated avidin or streptavidin are then used to bind the enzyme to the probe. After the appropriate enzyme substrate has been added, the cells may be observed visually for the pres- ence of HPV.

Another embodiment of the present invention comprises kits comprising compartments (e.g., vials) containing the means components for performing the as¬ says of the present invention. . In a preferred embodi- ment, the kit includes a first probe reagent comprising a probe of at least about 200 to 600 nucleotides com¬ plementary to a nucleic acid sequence of at least one HPV type (e.g., 6 or 11) and/or a second probe of at least about 200 to 600 nucleotides complementary to a nucleic acid sequence of one or more different HPV types (e.g., 16, 18, 31, 33 an 35); and a denaturation step (preferably heat or a chemical denaturation re¬ agent) for converting double stranded DNA in cells to single stranded DNA. The kit can also include an avi- din or streptavidin labelled enzyme and a substrate for the enzyme, as well known in the art. All of the kit compositions are commonly provided in liquid form or may be lyophilized for subsequent reconstitution with water at the assay site. The following examples are offered by way of illustration and not by limitation. EXPERIMENTAL Reagents

DNA probes were synthesized on an Applied Biosystems DNA Synthesizer (Model 38OB, Foster City, CA) with reagents from the same source. DNA probe pu¬ rification was accomplished by: 1) fractionation of the tritylated product with a high pressure liquid chromatography system using a reverse phase column, or 2) fractionation by gel electrophoresis on a 20% poly- acrylamide gel containing 7M urea. Computer analysis of HPV nucleotide sequences was done with the Micro- Genie Program (Beckman Instruments, Palo Alto, CA) .

Molecular clones containing HPV Types 3a, 6b, 6VC, 8, 8c, 10, 11a, 12, 13, 14a, 15, 16, 17a, 18, 19, 20, 21, 22, 23, 24, and 25, were obtained from labo¬ ratories in Japan, Europe and the U.S. The CaSki and A-549 cell lines were obtained from the American Type Culture Collection.

SSC buffer is 0.015M sodium citrate (pH 7.0), 0.15M NaCl; PBS is 0.01M sodium phosphate (pH 7.4), 0.13M NaCl; and Denhardt's solution is 0.02% ficoll 400, 0.02% polyvmylpyrolidone (MW 360,000), 0.02% BSA. Carnoy's B solution is 10% HOAc, 30% chloroform, 60% EtOH. HRP substrate solution is 0.4 mg/ml aminoethyl carbazole, 0.025% hydrogen peroxide, 0.1M NaOAc (pH 4.5) .

I. CLONING OF HPV GENOMES a. Source of DNA. Cells from patients were collected by cervical lavage, washed, lysed, and the nucleic acid isolated (Burk, R.D., Kadish, A.S., Calderin, S. and Ro ney, S.L. , Am. J. Obstet. Gynecol. 154:982-989. 1986) . HPV genomes were detected and typed by Southern blot by digesting aliquots of the DNA preparations with PstI, a restriction enzyme which cleaves the genomes of the different virus types into characteristic fragment sizes. The digested DNA's were electrophoresed through agarose gels and then transferred onto nitrocellulose filters (Southern, E., J. Mol. Biol. 98:503 (1973). Filters were then probed with a mix of nick-translated HPV genome Types 6, 11, 16, and 18, washed at low stringency (Lorincz, A.T. , Lancaster, W.D., and Temple, G.F., J. Virol. 58:225-229) and developed by autoradi¬ ography. DNA was selected for cloning based on HPV type, copy number, and episomal state. b. HPV sequences.

The following references describe sequences of HPV Types 6, 11, 16, 18, 33: Schwarz, E. , et al., "DNA sequence and genome organization of genital human papillomarvirus Type 6b", EMBO J. 2:2361-2368 (1983). Seedorf, K. , et al., "Human papillomavirus type 16 DNA sequence", Virology 145:181-185, (1985); Dartmann, K. , et al. , "The nucleotide sequence and genome organiza¬ tion of human papillomavirus Type 11," Virology 151:124-130, (1986); Cole, S.T., and R.E. Streek, "Genome organization and nucleotide sequence of human papillomavirus Type 33, which is associated with cervi¬ cal cancer," J. Virol. 58:991-995, (1986); and Cole, S.T. and O. Danos, "Nucleotide sequence and comparative analysis of the human papillomavirus Type 18 genome," j. Mol. Biol. 1983:599-608 (1987); all of which are incorporated herein by reference. c. Cloning of HPV genome Types 6, 11, 16 and 18. Approximately 10 μg of DNA containing Types 6, 11, or 16 were cut with BamHl; DNA containing Type is was cut with EcoRl. DNA's were then extracted with phenol:chloroform (1:1), chloroform, and then ethanol precipitated. Approximately 2-5 μg of each DNA were analyzed by Southern blot for hybridization to the ap¬ propriate gamma-32P-ATP labelled 24-mer oligonucleo- tides (see Table I below) . Oligonucleotides contained approximately 50% G and C residues. Hybridizations were carried out at 43°C, 15 h, in oligo hybridization solution (0.5 to 1.0 ng/ml oligo, 0.6M NaCl, 90 mM Tris HC1, pH8, 10 mM EDTA, 0.5% 5 x Denhardts, 30% forma- ide, 0.1 mg/ml hydrolyzed yeast RNA). Filters were washed 15 min, room temperature, in lx oligo wash solu- tion (0.09M NaCl. 0.009 M Tris, pH8, 0.6 mM EDTA, 0.1% SDS) , 15 min at 50*C in lx wash solution, and then 2 min, room temperature, in lx wash solution. Probe hybridization was detected by autoradiography. In almost all cases, the HPV genomes detected were full length and complementary to the appropriate oligonucletides.

The remaining half of each sample, approxi¬ mately 2-5 μg, was ligated to 1 μg, lambda DASH/R1 for Type 18 or DASH/BAM for Types 6, 11, and 16 (Strata- gene, San Diego, CA) « The reactions were packaged (Stratagene's Gigapack-Plus) and titered on E^ coli

P2392, a host which selects for recombinant phage. Approximately 3 x 10 5 plaque forming units were screen¬ ed by filter hybridization (Maniatis, T., Fritsch, E.F., and Sambrook, J. , Molecular cloning: a laboratory manual. 1982 by Cold Spring Harbor Laboratory) . Hy¬ bridization and washing conditions were as established above for Southern blots. Positive clones were detect-

₃ ed at a frequency of about one m 10

TABLE 1

Probe Sequence HPV Type

GGTTGAACCGTTTTCGGTCCCTCC 3 6/11 GAGTTACAGGACTAAAGGGTGTTC 3 6/11 CTGTCACATCCACAGGAACAGGTC 3 6/11 CAGAATAGCCATATCCACTGTCCG 3 6/11 GTGGTATCTACCACAGTAACAAAC 3 6/11 CTTCAGGACACAGTGGCTTTTGAC 3 16 GAAGCGTAGAGTCACACTTGCAAC 3 16 CAACGCATGTGCTGTCTCTGTTTC 3 16 CACTTCCACTACTGTACTGACTGC 3 16 GTCTCCATCAAACTGCACTTCCAC 3 16 CTGTGCAACAACTTAGTGGTGTGG 3 16 CAGACACACAAAAGCACACAAAGC 3 16 CAGTACGCCTAGAGGTTAATGCTG 3 16 CTAGAATTAGAGAATTAAGAGATT 3 18 GCGGTGCCAGAAACCGTTGAATCC 3 18 TCGTCGGGCTGGTAAATGTTGATG 3 18 GAATGCTCGAAGTCGTCTGCTGAG 3 18 AATGTCTTAATTCTCTAATTCTAG 3 18 GGATTCAACGGTTTCTGGCACCGC 3 18 CCTGTCGTGCTCGGTTGCAGGACG 3 18

TTTTGGGGCTCTAAATGCAATAC 3 18

d. Cloning of Types 31, 33, and 35.

Approximately 10 μg of DNA containing Type 31 or 35 were cut with EcoRl: DNA containing Type 33 was cut with Bglll. DNAs were extracted with phenol:chlo- reform (1:1), chloroform, and then ethanol precipitat¬ ed. Approximately half of each sample was analyzed by Southern blot for hybridization to nick-translated HPV16 DNA. Hybridizations were carried out at low stringency (30% formamide, 0.6M NaCl, 90 mM Tris, pH8, 10 mM EDTA, 0.5% SDS, 5 x Denhardts, 0.1 mg/ml yeast RNA, at 43^βC) . Filters were then washed 15 min, room temperature, 1 x wash solution (0.2 x SSC, 0.1% SDS where 1 x SSC is 0.15M NaCl, 0.015M sodium citrate), then 15 min, 50^βC, 1 x wash solution, followed by 10 min. 65^βC, 1 x NT wash solution. Probe hybridization was detected by autoradiography. Filters were then rewashed at higher stringency (0.03 x SSC, 0.1% SDS, 65^βC, 15 min) and analyzed by autoradiography. In all cases, HPV genomes were full length and related but not identical to Type 16.

The remaining half of each sample was then ligated to the appropriate lambda DASH vector, and was packaged and titered as described above. Approximately 3 x 10 5 plaque forming units were screened by filter hybridization. Hybridization and washing conditions were as established above for the Southern blots. e. Analysis and subcloning of HPV clones.

Bacteriophage DNA was isolated from positive clones and analyzed by Southern blot following restric- tion with PstI, BamHl, or EcoRl. In almost all cases, the clones also contained additional inserts which con¬ sisted of human genomic DNA. The DNA's were then cut with restriction enzymes which excised the HPV genomes away from the lambda and human DNA. EcoRl was used for Types 18, 31, and 35; BamHl was used for Types 6, 11, and 16; Bglll was used for Type 33. The restricted DNA's were electrophoresed on agarose gels and the HPV DNA isolated by eluting onto NA-45 paper (Schleicher and Schuell, Keene, NH) , according to standard proto¬ col.

The genomes were ligated to Bluescript Ml3 DNA (Stratagene) which had been EcoRl or BamHl digested and treated with calf intestinal phosphatase (Boeringer Mannheim, Indianapolis, IN) . Bluescript vectors have large polylinkers with 26 unique restriction sites. The polylinkers are flanked by T7 and T3 polymerase promoters present at the NH₂-terminal portion of a LacZ gene fragment. The vectors also contain a 454 nucleo¬ tide intergenic region (M13 related) . The ligation reactions were transformed into E__;_ coli BB-4 (Strata¬ gene) and recombinant colonies identified by restric- ^• tion analysis of their DNA (Maniatis et al., above).

With the exception of HPV6, all clones matched publish¬ ed restriction maps. The HPV6 clone did not have the expected 5.3 kb PstI fragment, but instead had 3.6 and 1.7 kb fragments. Recombinant plasmids contained full length HPV genomes and were free of human chromosomal DNA.

II. IN SITU HYBRIDIZATION WITH LONG DNA PROBES ON CULTURED CELLS a. Preparation and Fixing of

Cells on Glass Slides.

Mammalian cells (about 10,000) were spotted on glass slides in 100 ul of the appropriate culture media and grown at 37'C for 18-24 hrs. This method allowed the generation of a large number of slides, each containing about 50,000 cells that had tenaciously adhered to the glass surface.

Prior to in situ hybridization, the slides were dipped twice in PBS solution and then fixed in Carnoy's B (10% HOAc, 30% chloroform, 60% EtOH) solu¬ tion for 3 min. The slides were blotted lightly to remove excess solution, air dried for 10 min. , and stored at -20^βC until use. This treatment produced fixed cells with good morphology, high stability and with high accessibility of short and long probes to cellular DNAs during in situ hybridization. b. In Situ Hybridization with Long Cloned DNA

Probes.

Labeling of long probes (i.e., greater than 50 bases) with 32p was accomplished by nick-translation (Rigby, P., Rhodes, D. , Dieckmann, M. , and Berg, P., "Labeling Deoxyribonucleic Acid to High Specific Activ¬ ity In Vitro by Nick Translation with DNA Polymerase I," J. Mol. Biol., 113:237-251 (1977)), and labeling with biotin was accomplished by nick-translation using biotinylated dUTP (Langer, P.R. , Waldrop, A.A. , and Ward, D.C., "Enzymatic Synthesis of Biotin-labeled

Polynucleotides: Novel Nucleic Acid Affinity Probes," Proc. Nat. Acad. Sci., 78:6633-6637 (1981)). Thirty microliters of long probe hybridization solution (20mM PIPES at pH 7.4, 500mM NaCl, 0.05% NaPPi, 50% forma- mide, 1 x Denhardt's solution, 10% dextran sulfate, 200 mg/ml calf thymus DNA, 200 mg/nl yeast RNA and 10 ng of 32P- or biotin-labeled long probe) was layered over the cells fixed on glass slides. A siliconized coverslip was placed over the solution, and the samples were in- cubated in a humidified chamber for 1 hr. at 37'C.

Following removal of the coverslip by soaking in 2 x SSC, the sample was stringently washed twice (5 min./wash) in 2 x SSC at room temperature.

Detection of 32P-labeled probe was acco - plished with autoradiography and of biotin-labeled probe by either of the two following methods:

Method #1: A conjugate of horse radish peroxidase (HRP) with streptavidin (75 ul) was added to the sample and incubated for 30 min. at room"tempera- ture. The sample was washed in 2 x SSC for 5 min. , then in 2 x SSC, 0.1% triton X-100 for 5 min. The sam¬ ple was very lightly blotted, and 75 ul HRP substrate solution was added and incubated for 30 min. at room temperature. The sample then was washed with PBS for one minute and mounted for viewing under a microscope. Method #2: (About twofold more sensitive than Method #1, but requires more steps) . The sample is treated with 75 ul of blocking solution (10% normal rabbit serum, 4% BSA, 2 x SSC) for 10 min. at 37°C and washed twice in 2 x SSC at room temperature. Bio- tinylated goat anti-avidin IgG (75 ul at mg/ml in 0.1% BSA) is added, incubated for 30 min. at 37'C, and re¬ moved by three washes (3 min./wash) in 2 x SSC at room temperature. Finally, 75 ul of an avidin-biotinylated HRP complex (ABC complex. Vector labs) was added and incubated for 15 min. at 37*C. Following three washes (3 min./wash) in 2 x SSC at room temperature, 75 ul of substrate solution was added, incubated for 30 min. in the dark at room temperature, and removed by rinsing in PBS for 1 min. The sample was lightly blotted and mounted for viewing.

III. RESULTS a. Computer Analysis of Known HPV Nucleotide Sequences The known genomic nucleotide sequences of HPV Types la (Danos, 0., Katinka, M. , and Yaniv, M. , "Human Papillomavirus la Complete DNA Sequence: A Novel Type of Genome Organization Among Papovaviridae," EMBO Jour¬ nal, 1.2:231-236 (1982)), 6b (Schwarz, E. et al., "DNA Sequence and Genome Organization of Genital Human Papillomavirus Type 6b," EMBO Journal, 2.12:2341-2348 (1983)), 8 (Fuchs, P.G., et al., "Epidermodysplasia Verruciformis - Associated Human Papillomavirus 8: Genomic Sequence and Comparative Analysis," J. Virol¬ ogy, 58.2:626-634 (1986)), 11 (Dartmann, K. , et al., "The Nucleotide Sequence and Genome Organization of Human Papillomavirus Type 11," Virology, 151:124-130 (1986)), 16 (Seedorf, K. , et al., "Human Papillomavirus Type 16 DNA Sequence," Virology, 145:181-185 (1985)), 33 (Cole, S.T., and Streeck, R.E., supra) , and the known regions of Type 18 (Matlashewski, G. , et al. , supra, and Schneider-Gadicke, A.S., and Schwarz, E. , "Different Human Cervical Carcinoma Cell Lines Show

Similar Transcription Patterns of Human Papillomavirus Type 18 Early Genes," EMBO Journal, 5.9:2285-2292 (1986) and Cole, S. T. and Denos, 0., "Nucleotide Sequence and Comparative Analysis of the HPV Type 18 Genome," J. Mol. Biol., 193:599-608 (1987)) have been cross-compared using the MicroGenie Program (Beckman Instruments) = In part, this was to determine the extent of nucleotide sequence divergence among the various HPV types and to determine how this divergence would affect the strategy of preparing highly specific synthetic DNA probes. It was found that each type of HPV had undergone surprising divergence in nucleotide sequence as shown in Figure 1, a-d, where HPV Types 6 and 11, 6 and 16, 6 and 33, and 16 and 33 are compared. (Only about 700 nucleotides from the 5' end of each virus is shown.) It is clear that there is considerable sequence conservation between Types 6 and 11₌ In contrast, there is much less sequence conserva¬ tion between HPV Types 6 and 16, 6 and 33, and 16 and 33. Overall throughout their entire genomes. Types 6 and 11, 6 and 16, 6 and 33, and 16 and 33 are 82%, 59%, 58%, and 66% homologous, respectively. b. Demonstration of In Situ Hybridization

A model system for demonstration and optimi- zation of in situ hybridization is the CaSki cell line which is derived from a cervical tumor and contains multiple copies of HPV-16 (Yee, et al., "Presence and Expression of Human Papillomavirus Sequences in Human Cervical Carcinoma Cell Lines," Am. J. Pathology, 119:361-365 (1985) and Pater, M.M. , and Pater, A., "Hu¬ man Papillomavirus Types 16 and 18 Sequences in Carcinoma Cell Lines of the Cervix," Virology, 145:313-318 (1985)). CaSki cells are easily cultured and therefore ideal for the production of a large num¬ ber of "standardized" glass slides containing immobil¬ ized cells. Such standardized samples are extremely useful for optimization of in situ hybridizations. It was found that a large number of standardized glass ^" slides could be prepared conveniently by growing cells directly on glass slides overnight. During this growth, the cells adhered tightly to the slides and subsequently could be processed using a variety of pro¬ cedures without cell loss.

After overnight growth, slides with immobil¬ ized CaSki cells were fixed in Carnoy's B solution for 5 min., rinsed in EtOH, air dried and stored at -20^βC until use. A variety of procedures were tested, in¬ cluding fixing with paraformaldehyde or glutaraldehyde. Carnoy's B fixative was found to be superior for 1) maintaining morphology of the cell, and 2) giving a more clearly defined colored precipitate when detecting HPV DNA using a horseradish peroxidase (HRP) detection system.

Effective mi situ hybridization assays were demonstrated using radioactively labeled DNA probes. Non-isotopic hybridizations were also conducted with biotinylated long probes using modifications of previ¬ ously described methods (McDougall, J.K. , Myerson, D. , and Beckmann, A.M. , "Detection of Viral DNA and RNA by In Situ Hybridization," J. Histochem. Cytochem. (1986) and Brigati, D.J. , et al., "Detection of Viral Genomes in Cultured Cells and Parafin-embedded Tissue Sections Using Biotin-labeled Hybridization Probes," J. Virol., 126:32-50 (1983)). A positive signal (brown precipi¬ tate) was observed in the nuclei of the CaSki cells due to the presence of a HRP-avidin complex which binds to the biotinylated hybridized DNA probe. This enzyme converts aminoethylcarbazole to a colored product. Control experiments using biotinylated HPV-6, HPV-11, and HPV-18 DNA as probe produced no color development, thus indicating that in situ hybridization was highly specific. Likewise, a negative control in situ hybrid¬ ization of biotinylated HPV-16 DNA with A-549 cells, which contains no HPV-16, produced no color development within the cells.

Results with long biotinylated probes indi¬ cated that the CaSki cell nuclei had a distinctive sig¬ nal pattern in the nuclei. Generally, there were 7-8 large brown granules per nucleus. Presumably, that each granule represents an HPV integration point within a unique chromosome, since CaSki cells are reported to contain about 700 copies of HPV-16 integrated in tandem arrays at 6-7 sites in the chromosomes. Thus, each integration site (i.e., each precipitate) roughly con¬ tains about 100 copies of HPV DNA.

Assuming 100 copies of HPV per granule, a probe dilution experiment was developed to test the sensitivity of our in situ hybridizations. Several dilutions of biotinylated HPV-16 DNA with non-biotinyl- ated HPV-16 DNA were used in several in situ hybridiza¬ tions with CaSki cells, and the point at which signal disappeared was determined. A sixfold dilution of the biotinylated HPV-16 DNA defined the limits of sensitiv- ity, and this translated into a detection limit of 15- 20 tandem copies of HPV-16 per cell (100/6=17) .

In situ hybridizations with biotinylated HPV DNA probes can be conducted directly on stained and unstained cervical smear samples, using, e.g., bio- tinylated human placental DNA as probe. Total human

DNA was chosen as probe, since this will hybridize rap¬ idly with the highly repetitive DNA sequences of human cells, thus allowing optimal in situ hybridization conditions to be quickly defined. A detectable non-isotopic signal can be picked up during in situ hybridization with cervical smears using 10 ng of biotinylated human placental DNA. Using this DNA probe, a preferred minimal treatment to achieve an in situ hybridization signal from cervical smear samples was derived in the follow¬ ing experiments. Four cervical smear samples were taken by a gynecologist and immersed in 95% ethanol by the stan¬ dard procedure:

- Sample 1 was processed directly.

Sample 2 was immersed in Carnoy's B solution and processed.

Sample 3 was fixed in paraformalde- hyde, washed and processed.

Sample 4 was fixed in paraformalde- hyde, treated with Triton X-100, fixed again in para- formaldehyde, washed and processed (this procedure pre¬ viously was developed for cervical smear iji situ hy¬ bridization) .

After annealing with biotinylated human placental DNA, these slides showed relative signals of 0.8, 1.0, 0.2, and 0.2 for Samples 1, 2, 3, and 4, re¬ spectively. These results suggest that pretreatments may be eliminated and cervical smears processed direct¬ ly following the standard immersion in ethanol by the gynecologist. Experiments were also conducted on in situ hybridizations at room temperature using biotinyl¬ ated HPV-16 long probes and the CaSki cell line. Es¬ sentially no difference between the non-isotopic signal obtained at room temperature versus that obtained when conducting the assay at conventional temperatures

(e.g., 37°C) was found. In addition, hybridization specificity is not lost at room temperature, since HPV-6 and HPV-18 probes produced no signal in the CaSki cell nuclei. These results indicate that rapid, speci- fie and sensitive in situ assays may be formatted com¬ pletely at room temperature. In other experiments, in situ hybridiza¬ tions were conducted on unstained cervical smears from the sexually transmitted disease clinic at Harborview Hospital in Seattle, Washington. Patients from this clinic show about 65% incidence of HPV infection. By in situ hybridization, analysis of unstained cervical smears from this population yielded the following results: 1) ten samples analyzed with a cocktail of HPV Types 6, 11, 16, and 18 produced five positive tests (60%) for HPV; 2) five samples analyzed with a cocktail of HPV Types 6 and 11 produced three positive tests for HPV; and 3) five samples analyzed with a cocktail of HPV Types 16 and 18 yielded one positive (20%) . In nearly all of the positive tests, there was a small percentage of positive cells mixed with a much larger population of negative cells.

From the foregoing, it will be appreciated that the present invention provides a hybridization probe-based HPV diagnostic test that can be used in conjunction with traditional cellular smear methodol¬ ogy, particularly for identifying the presence and/or type of HPV in an infected sample of a cervical smear. The assays of the present invention are rapid, reliable and economical, and can be readily formatted for clini- cal laboratories.

Although the invention has been described in some detail by way of illustration and example for pur¬ poses of clarity of understanding, it will be apparent that certain changes and modifications may be practiced within the scope of the appended claims.

Claims

1. A rapid in situ hybridization assay for detecting the presence of or typing Human Papilloma- virus (HPV) in a non-frozen cellular smear fixed on a support in the absence of aldehyde-based cross-linking reagents, said assay comprising the steps of: combining nucleic acids from the fixed bio¬ logical sample with at least one detectable probe of about 50 or more nucleotides or analogs thereof, where¬ in the probe is capable of specifically hybridizing with a substantially complementary region from one or more HPV types; and detecting the presence or absence of probe hybridization complexes, wherein the mixing and detect¬ ing steps are completed in less than about four hours.

2. An assay according to Claim 1, wherein the biological sample is fixed by treatment in an alco- hoi bath.

3. An assay according to Claim 1, wherein the support is a glass or plastic slide.

4. An assay according to Claim 1, wherein all of the steps are performed at between about 20"C and 37^βC.

5. An assay according to Claim 1, wherein the cellular smear is obtained from a cellular lavage, scraping or biopsy.

6. An assay according to Claim 1, wherein the probe comprises nick-translated fragments.

7. A method according to Claim 1, wherein the hybridizing is homoduplexing.

8. An assay according to Claim 1, wherein the combining step is conducted in the presence of a tetraalkylammonium or triethylamine salt.

9. A method according to Claim 1, wherein the combining step is conducted in the presence of a volume exclusion agent.

10. An assay according to Claim 1, wherein said combining step is performed in less than about one hour.

11. An assay according to Claim 1, wherein all of said steps are performed in less than about two hours.

12. An assay according to Claim 1, wherein the HPV type is related to 6, 11, 16, 18, 31, 33, or 35.

13. An assay according to Claim 1, wherein the composition comprises at least two detectable probes, each probe being capable of specific hybridiza¬ tion with a different HPV type.

14. A method for diagnosing Human Papilloma¬ virus (HPV) infections in a biological sample contain¬ ing cells suspected of harboring integrated HPV, said method comprising the steps of: treating the biological sample with a non- aldehyde based immobilizing agent, whereby DNA from the cells in the biological sample is fixed through the cells on a support under non-freezing conditions and made accessible to hybridization with nucleic acid probes; combining under stringent hybridizing condi¬ tions the fixed nucleic acids and probes of 50 or more nucleotides, or analogs thereof, substantially comple¬ mentary to an HPV type; washing to remove non-complexed probe; and determining the presence or absence of DNA/probe complexes; wherein the combining and determining steps are per¬ formed in between about 30 minutes and two hours and at least one of the steps is performed at room temperature under stringent hybridizing conditions.

15. A rapid in situ hybridization test for the detection and typing of Human Papillomavirus (HPV) in a cervical smear sample fixed on a glass slide in an ethanol solution, said method comprising the steps of: (i) inactivating competing endogenous enzyme activity;

(ii) denaturing nucleic acids in the sample; (iii) hybridizing a labelled probe to the target nucleic acids, wherein the probe comprises a sequence of at least about 50 nucleotides complementary to one HPV type DNA or mRNA;

(iv) washing the sample to remove unbound probe;

(v) incubating the sample with detection agents; and

(vi) visually inspecting the sample.

16. A kit for Human Papillomavirus (HPV) detection by i situ hybridization of alcohol-fixed cervical cell smears, said kit comprising a first probe reagent component comprising a biotinylated probe of at least about 50 to 600 nucleotides complementary to a nucleic acid sequence of HPV types 6 or 11 and/or a second biotinylated probe of about 50 to 600 nucleo- tides complementary to a nucleic acid sequence of HPV types 16, 18, 31, 33, or 35; and a denaturation reagent for converting double stranded DNA in the cells to sin¬ gle stranded DNA.

17. The kit of Claim 16, further comprising an enzyme labelled with avidin or streptavidin and an enzyme substrate.