CN111593146A - High-sensitivity single-molecule RNA virus detection method based on RNA fluorescent in-situ hybridization - Google Patents

Abstract

The invention relates to a high-sensitivity single-molecule RNA virus detection method based on RNA fluorescence in situ hybridization, which comprises the following steps: a) processing samples and making cytological and viral smears; b) binding viral RNA to a digoxigenin-or biotin-labeled probe; c) binding of the labeled probe by the antibody; d) developing with a fluorescent or peroxidase substrate; e) the smear is examined microscopically to identify viral RNA. The accuracy of the detection method of the present invention can reach more than 90%, for example, the novel coronavirus (SARS-CoV-2).

Description

High-sensitivity single-molecule RNA virus detection method based on RNA fluorescent in-situ hybridization

Technical Field

The present invention relates to a method for assaying RNA viruses for high-sensitivity intracellular and extracellular identification, which is suitable for clinical (including throat swabs, nasal swabs, tissues (biopsy or autopsy), body fluids, feces, alveolar/bronchial lavage fluids) and environmental sample (such as food, water sources and soil) detection, and various applications.

Background

The genetic material of RNA viruses is ribonucleic acid (RNA). Typically, the nucleic acid is single stranded (ssRNA) or double stranded (dsRNA). Single-stranded RNA viruses can be classified into positive-translation, negative-translation, and double-translation RNA viruses according to their translational significance, and positive-translation RNA viruses are similar to mRNA and can be directly translated into protein by ribosomes; negative-translation RNA viruses require the action of RNA polymerase, which synthesizes a positive-translation RNA complementary to itself using itself as a template, and then translates proteins using this RNA as mRNA.

RNA viruses have both self-replication and reverse transcriptionIn the replication mode, the activity of the enzyme of the error recovery mechanism is very low and almost none, so that the mutation is rapid during the replication of the viral RNA. Since vaccines are developed based on fixed genes or proteins of viruses, it is difficult to develop vaccines for RNA viruses. RNA viruses are more susceptible to disease, are more lethal to the host, are more mutable, and are more diverse than DNA viruses, are more difficult to develop effective vaccines, and are difficult to prevent. However, RNA viruses are generally less resistant than DNA viruses and are easier to cure^1-3. There are exceptions, however, such as the strong resistance of double-stranded RNA viruses and the very difficult cure of retroviruses. Common RNA viruses are: novel coronavirus (SARS-CoV-2), SARS virus (SARS-CoV-1), all influenza virus, rhinovirus, MERS virus, Ebola virus (Ebolavirus), AIDS virus (HIV), Hepatitis A Virus (HAV), Hepatitis C Virus (HCV), norovirus, Japanese encephalitis virus, poliovirus, Coxsackie virus, dengue virus, rotavirus, Marburg virus and the like. The superiority of the virus detection method will be described below by taking SARS-CoV-2 which is now causing global pandemics as an example.

SARS-CoV-2 is coronavirus of family Coronaviridae, belonging to a type of coronavirus related to severe acute respiratory syndrome^4-5. It has an enveloped positive-strand single-stranded RNA. The virus is irregular in shape and about 60-220nm in diameter. The virion is surrounded by a fat membrane, the surface of which has three glycoproteins: spike glycoprotein (S, Spike Protein, which is the receptor binding site, cytolytic and major antigenic site); small Envelope glycoprotein (E, Envelope Protein, smaller, Envelope-bound Protein); membrane glycoproteins (M, Membrane proteins, responsible for transmembrane transport of nutrients, budding release of nascent viruses and formation of viral envelope). In addition, hemagglutinin-esterase (HE protein) is also present. The nucleic acid of coronavirus is non-segmented single-stranded (+) RNA, has the length of 27-31kb, is the longest RNA nucleic acid chain in RNA virus, and has important structural characteristics specific to positive-strand RNA: namely, the 5 'end of the RNA chain is provided with a methylated cap, and the 3' end is provided with a PolyA tail structure. This structure is very similar to eukaryotic mRNA and is an important structural basis for the genomic RNA itself to function as a translation template, and the RNA-DNA-RNA transcription process is omitted. The rate of recombination between the RNA of coronaviruses and RNA is very high, and it is this high rate of recombination that causes the virus to mutate. After recombination, the RNA sequence is changed, and the amino acid sequence encoded by the nucleic acid is also changed, and the protein composed of amino acids is changed, so that the antigenicity is changed. The result of the change of antigenicity may be the failure of the original vaccine, the failure of immunity, and the failure of antigen-antibody detection of virus.

Early detection of SARS-CoV-2 is critical not only for rapid implementation of treatment, but also for patient isolation and effective public health monitoring, containment and response. CT is the main means for diagnosing COVID-19, but the diagnosis cannot be really confirmed only by CT images^6-7. Moreover, one disadvantage of large-scale application of CT is that there may be a risk of cross-infection (nosocomial infection), especially when applied to large-scale patient screening. Detection of the virus is the gold standard for diagnosis of COVID-19. The detection of viruses by molecular biology techniques has been successfully applied to clinical virus detection (see table one). Because each of the above methods has some limitations, there is still a need to develop new virus identification and quantification means to overcome the limitations of the current detection methods.

Table one shows the limitations of several current methods of virus detection,

（http://www.labome.cn/method/Methods-for-Rapid-Virus-Identification-and-Quantification.html）

method of producing a composite material	Principle of detection	Repeatability of	Time of day	Work load	Cost of
						Viral plaque assay	Infectivity detection	Difference (D)	Several days	Big (a)	Is low in
TCID50, LD50, EID50	Infectivity detection	Difference (D)	Several days	Big (a)	Is low in
						Immunofluorescent plaque assay	Infectivity detection	Difference (D)	Several days	Big (a)	Height of
qPCR	Viral nucleic acid detection	Is very high	Several hours	Medium and high grade	Height of
						Immunoblotting (immunoblotting)	Viral protein detection	Good taste	Several days	Medium and high grade	Is low in
Immunoprecipitation method (immunoprecipitation)	Viral protein detection	Good taste	Several days	Medium and high grade	Is low in
						ELISA	Viral protein detection	Good taste	Several hours	Medium and high grade	Is low in
Hemagglutination assay (hemagglutination assay)	Viral protein detection	Good taste	Several hours	Medium and high grade	Is low in
						Virus flow cytometry (viral flow cytometry)	Viral particle counting	Is very good	Several hours	Big (a)	Height of
Transmission electron microscopy	Viral particle counting	Is very good	Several weeks	Big (a)	Height of

Watch 1

Nucleic acid amplification techniques including PCR, nucleic acid sequence-based amplification, and the laurencephmor microbial detection array, are undoubtedly the leading technology for rapid detection and identification of most known human viruses. PCR allows amplification of a specific region of a DNA sequence in vitro 10⁶And is therefore an extremely sensitive detection means. PCR can also be used for the identification of viral RNA by reverse transcription of RNA into DNA followed by PCR analysis, a process known as reverse transcription PCR (RT-PCR). The more amplification products, the stronger the accumulated fluorescent signal. Nucleic acid detection is the detection of the accumulation of fluorescent signal to determine the presence or absence of viral nucleic acid in a sample⁸. RT-PCR adopted specific regions for detecting SARS-CoV-2 are mainly 3: open reading frame 1ab (ORF 1 ab), nucleocapsid protein (N), envelope protein (E) gene^9-10. ORF1ab is the most specific and confirmed target; n is an additional validation target; e is a first-line screening target.

At present, SARS-CoV-2 detection is mainly nucleic acid RT-PCR detection, and some detection reagents of companies are approved by the national drug administration. However, the approved SARS-CoV-2 nucleic acid detection method has some limitations. The first is the problem of false negatives. RT-PCR has a positive rate of only 30% -50%, so that the omission of false negative is a big problem (probably leaving the superpropagator!) and is far from the clinical diagnosis. Even some patients are positive in the third or fourth test, which greatly affects and delays subsequent treatment. False negatives can be caused for several reasons: (a) the virus amount of the sample is very small, and the subsequent separation and final result are influenced by the non-standard sampling process. Taking pharyngeal swab collection, which is the most common method, as an example, since pharyngeal portion has a low virus content and is easily degraded by ubiquitous RNA degrading enzymes, it may be extremely difficult to extract trace nucleic acids of these small viruses, and the detection limit of RT-PCR is 1000-. In fact, considering that the virus is mainly infected by droplets, the saliva/nasal cavity of the mouth contains many or even many viruses, which cannot be detected, probably because of the problem of RNA extraction, rather than the sampling is not standard or the viruses are few and cannot be detected, even though the viruses are "subtle"; (b) the high mutation rate of the virus can cause drastic change of the nucleic acid sequence of the virus, and can cause mismatching with the original PCR primer; (c) the quality of nucleic acid templates is one of the most important factors for PCR. The quality problems of the nucleic acid template such as breakage, protein adhesion, steric hindrance and the like in an amplification area can cause amplification failure to cause false negative of the result or inaccurate quantification; (d) the dependence of the PCR experiment on the instrument is very high, and a centrifugal machine and an amplification instrument are factors causing PCR false negative; (e) the success of a PCR experiment or lack thereof is of crucial importance for the quality of the reagents, which concerns several aspects: cell lysis, template extraction, primer site selection, Taq enzyme activity and the like; a problem with either of these links can lead to false negatives in the results. The kit is produced by more than one hundred companies at home, the product quality is uneven, and a small laboratory has no research, development, production condition and qualification at all and is not involved in the research, development and production of the reagent at all; (f) PCR experiments have many links, and the quality requirement of each link is high, such as adding less reagent, centrifuging insufficiently, designing wrong circulation parameters, and causing false negative of results on RNA extraction degradation, reverse transcription failure and the like. Therefore, the experimental operator who requires PCR has high quality and skill, can strictly follow the operation procedures, and can sharply find and solve the problems. Because RT-PCR nucleic acid test is not developed in few in clinical hospital clinical laboratory, and doctors skilled in the clinical laboratory of nucleic acid extraction, purification and amplification are not enough, the RT-PCR nucleic acid test can not adapt to the requirement of massive sample test.

The second is the problem of false positives. The problem of false positives in PCR is simply, and generally involves only contamination and non-specificity of the primers. The pollution can be solved by strict laboratory management, reasonable environment setting, pollution resistance by adding UNG enzyme and other measures, and the nonspecific problem of the primer basically belongs to the reagent quality problem of manufacturers. The third is that the laboratory requirements are high. The laboratory needs nucleic acid extraction appearance and fluorescence quantitative PCR appearance, and not every laboratory can both be equipped with, and require higher to the laboratory safety level (P2 laboratory adds P3 protection) to avoid virus pollution safety cabinet and laboratory, cause inspection personnel to infect. The fourth problem is that RT-PCR is cumbersome and expensive.

IgM antibody detection is an important diagnostic method for blood tests for viral infections (early infection, e.g., within two weeks)^11-12. IgM is the first antibody to appear during infection and is often used as a marker for acute infection. As infection progresses, the IgM concentration gradually decreases and disappears after IgG appears. Its advantages are high speed and simplicity. Compared with the RT-PCR nucleic acid detection used in the current diagnosis, the antibody detection is simpler and more efficient, has strong sensitivity and high specificity, can effectively break through the limitation of the existing detection technology on personnel and places, realizes the rapid diagnosis of suspected patients and the field screening of close contact people when the detection time is shortened, and promotes the forward movement and the downward movement of the diagnosis screening. However, this approach also has certain limitations. The first is the problem of false negatives. The positive detection rate and sensitivity are still not ideal. False negatives are a major problem with missed detections (possibly leaving the superpropagator!). False negatives can be caused for several reasons: (a) the antibody/antigen preparation has a long research and development period, and the product is still in an experimental stage and has unstable quality; (b) the RNA virus has high mutation speed, so that the antibody can not be detected; (c) antibodies are generally detected within 3-5 days after reinfection and IgM concentrations in the blood decrease rapidly due to clearance (e.g.after two weeks), i.e.after two weeks the utility value may be limited. And alsoDuring the window period (patient infection until antibody detection), the patient may have already transmitted the virus to many people, and is likely to be out of country across provinces, with great potential infection.

The antibody detection method is applied more before, but with the gradual improvement of our cognition, it is clear that the influenza virus IgG antibody level recovery phase is increased by 4 times or more than the acute phase in the influenza diagnosis and treatment scheme in 2019, and the method only has retrospective diagnosis significance and cannot be used for diagnosing virus infection, and the IgM antibody detection sensitivity is low, and the conventional use is not recommended. Moreover, IgG positivity cannot judge that the patient is in the past infection or infection stage. IgG still exists in the cured patients with the novel coronavirus pneumonia, but the virus in the body is cleared. The main reason is that the antibody is generally produced in a large amount only in the convalescent period of a patient, the timeliness is poor, the antibody cannot be used for early diagnosis of virus infection, the significance of diagnosis and prevention and control of the SARS-CoV-2, which is a novel coronavirus with extremely high infectivity, is not high, and the nucleic acid detection is still the gold standard of the virus detection. Therefore, the virus antibody detection is not listed as a pathogeny detection project in the current diagnosis and treatment guidelines of various novel coronavirus SARS-CoV-2.

There is also a problem of false positives for specific IgM and IgG immunoassays. False positives are usually caused by the following two reasons, namely setting of a positive judgment value (Cut-off value) of the kit, and weak positive results which are close to the positive judgment value are likely to be false positives; secondly, endogenous or exogenous interfering substances which lead to false positives of the immunoassay are present in patient samples. Endogenous interfering substances generally include rheumatoid factor heterophile antibodies, complement, lysozyme and the like. Exogenous interference factors generally include hemolysis of the specimen, bacterial contamination, prolonged storage of the specimen, and incomplete coagulation of the specimen.

Fluorescent in situ hybridization (Fluorescence) of RNAin situHybridization (FISH) is an important nonradioactive in situ hybridization technique, which utilizes a reporter molecule (e.g., biotin, digoxigenin, etc.) to label a nucleic acid probe, and then combines the probe with a chromosome or a target DNA/RNA hybridization, if the two are homologous complementary, a hybrid of the target DNA/RNA and the nucleic acid probe can be formed. At this time, the immunochemical reaction between the reporter molecule and the fluorescein-labeled specific avidin can be utilized to perform qualitative, quantitative or relative positioning analysis on the DNA/RNA to be detected under the mirror by the fluorescent detection system¹³. This approach has several advantages.

The first is high sensitivity and accuracy. (a) The method can detect single virus (comparing with the 1000-5000 detection limit of RT-PCR, the advantages are very obvious); (b) the probe has high stability, good specificity and accurate positioning, and can quickly obtain a result; (c) through multiple immunochemical reactions, the hybridization signal is enhanced, the sensitivity is improved, and the sensitivity is equivalent to that of a radioactive probe; (d) multicolor FISH allows simultaneous detection of multiple sequences by displaying different colors in the same core (multi-target detection, e.g., up to 20 targets, far beyond two targets for RT-PCR!); (e) after the sample is fixed, the cross contamination possibility is extremely low, and the false positive is extremely low; (f) simple operation, error avoidance and high repeatability. The second is that the requirements on the laboratory are not high. The fluorescence in situ hybridization does not need complex and expensive experimental equipment, only needs a common optical microscope or a fluorescence microscope, is very suitable for small hospitals, remote and underdeveloped areas/countries (such as Africa) and special occasions (such as diamond princess postship or field hospital), and the fixed sample is detected, so that the infection risk of detection personnel is greatly reduced, and the detection is safer. The third advantage is economical and practical. The fluorescence in situ hybridization does not need a large amount of primers and enzymes required by amplification, so the cost is lower than that of RT-PCR.

Compared with the automatic judgment result of RT-PCR, the RNAFISH can adopt a manual judgment result, and can also use an artificial intelligence technology to identify the judgment result or help the judgment result.

Reference documents:

1.Poltronieri P, Sun B, Mallardo M. RNA viruses: RNA roles inpathogenesis, coreplication and viral load. Curr Genomics 2015;16:327-35；

2.Duffy S. Why are RNA virus mutation rates so damn high PLoS Biol 2018;16:e3000003；

3.Carrasco-Hernandez R, Jácome R, López Vidal Y, Ponce de León S. Are RNAviruses candidate agents for the next global pandemic A review. ILAR J 2017;58:343-358;

4.Chan JF, Kok KH, Zhu Z, Chu H, To KK, Yuan S, Yuen KY. Genomiccharacterization of the 2019 novel human-pathogenic coronavirus isolated froma patient with atypical pneumonia after visiting Wuhan. Emerg Microbes Infect2020;9:221-236；

5.Lu R, Zhao X, Li J, Niu P, Yang B, Wu H, Wang W, Song H, Huang B, ZhuN, Bi Y, Ma X, Zhan F, Wang L, Hu T, Zhou H, Hu Z, Zhou W, Zhao L, Chen J,Meng Y, Wang J, Lin Y, Yuan J, Xie Z, Ma J, Liu WJ, Wang D, Xu W, Holmes EC,Gao GF, Wu G, Chen W, Shi W, Tan W. Genomic characterisation and epidemiologyof 2019 novel coronavirus: implications for virus origins and receptorbinding. Lancet 2020;395:565-574；

6.Fang Y, Zhang H, Xie J, Lin M, Ying L, Pang P, Ji W. Sensitivity ofchest CT for COVID-19: comparison to RT-PCR. Radiology 2020;200432；

7.Pan F, Ye T, Sun P, Gui S, Liang B, Li L, Zheng D, Wang J, Hesketh RL,Yang L, Zheng C. Time course of lung changes on chest CT during recovery from2019 novel coronavirus (COVID-19) pneumonia. Radiology 2020;200370；

8.Jozefczuk J, Adjaye J. Quantitative real-time PCR-based analysis ofgene expression. Methods Enzymol 2011;500:99-109；

9.Chu DKW, Pan Y, Cheng SMS, Hui KPY, Krishnan P, Liu Y, Ng DYM, Wan CKC,Yang P, Wang Q, Peiris M, Poon LLM. Molecular diagnosis of a novelCoronavirus (2019-nCoV) causing an outbreak of pneumonia. Clin Chem 2020; 66:549-555；

10.Corman VM, Landt O, Kaiser M, Molenkamp R, Meijer A, Chu DK, BleickerT, Brünink S, Schneider J, Schmidt ML, Mulders DG, Haagmans BL, van der VeerB, van den Brink S, Wijsman L, Goderski G, Romette JL, Ellis J, Zambon M,Peiris M, Goossens H, Reusken C, Koopmans MP, Drosten C. Detection of 2019novel coronavirus (2019-nCoV) by real-time RT-PCR. Euro Surveill 2020;25(3)；

11.Li ZN, Lin SC, Carney PJ, Li J, Liu F, Lu X, Liu M, Stevens J, LevineM, Katz JM, Hancock K. IgM, IgG, and IgA antibody responses to Influenza A(H1N1)pdm09 hemagglutinin in infected persons during the first wave of the2009 pandemic in the United States. Clin Vaccine Immunol 2014;21:1054-1060；

12.Yao Y, Zhao ZP, Song W, Li RQ, Dong Z, Kun Q, Zhao XY. Unreliableusage of a single influenza virus IgM antibody assay in influenza-likeillness: A retrospective study of the 2016-2018 flu epidemic. PLoS One 2019;14:e0215514；

13.Nturibi E, Bhagwat AR, Coburn S, Myerburg MM, Lakdawala SS.Intracellular colocalization of Influenza viral RNA and Rab11A is dependentupon microtubule filaments. J Virol 2017;91(19):e01179-17；

14.Straccia P, Fadda G, Pierconti F. Comparison between cytospin andliquid-based cytology in cerebrospinal fluid diagnosis of neoplasticdiseases: A single institution experience. Cytopathology 2019;30:236-240；

15.Pan Z, Yang G, Wang Y, He H, Pang X, Gao Y, Shi W, Li Y, Dong L, SongY. Thinprep plus Papanicolaou stain method is more sensitive than cytospin-coupled Wright Giemsa stain method in cerebrospinal fluid cytology fordiagnosis of leptomeningeal metastasis from solid tumors. PLoS One 2015;10:e0122016；

16.Warnes SL, Summersgill EN, Keevil CW. Inactivation of murine noroviruson a range of copper alloy surfaces is accompanied by loss of capsidintegrity. Appl Environ Microbiol2015;81:1085-91；

17. Han LL, Yu D T, He J Z. Research methods for soil viral ecology. ActaEcologicaSinica 2017;37:1749-56；

18. Liao Ning-Bo, Li Jing, Sun Liang, et al. Research progress inextraction and detection of foodborne viruses from food samples[J]. ChineseJournal of Public Health 2017; 33: 1792-97;

19.Butot S, Putallaz T, Sanchez G. Procedure for rapid concentration anddetection of enteric viruses from berries and vegetables[J]. Appl Environ.Microbiol2007; 73: 186-92；

20.Ma B, Savas JN, Chao MV, Tanese N. Quantitative analysis of BDNF/TrkBprotein and mRNA in cortical and striatal neurons using α-tubulin as anormalization factor. Cytometry A 2012;81:704-17；

21.Ma B, Tanese N. Combined FISH and immunofluorescent staining methodsto colocalize proteins and mRNA in neurons and brain tissue. Methods Mol Biol2013; 1010:123-38;

22.Ma B, Savas JN, Yu MS, Culver BP, Chao MV, Tanese N. Huntingtinfacilitates β-actin mRNA transport in dendrites of cortical neurons.Scientific Reports 2011; 1: 140;

23.Ma B, Baj G, Tongiorgi E, Chao MV, Tanese N. Localization of BDNF mRNAwith the Huntington’s disease protein in rat brain. Mol Neurodegener 2010; 5:22;

24.Ma B, Tanese N. RNA-directed FISH and immunostaining. Fluorescence insitu Hybridization (FISH) – Application Guide, T Liehr (Editor), 2nd Ed.,Springer, Berlin, 2017, ISBN: 978-3662529577；

25.Cox WG, Singer VL. Fluorescent DNA hybridization probe preparationusing amine modification and reactive dye coupling. Biotechniques 2004;36:114-22；

26. research progress of Song national dragon, auspicious Oriental quantum dot as fluorescent probe in the biomedical field [ J ]. nanotechnology 2016; 6: 9-13;

27.Liu Y, Le P, Lim SJ, Ma L, Sarkar S, Han Z, Murphy SJ, Kosari F,Vasmatzis G, Cheville JC, Smith AM. Enhanced mRNA FISH with compact quantumdots. Nat Commun 2018; 9:4461;

28.Wang H, Pangilinan RL, Zhu Y. Detection of cytokine receptors usingtyramide signal amplification for immunofluorescence. Methods Mol Biol 2020;2108:89-97；

29.Lauter G, Söll I, Hauptmann G. Sensitive multiplexed fluorescent insitu hybridization using enhanced tyramide signal amplification and itscombination with immunofluorescent protein visualization in zebrafish.Methods Mol Biol 2020;2047:397-409。

disclosure of Invention

The invention designs a high-sensitivity single-molecule RNA virus detection method based on RNA fluorescent in-situ hybridization, which solves the technical problem that the accuracy of the existing nucleic acid virus detection is not ideal. For example, the accuracy of nucleic acid amplification detection of SARS-CoV-2 is only 30% -50%, which is a clinical problem and cannot effectively control the spread of virus.

In order to solve the technical problems, the invention adopts the following scheme:

a high-sensitivity single-molecule RNA virus detection method based on RNA fluorescence in situ hybridization comprises the following steps:

step a, processing a sample to prepare a smear (cytology smear and virus smear);

b, combining the virus RNA with a labeled probe;

step c, binding Digoxigenin (DIG) or biotin-labeled probes through antibodies;

d, developing color by using fluorescence or peroxidase substrate;

and e, detecting signals by using a common light mirror or a fluorescence microscope/laser confocal microscope to identify the viral RNA.

Such viruses are identified by identifying the RNA of the RNA virus, which can be identified include viral genomic RNA and its transcription intermediate RNA, and fragments of these RNAs.

Preferably, the virus is a novel coronavirus (SARS-CoV-2), SARS virus (SARS-CoV-1), all influenza virus, rhinovirus, MERS virus, Ebola virus (Ebola virus), AIDS virus (HIV), Hepatitis A Virus (HAV), Hepatitis C Virus (HCV), norovirus, encephalitis B virus, polio virus, Coxsackie virus, dengue virus, rotavirus or Marburg virus, and the like.

Preferably, when the RNA virus is SARS-CoV-2, the sequence of the probe comprises:

GTTTCAAGCTTTTTGGAAATGAAGAGTGAAAAGCAAGTTGAACAAAAGAT (ORF1a)
	AAACTTCATGGCAGACGGGCGATTTTGTTAAAGCCACTTGCGAATTTTGT (ORF1a)
GCGTGAGCTTAACGGAGGGGCATACACTCGCTATGTCGATAACAACTTCT (ORF1a)
	CTGCTCGCATAGTGTATACAGCTTGCTCTCATGCCGCTGTTGATGCACTA (ORF1b)
TGTGTTCTCTTATGTTGGTTGCCATAACAAGTGTGCCTATTGGGTTCCAC (ORF1a)

preferably, when the RNA virus is SARS-CoV-2, the detection of a negative RNA can indicate that the virus is replicating, and the probe is an antisense probe, wherein the negative RNA is detected by the antisense probe, and the sequence of the antisense probe is:

CAAAGTTCGAAAAACCTTTACTTCTCACTTTTCGTTCAACTTGTTTTCTA(ORF1a)
	TTTGAAGTACCGTCTGCCCGCTAAAACAATTTCGGTGAACGCTTAAAACA(ORF1a)
CGCACTCGAATTGCCTCCCCGTATGTGAGCGATACAGCTATTGTTGAAGA(ORF1a)
	GACGAGCGTATCACATATGTCGAACGAGAGTACGGCGACAACTACGTGAT(ORF1b)
ACACAAGAGAATACAACCAACGGTATTGTTCACACGGATAACCCAAGGTG(ORF1a)

preferably, when the RNA virus is SARS-CoV-2, the sequence of the probe (for SARS-CoV-2) is:

TGGATGTAATTATCTTGGCA
	CCACGCGAACAAATAGATGG
CGCTGAGATTCCTAAAGAGG
	CTTCATGGCAGACGGGCGAT
CTGTGGCCCTGATGGCTACC
	CTGCTCGCATAGTGTATACA
GCTCTCATGCCGCTGTTGAT
	GGTTGCCATAACAAGTGTGC
CCACGTGCTAGCGCTAACAT
	GACACTAAGAGGGGTGTATA

preferably, the virus is replicating as evidenced by the detection of negative RNA (for SARS-CoV-2), which is an antisense probe with which negative RNA is detected, the sequence of the antisense probe being:

ACCTACATTAATAGAACCGT
	GGTGCGCTTGTTTATCTACC
GCGACTCTAAGGATTTCTCC
	GAAGTACCGTCTGCCCGCTA
GACACCGGGACTACCGATGG
	GACGAGCGTATCACATATGT
CGAGAGTACGGCGACAACTA
	CGAACGGTATTGTTCACACG
GGTGCACGATCGCGATTGTA
	CTGTGATTCTCCCCACATAT

preferably, the detection is carried out by ordinary microscopy and spatially resolved fluorescence microscopy, and the smear is also detected and processed by an automated image acquisition and analysis system.

The smear of the invention includes cytological and viral smears for RNA hybridization analysis. During the experiment, corresponding DNA and RNase cleaning reagents (such as Life Technologies or Fisher Scientific) are used to clean the environment and DNase (DNase) and RNase (RNase) contamination on the instrument equipment, and finally to avoid false positive and false negative of the detection result. Domestic reagents can also be used, for example, RNase and DNase Away in Byun can simultaneously remove 2 interferents; and RNase, DNase, RNA and DNA Away can effectively remove RNase, DNase, DNA and/or RNA pollutants on the solid-phase surfaces of experimental instruments, equipment, materials, experiment tables, gloves and the like, so that the detection result is more reliable.

All solutions of the present invention need to be prepared with diethyl pyrocarbonate (DEPC; Sigma) treated water (DEPC water for short). Two exceptions are: firstly, the method comprises the following steps: commercially available water or solutions, the products of which have been stated to be free of RNase or/and DNase (e.g.ultrapure water for PCR), can be used according to the instructions for the reagents. Secondly, the method comprises the following steps: water or solutions in commercially available kits or sampling devices (e.g. BD SurePath)^TMliquid-based Pap test), can also be used according to the instructions for the reagents without additional formulation.

The DEPC water was an aqueous solution obtained by treating with 0.1% DEPC for 12 hours and then subjecting to high temperature and high pressure treatment. Since DEPC is a highly efficient alkylating agent, it inactivates proteins by reacting with His residues in proteins, and thus inactivates RNases, which are very persistent in water. 1 ml of DEPC was added to 1L of deionized water and stirred at room temperature overnight. The next day the solution was autoclaved to hydrolyze and inactivate DEPC. All solutions required for the process required formulation with DEPC water.

The present invention uses coverslips or common microscope slides to make cytological and viral smears. Can be purchased directly from commercial sources (such as Hangzhou Xinyou) or made by oneself. The slide needs to be clean, has good optical performance and is suitable for microscope observation. A cover glass or a microscope slide (25.4mmx76.2mm) with the diameter of 12mm is taken, 1N nitric acid is soaked overnight, each piece is independently aired after being washed by distilled water, the piece is baked for 2 hours in an oven at the temperature of 200 ℃, and the piece is aired for standby after being treated for ten minutes by 0.01 percent polylysine (PLL; Sigma). Microscope slides are drawn with an immunolabeling pen (e.g., ImmunoPen; Millipore) into a 12mm diameter circle within which the smear is made for cell localization and quantitative analysis. If the area of the smear is large,reagents may be added in corresponding areas. For example, if a 12mm diameter coverslip is added with 50 μ l of reagent, 5cm²And adding 250 mul to the smear.

The sampling swab of the invention adopts a polyester and nylon flocked swab or an artificial cotton swab of a plastic rod to collect specimens and smears. The collected specimens should be taken for inspection or refrigerated storage and transport as soon as possible. If desired, the liquid sample may be supplemented with an RNase inhibitor (e.g., Superase, Thermo Fisher) to prevent degradation of the RNA in the sample. Protease inhibitors (aprotinins, e.g.protease Inhibitor Cocktail, Sigma) can also be added to prevent degradation of the protein.

When there are many fragments and excessive inflammatory cells in the sample, the Thin Prep technique can be used^14-15(Hologic Corp.). The Thin Prep filters out cells from the solution, the filtered cells are attached to a re-filter, and the cells are then transferred to a slide or cover glass for a Thin, uniform monolayer of cells, which removes diagnostically insignificant debris and excess inflammatory cells¹⁴. The ThinPrep 5000 Processor (Hologic) can also be used to automatically make smears and fixes.

When the sample contains fewer cells, Cytospin technology can also be used. Cytospin is a rapid, efficient, and cost-effective method for increasing the yield of cells in a cell sample and better preserving the morphology of the cells¹⁵. For example, Cytospin can be used^TM4 Low temperature centrifuge (Thermo Fisher), centrifuge at 800rpm for 5 minutes, make smear.

Fresh samples are collected in an anticoagulation vial, and anticoagulant may be added as needed. For non-hemorrhagic fluids, ethylenediaminetetraacetic acid (EDTA) is used, whereas for hemorrhagic fluids (e.g. bloody ascites), heparin is the first choice.

Concentration of the virus can be carried out by several different methods:

in one embodiment, 10% polyethylene glycol (PEG) and 0.5 mol/L NaCl are added at 4 deg.C overnight at 8000 ℃ for half an hour, the supernatant is discarded, and the pellet is resuspended in 1 ml of DEPC water or ultrapure water (RNase-free), smeared, dried and then driedFixation with 4% Paraformaldehyde (PFA). The virus concentration is suitable for the virus concentration of urine, pleural effusion, environmental water and other specimens. The PEG Virus Precipitation Kit (Biovision) can also be used to concentrate the Virus¹⁶。

The following treatments, preparations and fixations were performed specifically on different specimens:

nasopharyngeal swab/oropharyngeal swab: naso/oropharyngeal swabs are collected with reference to clinical requirements using a specialized virus sampling tube (e.g., Youkang). The cotton swab was then gently pressed onto the clean slide to make a thin, uniform smear, which was fixed with 4% PFA. Alternatively, the swab may be shaken to elute the cells into buffer, and then a smear may be made by the Thin Prep method, followed by fixation with 4% PFA.

Saliva: saliva is collected directly in a sterile container, smeared directly and air-dried. Or centrifuging the collected saliva, smearing the supernatant, air drying, and fixing with 4% PFA. Smears were also made with Thin Prep and fixed with 4% PFA.

Oral gargle: when collecting the gargle, the patient is rinsed with sterile saline, then the gargle is collected in a sterile container, centrifuged at 800g for 15 minutes at 4 ℃, and the precipitate is taken for cytological smear. Smears were also made with Thin Prep and fixed with 4% PFA.

Alveolar or bronchial lavage fluid: after centrifugation the cell smear was fixed with 4% PFA. Smears were also made with Thin Prep and fixed with 4% PFA after smearing. The supernatant was concentrated and smeared, dried, and fixed with 4% PFA.

Phlegm: thick sputum requires liquefaction. Equal volumes of N-acetyl-L-cysteine-sodium hydroxide (NALC-NaOH) solution were mixed with the sample, incubated at room temperature for 20 minutes, then Phosphate Buffered Saline (PBS) was added, and the mixture was centrifuged again (3500 g) for 20 minutes. The supernatant was smeared and the pellet resuspended in PBS and then smeared and fixed with 4% PFA.

Tear and conjunctival secretion smear tear and conjunctival secretion smears directly, white blood cells and epithelial cells were visible, and the smear was air dried and fixed with 4% PFA.

Smearing with a cotton swab, namely, smearing with a cotton swab after wiping the cornea. Goblet epithelial cells and leukocytes were visible in normal smears, fixed with 4% PFA post-smear.

Blood: fresh non-anticoagulated blood can be smeared directly and dried and fixed with 95% methanol or 4% PFA. Or collecting blood with heparin anticoagulation tube, then obtaining mononuclear cells (for example, detecting HIV in T cells) from the mononuclear cell layer by Ficoll Histopaque (Sigma) density gradient centrifugation, washing the cells by PBS centrifugation, then suspending the cells in a small amount of PBS, and then smearing. Or both plasma smears were dried and fixed with 95% methanol or 4% PFA.

Bone marrow smear: bone marrow was smeared directly and dried and fixed with 95% methanol or 4% PFA.

Urine: after centrifugation, the pellet was smeared and fixed with 4% PFA. Smears were also made with Thin Prep or Cytospin and fixed with 4% PFA. The supernatant was concentrated and smeared, dried, and fixed with 4% PFA.

Hydrothorax and ascites: anticoagulant is added according to the requirements of the sample. After centrifugation, cell smears were made and fixed with 4% PFA. Smears were also made with Thin Prep or Cytospin and fixed with 4% PFA. The supernatant was concentrated and smeared, dried, and fixed with 4% PFA.

Cerebrospinal fluid (e.g. for detection of enterovirus or HCV): cerebrospinal fluid was centrifuged and the pellet was smeared with cells and fixed with 4% PFA. Cytological smears were also prepared with Thin Prep or Cytospin and fixed with 4% PFA. The supernatant was concentrated and smeared, dried, and fixed with 4% PFA.

Vaginal smear and cervical smear: pap smears were made and fixed with 4% PFA. BDSurePath can also be used^TMliquid-based Pap test samples were collected and smeared so that diagnostically insignificant debris and excess inflammatory cells were removed by gradient centrifugation and fixed with 4% PFA post-smear. Smears were also made with Thin Prep or Cytospin and fixed with 4% PFA.

Stool: mixing the stool with proper amount of normal saline, stirring well, filtering with 250-micrometer and 125-micrometer filter screens, centrifuging the mixture at 1500 rpm for 10 minutes, centrifuging, smearing the cell, fixing with 4% PFA, smearing the supernatant, drying, and fixing with 4% PFA. Distilled water (capable of lysing exfoliated cells in the intestinal tract) 1: stool was diluted 10, centrifuged at high speed, the supernatant smeared, dried and fixed with 4% PFA.

Biopsy tissue (incisional and excisional tissue biopsies): tissue blocks no larger than 1.5cm by 0.5cm are embedded in OCT embedding medium (e.g. O.C.T. Compound, Tissue-Tek) and frozen either directly in liquid nitrogen or in liquid nitrogen cooled isopropane. And (4) slicing by a freezing slicer, wherein the thickness is 5-20 mu m, placing the slices on a treated cover glass or glass slide, and fixing by 4% PFA after natural drying.

Fine needle aspiration biopsy: the biopsies were smeared on coverslips or slides, dried and fixed with 4% PFA. Smears were also made with Thin Prep or Cytospin using biopsy or needle wash and fixed with 4% PFA.

Environmental specimen (object surface): the specimens were collected by smear. Collected with a special virus sampling tube (e.g., Youkang). The surface of the object is smeared with the wetted swab, immediately smeared with the swab, dried and fixed with 4% PFA, or preserved in a virus preservation solution of a virus sampling tube, smeared later, and fixed with 4% PFA after drying. The preservation solution is based on Hank's solution, and virus stabilizing components such as BSA (bovine serum albumin, a fifth component), HEPES and the like are added, so that the activity of the virus can be maintained in a wider temperature range, the virus decomposition speed is reduced, and the positive rate of virus separation is improved. Or using virus DNA/RNA sample preservation solution (inactivation type; kang century) to sample according to the method. Its advantages are long storage time at ordinary temp and high effect on deactivating virus. The smear was dried and fixed with 4% PFA.

Soil: firstly, breaking soil blocks, removing large objects such as sand and stone plants by using a sieve with the pore diameter of 2mm, adding 1% potassium citrate solution or 250mmol/L glycine into a sample to be mixed as an extracting solution, and then transferring an elution buffer solution into a Falcon tube provided with a nylon cell filter screen with the pore diameter of 40 mu m¹⁷To remove debris. Smearing the eluate directly, or smearing after concentrating with PEG, drying, and applying4% PFA fixation.

Water (including drinking water, sewage, river/lake/sea water, etc.): after being filtered by a nylon cell filter screen with the aperture of 40 mu m, a smear is made after concentration, and after drying, the smear is fixed by 4% PFA. According to the report of related documents, the virus content of some water bodies is high (for example, the hepatitis A virus content in some seawater may be more than 1000/ml), so that 100-.

Animal specimens (containing viruses in tissues or organs): tissue blocks no larger than 1.5cm by 0.5cm are embedded in OCT embedding medium (e.g. O.C.T. Compound, Tissue-Tek) and frozen either directly in liquid nitrogen or in liquid nitrogen cooled isopropane. And (4) slicing by a freezing slicer, wherein the thickness is 5-20 mu m, placing the slices on a treated cover glass or glass slide, and fixing by 4% PFA after natural drying.

Plant specimen (in-plant): tissue blocks no larger than 1.5cm by 0.5cm are embedded in OCT embedding medium (e.g. O.C.T. Compound, Tissue-Tek) and frozen either directly in liquid nitrogen or in liquid nitrogen cooled isopropane. And (4) slicing by a freezing slicer, wherein the thickness is 5-20 mu m, placing the slices on a treated cover glass or glass slide, and fixing by 4% PFA after natural drying.

Animal and plant specimens (contaminated with viruses): at present, the elution-concentration method is widely applied to the virus extraction of carbohydrate food, fat/protein food and aquatic shellfish food. In general, the elution methods for viruses in different food species are essentially the same, i.e., they all use a specific (basic or neutral) elution buffer^18-19. Beef extract and glycine are often used with eluents because they reduce non-specific adsorption of viral particles to food ingredients during extraction of the virus. Wherein, the high-protein beef extract can also promote the adsorption of the norovirus to PEG molecules. So 3% beef extract or glycine solution (50 mM) can be added to aid elution. For example, 10 g of sample is added to 50 ml of eluent (50 mM glycine, 100 mM Tris, 3% [ wt/vol ]]Beef extract [ pH 9.5]). Then the elution buffer is transferredMove to a Falcon tube (BD Falcon) equipped with a nylon cell strainer with a 40 μm pore size to remove debris. The eluate was smeared directly or after concentration with PEG, dried and fixed with 4% PFA.

The design of the probe in the invention is as follows:

the FISH probe and the corresponding antisense probe are 20-80 nucleotides in length, and both probes can be used simultaneously. Antisense probes can detect intermediates of RNA (e.g., negative RNA of SARS-CoV-2), and can determine whether the virus replicates intracellularly/in vivo. The probes are labeled with fluorescent dyes or haptens after synthesis. In this invention, DIG is mainly used to label oligonucleotide probes.

BLAST searches were performed to ensure specificity for the target RNA using Oligo6, Primer-Blast, Lasergene Molecular Biology or other similar software for probe design. The optimal probe has high G/C content (> 50%), low self-complementarity, no dimer formation, and no "hairpin" structure.

Synthesis of the Probe of the present invention:

using a DNA synthesizer (e.g., Dr Oligo)^TM192, Biolytic Lab Performance). The probes are labeled with DIG random primer DNA labeling (e.g., digoxigenin DNA labeling Kit, Sigma), or with DIGOLIGOnucleotide labeling Kit, 2nd Generation (Roche)²⁰. After labeling with Illustra Probe Quant^TMThe probe sample was purified by G-50 Micro Columns (GE Healthcare).

DIG-labeled DNA probes can also be generated using DIG-Nick transformation Mix (Sigma or Roche)^21-24. Plasmid DNA containing viral gene sequences or purified PCR products were used as templates for probe production. A plasmid without inserted viral sequences (blank plasmid) was used as a negative control. About 50 μ l of probe can be produced by 1.0 μ g of template DNA in general.

In another implementation, the probes are directly labeled with a fluorescent dye. Using a DNA synthesizer (e.g., Droligo)^TM192, Biolytic Lab Performance) with a probe length of 20 nucleotides, which reduces the reaction time for hybridization. ProbeThe probe is labeled with a probe Labeling Kit (e.g., Alexa Fluor 488 Oligonucleotide Amine Labeling Kit (Thermo Fisher)) after synthesis by adding an Amine-modified nucleotide thereto²⁵。

In another implementation, the probes are labeled with biotin. Using a DNA synthesizer (e.g., Dr Oligo)^TM192, Biolytic Lab Performance). The probe is 20 nucleotides in length, which can reduce the reaction time for hybridization. Labeling of the kit with probes after probe synthesis (e.g., Pierce)^TMA Biotin 3' End DNA Labeling Kit or a Biotin Deca Label DNA Labeling Kit; thermo fisher) to label the probe.

The hybridization process of the invention is as follows:

the hybridization experiment mainly adopts the cover glass smear with the diameter of 12mm, and can be placed in a 24-hole cell culture plate for operation. If a microscope slide smear is used, the amount of sample to be applied can be adjusted appropriately to 1cm per unit²The sample was added in an amount corresponding to the sample addition amount of the cover glass having a unit reference diameter of 12mm, and the procedure was also appropriately adjusted.

Wherein the formulation of 10x phosphate buffered saline (10 x PBS) is: 80.0g NaCl, 2.0g KCl and 14.4g Na are added₂HPO4、2.4gKH₂PO4 was dissolved in 800ml of DEPC water, the pH was adjusted to 7.4, and then added to 1 liter with DEPC water. Stored at room temperature after autoclaving. When used, the solution was diluted 10 times with DEPC water to obtain 1xPBS (PBS for short).

After the smear was fixed with 4% PFA for 10 min, it was washed with PBS for 2X 5 min, then permeabilized with 0.2% Triton X-100 for 5 min and washed with PBS for 1X 5 min.

If methanol fixation is used, 95% methanol is used for fixation for 1 to 3 minutes, air-dried after fixation, washed with PBS for 1X 5 minutes, and then the same procedure as described below is carried out.

For each coverslip (or 1cm on a microscope slide)²The same applies to the same), 20. mu.l of an 80% deionized formamide/1 × sodium chloride/sodium citrate solution (1XSSC) containing 1. mu.g of salmon sperm single-stranded DNA and 1. mu.g of yeast tRNA, respectively, was prepared, and this solution was put on a 85 ℃ dry bathAfter 5 minutes of heating, place on ice. Then 20. mu.l of hybridization buffer was added to obtain 40. mu.l of prehybridization mixture for prehybridization. Prehybridization can block sites of non-specific binding of smear neutralization probes, reduce background, and enhance signal-to-noise ratio.

Wherein the formula of the hybridization buffer solution is as follows: mu.l of 25% dextran sulfate (Sigma), 200. mu.l of 20 mg/ml Bovine Serum Albumin (BSA), 100. mu.l of 200 mM vanadyl Ribonucleoside complex (Ribose Vanadyl complexes, RVC; Sigma), 100. mu.l of 20XSSC, 10. mu.l of 1M sodium phosphate buffer (pH 7.0) and 190. mu.l of DEPC water were combined to make 1 ml hybridization buffer, vortexed, centrifuged at 4 ℃ for 5 minutes (12,000 RCF), and then placed on ice for use, while taking the supernatant.

Wherein the formulation of 1M sodium phosphate buffer (pH 7.0) is: combine 57.7ml of 1M Na₂HPO₄And 42.3ml of 1MNaH₂PO₄To prepare 100 ml of solution. With Na₂HPO₄Or NaH₂PO₄The pH was adjusted to 7.0. Stored at room temperature after autoclaving.

Wherein the formulation of 20 × SSC (20 XSSC) is 3M NaCl, 300 mM sodium citrate.2H2H2M₂O, pH7.0. And (4) storing at room temperature after autoclaving.

And (3) placing absorbent paper at the bottom of the antibody incubation box, adding DEPC water, and soaking the absorbent paper, so that the humidity in the box can be kept, and the hybridization solution is not easy to volatilize.

Smearing with a cover glass: paraffin membrane is spread on the bottom of the box, 40 μ l of prehybridization mixture is added to the paraffine membrane, a cover glass is covered, the smear is placed face down, and incubation is performed in a hybridization oven (e.g., Biyuntian Co.) at 37 ℃ for half an hour to one hour (prehybridization).

Microscope slide: add prehybridization mixture (40 μ l/cm) to slide²). The hybridization solution was then covered with a paraffin film of comparable size to prevent evaporation. Incubation in the hybridization oven at 37 ℃ for half an hour to one hour (prehybridization).

In another embodiment, prehybridization and hybridization can be accomplished using antibody incubation cassettes (moisturizing) or a hybridization apparatus (moisturizing and thermostating) using similar principles.

For each cover slip, 20. mu.l of 80% formamide/1 XSSC solution containing 50 ng of oligonucleotide probe (5 probes, 10ng each), 1. mu.g of salmon sperm single-stranded DNA and 1. mu.g of yeast tRNA was prepared. For nicked translated DNA probes, 1. mu.l of probe was used per cover slip.

Heating the mixture at 85 ℃ for 5 minutes in a dry bath; left on ice for 5 minutes. After the suspension was cooled, 20. mu.l of hybridization buffer was added to each cover slip to generate 40. mu.l of probe hybridization solution. The probe hybridization solution was added according to the prehybridization method, incubated at 37 ℃ for 3-6 hours in a hybridization oven, rinsed with 40% formamide/1 XSSC for 30 minutes at 37 ℃ (gently shaken on an orbital shaker), rinsed with 1XSSC37 ℃ for 2X 10 minutes (gently shaken on an orbital shaker), and then washed in 1XSSC for 10 minutes.

In another implementation, a fluorescent dye (e.g., Alexa 488) directly labeled probe is used. In this case, the concentration of the probe can be increased to 200ng (in 40. mu.l)/cover glass/cm²(10 probes, 20ng each). Therefore, the hybridization time can be greatly shortened to half an hour or even less than half an hour, the detection time is greatly shortened, and the rapid detection of the virus is realized.

Positive control of viral detection in the present invention:

virus: the reference virus may be added to an article that does not contain a virus. For example, known titers of hepatitis A, poliovirus, or live attenuated vaccines can be tested after addition to vegetables and fruits, allowing for the determination of the yield of the virus purification process, and the effectiveness and feasibility of the method. In addition, these reference samples can be tested together with the test sample to determine the effectiveness of the test method as a quality control sample.

Plasmid: plasmids containing viral sequences can be used to produce probes with higher sensitivity, but may be less specific than typical oligonucleotide probes. The plasmid is used as a reference substance for virus detection, so that the effectiveness and feasibility of the method can be tested. In addition, these samples can be tested together with the test sample as a positive control. For example, HEK293T cells cultured on coverslips can be transfected with plasmids and then FISH performed. Transfection may be with Lipofectamine3000 or Calcium Phosphate transfection methods (e.g., Calcium Phosphate Cell transfection kit (Calcilum Phosphate Cell transfection kit) produced by Byunyun), with intracellular expression of fluorescent protein or other Tag (which can be detected by antibodies) as a marker of successful transfection.

DIG detection in the invention:

DIG can be detected by an automated IHC instrument, such as a BoND MAX automated immunohistochemical staining instrument from Leica, or manually.

The smear was blocked with 2% goat serum (Sigma) or 1% BSA (Sigma) for 20 min. The goat serum preferably adopts serum specially used for immunostaining blocking, and when BSA is used, BSA specially used for immunostaining blocking without IgG and protease should be selected.

Respiratory epithelial cells have a low content of endogenous Peroxidase (HRP), and liver and inflammatory cells may have a high content of HRP. If secondary antibody is linked to HRP, blocking of endogenous peroxidase is required, and the following steps can be performed after treating with PBS containing 0.2% hydrogen peroxide or methanol for 20 minutes and washing with PBS for 2X 5 minutes.

The detection of haptens such as DIG labeled on the probe can be carried out by various methods.

In one embodiment, a rabbit anti-DIG antibody labeled with HRP is added, incubated at room temperature for 1 hour, washed with PBS for 3 × 5 minutes, then developed with 3-amino-9-ethylcarbazole (AEC) substrate, washed with PBS for 2 × 5 minutes, rapidly nuclear stained with hematoxylin, and then liquid-blocked with a water-soluble blocking agent (e.g., permanent immunohistochemical blocking agent VectaMount)^TM). After mounting, the film is examined by a common optical microscope.

In another embodiment, the primary antibody is incubated with polyclonal rabbit anti-DIGIgG antibody for one hour at room temperature, washed with PBS for 3 x 5 minutes, followed by addition of secondary goat anti-rabbit IgG-HRP, incubated for 30 minutes at room temperature, washed with PBS for 3 x 5 minutes, followed by development with AEC substrate. After washing with PBS for 2 × 5 min, rapid nuclear staining was performed with hematoxylin, followed by blocking with water-soluble blocking solution (same as above). After mounting, the film is examined by a common optical microscope.

In another embodiment, the primary antibody is incubated with polyclonal chicken anti-DIG IgY antibody for one hour at room temperature, washed with PBS for 3X 5 minutes and then added with secondary goat anti-chicken IgY-HRP, incubated for 30 minutes at room temperature, washed with PBS for 3X 5 minutes and then developed with AEC substrate. After washing with PBS for 2 × 5 min, rapid nuclear staining was performed with hematoxylin, followed by blocking with water-soluble blocking solution (same as above). After mounting, the film is examined by a common optical microscope.

In another embodiment, the primary antibody is incubated with polyclonal chicken anti-DIG IgY antibody for 1 hour at room temperature, washed with PBS for 3X 5 minutes, then added with secondary goat anti-chicken IgY-DyLight 488 or 550, incubated for 30 minutes at room temperature, washed with PBS for 3X 5 minutes, incubated with 1. mu.g/ml DAPI or Hoechst 33342 for ten minutes, nuclear stained, washed with PBS for 2X 5 minutes, and then mounted with fluorescent staining mounting fluid (DAKO).

In another embodiment, the primary antibody is incubated with polyclonal rabbit anti-DIG IgG antibody for one hour at room temperature, washed with PBS for 3X 5 minutes, then added with secondary goat anti-rabbit IgG-DyLight488 or 550, incubated at room temperature for 30 minutes, washed with PBS for 3X 5 minutes, then incubated with 1. mu.g/ml DAPI or Hoechst 33342 for ten minutes, nuclear stained, washed with PBS for 2X 5 minutes, and then mounted with fluorescent staining mounting solution (DAKO Corp.).

In another embodiment, the primary antibody is incubated with polyclonal rabbit anti-DIG IgG antibody for one hour at room temperature, PBS is washed for 3X 5 minutes, then secondary goat anti-rabbit IgG antibody is added, incubated for half an hour at room temperature, PBS is washed for 2X 5 minutes, tertiary antibody is incubated with rabbit anti-goat IgG antibody for half an hour at room temperature, PBS is washed for 2X 5 minutes, quaternary antibody is incubated with goat anti-rabbit IgG antibody for half an hour at room temperature, quinary antibody is incubated with rabbit anti-goat IgG antibody for half an hour at room temperature, PBS is washed for 2X 5 minutes, hexa antibody is incubated with goat anti-rabbit IgG antibody for half an hour at room temperature, the signal is amplified in cycles, finally anti-goat anti-rabbit IgG-Dylight488 or 550 is added, incubated for half an hour at room temperature, after PBS is washed for 2X 5 minutes, then incubated with 1. mu.g/ml DAPI or hohsett 33342 for ten minutes, nuclear staining is performed, PBS is washed for 2X 5 minutes, mounting with fluorescent staining mounting solution (DAKO). In this embodiment, the smear was blocked only with 1% BSA (Sigma) and not with 2% goat serum.

In another embodiment, detection is performed using quantum dot (QD or QDot) labeled antibodies. The quantum dot is a three-dimensional nanocrystal and has a plurality of excellent optical properties, such as wide excitation wavelength range, narrow and symmetrical emission wavelength range, high quantum yield, long fluorescence lifetime, stable optical properties and the like. The quantum dots can be used as fluorescence to mark different components of biological systems, such as tissues, cells, biological macromolecules and animal living body imaging^26-27Primary antibodies were incubated with polyclonal chicken anti-DIG IgY antibody for one hour at room temperature, washed with PBS for 3 × 5 minutes, then added with secondary goat anti-chicken IgY-Qdot 585, incubated for 30 minutes at room temperature, washed with PBS for 3 × 5 minutes, incubated with 1 μ g/ml DAPI or Hoechst 33342 for ten minutes, nuclear stained, washed with PBS for 2 × 5 minutes, and then mounted with fluorescent staining mounting solution (DAKO).

In another embodiment, the primary antibody is incubated with polyclonal rabbit anti-DIG IgG antibody for one hour at room temperature, washed with PBS for 3X 5 minutes, then added with secondary antibody goat anti-rabbit IgG-Qdot 585, incubated for 30 minutes at room temperature, washed with PBS for 3X 5 minutes, incubated with 1. mu.g/ml DAPI or Hoechst 33342 for ten minutes, subjected to nuclear staining, washed with PBS for 2X 5 minutes, and then mounted with fluorescent staining mounting solution (DAKO).

In another method, the primary antibody is incubated with polyclonal chicken anti-DIG IgY antibody for one hour at room temperature, washed with PBS for 3 × minutes, then added with secondary goat anti-chicken IgY-HRP, incubated for 30 minutes at room temperature, washed with PBS for 3 × minutes, developed with a Tyramide Signal Amplification method (e.g., Tyramide Signal Amplification-Alexa 488 or Tyramide Signal Amplification with SuperBoost kit; Thermo Fisher or Invitrogen), and the specific development time is controlled by microscopic observation during development, after development is complete, washed with PBS for 3 × minutes, incubated with 1. mu.g/ml DAPI or Hoechst 33342 minutes, nuclear staining is performed, after washing for 2 × minutes, coverslipping with fluorescent staining coverslipping solution (InvDAKO Co.) where the sensitivity of the Superitrogen kit is 10-fold that of the standard ICC/IHC/ISH, and the sensitivity of the SuperBoost kit is 200-fold higher than that of the standard ICC/IHC/ISH/200-fold methodDesign for amplifying detection signal required by high-resolution imaging of low-abundance target^28-29. Combining the brightness of Invitrogen Alexa Fluor dye with the trustworthy poly-HRP mediated tyramide signal amplification, the sensitivity of SuperBoost reagents is typically 2 to 10 times higher than standard reagents (including TSA reagents; Perkinelmer). For imaging requiring sharpness and high resolution, images of high signal intensity and low background can be obtained using the SuperBoost signal amplification kit.

In another embodiment, the primary antibody is incubated with polyclonal rabbit anti-DIG IgG antibody at room temperature for one hour, PBS washed for 3X 5 minutes, then added with secondary goat anti-rabbit IgG-HRP, incubated at room temperature for 30 minutes, PBS washed for 3X 5 minutes, and developed using a Tyramide Signal Amplification method (e.g., Tyramide Signal Amplification-Alexa 488 or Tyramide Signal Amplification with SuperBoost Kits; Thermo Fisher or Invitrogen), with the specific development time being controlled by microscopic observation during development, after development is complete, PBS washed for 3X 5 minutes, then incubated with 1. mu.g/ml DAPI or Hoechst 33342 for ten minutes for nuclear staining, and after washing for 2X 5 minutes, coverslipped with fluorescent staining mounting fluid (DAKO).

In another embodiment, the probe is labeled with biotin. After hybridization, streptavidin (streptavidin) labeled with Qdot 585 was incubated at room temperature for half an hour, washed with PBS for 2X 5 minutes, then incubated with 1. mu.g/ml DAPI or Hoechst 33342 for ten minutes for nuclear staining, washed with PBS for 2X 5 minutes, and then mounted with fluorescent staining mounting solution (DAKO).

In the various embodiments above, secondary antibodies (e.g., goat anti-chicken IgY and goat anti-rabbit IgG antibodies) may be used in their F (ab')2 fragments (rather than whole antibody molecules) to reduce background (e.g., to avoid non-specific binding of the antibody Fc fragment to some cell surface Fc receptors). In addition, the secondary antibody can be used after being pre-incubated with human serum (1: 1000) for 15 minutes before being added, so that the potential non-specific binding of the secondary antibody and human cells can be reduced, and the aims of reducing background and enhancing signal-to-noise ratio are fulfilled.

Microscopic examination in the invention is as follows:

developed with AEC substrate and examined microscopically with a conventional optical microscope. Developed with a fluorescent substrate, examined with a fluorescence microscope or a laser confocal microscope, or examined with methods such as high resolution variant stimulated emission depletion (STED) fluorescence microscopy, light activated localization microscopy (PALM), Zeiss Airyscan, etc. Nuclear staining can be used to identify cells in a sample, particularly when the sample is low in cells (e.g., pharyngeal swabs or saliva).

Compared with the automatic judgment result of RT-PCR, the RNAFISH generally adopts a manual judgment result, and is simple and convenient. Artificial intelligence techniques can also be used to identify diagnostic test results, such as Aperio VERSA Brightfield, Fluorescence & FISH Digital Pathology Scanner, Meta system FISH spot counting, or the Digital Pathology image analysis platform HALO.

The image analysis may be performed by different software, for example the freely sharing software ImageJ²⁰. The spot fluorescence (both intracellular and extracellular) in the smear can be counted to determine the number of virus particles, for example, the AnalyzePartics function in the Analyze Menu can be used to determine the number of viruses, or the FindFoci ImageJ Plugin can be used to count the viruses.

Alternatively, the fluorescence intensity in the smear can be measured, and the RNA of the virus can be semi-quantitated and compared to the fluorescence intensity of a reference virus or plasmid to semi-quantitate the RNA. See the examples for specific operations.

The three-dimensional image is taken by the optical sectioning function of laser confocal microscopes and other high-resolution microscopes, which allows for better localization of the virus. Viral RNA or viruses are more diagnostic located within cells (e.g., airway epithelial cells). Since they cannot be present inside the cells even if the specimen is contaminated with few viruses. Counting of viral RNA particles in cells can be performed using some software. For example, the virus may be quantified using the FindFoci ImageJ Plugin, Imaris Spot or FISH-Quant.

Procedure using findfici ImageJ plug:

downloading and installing ImageJ (https:// ImageJ. nih. gov/ij/download. html or https:// ImageJ. net/Fiji/Downloads);

installing and opening a FindFoci GUI; the instructions are as follows: plugin- > GDSC- > FindFoci- > FindFocusGUI;

opening a picture to be analyzed and decomposing the picture into different color channels; the instructions are as follows: image — > Color — > split channels;

selecting smFISH on the FindFocusGUI;

adjusting Background parameters by adjusting Background param until the fluorescent signals are on the mark points, namely all spot-like fluorescence is segmented and identified;

the number and characteristics of the spotted fluorescence light can be displayed in a measurement table, and the result can be output as a text file.

Procedure using FISH-Quant:

storing the picture to be analyzed into a single-color picture according to different color channels;

opening FISH-Quant in Metlab;

data is loaded according to the steps of the FISHQurant manual, images are filtered, and threshold parameters are set for the images. Adjusting the threshold parameters until each blob is marked in the GUI tool; signal intensity profiles typically show a clear separation between background and real signal;

the results may be output as a text file to determine the virus particle number or the number of transcribed copies.

Procedure using Imaris Spot:

installing Imaris;

opening a picture in Imaris;

selecting a Spots tool;

providing an estimate of the spot size (e.g., 300 nanometers);

the blob quality threshold tool is slid until all blobs are accurately identified. Signal intensity profiles typically show a clear separation between background and real signal;

the results may be output as a text file to determine the virus particle number or the number of transcribed copies.

Report form of virus detection:

negative positive (qualitative);

negative ++++ (semi-quantitative);

RNA fluorescence quantification (semi-quantification);

viral particle count (quantification).

The high-sensitivity single-molecule RNA virus detection method based on RNA fluorescence in situ hybridization has the following beneficial effects:

(1) the present invention provides an ultrasensitive detection of RNA viruses which allows the detection of viral RNA and fragments thereof in any sample in as small an amount as possible, and thus allows detection even in any sample, particularly for non-culturable viruses, and with a greatly improved accuracy of the detection of viruses, which can be up to 90% or more by the detection method of the present invention, such as for example, for the New crown Virus (SARS-CoV-2).

(2) The present invention provides for the ultrasensitive detection of RNA viruses, which allows for the detection of any clinically staged and typed patient or animal sample. For example, for new coronary pneumonia (COVID-19), asymptomatic patients, clinically diagnosed patients, mild, normal, severe, and critically ill patients can be detected, and the virus can be detected immediately before the appearance of IgM/IgM antibodies or after the infection, and can effectively guide isolation and prevent the spread of the virus.

(3) The virus smear (extracellular detection) in the invention may have a background problem, which can be minimized by the method of the invention, and the image analysis and artificial intelligence can identify the background and signal.

(4) The method has the great advantages that the single molecule/single virus detection in the cells avoids the problem of false positive, namely pollution, possibly existing in nucleic acid amplification.

(5) The present invention is intended to use the results in clinical diagnostics, biomedical research and environmental testing, applicable to clinical (including pharyngeal swabs, nasal swabs, tissues (biopsies or autopsies), body fluids, stool, alveolar/bronchial lavage) and environmental samples (e.g., food, water supplies and soil).

Detailed Description

The invention will be further illustrated with reference to the following examples:

example 1: HEK293T cell culture and plasmid transfection assay;

a12 mm diameter coverslip was rinsed by soaking in 1N nitric acid as described above and then coated with 0.01% polylysine (PDL; Sigma). HEK293T cells were seeded on cover slips and plated in 24-well cell culture plates at 37 ℃ in 5% CO₂And (5) carrying out sterile constant-temperature culture. The medium was MEM medium (GIBCO) plus 10% bovine serum (FBS) and antibiotics (penicillin and streptomycin, GIBCO).

The plasmid was SARS-CoV-2 (2019-nCoV) Nuclear Gene ORF cDNA clone plasmid, C-OFPSpark tag (Codon Optimized; Sino Biological); wherein OFPSpark is a red (orange) fluorescent protein derived from DsRed (maximum excitation/emission wavelengths 549 and 566nm, respectively). The protein is expressed in cells and serves as a marker for successful transfection.

First, PCR primers are designed for the nucleoprotein fragment of the plasmid by using Primer-Blast, and the length of the PCR product is set to be 50-70 base pairs. A blank plasmid containing no such sequence served as a negative control. Probes of 50-70 base pairs in length can also be designed directly. One advantage of using PCR products is that they are relatively inexpensive compared to direct synthesis of probes 50-70 base pairs in length.

The primer sequences were designed as follows:

after the PCR reaction is completed, the product is purified, for example, by using QIAquick PCR Purification Kit (Qiagen) Purification Kit, labeling the probe with DIG random primer DNA labeling Kit (e.g., digoxin DNA labeling Kit, Sigma), and Illustra Probe Quant^TMG-50 Micro Columns (GE Healthcare) to purify the probe sample.

HEK293T cells cultured on coverslips were transfected with Lipofectamine3000 or Calcium Phosphate transfection (e.g., Calcium Phosphate Cell transfection kit (Calcium Phosphate Cell Transfection kit) produced in Byson clouds). One day after transfection, wash with PBS for 1 × 5 min, and fix with 4% PFA for 10 min at room temperature. PBS wash 2X 5 minutes, cell permeabilization with 0.2% Triton X-100 for 5 minutes, PBS wash 1X 5 minutes.

For each cover slip, 20. mu.l of 80% deionized formamide/1 XSSC containing 1. mu.g salmon sperm single stranded DNA and 1. mu.g yeast tRNA was prepared. The solution was heated on a dry bath at 85 ℃ for 5 minutes and then placed on ice. Then 20. mu.l of hybridization buffer was added to obtain 40. mu.l of prehybridization mixture for prehybridization. After prehybridization in a hybridization oven at 37 ℃ for 1 hour, the prehybridization solution was removed and the hybridization solution containing the probe was added.

For each cover slip, 20. mu.l of 80% formamide/1 XSSC solution containing 50 ng of oligonucleotide probe (5 probes, 10ng each), 1. mu.g of salmon sperm single-stranded DNA and 1. mu.g of yeast tRNA was prepared. Heating the mixture in a dry bath at 85 ℃ for 5 minutes; left on ice for 5 minutes. After the suspension was cooled, 20. mu.l of hybridization buffer was added to each cover slip to generate 40. mu.l of probe hybridization solution.

After hybridization at 37 ℃ for 4 hours in a hybridization oven, the cells were rinsed with 40% formamide/1 XSSC for 30 minutes at 37 ℃ (with gentle shaking on an orbital shaker), and rinsed with 1XSSC37 ℃ for 2X 10 minutes (with gentle shaking on an orbital shaker). Then washed in 1 × PBS for 10 minutes.

The smear was blocked with 2% goat serum or 1% BSA for 20 min. Primary antibody was incubated with polyclonal chicken anti-DIG IgY antibody for 1 hour at room temperature, washed with PBS for 3X 5 minutes, then added with secondary antibody-goat anti-chicken IgY-DyLight 488, incubated for 30 minutes at room temperature, washed with PBS for 2X 5 minutes, then incubated with 1. mu.g/ml DAPI or Hoechst 33342 for ten minutes for nuclear staining, washed with PBS for 2X 5 minutes, and then mounted with fluorescent staining mounting solution (DAKO).

The microscopic examination can adopt a common fluorescence microscope or a laser confocal microscope, and the excitation light wavelength is 364 nanometers (nuclear staining), 488 nanometers (FISH) and 546 nanometers (OFP fluorescent protein).

Example 2: SARS-CoV-2 nasopharyngeal/oropharyngeal swab detection one

Nasopharyngeal/oropharyngeal swabs were collected with a dedicated virus sampling tube according to clinical requirements, smeared and fixed with 4% PFA for 10 min. The swab may also be shaken to elute the cells into buffer, then a smear made with Thin Prep, fixed with 4% PFA for 10 minutes after smear. Then washed with PBS for 2X 5 minutes, followed by permeabilization with 0.2% Triton X-100 for 5 minutes, followed by washing with PBS for 1X 5 minutes.

For each coverslip (or 1cm on a microscope slide)²Smear area of (d), the same below), 40. mu.l of either prehybridization solution or hybridization solution was used.

For each cover slip, 20. mu.l of 80% deionized formamide/1 XSSC containing 1. mu.g salmon sperm single-stranded DNA and 1. mu.g yeast tRNA, respectively, was prepared. The solution was heated on a dry bath at 85 ℃ for 5 minutes and then placed on ice. Then 20. mu.l of hybridization buffer was added to obtain 40. mu.l of prehybridization mixture for prehybridization. After prehybridization in a hybridization oven at 37 ℃ for 1 hour, the prehybridization solution was removed and the hybridization solution containing the probe was added.

For each cover slip, 20. mu.l of 80% formamide/1 XSSC solution containing 50 ng of oligonucleotide probes (5 probes, 10ng each), 1. mu.g of salmon sperm single-stranded DNA and 1. mu.g of yeast tRNA was prepared. Heating the mixture in a dry bath at 85 ℃ for 5 minutes; left on ice for 5 minutes. After the suspension was cooled, 20. mu.l of hybridization buffer was added to each cover slip to generate 40. mu.l of probe hybridization solution.

The sequences of the five probes are as follows:

GTTTCAAGCTTTTTGGAAATGAAGAGTGAAAAGCAAGTTGAACAAAAGAT (ORF1a)
	AAACTTCATGGCAGACGGGCGATTTTGTTAAAGCCACTTGCGAATTTTGT (ORF1a)
GCGTGAGCTTAACGGAGGGGCATACACTCGCTATGTCGATAACAACTTCT (ORF1a)
	CTGCTCGCATAGTGTATACAGCTTGCTCTCATGCCGCTGTTGATGCACTA (ORF1b)
TGTGTTCTCTTATGTTGGTTGCCATAACAAGTGTGCCTATTGGGTTCCAC (ORF1a)

the virus is replicating as evidenced by the detection of negative RNA (intermediate RNA) that can be detected using an antisense probe. The sequences of five antisense probes are as follows:

CAAAGTTCGAAAAACCTTTACTTCTCACTTTTCGTTCAACTTGTTTTCTA(ORF1a)
	TTTGAAGTACCGTCTGCCCGCTAAAACAATTTCGGTGAACGCTTAAAACA(ORF1a)
CGCACTCGAATTGCCTCCCCGTATGTGAGCGATACAGCTATTGTTGAAGA(ORF1a)
	GACGAGCGTATCACATATGTCGAACGAGAGTACGGCGACAACTACGTGAT(ORF1b)
ACACAAGAGAATACAACCAACGGTATTGTTCACACGGATAACCCAAGGTG(ORF1a)

after probe synthesis, the probes are labeled with DIG random primer DNA labeling (e.g., digoxigenin DNA labeling kit, Sigma).

After hybridization at 37 ℃ for 3-4 hours in a hybridization oven, the cells were rinsed with 40% formamide/1 XSSC for 30 minutes at 37 ℃ (gentle shaking on an orbital shaker) and rinsed with 1XSSC37 ℃ for 2X 10 minutes (gentle shaking on an orbital shaker). Then washed in 1 × PBS for 10 minutes.

The smear was blocked with 2% goat serum or 1% BSA for 20 min. Primary antibodies were incubated with polyclonal chicken anti-DIG IgY antibody for 1 hour at room temperature, washed with PBS for 3X 5 minutes, then added with secondary antibody-goat anti-chicken Ig-DyLight 488 or 550, incubated for 30 minutes at room temperature, washed with PBS for 2X 5 minutes, then incubated with 1. mu.g/ml DAPI or Hoechst 33342 for ten minutes for nuclear staining, washed with PBS for 2X 5 minutes, and then mounted with fluorescent staining mounting solution (DAKO).

The microscopic examination can adopt a common fluorescence microscope or a laser confocal microscope, and the excitation light wavelength is 364 nanometers (nuclear staining) and 488 nanometers/546 nanometers (FISH).

Example 3: SARS-CoV-2 nasopharyngeal/oropharyngeal swab detection two

Sample collection, processing and hybridization were as in example 2.

The treatment was carried out for 20 minutes with PBS containing 0.2% hydrogen peroxide, and the following steps were carried out after washing for 2X 5 minutes with PBS.

The smear was blocked with 2% goat serum or 1% BSA for 20 min. Primary antibodies were incubated with polyclonal rabbit anti-DIG IgG antibody for one hour at room temperature, washed with PBS for 3 × 5 minutes, and then secondary antibodies goat anti-rabbit IgG-HRP were added, incubated for 30 minutes at room temperature, washed with PBS for 3 × 5 minutes, and then developed with AEC substrate. After washing for 2X 5 minutes in PBS, rapid nuclear staining was performed with hematoxylin, followed by blocking with water-soluble blocking solution (e.g., permanent immunohistochemical blocking vector VectaMount;). The images can be photographed and analyzed by common optical microscopy or by come Aperio VERSA.

Example 4: SARS-CoV-2 nasopharyngeal/oropharyngeal swab detection three

Sample collection, processing and hybridization were as in example 2.

The treatment was carried out for 20 minutes with PBS containing 0.2% hydrogen peroxide, and the following steps were carried out after washing for 2X 5 minutes with PBS.

The smear was blocked with 2% goat serum or 1% BSA for 20 min. Primary antibodies are incubated with polyclonal chicken anti-DIG IgY antibody at room temperature for one hour, washed with PBS for 3X 5 minutes, then added with secondary antibody goat anti-chicken IgY-HRP, incubated at room temperature for 30 minutes, washed with PBS for 3X 5 minutes, and developed with a Tyramide Signal Amplification method (e.g., Tyramide Signal Amplification-Alexa 488 or Tyramide Signal Amplification with SuperBoost kit; Thermo Fisher or Invitrogen), with the specific development time being controlled by microscopic observation during development, after development is complete, after washing with PBS for 3X 5 minutes, then incubated with 1. mu.g/ml DAPI or hoechs 33342 for ten minutes for nuclear staining, after washing with PBS for 2X 5 minutes, and mounted with fluorescent mounting solution (DAKO Corp.) after mounting.

The microscopic examination can adopt a common fluorescence microscope or a laser confocal microscope, and the excitation light wavelength is 364 nanometers (nuclear staining) and 488 nanometers (FISH) respectively. Detection was performed with 60 × (dry or oil) or 100 × (oil).

Example 5: SARS-CoV-2 nasopharyngeal/oropharyngeal swab detection 4-quantum dot detection

Sample collection, processing and hybridization were as in example 2.

The smear was blocked with 2% goat serum or 1% BSA for 20 min. Primary antibody was incubated with polyclonal rabbit anti-DIG IgG antibody for one hour at room temperature, washed with PBS for 3 × 5 minutes, added with secondary antibody goat anti-rabbit IgG-Qdot 585, incubated for 30 minutes at room temperature, washed with PBS for 3 × 5 minutes, incubated with 1 μ g/ml DAPI or Hoechst 33342 for ten minutes for nuclear staining, washed with PBS for 2 × 5 minutes, and mounted with fluorescent staining mounting solution (DAKO).

The microscopic examination can adopt a common fluorescence microscope or a laser confocal microscope, and the excitation light wavelength is 364 nanometers (nuclear staining) and 594 nanometers (FISH).

Detection was performed with 60 × (dry or oil) or 100 × (oil).

Example 6: SARS-CoV-2 nasopharyngeal/oropharyngeal swab detecting 5-quick detecting method

Sample collection, processing and prehybridization were as in example 2.

Wherein the sequence of the probe is as follows:

TGGATGTAATTATCTTGGCA
	CCACGCGAACAAATAGATGG
CGCTGAGATTCCTAAAGAGG
	CTTCATGGCAGACGGGCGAT
CTGTGGCCCTGATGGCTACC
	CTGCTCGCATAGTGTATACA
GCTCTCATGCCGCTGTTGAT
	GGTTGCCATAACAAGTGTGC
CCACGTGCTAGCGCTAACAT
	GACACTAAGAGGGGTGTATA

wherein the sequence of the antisense probe is as follows:

ACCTACATTAATAGAACCGT
	GGTGCGCTTGTTTATCTACC
GCGACTCTAAGGATTTCTCC
	GAAGTACCGTCTGCCCGCTA
GACACCGGGACTACCGATGG
	GACGAGCGTATCACATATGT
CGAGAGTACGGCGACAACTA
	CGAACGGTATTGTTCACACG
GGTGCACGATCGCGATTGTA
	CTGTGATTCTCCCCACATAT

using a DNA synthesizer (e.g., Dr Oligo)^TM192, Biolytic Lab Performance) with a probe length of 20 nucleotides, which reduces the reaction time for hybridization. The probe is synthesized by adding Amine-modified nucleotides and Labeling the probe with a probe Labeling Kit (e.g., Alexa Fluor 488 Oligonucleotide Amine Labeling Kit (Thermo Fisher)) after synthesis.

In this case, the concentration of the probe can be increased to 200ng (in 40 μ l)/cover glass/cm²(10 probes, 20ng each.) the mixture was heated in a dry bath at 85 ℃ for 5 minutes, placed on ice for 5 minutes, after the suspension was cooled, 20. mu.l of hybridization buffer was added to each coverslip to produce 40. mu.l of probe hybridization solution, the hybridization oven was incubated for half an hour, rinsed with 40% formamide/1 XSSC for 30 minutes at 37 ℃ (gentle shaking on an orbital shaker), rinsed with 1XSSC37 ℃ for 2 × 10 minutes (gentle shaking on an orbital shaker), then washed in 1 × PBS for 10 minutes, incubated with 1. mu.g/ml DAPI or Hoechst 33342 for ten minutes, nuclear staining was performed, and after washing with PBS for 2 × 5 minutes, slides were blocked with fluorescent staining mounting fluid (DAKO).

The microscopic examination can adopt a common fluorescence microscope or a laser confocal microscope, and the excitation light wavelength is 364 nanometers (nuclear staining) and 488 nanometers (FISH). Detection was performed with 60 × (dry or oil) or 100 × (oil).

Example 7: saliva SARS-CoV-2 quantum dot detection

Saliva is collected directly in a sterile container and can be smeared directly. Or the collected saliva was centrifuged and the supernatant smeared and fixed with 4% PFA.

The probe sequence was the same as in example 6 except that the probe was labeled with biotin. Prehybridization and hybridization were the same as in example 6.

Streptavidin (streptavidin) labeled with Qdot 585 was incubated at room temperature for half an hour, washed with PBS for 2X 5 minutes, then incubated with 1. mu.g/ml DAPI or Hoechst 33342 for ten minutes for nuclear staining, washed with PBS for 2X 5 minutes, and then mounted with fluorescent staining mounting solution (DAKO).

The microscopic examination can adopt a common fluorescence microscope or a laser confocal microscope, and the excitation light wavelength is 364 nanometers (nuclear staining) and 585 nanometers (FISH). Detection was performed with 60 × (dry or oil) or 100 × (oil).

The number of viruses in the pictures was quantified by findfici ImageJ plug quantification spots after picture collection.

For example, 100. mu.l of the supernatant is applied, and the smear area is 2cm²。

1 ml sample virus content = (picture 1 virus number + picture 2 virus number + picture 3 virus number + picture 4 virus number)/4/picture area (mum)²）×2×10⁹× dilution/concentration factor.

Example 8: water source hepatitis A Virus detection

The water bodies that can be detected include drinking water, sewage, river/lake/sea water, and the like. After filtering the water with a nylon cell filter having a pore size of 40 μm, the filtrate was concentrated to prepare a smear, which was dried and fixed with 4% PFA. According to the related literature, some water bodies have high virus content (for example, the content of hepatitis A virus in seawater is more than 1000/ml), at this time, 100-.

Firstly, designing PCR primers aiming at hepatitis A virus by using Primer-Blast, and setting the length of a PCR product to be 50-60 base pairs. Primer sequences are shown in the following table:

the PCR reaction is finishedAfter completion, the product is purified using the QIAquick PCR Purification Kit-Qiagen Purification Kit, then labeled with DIG random primer DNA marker (e.g., digoxin DNA marker Kit, Sigma), and labeled with Illustra Probe Quant^TMThe probe sample was purified by G-50 Micro Columns (GE Healthcare).

DIG-labeled probes of 50-70 base pairs in length can also be designed directly.

Hybridization and detection of DIG were then carried out as in example 2.

Spots on the smear were then quantified using TIRF (e.g., Leica), 100 × (oil-mirror) and FindFoci ImageJ Plugin.

For example, 100. mu.l of the supernatant is applied, and the smear area is 2cm²。

1 ml water sample virus content = (picture 1 virus number + picture 2 virus number + picture 3 virus number + picture 4 virus number)/4/picture area (mum)²）×2×10⁹× dilution/concentration factor.

Example 9: detection of hepatitis A virus in shellfish aquatic products

The gill and visceral tissues of shellfish are taken, the Tissue blocks are not larger than 1.5cm × 1.5cm × 0.5cm, and are embedded in OCT embedding medium (such as O.C.T. Compound, Tissue-Tek), and the liquid nitrogen is directly and rapidly frozen or is frozen by isopropyl cooled by liquid nitrogen. And (4) slicing by a freezing slicer, wherein the thickness is 5-20 mu m, placing the slices on a treated cover glass or glass slide, and fixing by 4% PFA after natural drying.

See example 8 for additional hybridization and detection steps. And finally, performing microscopic examination by using a fluorescence microscope or a laser confocal microscope. Detection was performed with 60 × (dry or oil) or 100 × (oil).

Example 10: blood aids virus detection

Blood was collected using a heparin anticoagulant tube, mononuclear cells were obtained from the mononuclear cell layer by Ficoll Histopaque (Sigma) density gradient centrifugation, and after washing the cells by centrifugation with PBS, the cells were resuspended in a small amount of PBS and then smeared. Plasma was additionally smeared. The smear was fixed with 4% PFA. Other body fluids can also be smeared and fixed as described for plasma smear methods.

PCR primers were first designed against the gp160 protein precursor of this virus using Primer-Blast, with the PCR product length set to 50-70 base pairs and avoiding the hypervariable regions V1-V5.

The primer sequences were designed as follows:

after the PCR reaction is complete, the product is purified using the QIAquick PCR Purification Kit-Qiagen Purification Kit, then labeled with DIG random primer DNA marker (e.g., digoxin DNA marker Kit, Sigma), labeled with Illustra Probe Quant^TMThe probe sample was purified by G-50 Micro Columns (GE Healthcare).

DIG-labeled probes of 50-70 base pairs in length can also be designed directly. See examples 2-4 for additional hybridization and detection procedures.

And finally, performing microscopic examination by using a fluorescence microscope or a laser confocal microscope. Detection was performed with 60 × (dry or oil) or 100 × (oil).

This method allows the detection of the HIV virus both intracellularly (e.g., in T cells) and extracellularly (e.g., in plasma). Intracellular and extracellular virus may also be counted.

Example 11: fecal norovirus (e.g., Norwalk viruses, Norviruses from gengroupII) detection

Mixing the stool with proper amount of normal saline, stirring well, filtering twice with 250 micron and 125 micron filter screens, centrifuging the mixture at 1500 rpm/min for 10 min, centrifuging, smearing the cell, fixing with 4% PFA, smearing the supernatant, drying, and fixing with 4% PFA. Distilled water (capable of lysing exfoliated cells in the intestinal tract) 1: stool was diluted 10, centrifuged at high speed, the supernatant smeared, dried and fixed with 4% PFA.

PCR primers were first designed for this virus using Primer-Blast, with the PCR product length set to 50-70 base pairs. The primer sequences were designed as follows:

after the PCR reaction is complete, the product is purified using the QIAquick PCR Purification Kit-Qiagen Purification Kit, then labeled with DIG random primer DNA (e.g., digoxin DNA labeling Kit, Sigma), and labeled with Illustra Probe Quant^TMThe probe sample was purified by G-50 Micro Columns (GE Healthcare).

DIG-labeled probes of 50-70 base pairs in length can also be designed directly. See examples 2-4 for additional hybridization and detection procedures.

And finally, performing microscopic examination by using a fluorescence microscope or a laser confocal microscope. Detection was performed with 60 × (dry or oil) or 100 × (oil).

Example 12: fecal Coxsackie virus assay (hand-foot-and-mouth disease, exemplified by Coxsackievirus A16 strain)

For stool management see example 11.

PCR primers were first designed for Coxsackievirus A16 (Coxsackievirus A16 strain S0195B polyprotein gene, complete cds) with Primer-Blast, and the PCR product length was set to 50-70 base pairs. The primer sequences were designed as follows:

after the PCR reaction is complete, the product is purified using the QIAquick PCR Purification Kit-Qiagen Purification Kit, then labeled with DNA labeling using DIG random primers (e.g., digoxin DNA labeling Kit, Sigma), labeled with Illustra Probe Quant^TMThe probe sample was purified by G-50 Micro Columns (GE Healthcare).

DIG-labeled probes of 50-70 base pairs in length can also be designed directly. See examples 2-4 for additional hybridization and detection procedures.

And finally, performing microscopic examination by using a fluorescence microscope or a laser confocal microscope, and performing detection by using 60 x (dry mirror or oil lens) or 100 x (oil lens).

The present invention has been described in connection with the embodiments, and it is obvious that the implementation of the present invention is not limited by the above-mentioned manner, and it is within the protection scope of the present invention as long as various modifications are made by using the method concept and technical scheme of the present invention, or the concept and technical scheme of the present invention is directly applied to other occasions without modification.

Claims (9)

1. A high-sensitivity single-molecule RNA virus detection method based on RNA fluorescence in situ hybridization comprises the following steps:

step a, processing a sample and making a cytological smear and a viral smear;

b, combining the virus RNA with a digoxin or biotin labeled probe;

step c, binding the labeled probe through the antibody;

d, developing color by using fluorescence or peroxidase substrate;

step e, detecting the smear by using a microscope, and identifying the virus RNA.

2. The RNA fluorescent in situ hybridization-based high-sensitivity single-molecule RNA virus detection method according to claim 1, which is characterized in that: such viruses are identified by identifying the RNA of the RNA virus, which can be identified include viral genomic RNA and its transcription intermediate RNA, and fragments of these RNAs.

3. The method for detecting the high-sensitivity single-molecule RNA virus based on the RNA fluorescent in-situ hybridization according to claim 1 or 2, which is characterized in that:

the virus is novel coronavirus (SARS-CoV-2), SARS virus (SARS-CoV-1), whole influenza virus, rhinovirus, MERS virus, Ebola virus (Ebola virus), AIDS virus (HIV), Hepatitis A Virus (HAV), Hepatitis C Virus (HCV), norovirus, encephalitis B virus, polio virus, Coxsackie virus, dengue virus, rotavirus or Marburg virus, etc.

4. The method for detecting high-sensitivity single-molecule RNA virus based on RNA fluorescent in situ hybridization according to any one of claims 1 to 3, which is characterized in that:

when the RNA virus is SARS-CoV-2, the sequence of the probe comprises:

。

5. the method for detecting high-sensitivity single-molecule RNA virus based on RNA fluorescent in situ hybridization according to any one of claims 1 to 3, which is characterized in that: when the RNA virus is SARS-CoV-2, the detection of negative RNA can prove that the virus is replicating, and the probe is antisense probe, wherein the negative RNA is detected by the antisense probe, and the sequence of the antisense probe is as follows:

。

6. the method for detecting high-sensitivity single-molecule RNA virus based on RNA fluorescent in situ hybridization according to any one of claims 1 to 3, which is characterized in that: when the RNA virus is SARS-CoV-2, the sequence of the probe is:

。

7. the method for detecting high-sensitivity single-molecule RNA virus based on RNA fluorescent in situ hybridization according to any one of claims 1 to 3, which is characterized in that: when the RNA virus is SARS-CoV-2, the detection of negative RNA can prove that the virus is replicating, and the probe is antisense probe, wherein the negative RNA is detected by the antisense probe, and the sequence of the antisense probe is as follows:

。

8. the method for detecting high-sensitivity single-molecule RNA virus based on RNA fluorescent in situ hybridization according to any one of claims 1 to 7, which is characterized in that: the detection is realized by a common microscope and a space-resolved fluorescence microscopy, and the smear can also be detected and processed by an automatic image acquisition and analysis system.

9. The method for detecting high-sensitivity single-molecule RNA virus based on RNA fluorescent in situ hybridization according to any one of claims 1 to 7, which is characterized in that:

the step a comprises positive control of virus detection, which is carried out together with a test sample to ensure that the test is effective;

or/and, the step b comprises a hybridization experiment;

or/and there is DIG detection in said steps c and d.