CN115058426B

CN115058426B - Nucleic acid molecular probe for specifically recognizing SARS-CoV-19, screening method, detection product and application thereof

Info

Publication number: CN115058426B
Application number: CN202210530552.8A
Authority: CN
Inventors: 申志发; 李应福; 吴再生; 刘继成
Original assignee: Shanghai Zhiyao Technology Co ltd
Current assignee: Shanghai Zhiyao Technology Co ltd
Priority date: 2022-05-16
Filing date: 2022-05-16
Publication date: 2024-07-16
Anticipated expiration: 2042-05-16
Also published as: CN115058426A

Abstract

The invention provides a nucleic acid molecular probe for specifically recognizing SARS-CoV-19, a screening method, a detection product and application thereof, and belongs to the technical field of nucleic acid probes. The invention utilizes the exponential enrichment ligand systematic evolution (SELEX) technology to screen and identify the S1 protein of SARS-CoV-19, and obtains the nucleic acid molecular probe A1-3 (Kd=1.05 nM) for identifying the SARS-CoV-19S1 protein with high specificity through multiple rounds of cyclic screening and enrichment from a DNA molecular library by improving screening conditions. The S1 protein can detect the S1 protein existing in saliva, and the detection limit is 120fM. The invention proves that A1-3 has the potential of rapidly diagnosing 2019 coronavirus, improves the sensitivity and the specificity, and has higher market competitiveness.

Description

Nucleic acid molecular probe for specifically recognizing SARS-CoV-19, screening method, detection product and application thereof

Technical Field

The invention belongs to the technical field of nucleic acid probes, and in particular relates to a nucleic acid molecular probe for specifically recognizing SARS-CoV-19, a screening method, a detection product and application thereof.

Background

Although quantitative reverse transcription real-time polymerase chain reaction (qRT-PCR) has been very successful in detecting SARS-CoV-19, the disadvantages of high cost, slow speed, long turnaround time, etc. have prevented it from being used as a tool for home rapid screening. The world is striving to slowly return to normal, and a simpler, faster, more cost-effective large-scale detection is needed to be critical for preventing or controlling new epidemic situations.

The existing ^TM COVID2019 and ErMUP RAPID COVID-19 coronavirus detection kits on the market are detection realized based on virus nucleocapsid protein antigen-antibody reaction in nasopharyngeal swab samples. Although relatively fast and inexpensive, such antigen detection is inherently less sensitive because the viral protein targets cannot be amplified.

In recent years, functional nucleic acids such as an Aptamer (Aptamer) and dnase (DNAzymes) have been used as an effective molecular tool for detecting targets of specific diseases and finding new biomarkers. The nucleic acid aptamer is a single-stranded DNA or RNA with a specific recognition function, which is screened from a random oligonucleotide molecular library by utilizing an exponential enrichment ligand system evolution technology (SYSTEMATIC EVOLUTION OF LIGANDS BY EXPONENTIAL ENRICHMENT, SELEX), and has affinity and specificity comparable to those of a monoclonal antibody. Compared with monoclonal antibodies, the aptamer has the following advantages: can be screened in vitro, has low molecular weight and no immunogenicity or toxicity, can be prepared, reformed and marked by chemical synthesis, has good chemical stability, can be reversibly denatured and renatured, and can be amplified by enzyme, sheared and the like. Nucleic acid aptamer binding target molecules range very widely, including polypeptides, proteins, lipids, sugars, nucleotides and metal ions, and extend from single targets to intact viral particles and cell complex targets. The aptamer can be combined with various medicines and carriers to form a multi-element compound targeting drug delivery system for tumor targeted therapy. Unfortunately, however, there is no report on the detection of SARS-CoV-19 using a nucleic acid aptamer.

Disclosure of Invention

Therefore, the invention aims to provide a nucleic acid molecular probe for specifically recognizing SARS-CoV-19, which has higher efficient specific recognition capability on S1 protein of SARS-CoV-19, and higher detection sensitivity, and provides a new detection tool for rapidly detecting SARS-CoV-19.

The invention provides a nucleic acid molecular probe for specifically recognizing SARS-CoV-19, the nucleotide sequence of the nucleic acid molecular probe is shown as SEQ ID NO. 1.

Preferably, the dissociation constant Kd of the nucleic acid molecular probe and the S1 protein of SARS-CoV-19 is 1.05nM.

The invention provides a SARS-CoV-19 detection kit, comprising the nucleic acid molecular probe and a detection reagent.

Preferably, the detection reagent comprises a nucleic acid molecule probe lysate and/or a sample diluent.

The invention provides a SARS-CoV-19 sensor detection system, which uses the nucleic acid molecular probe as a detection probe.

The invention provides application of the nucleic acid molecular probe in preparing a kit or a sensor detection system for detecting SARS-CoV-19 or SARS-CoV-19 mutant.

The invention provides a screening method of the nucleic acid molecular probe, which comprises the following steps:

1) Connecting a single-stranded DNA random library RFL, a phosphorylated fluorescent substrate FS and a connecting template, and purifying the obtained connecting product to obtain a purified connecting product;

2) Subjecting the purified ligation product to negative screening with Histag, purifying, and collecting ligation product without cleavage;

3) Positively screening the ligation product without cleavage by using S1 protein of SARS-CoV-19, purifying, and collecting the ligation product without cleavage;

4) Carrying out first round PCR amplification and purification on the connecting product which is not subjected to cleavage in the step 3) by using an FP/RP1 primer pair to obtain a first PCR amplification product;

5) Performing a second round of PCR amplification on the first PCR amplification product by using an FP/RP2 primer pair, and purifying to obtain a second PCR amplification product;

6) Replacing the single-stranded DNA random library RFL in the step 1) with the second PCR amplification product, and connecting with a phosphorylated fluorescent substrate FS and a connecting template for the next round of screening; the screening times are 15-17 times.

Preferably, the nucleotide sequence of RFL of the single-stranded DNA random library in the step 1) is shown as SEQ ID NO. 2;

The nucleotide sequence of the phosphorylated fluorescent substrate FS in step 1) is shown in SEQ ID NO. 3.

The nucleotide sequence of the connection template in the step 1) is shown as SEQ ID NO. 4.

Preferably, the nucleotide sequence of the FP primer in the step 4) or the step 5) is shown as SEQ ID NO. 5;

The nucleotide sequence of the RP1 primer in the step 4) is shown as SEQ ID NO. 6;

the nucleotide sequence of the RP2 primer in the step 5) is shown as SEQ ID NO. 7.

Preferably, the initial concentration of S1 protein in step 3) is 100nM, and as the number of screens increases, the concentration of S1 protein decreases to 100pM;

The time of the negative screening in the step 2) or the positive screening in the step 3) is 2 hours, and the time is shortened to 0.5 hours along with the increase of the screening times.

The invention provides a nucleic acid molecular probe for specifically recognizing SARS-CoV-19, the nucleotide sequence of the nucleic acid molecular probe is shown as SEQ ID NO. 1. The nucleic acid molecular probe can recognize the S1 protein of SARS-CoV-19 with high specificity, and the dissociation constant Kd of the nucleic acid molecular probe and the S1 protein of SARS-CoV-19 is 1.05nM. The detection sensitivity of the nucleic acid molecular probe is high, and the detection limit of the nucleic acid molecular probe on S1 protein after saliva dilution is only 120fM. Therefore, the nucleic acid molecular probe provided by the invention has the potential of rapidly diagnosing 2019 coronavirus, improves the sensitivity and the specificity, and obviously improves the diagnostic value.

Drawings

FIG. 1 is a schematic diagram of a screening of nucleic acid molecular probes provided by the present invention;

FIG. 2 is a diagram of PCR amplification electrophoresis, wherein lanes 1 and 2 are the first round of PCR products, and lanes 3 and 4 are the second round of PCR products;

FIG. 3 shows the probe after denaturePAGE electrophoresis purification and S1 interaction;

FIG. 4 is a diagram showing comparison of sequencing results;

FIG. 5 is a graph of the binding capacity of A1-1, A1-2, A1-3, A1-4, A1-5 to S1;

FIG. 6 is a graph showing the relationship between the detection system of fluorescent aptamer probe and the time of action;

FIG. 7 shows the results of the specificity evaluation of specificity A1-3 in a fluorescent aptamer probe detection system;

FIG. 8 is a plot of fluorescence intensity versus concentration for fluorescent aptamer probe detection, where A: fluorescence intensity detected by the action of different concentrations of probe with a fixed amount of S1 (100 nM); b: detecting a fluorescence intensity fitting curve;

fig. 9 shows the effect of saliva on the performance of fluorescent aptamer probe detection systems in normal humans, wherein P <0.05, P <0.01, P <0.001.

Detailed Description

The invention provides a nucleic acid molecule probe A1-3 for specifically recognizing SARS-CoV-19, the nucleotide sequence of the nucleic acid molecule probe is shown as SEQ ID NO. 1 (CGCCTTGCGCCACCTTCCCGGCCCTTACGCATCTTCCAAC). The source of the nucleic acid molecular probes A1-3 is not particularly limited in the present invention, and DNA fragment synthesis methods well known in the art may be employed. In an embodiment of the invention, the nucleic acid molecular probe is commissioned for synthesis by Takara Bio-engineering (Dalian) Inc.

In the present invention, the dissociation constant Kd of the nucleic acid molecular probe A1-3 and the S1 protein of SARS-CoV-19 is preferably 1.05nM. Compared with nucleic acid molecular probes (A1-1, A1-2, A1-4 and A1-5) obtained by screening in the same batch, the nucleic acid molecular probes A1-3 have stronger capability of specifically recognizing S1 protein, and provide a basis for subsequent diagnosis or detection of SARS-CoV-19 virus.

In the present invention, the detection reagent preferably includes a nucleic acid molecule probe solution and/or a sample dilution. The nucleic acid molecule probe lysate is preferably Phosphate Buffer (PBS) comprising 0.1. Mu.M RNase inhibitor. The sample diluent is preferably Phosphate Buffered Saline (PBS).

The invention provides a SARS-CoV-19 sensor detection system, which uses the nucleic acid molecular probe as a detection probe. The present invention is not particularly limited as long as the sensor detection system is employed, and the nucleic acid molecular probe may be used as a detection probe, as is well known in the art.

The invention provides application of the nucleic acid molecular probe in preparing a kit or a sensor detection system for detecting SARS-CoV-19 or SARS-CoV-19 mutant. The SARS-CoV-19 mutant preferably comprises Omicron mutant strain B.1.1.529, alpha mutant strain: b.1.1.7, beta mutant: B.1.351.

The invention provides a screening method of the nucleic acid molecular probe, the detection raw material is shown in figure 1, and the method comprises the following steps:

In the invention, the nucleotide sequence of the RFL of the single-stranded DNA random library is preferably shown as SEQ ID NO. 2; the nucleotide sequence of the phosphorylated fluorescent substrate FS is shown as SEQ ID NO. 3. The nucleotide sequence of the connecting template is shown as SEQ ID NO. 4. The nucleotide sequence of the FP primer is shown as SEQ ID NO. 5; the nucleotide sequence of the RP1 primer is shown as SEQ ID NO. 6; the nucleotide sequence of the RP2 primer is shown as SEQ ID NO. 7.

In the present invention, the initial concentration of S1 protein was 100nM, and as the number of screening increases, the concentration of S1 protein was reduced to 100pM (the final 6-week screening protein concentration was 100 pM). The time of the negative screening or the positive screening is preferably 2 hours, and the time is shortened to 0.5 hours with the increase of the screening times. In the case of the negative or positive screening, the temperature is preferably 20 to 27 ℃, more preferably 25 ℃.

In the present invention, the purification method preferably uses 10% dPAGE purification. The probe is enriched through multiple rounds of in vitro screening, and finally the aptamer with strong specificity and high affinity is obtained, and the fluorescent aptamer probe with RNA shearing function is obtained through connecting a fluorescent substrate, so that the aim of detecting SARS-CoV-19 is fulfilled.

The following examples are presented to provide a nucleic acid molecular probe specifically recognizing SARS-CoV-19, and screening method, detection product and application thereof, but they should not be construed as limiting the scope of the present invention.

Description of Experimental materials

1.SARS-CoV-19Spike protein(S1 Subunit,His tag)

The S1 protein used in the present invention was purchased from SinoBiologi (specification: 100. Mu.g/model: 40591-V08B 1).

2 Nucleotide sequences for experiments

The nucleotide sequences used in the present invention are shown in Table 1, and are synthesized by Takara Bio-engineering (Dalian) Inc., wherein FS and RP2 are purified by High Performance Liquid Chromatography (HPLC) and other sequences are purified by PAGE. The initial library was screened for an overall length of 68nT, with 28nT fixed primer binding regions at both ends, corresponding to complementary primer sequences, and 40nT random regions in the middle.

TABLE 1 nucleotide sequences

Note that: RFL is an initial random DNA library, with fixed primer binding regions at both ends and a random region of 40 bases in the middle

FS is a fluorescent substrate that modifies a fluorescent group and a quenching group that are adjacent to each other when the FS sequence is complete and are non-fluorescent when FS and DL are linked to form a fluorescent aptamer enzyme (RFD) probe that is incubated with S1 protein, and if an aptamer that recognizes S1 protein is present, the probe cleaves the fluorescent group and the quenching group and separates, thereby generating fluorescence.

Front Primer (FP): a front primer for the subsequent two rounds of PCR amplification;

rear primer 1 (RP 1): rear primers for the first round of PCR;

Rear primer (RP 2): the rear primer for the second PCR amplification, RP2 introduces poly A, the molecular weight of the amplified rear chain, namely the non-template chain, can be large, and the template and the non-template can be separated by utilizing the molecular weight difference in the subsequent denaturing acrylamide gel separation process.

And (3) connecting a template: the two ends of the fluorescent substrate are respectively complemented with the connecting places of the FS and the DL, and the fluorescent substrate is used as a template for connecting the fluorescent substrate with the random library, so that the efficiency of connecting the FS and the DL is higher;

aF, r and Q represent respectively a fluorescent group-labeled T base, an adenine ribonucleotide and a quenching group DABCYL-labeled T base.

The main reagents and sources are shown in Table 2.

TABLE 2 description of the sources of the main reagents

4. The main instruments and sources are shown in Table 3.

TABLE 3 description of major instrument sources

3. Preparation of reagents

(1) The formulation of Phosphate Buffered Saline (PBS) is shown in Table 4.

Table 4 phosphate buffer formulations

800Ml of ddH ₂ O is added into a 1L cleaned beaker, the medicines are weighed and placed into the beaker, after the medicines are gently stirred by a clean glass rod until the medicines are fully dissolved, the pH value is regulated to 7.4 by a pH meter, the volume is regulated to 1L, and the medicines are placed into a refrigerator at 4 ℃ for storage for standby after high-pressure sterilization.

(2) Preparing 2.5% agarose gel;

1.5g of agarose powder is weighed and dissolved in 60ml of 0.5 XTBE Buffer, the agarose is heated in a microwave oven for about 1min to completely dissolve, the agarose powder is uniformly shaken after being slightly cooled, the solution is poured into a fixed gel preparation frame and inserted into a comb, the gel is filled after the gel is cooled, and the solidification is accelerated after the gel is cooled because of high concentration. After it is solidified at room temperature, it is stored at 4 deg.C for use, and the agarose gel is preferably prepared for use, and the electrophoresis Buffer is 0.5 XTBE Buffer.

(3) LB culture medium and culture medium are shown in Table 5.

Table 5 LB culture solution formulation

800Ml of ddH ₂ O was added to a 1L-cleaned beaker, and the above-mentioned medicines were weighed and placed in the beaker in this order, and dissolved by stirring thoroughly. Adjusting pH to 7.0 with 5M NaOH, adding ddH ₂ O to 1L, sterilizing at 121deg.C, and packaging in refrigerator at 4deg.C. 15g of agar powder is added into each liter of LB culture solution to obtain a solid LB culture medium.

(4) Preparation of 1M HEPES (pH 7.5);

23.83g of HEPES was dissolved in 60mL of double pure water, the pH was adjusted to 7.5 with 1M NaOH solution, the double pure water was fixed to 100mL, and a 1M stock solution was prepared, and the solution was stored in a refrigerator at 4℃after autoclaving.

(5) Preparation of Tris-HCl

12.11G of Tris was weighed into a 200mL glass beaker, dissolved in 60mL of double pure water with a magnetic stirrer, after sufficient dissolution, pH was adjusted to 7.5 with 1M HCl, the volume was fixed to 100mL with double pure water to prepare 1M Tris-HCl (pH 7.5), transferred into a glass bottle, autoclaved and stored in a refrigerator at 4 ℃.

(6) Preparation of Selection Buffer 2×selection Buffer (2×sb);

100ml of a solution containing 100mM HEPES (pH 7.5), 400mM NaCl, and 10mM divalent metal ion Mg ²⁺ was prepared and autoclaved and stored in a refrigerator at 4 ℃.

(7) Preparing a DNA eluting buffer;

8mL 5M NaCl,2mL 1M Tris-HCl (pH 7.5), 0.4mL of 0.5M EDTA (pH 8.0) was added to the beaker and the final volume was adjusted to 200mL with double deionized water. Sterilizing under high pressure, and storing in a refrigerator at 4deg.C.

(8) Preparing a reaction termination buffer solution;

to a 1.5ml EP tube were added 150. Mu.L of 0.5M EDTA (pH 8.0) and 600. Mu.L of 8M urea, and after mixing, the mixture was stored in a refrigerator at 4 ℃.

(9) The formulation of 5 XTBE running buffer is shown in Table 6.

Table 65 XTBE run buffer formulations

800Ml of ddH ₂ O was added to a 1L clean beaker, the above-mentioned medicines were weighed and placed in the beaker, stirred with a clean glass rod until they were sufficiently dissolved, and the volume was fixed to 1L with ddH ₂ O, and poured into a glass bottle for storage at room temperature. When used, the solution was diluted to 1 XTBE, 0.5 XTBE buffer in ultrapure water by volume.

(10) Preparing 10% (W/V) Ammonium Persulfate (AP);

Weighing 1gAP ml of the solution into a 1.5ml centrifuge tube, adding 1ml of ultrapure water, fully and uniformly mixing, and placing the mixture in a refrigerator at 4 ℃ for standby. The shelf life at 4℃was 2 weeks.

(11) 2X denature gel loading buffer;

8g of sucrose, 10mg of bromophenol blue and 10mg of xylene blue are weighed into a 200ml beaker, 400 mu L of 10% (W/V) SDS and 8ml of 5 XTBE buffer are added, and water is added to fix the volume to 40ml; then adding 44g of urea, heating at constant temperature under the water bath condition of 50 ℃ and stirring by a glass rod to fully dissolve the urea; finally, the materials are sub-packaged in an EP pipe and stored in a refrigerator at 4 ℃ for standby.

(12) Preparing 3M sodium acetate;

40.8g of sodium acetate trihydrate is weighed into a 100ml beaker and 50ml of ultrapure water is added; stirring the glass rod until the solution is fully dissolved, adding glacial acetic acid to adjust the pH of the solution to 5.2, and fixing the volume to 100ml by ddH ₂ O; finally, the mixture is preserved in a refrigerator at room temperature or 4 ℃ for standby after high-temperature high-pressure sterilization.

(13) Preparing SYBR-Green I working solution;

1. Mu.L of SYBR-Green I stock solution (10000X) is added into 999. Mu.L of TE buffer, and after vortex mixing, the mixture is placed in a refrigerator at4 ℃ for storage in a dark place.

(14) Preparing a low molecular weight marker working solution;

8.3 mu L of ultrapure water is taken, 0.5 mu L of low molecular weight marker stock solution is added, 1.2 mu L of SYBR-Green I working solution is added in a dark place, and finally 2 mu L of 6 multiplied by loadingbuffer is added for uniform mixing, so that the product is prepared.

(15) The formulation of 10% denatured polyacrylamide precursor is shown in table 7.

Table 710% modified polyacrylamide precursor formula

900Ml of ddH ₂ O was added to a 1L-cleaned beaker, and the above-mentioned medicine was weighed and placed in the beaker; placing in a magnetic stirrer, stirring at 600rpm and 37 ℃ for about 4 hours to fully mix until no granular solid is visible to the naked eye; adding ultrapure water to fix the volume to 1L; finally, the mixture is evenly mixed and split-packed in a 500ml brown bottle for storage at room temperature for standby.

Example 1

1. Bacterial sample preparation

(1) Selecting bacteria from the freezing tube, coating the bacteria on a culture medium, and culturing the bacteria at 37 ℃ overnight;

(2) Single colonies are picked out to LB tubes for enrichment overnight;

(3) Culturing until OD value is about 1, sucking out and transferring the culture solution into a 15ml sterile centrifuge tube, centrifuging at 4000rpm for 10min, sucking the supernatant into a new centrifuge tube, about 6ml, adding 60 μl PMSF, and gently mixing;

(4) Filtering the mixed solution with 0.22 μm sterilizing filter for 2 times, packaging into 1.5ml EP tube, storing in-80deg.C refrigerator, and storing in-30deg.C refrigerator.

2. Purification of the synthetic sequences

Preparation of 2.110% Density polyacrylamide gel

(1) Taking a thick plate and a thin plate of CBS, two plastic strips with the diameter of 1.0mm and a comb with 12 holes with the diameter of 1.0mm, cleaning the thick plate and the thin plate with clear water, and rinsing the thick plate and the thin plate with ultrapure water for 2-3 times;

(2) Blowing the glass plate by a blower, thoroughly cleaning and airing by absolute ethyl alcohol, and taking care of ensuring that the pouring adhesive surfaces of the thin plate and the thick plate are free of any residues and dust;

(3) Placing two plastic strips in parallel on two outermost sides of a glue pouring surface of a thick plate, covering a thin plate, and clamping and fixing the edges of the two plates and the plastic strips by using a small clamp;

(4) Taking a 50ml beaker, washing with ultrapure water, sequentially adding 35ml of 10% modified polyacrylamide precursor, 350 mu L of 10% APS and 35 mu LTEMED, and rapidly and uniformly stirring with a large gun head until no bubbles are generated;

(5) Immediately after uniform mixing, the notch of the beaker is stuck to a thick plate of the glue filling port, gel is slowly and uniformly filled from the horizontal glue filling port, and the liquid level can be uniformly moved back and forth;

(6) And stopping pouring when the gel is completely poured to the tail end of the glue dispensing plate, vertically inserting the comb into the glue pouring opening, and standing for 12-15min at room temperature to be gelled and fixed.

2.2 Preparation of Denature PAGE electrophoresis samples

(1) Each of the commercially available sequences DL, FS, FP, RP, RP2, LT 2OD was dissolved in 100. Mu.L of double deionized water.

(2) Heating 2X denature gel loading buffer in 45 deg.C metal bath to dissolve completely, wherein the buffer has crystalline solid at room temperature or low temperature, and care is taken to ensure complete dissolution;

(3) Samples were mixed with 2X denature gel loadingbuffer equal volumes 1:1.

2.3Denature PAGE electrophoresis

(1) Removing the clip of the solidified 10% density polyacrylamide gel, cleaning the gel plate with clear water, and pulling out the comb;

(2) The gel plate is vertically fixed on the electrophoresis rack, a metal heat radiation plate is placed on the back surface, and the metal plate is fixed by a large clip;

(3) Respectively adding a proper amount of 1 XTBE buffer into an upper tank and a lower tank of an electrophoresis frame, and carefully flushing each sample adding hole by using a syringe to absorb the 1 XTBE buffer so as to ensure that no residual adhesive tape exists in the sample adding holes;

(4) Switching on a power supply, setting 20mA, and pre-electrophoresis for 10min under the constant current condition;

(5) After the pre-electrophoresis is finished, slowly adding electrophoresis samples by using a 20 mu L micropipette, and adding 60 mu L samples at most into each sample adding hole;

(6) Switching on a power supply, performing electrophoresis for about 90min under the condition of 30mA constant current, and stopping the electrophoresis when bromophenol blue migrates to about 5cm away from the bottom edge of the gel;

(7) The glass plate is peeled off, and the gel is taken out after being wrapped by a preservative film.

2.4Denature PAGE electrophoretic imaging

If the DNA sample does not have the modified fluorescent group, placing the gel on a fluorescent plate, and carrying out short-wave (wavelength 254 nm) irradiation observation by using a handheld ultraviolet lamp, wherein the DNA is gray-black under the short-wave ultraviolet irradiation; if the sample has fluorescent modification, placing the gel in a Bio-rad imaging system, selecting nucleic acid gel, and performing SYBR-Green program, and timely storing an imaging file after imaging.

Clearly aggregated grey strip dark bands are visible on each sample lane under the ultraviolet lamp, which is the position of each sequence after purification. And circling the positions of the sequences by using a marker pen.

2.5Denature PAGE electrophoretic gel recovery

(1) Cutting off gel region marked by marker pen with sterilized aseptic surgical blade, placing into 1.5ml EP tube, grinding gel with large gun head, adding 400 μLDNA eluting buffer solution, 50deg.C, 600rpm, and eluting with shaking for 30min;

(2) The EP tube is put into a centrifuge for balancing, centrifuged at 13000rpm for 5min, and the supernatant is carefully sucked by a middle gun head and put into another new EP tube;

(3) 200 mu L of DNA eluting buffer is continuously added into the EP tube containing the gel, the mixture is centrifuged at 13000rpm for 3min after the mixture is continuously oscillated for 5min, and the supernatant is sucked into the same new EP tube;

(4) The upper mixture in the gel tube was aspirated with a small gun head and centrifuged at 13000rpm for 3min, carefully aspirating the upper supernatant.

2.6 Precipitation and drying after gum recovery

(1) Adding about 50 mu L of 3M sodium acetate and 600 mu L of cold isopropanol into the collected upper pigging, mixing the materials evenly upside down, and placing the materials in a refrigerator at the temperature of minus 30 ℃ for precipitation for more than 30 minutes;

(2) Taking out the centrifuge tube 13000rpm from the refrigerator, centrifuging at 4 ℃ for 10min, sucking and discarding the supernatant, adding 700 mu L of 70% ethanol, washing for 3 times, centrifuging at 13000rpm for 3min each time, sucking and discarding the supernatant, opening the EP tube cover, putting into a vacuum centrifugal concentrator, vacuum centrifuging at 45 ℃ for concentrating and evaporating for 12min, and storing the recovered DNA in the refrigerator at-30 ℃ for later use.

(3) The purified DNA was dissolved in 100. Mu. LDEPC water, and the concentration of the DNA was measured by Danodrop 2000 and stored in a-30℃refrigerator for further use.

3. Fluorescent aptamer probe screening process

3.1 Principle of fluorescent aptamer Probe screening

Screening of aptamer probes by SELEX screening techniques is a technique currently in common use to obtain specific aptamer probes. A single-stranded DNA library was constructed artificially, the middle part of the nucleic acid strand being a random sequence of 40 bases, the 5 'and 3' ends being fixed sequences suitable for the amplification primers. A section of fluorescent substrate is artificially synthesized, wherein the fluorescent substrate contains a T base marked by a fluorescent group, adenine ribonucleotide and a T base marked by a quenching group DABCYL, and the substrate and the library are connected together through a section of connecting template to form RNA-cleaving DNAzyme with an RNA shearing function, so that the fluorescent substrate becomes functional nucleic acid which acts as a fluorescent probe with S1 protein. When the probe is combined with S1protein, a special secondary structure is formed, the special secondary structure has an RNA shearing function, and the adenine ribonucleotide fragment is sheared, and the quenching group leaves the fluorescent group, so that the fluorescent DNAzyme is emitted. As shown in fig. 1, the screening process includes the following stages: (1) Phosphorylating the 5 'end of the fluorogenic substrate FS (Fluorescent substrate), and connecting the phosphorylated fluorogenic substrate FS with the 3' end of the screening library DL (ssDNAlibrary) by using a connecting template LT (Ligase template); (2) Purifying the connected sequences by using a density PAGE electrophoresis, and recovering to obtain a single-stranded probe; (3) negative screening: after the screening probe acts on HIStag, a part of the probes possibly have secondary structure change and then the quenching groups are sheared, a part of the probes are sheared when combined with non-target substances and the quenching groups with secondary structure change are sheared, and the other part of the probes are not combined with the probes and the sequence with self structure change can be screened in the next step; (4) All fragments after the effect were purified by means of density PAGE electrophoresis, and sequences which did not bind to non-target substances nor which were altered in their own structure were recovered as further screened libraries according to the band position selection; (5) positive screening: after the screening probe acts with the S1protein, one part of the quenching groups with the secondary structure changed when the probe is combined with the target substance are sheared to emit fluorescence, and the other part of the quenching groups are not changed in the combination sequence with the target substance; (6) Purifying all fragments after the action by using a density PAGE electrophoresis, and selectively recovering a broken band after being combined with a target substance according to the band position; (7) Performing a first round of amplification on the recovered sequence using primers FP (Forward primer) and RP 1; (8) Performing a second round of amplification by using primers PR (REVERSE PRIMER 1) and RP2 (REVERSE PRIMER 2), wherein the second round of amplification takes the amplified product of the first round as a template, and the primer RP2 is connected with 20 adenine bases on the antisense strand of the screening library sequence; (9) Purifying the amplified products of the second round by using a density PAGE electrophoresis, and selecting the sense strand of the probe as a library for the next round of screening; (10) The recovered sequence is linked to the phosphorylated fluorogenic substrate for the next round of positive selection.

In summary, the probe is enriched through multiple rounds of in vitro screening, and finally the aptamer with strong specificity and high affinity is obtained, and the aptamer is connected with a fluorogenic substrate to become a fluorescent aptamer probe with RNA shearing function, so that the aim of detecting SARS-CoV-19 is fulfilled.

3.2 Fluorescent substrate phosphorylation and ligation to screening library

3.2.1 FS 5' -end phosphorylation

(1) A total volume of 50. Mu.L of a phosphorylation reaction system was prepared according to the measured concentration, and the method was as follows:

Wherein FS was dissolved at a concentration of 100. Mu.M with 1X TEbuffer. PNK enzyme concentration was 10U/. Mu.L and ATP concentration was 10mM.

Mixing at low speed, reacting in metal bath at 37deg.C for 30min, inactivating enzyme in metal bath at 95deg.C for 5min, and standing for 5min to room temperature.

3.2.2 FS and DL connection

(2) A ligation reaction system was prepared in a total volume of 100. Mu.L, and was as follows:

wherein DL and LT were dissolved at 100. Mu.M with 1X TEbuffer, respectively.

Mixing uniformly at a low speed, and then standing at room temperature for reaction for 2 hours. Adding 10 μl of 3M sodium acetate and 300 μl of cold ethanol into the tube, mixing, standing in a refrigerator at-30deg.C for precipitation for more than 30 min; taking out the centrifuge tube from the refrigerator, centrifuging at low temperature of 13000rpm and 4 ℃ for 10min, sucking and discarding the supernatant, adding 700 mu L of 70% ethanol for washing 3 times, centrifuging at 13000rpm for 3min each time, sucking and discarding the supernatant, finally opening the EP tube cover, putting into a vacuum centrifugal concentrator, concentrating and evaporating at 45 ℃ for 12min in vacuum, and fully dissolving the obtained recovered DNA with 20 mu L of DEPC water.

3.3 Purification of ligation products by Density PAGE electrophoresis

The ligation product was purified by DNA denature PAGE gel as described above, the fluorescence signal was observed with a DARK READER fluorescence projector, the DL-FS ligation band should be on top of the uppermost dye (xylene blue) to see a distinct fluorescence band, the position of the DNA band was marked with a clear marker, the gel area marked with the marker was cut off with a sterile surgical blade after sterilization, placed in an EP tube of 1.5ml, the gel was crushed with a large gun, 400. Mu.L of DNA elution buffer was added, 50 ℃,600rpm, shaking elution was performed for 30min, the EP tube was placed in a centrifuge and leveled, centrifuged for 5min at 13000rpm, and the supernatant was carefully aspirated with a medium gun and placed in another new EP tube. 200. Mu.L of DNA elution buffer was continuously added to the gel-containing EP tube, and after 5min of continued shaking, the mixture was centrifuged at 13000rpm for 3min, and the supernatant was aspirated into the same fresh EP tube. The upper mixture in the gel tube was aspirated with a small gun head and centrifuged at 13000rpm for 3min, carefully aspirating the upper supernatant. Adding about 50 mu L of 3M sodium acetate and 600 mu L of cold isopropanol into the collected upper pigtail, mixing the materials evenly upside down, placing the materials in a refrigerator for precipitation for more than 30 minutes at the temperature of minus 30 ℃, taking out a centrifuge tube 13000rpm from the refrigerator, centrifuging at the temperature of 4 ℃ for 10 minutes, absorbing and discarding the supernatant, adding 700 mu L of 70% ethanol for washing 3 times, centrifuging at 13000rpm for 3 minutes each time, absorbing and discarding the supernatant, finally opening an EP tube cover, placing the EP tube cover into a vacuum centrifugal concentrator, and evaporating the EP tube cover to dryness by vacuum centrifugal concentration at the temperature of 45 ℃ to obtain the recovered single-chain DL-FS connecting strip.

3.4 Negative selection of fluorescent aptamer probes

(1) To the recovered dried DNA ligation product tube was added 25. Mu.L of 2 XSB and 100nM HIStag 25. Mu.L, and the mixture was left to stand at room temperature for 2 hours in the absence of light;

(2) Adding 75 mu L of reaction stop buffer to stop the reaction;

(3) Adding 12.5 μl of 3M sodium acetate and 250 μl of cold ethanol, mixing, standing in a refrigerator at-30deg.C for precipitation for more than 30 min; taking out a centrifuge tube 13000rpm from a refrigerator, centrifuging at a low temperature of 4 ℃ for 10min, sucking and discarding the supernatant, adding 700 mu L of 70% ethanol, washing for 3 times, centrifuging at 13000rpm for 3min each time, sucking and discarding the supernatant, opening an EP tube cover, putting into a vacuum centrifugal concentrator, and vacuum-centrifuging at 45 ℃ for concentrating and evaporating for 12min to obtain recovered DNA;

(4) DNAdenature PAGE purification of recovered product, observing fluorescent signal with DARK READER fluorescent projector, DL-FS ligation band should be on top of the uppermost dye (xylene blue), and obvious fluorescent band can be seen, sequence combined with THP-1 cell culture supernatant has RNA cleavage function to break DNA, molecular weight is reduced, but because of small amount, band is not obvious, its band should be under DL-FS ligation band, after labeling the position of DL-FS ligation band with clear marker, cut off adhesive tape and recovered by the previous step, precipitate and dry.

3.5 First round screening and amplification of fluorescent aptamer probes

(1) Adding 25 mu L of 2 XSB and 100nM S1 protein 25 mu L of a DL-FS connection product pipe obtained after negative screening, adding 75 mu L of a reaction termination buffer solution to terminate the reaction after the reaction is carried out at room temperature for 2h and the reaction is carried out at a dark place, adding about 120 mu L of 3M sodium acetate and 300 mu L of cold isopropanol, standing upside down and uniformly mixing, placing in a refrigerator at a temperature of minus 30 ℃ for precipitation for more than 30min, taking out a centrifuge tube 13000rpm from the refrigerator, centrifuging at a low temperature of 4 ℃ for 10min, absorbing and discarding the supernatant, adding 700 mu L of 70% ethanol for 3 times of precipitation, absorbing and discarding the supernatant after each time of washing for 13000rpm for 3min, finally opening an EP pipe cover, placing in a vacuum centrifugal concentrator for 12min, and concentrating and evaporating the obtained product at a temperature of 45 ℃ by vacuum centrifugation;

(2) DNAdenature PAGE purification of recovered product, using DARK READER fluorescence projector to observe fluorescence signal, DL-FS ligation band should be on top of the uppermost dye (xylene blue), visible fluorescence band, sequence combined with K562 cell culture supernatant with RNA cleavage function to break DNA, molecular weight reduction, but because of small amount, the band should be under DL-FS ligation band, therefore selecting DL-FS ligation band lower position with clear marker after cutting off adhesive strip, attention should not cut to ligation band, and recovering and precipitating with sodium acetate, isopropanol, drying according to the previous step, using 10 μL DEPC water to dissolve recovered product as first round amplification template.

(3) And (3) PCR amplification:

① The first round of amplification reaction system is specifically as follows:

Here, FP was dissolved to a concentration of 100. Mu.M with 1X TEbuffer.

PCR reaction conditions: pre-denaturation at 94℃for 1min; denaturation at 94℃for 30sec, annealing at 50℃for 45sec, extension at 72℃for 45sec, 15 cycles; finally, the extension is carried out for 1min at 72 ℃. The final product served as the second round amplification template.

② The second round of amplification reaction system is specifically as follows:

FP and RP2 were dissolved at 100. Mu.M with 1X TEbuffer, respectively.

The above mixture was split into 6 tubes, and 50. Mu.L of each tube was amplified under the same PCR conditions as the first round of amplification. The PCR results were all confirmed by 2.5% agarose gel electrophoresis.

(4) The second round of PCR products were precipitated with sodium acetate and isopropanol and dried, after purification with DNA denature PAGE, two gray black bands were clearly observed by short wave (254 nm wavelength) irradiation with a hand-held UV lamp, the lower bands were marked with markers, the strips were cut off and recovered as described before, precipitated and dried as the library for the next round of screening.

Single stranded DNA library results of PCR amplification screening

After each round of action of the artificially constructed single-stranded DNA library and S1, effective amplification of the screened single-stranded DNA is critical to the screening process, and because the recovery amount of the gel is low, each round of screening needs to carry out two rounds of amplification after purifying the collected single-stranded DNA, the first round of amplification is carried out on the recovered single-stranded DNA, the second round of amplification products are used as templates, 20 adenine bases are connected on an antisense strand so as to facilitate separation of denatured gel, and the sense strand is used as a library for the next round of screening after purification.

The two rounds of PCR products were characterized by 2.5% agarose gel electrophoresis, and the results are shown in FIG. 2, and it can be seen from the graph that the second round of PCR products have a molecular weight of about 20 bases and the positions of the bands are correct compared with the first round of PCR products.

3.6 Multiple rounds of screening of fluorescent aptamer probes

Repeating step 3.5, repeating the screening for several rounds, when the obtained DNA library is acted with SARS-CoV-19S1protein, observing fluorescent signal by using DARKREADER fluorescent projector, RFL-FS connecting band should be on the upper portion of uppermost dye (xylene blue), and can see that the fluorescent signal is obviously weakened, the sequence combined with K562 cell culture supernatant has RNA shearing function to make DNA break, molecular weight is reduced, its band should be under DL-FS connecting band, and undergone the processes of aggregation of several rounds of screening, fluorescent signal is obviously strengthened, screening is stopped, selecting said band, marking with clear marker pen, cutting off adhesive tape, taking attention not to connecting band, recovering and precipitating and drying according to the above-mentioned steps, using 10 mu L DEPC water to dissolve and recover product.

The fluorescent probe which is acted with S1 has RNA shearing function to break the probe, the molecular weight is reduced, the band of the fluorescent probe is at the lower part of the unbroken band, the earlier band is not obvious, and after 15 rounds of cyclic screening processes, the target probe sequence is obviously enhanced after 16 th round of action due to enrichment of a specific probe library (see figure 3), so that a large number of probes are acted with S1, and the fluorescent probe is an aptamer sequence required by an experiment.

4. High throughput sequencing of fluorescent aptamer probes

PCR amplification is carried out on the screened product by using a primer without a mark, and the amplified product is used for high-throughput sequencing, and the sequencing process is completed by Shanghai Peinosen Biotech Co.

The single-stranded DNA screened in round 15 was subjected to PCR amplification with unlabeled primers, and the amplified product was purified and used for high throughput sequencing, which was completed by Shanghai Norsen. The five sequences with the highest occurrence frequencies were selected as alternatives among the sequencing results and named A1-1, A1-2, A1-3, A1-4, A1-5, respectively (see FIG. 4).

Example 2

Detection of SARS-CoV-19S1 protein by fluorescent aptamer probe

(1) Preparation of fluorescent probes: the FS 5' end is phosphorylated, and is connected with the sequence selected after sequencing, and the connection product is purified by DNAdenature PAGE and can be stored in a refrigerator at the temperature of minus 30 ℃ in a dark place.

(2) Interaction with SARS-CoV-19S1 protein: to the resulting ligation product tube, 25. Mu.L of 2 XSB and 100pM of S1 protein were added for 2 hours at room temperature under light-shielding conditions, and then 150. Mu.L of 1 XSB were added and mixed uniformly to be measured.

(3) Fluorescence measurement procedure: firstly, a computer is turned on, and then an F-7OOO fluorescence spectrophotometer is turned on; sample measurement is performed after F7000 is preheated for 15 minutes; and (3) opening control software to set parameters ：Measurementtype：wavelength scan,Scanmode：Emission,EX WL：492.0nm,EM StartWL：500nm,EM EndWL：600nm,Scan speed：240nm/min,Delay：0.0s,EX Slit and EM Slit to 5.0nm, and enabling PMTV oltage to be: 600V, response:0.5s; adding 200 mu L of reaction solution into a fluorescence measurement cuvette, inserting the cuvette into a sample tank, closing a cover, clicking a measurement, and then starting 500-600nm emission wave scanning, and storing experimental results after the scanning is finished; when the next sample is measured, the cuvette is washed three times by ultrapure water and absolute ethyl alcohol respectively, and the next sample is measured after the ethyl alcohol is dried so as to avoid cross contamination.

In order to select the sequence with the highest specificity as an aptamer probe, the five sequences with the head and tail fixed sequences are synthesized again, the phosphorylated fluorogenic substrates are respectively connected, 0.2nmol of each sequence acts with S1, and then the fluorescence intensity of each sequence is detected by a fluorescence spectrophotometer, and as can be seen from FIG. 5, the fluorescence intensity of the sequence A1-3 combined with the sample is obviously higher than that of other sequences, which indicates that the recognition capability of the sequence A1-3 is stronger, and the sequence can be subjected to the next experimental analysis.

Example 3

Selection of fluorescent aptamer probe sequences

(1) The sequence (A1-3) selected after sequencing was synthesized by Shanghai, centrifuged and diluted to 100. Mu. Mol/L with DEPC water.

(2) And 3.2, connecting the phosphorylated FS 5' end with a synthetic sequence, purifying the connected product by DNAdenature PAGE, and storing the connected product in a refrigerator at the temperature of minus 30 ℃ in a dark place.

(3) 0.2Nmol of each probe was dissolved in 25. Mu.L of 2 XSB, reacted with 25. Mu.L of 100pM S1 protein for 2 hours in the dark, and a set of probe detection systems was set as a control.

(4) After adding 150. Mu.L of 1 XSB to each group and mixing uniformly, the fluorescence intensity was measured by an F-7000 fluorescence spectrophotometer.

Example 4

Optimization of time of action of fluorescent aptamer probe

(1) Selecting sequence A1-3, and connecting the phosphorylated FS 5' end with the synthesized sequence in step 3.2, purifying the connection product with DNAdenature PAGE, storing in a refrigerator at-30deg.C in dark place, and storing a large amount for subsequent experiments.

(2) 0.2Nmol of probe was dissolved in 50. Mu.L of 2 XSB, and was shielded from light with 50. Mu.L of cell culture supernatant, and a set of probe detection systems was set as a control.

(3) The fluorescence intensity of the cell culture supernatant was measured with an F-7000 fluorescence spectrophotometer at time points of 0min,20min,40min,60min,80min,100min,120min,140min,160min,180min, etc.

Optimization of time of action of fluorescent aptamer probe

For the action concentration, PCR conditions, action temperature and buffer solution in the detection system, we select according to the reagent instruction and the earlier working basis, but the action time of the fluorescent aptamer probe and S1 needs to be explored. The fluorescence intensity of the fluorescent aptamer probe is selected to be plotted at ten time points of 0min,20min,40min,60min,80min,100min,120min,140min,160min and 180min, meanwhile, a group of blank control is added, as shown in fig. 6, the detected fluorescence intensity is continuously increased along with the time extension, the fluorescence intensity of the experimental group reaches the plateau at about 120min, and the time point is selected as the optimal action time.

Example 5

Evaluation of fluorescent aptamer probe detection System

1 Evaluation of sequence specificity of fluorescent aptamer probes

Fluorescence polarization analysis of the dissociation constant of the RFD probe. All fluorescence polarization experiments were performed in 96-well black plates at 25℃and fluorescence intensities of 520nm were recorded using a multifunctional microplate reader at 470nm for excitation light. And processing the data by adopting a formula I.

Deltar=Bmax [ pro ]/(Kd+ [ pro ]) formula I

Wherein Deltar is polarization change after the RFD probe reacts with S1protein under a certain concentration, kd is dissociation constant, and Bmax is fluorescence polarization change after the RFD probe (A1-3, A1-2) is completely combined with extracellular fluid.

The results are shown in FIG. 7. The specificity A1-3 Kd of the fluorescent aptamer probe detection system is 1.05nM. Whereas A1-3 Kd is 2.25nM. It can be seen that A1-3 has a strong ability to specifically recognize S1 protein.

2 Evaluation of sequence sensitivity of fluorescent aptamer probes

The fluorescence intensity was analyzed by a fluorescence spectrometer with excitation wavelength of 488nM and emission wavelength of 517nM by gradient dilution with 100nM protein concentration. After the completion of the reaction, the reaction mixture was precipitated with ethanol, and the substrates digested with DNA were separated by 10% dPAGE. The sensitivity of the probe is the extracellular fluid concentration at the lowest concentration that initiates the shear reaction.

High sensitivity detection is critical for various practical applications. The fluorescence intensities were detected after 120min of interaction of a fixed amount of S1 with different concentrations (0 nM, 10nM, 25nM, 50nM, 100nM, 200nM, 400nM, 600nM, 700nM, 800 nM) of fluorescent aptamer probe, respectively, as shown in FIG. 8. As can be seen in FIG. 8A, the 120fM probe causes an increase in detectable fluorescence compared to the blank (0 nM target), and the fluorescence signal increases with increasing probe concentration. As shown in FIG. 8B, the linear relationship between the probe concentration and the fluorescence intensity is that the fluorescence intensity of the detection signal is linearly related to the probe concentration in the range of 0.1-1000 nM, the linear regression equation is F=30.35+0.74C, the correlation coefficient R ² =0.9926, F represents the fluorescence intensity at 520nM, and C represents the probe concentration.

Example 6

Human saliva interference experiment of fluorescent aptamer probe detection system

To verify that the probes herein are able to function in subsequent clinical applications, we examined their stability in saliva specimens. S1protein is diluted by saliva of normal people, 6 groups are arranged, the S1protein respectively accounts for 50%, 80%, 90%, 98%, 99% and 99.8% of the total volume, then the S1protein acts with fluorescent aptamer probes, the acting system is 50 mu L, and finally the fluorescence intensity is measured.

To verify whether the screened fluorescent aptamer probe detection system can be practically applied to saliva sample detection, we used normal human saliva interference group for verification. As shown in FIG. 9, after S1 was diluted in saliva of normal people, the fluorescence intensity of each group was detected by using a probe, and it can be seen from the graph that when the saliva content in the system is 99.8%, that is, S1 only accounts for 0.02% of the system (100 fM), the detected fluorescence intensity is still increased compared with that of the blank group, so that the detection system is considered to be directly used for saliva sample detection.

The foregoing is merely a preferred embodiment of the present invention and it should be noted that modifications and adaptations to those skilled in the art may be made without departing from the principles of the present invention, which are intended to be comprehended within the scope of the present invention.

Sequence listing

<110> Shanghai Zhi pharmaceutical science and technology Co., ltd

<120> A nucleic acid molecular probe specifically recognizing SARS-CoV-19, screening method, detection product and application thereof

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 40

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 1

cgccttgcgc caccttcccg gcccttacgc atcttccaac 40

<210> 2

<211> 29

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<220>

<221> misc_feature

<222> (17)..(17)

<223> N=40 bp long random sequence

<400> 2

cacggatcct gacaagncag ctccgtccg 29

<210> 3

<211> 28

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<220>

<221> misc_feature

<222> (13)..(13)

<223> n1=F

<220>

<221> misc_feature

<222> (14)..(14)

<223> n2=rA

<220>

<221> misc_feature

<222> (15)..(15)

<223> n3=Q

<400> 3

actcttccta gcnnnggttc gatcaaga 28

<210> 4

<211> 16

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 4

cacggatcct gacaag 16

<210> 5

<211> 12

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 5

cggacggagc tg 12

<210> 6

<211> 33

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<220>

<221> misc_feature

<222> (21)..(21)

<223> n=S9，a triethylene glycol

<400> 6

aaaaaaaaaa aaaaaaaaaa ncggacggag ctg 33

<210> 7

<211> 23

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 7

ctaggaagag tcggacggag ctg 23

Claims

1. A nucleic acid molecular probe for specifically recognizing SARS-CoV-19 is characterized in that the nucleotide sequence of the nucleic acid molecular probe is shown as SEQ ID NO. 1.

2. The nucleic acid molecular probe for specifically recognizing SARS-CoV-19 as claimed in claim 1, wherein the dissociation constant Kd of the nucleic acid molecular probe and S1 protein of SARS-CoV-19 is 1.05 nM.

3. A SARS-CoV-19 assay kit comprising the nucleic acid molecular probe of claim 1 or 2 and a detection reagent.

4. The test kit according to claim 3, wherein the test reagent comprises a nucleic acid molecule probe solution and/or a sample diluent.

5. A SARS-CoV-19 sensor detection system, characterized in that the nucleic acid molecule probe according to claim 1 or 2 is used as a detection probe.

6. Use of the nucleic acid molecular probe according to claim 1 or 2 for preparing a kit or a sensor detection system for detecting SARS-CoV-19.