RU2052504C1 - Polypeptide, dna fragment hc 256 and strain of bacterium escherichia coli - a producer of polypeptide hc 80 fused with beta-galactosidase of escherichia coli - Google Patents

Abstract

FIELD: biotechnology, immunology. SUBSTANCE: polypeptide HC80 showing properties of hepatitis C virus protein and showing capability to bind antibodies to gene NS4 of hepatitis C virus product. Polypeptide is prepared in the strain of bacterium E. coli transformed with recombinant plasmid pHC 256 containing nucleotide sequence of gene NS3 fragment and fused with beta-galactosidase of E. coli, or in the strain of E. coli transformed with plasmid pHC 256F. EFFECT: popypeptide preparing. 4 cl

Description

 The invention relates to biotechnology, genetic engineering and immunology and can be used for serodiagnosis of hepatitis C.

 Hepatitis C occurs as a result of infection with the hepatitis C virus and differs from other forms of virus-associated liver diseases, including already known hepatitis A, hepatitis B, hepatitis D, as well as hepatitis caused by Epstein-Barr virus or cytomegalovirus. HCV infection is usually carried out with a blood transfusion. HCV infects liver cells when ingested. Clinically, hepatitis C proceeds more easily than hepatitis B. However, it has been shown that in almost fifty percent of patients, the disease takes a chronic course with periodic exacerbation of the process and in twenty percent of chronic patients with hepatitis C, the disease leads to cirrhosis. In addition, there is evidence that hepatitis C virus infection is directly related to the occurrence of primary liver cancer. Therefore, for the implementation of anti-epidemic, preventive measures and the timely detection of HCV infection, the development of diagnostic drugs that can detect infected HCV is extremely important.

 Numerous studies of HCV have made it possible to determine its structure, genome organization, and elucidate the expression mechanism and functions of individual viral proteins. HCV has a positive RNA genome of approximately 9,400 nucleotides. This nucleotide sequence contains a single large open reading frame that spans most of the viral genome and can encode a large virus-specific polypeptide consisting of 3010 3011 amino acid residues, which is the precursor of individual viral structural and non-structural proteins. The precursor protein is processed by cellular and virus-specific proteases. HCV structural proteins include 19 kDa core (nuclear) antigen. Corantigen has the ability to bind RNA and forms a HCV nucleocapsid. Two other structural proteins are glycoproteins of about 32 and 72 kDa in size, which are processed, like the corantigen, from the N-terminal region of the virus-specific polyprotein. A 32 kDa protein is thought to be the matrix or surface protein of the HCV virion, and a 72 kDa protein is either the surface virion protein or the first non-structural HCV protein (NS1). The 23 kDa HCV NS2 protein is associated with the membranes of virus-infected cells, but its functional role is unknown. 60 kD NS3 protein has the nucleotide triphosphate-binding, helicase activity and, apparently, is involved in the replication of the HCV genome; it also has the enzymatic activity of a serine protease, which, apparently, provides the processing of non-structural proteins. NS4 and NS5 gene expression products have not yet been characterized, but it is known that they can encode proteins of 52 and 116 kDa, respectively. Like the NS2 protein, NS4 is very hydrophobic and is probably a membrane-binding protein with unknown function. The product of NS5 gene expression is apparently multifunctional, this protein has, in particular, RNA-dependent RNA polymerase activity, which is used in the replication of the viral genome.

Most diagnostic methods for HCV infection are based on the determination of antibodies to serum HCV proteins (serodiagnosis). For these purposes, various approaches are used that apply the principles of enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), agglutination reaction (latex, red blood cells), immunofluorescence, immunoblotting and radioimmunoprecipitation. One of the most promising ways to improve all these diagnostic test systems is to use recombinant HCV proteins synthesized in various expression systems as an antibody-binding substrate. The use of such recombinant proteins that preserve the antigenic determinants of HCV instead of viral antigens not only increases the specificity and sensitivity of test systems, but also makes them safe to use. There is a significant number of developments aimed at creating recombinant protein products of HCV genes, and, in particular, the HCV NS3 protein gene [1-3]
Currently, a search is underway for the polypeptides that are most promising for the diagnosis, treatment and prevention of hepatitis C. Studies are conducted both in the direction of selecting producer cells [1] and in the direction of choosing the most antigenically active determinants and creating recombinant polypeptides of HCV gene products.

The essence of this invention lies in the fact that the proposed hybrid HC80 polypeptide, consisting of the expression product of a fragment of the HCV genome (80 amino acid residues of the HCV NS3 protein, amino acid residues 1171-1250) free or fused with E.coli beta-galactosidase, binding antibodies to the product HCV NS3 protein gene, different from the known ones:
1) size (polypeptide 33c corresponds to 1192 1457 amino acid residues of the HCV NS3 protein, and p1192 polypeptide corresponds to 1192-1240 amino acid residues of the HCV NS3 protein;
2) the presence of amino acid substitutions (for example, V-1 at 1196th position, SN at 1200th position, ML at 1201th position, etc.).

 The invention also consists in the fact that a DNA fragment is proposed that encodes an HC80 polypeptide and is part of the recombinant plasmid pH256, and a strain of E. coli VKPM transformed with a recombinant plasmid rHC256, including a HC256 DNA fragment, and expresses the HC80 protein.

Strain E. coli protein producer HC80 is characterized by the following features: cells are straight, rod-shaped, motile with peritrichous flagella, gram-negative, non-spore. Cells grow on LB medium and other culture media used to cultivate Escherichia coli and simple culture media containing 10 μg / ml tetracycline and 50 μg / ml ampicillin. When grown on nutrient agar media at ³⁷ ° C colonies smooth cells, round, shiny, pale yellow, clear, smooth edge. When grown on the same medium, but at 30-32 ^{° C} the colonies of cells are "slimy" phenotype characteristic for colonies of cells with lon mutations, growing at lower temperatures. When growing on liquid media, cells form a uniform intense turbidity. Cells grow well at temperatures from 4 to 37 ^about With an optimum pH of 6.8 to 7.5. As a source of nitrogen, cells use both mineral salts in the ammonium and nitrate forms, and organic forms in the form of peptone and amino acids. Nitrates are reduced to nitrites. Gelatin is not liquefied. Maltose is not fermented. Urease activity is not formed. Transformation of cells with plasmids with bacteriophage promoters is carried out according to standard methods. The obtained clones of cells with plasmids are grown on LB medium at a temperature of 30-32 ^о С. Preparative fermentation for producing a recombinant protein is carried out at a temperature of 39-42 ^о С. The strain productivity when using plasmid expression vectors with lambda bacteriophage promoters is about 500 μg of recombinant protein per 1 ml of cell suspension at a culture density of 1 x 10 cells / ml. The protein is stable at ⁴ ° C for 3-4 months.

 The recombinant HC80 polypeptide isolated and purified from the producer strain, immobilized on a solid carrier (polyvinyl chloride or polystyrene tablets, nitrocellulose, nylon, latexes, erythrocytes, etc.) binds antibodies to the products of the HCV protein NS3 in blood serum and other. The strain is deposited in the collection of industrial microorganisms of the Research Institute of Genetics and selection of industrial microorganisms.

 PRI me R 1. Obtaining a DNA fragment of HC256.

To obtain a DNA fragment, oligonucleotides were used:
cr1 5 'GGGGATCCTGCCCCTTCGGGCACGCTGTGGGCATCTTCCGGGCTGCCGTAT 3'
cr2 5 'GCACCCGGGGGGTTGCGAAGGCGGTGGACTTTGTGCCCGTAGAGTCCATGG
AAACTAC 3 '
cr3 5 'TATGCGGTCTCCGGTCTTCACGGACAACTCATCCCCCCCGGCCGTAC 3'
cr4 5 'CGCAGTCATTTCAAGTGGCCCACCTACACGCTCCCACTGGCAGC 3'
cr5 5 'GGCAAGAGTACTAAAGTGCCGGCTGCATATGCAGCCCAAGGGTACAAGCTGCAGGG 3'
rc1 5 'ATGCCCACAGCGTGCCCGAAGGGGCAGGATCCCC 3'
rc3 5 'CCGTGAAGACCGGAAGACCGCATAGTAGTTTCCATGGACTCTACGGGCACAAAGTC
CACCGCCTTCGCAACCCCCGGGTGCATACGGCAGCCCGGAAG 3 '
rc3 5 'TGGGCCACTTGAAATGACTGCGGTACGGCCGGGGGGGATGAGTTGT 3
rc4 5 'CCCTGCAGCTTGTACCCTTGGGCTGCATATGCAGCCGGCACTTTAGTAC
TCTTGCCGCTGCCAGTGGGAGCGTGTAGG 3 '
The oligonucleotides cr 1, 2, 3, 4, 5, and rc 1, 2, 3, 4 are mixed and quenched using T4 phage polynucleotide kinase. For this, 50 pmoles of each of the oligonucleotides, 50 μl of ten-fold kinase buffer (0.5 M Tris HCl, pH 7.6, 0.1 M MgCl, 50 mM dithiothreitol, 1 mM spermidine, are added to an 1.5 ml Eppendorf tube) and 1 mM EDTA), 250 pmol (150 mCi) [gamma-P] ATP (specific activity 3000 Ci / mmol), 150 units of polynucleotide kinase activity of T4 and redistilled water to a volume of 500 l and incubated for 30-60 min at 37 ^C. Then the reaction mixture is heated to a temperature of 98 ^about C, cooled to 16 ^about C and crosslinked with DNA ligase. For this, 100 μl of a mixture of kinase-treated oligonucleotides are mixed with 12 μl of ten-fold ligation buffer (0.66 M Tris-Hcl, pH 7.6, 50 mM MgCl, 50 mM dithiothreitol and 10 mM ATP), 8 μl (50 activity units) DNA -ligazy T4 phage and incubated at ⁴ ° C for 5 hours. The reaction mixture was heated to 65 ^{° C} for 15 min to inactivate the enzyme. 10 μl of the solution treated with kinase and ligase oligonucleotides is used for DNA analysis in 12% polyacrylamide gel (after autoradiography, a fragment of about 256 bp is visible). 100 l of a solution obtained DNA fragment was hydrolyzed with restriction enzymes PstI and BamHI in a buffer solution for restriction enzyme (final concentration 20 mM Tris-HCl pH 7.5, 50 mM NaCl, 10 mM MgCl, 1 mM dithiothreitol) for 5 hours at ³⁷ ° C . The enzymes are inactivated by heating at 70 ^C. 10 l of the DNA fragment solution, hydrolyzed with restriction endonucleases and is used for DNA analysis in a 12% polyacrylamide gel (after autoradiography visible fragment of about 256 bp).

 DNA is precipitated with ethyl alcohol and dissolved in 20 μl of distilled water. 10 μl of the restriction endonuclease treated DNA fragment is ligated with the DNA of the vector plasmid pUC18 treated with restriction enzymes BamHI and PstI. The obtained ligase mixture transform cells of E. coli strain DH5alpha by the usual method (Molecular cloning, New Jork, CSHL, 1982). Transformed cells are plated on plates with 1.2% LB agar containing 50 μg / ml ampicillin. The grown colonies are checked for the presence of recombinant plasmids. For this, bacterial cells lyse and secrete plasmid DNA as described (Nature, 1981, 145, 1365). The isolated plasmid DNA is treated with restriction enzymes Bam HI and PstI and the hydrolyzate is examined by electrophoresis on a 12% polyacrylamide gel. The plasmid DNA hydrolyzate from the selected recombinant HCNS3 strain has 2 bands of 2686 and 256 bp DNA on the electrophoregram. which corresponds to the size of the vector and the synthesized DNA fragment of HC256.

Using the Sanger method (PNAS, 1977, 74, 5463), the nucleotide sequence of the HC256 DNA fragment was determined:
GGGGATCCTGCCCCTTCGGGCACGCTGTGGGCATCTTCCGGGCTGCCGCCGTATGCACC
CGGGGGGTTGCGAAGGCGGTGGACTTTGTGCCCGTAGAGTCCATGGAAACTACTAT
GCGGTCTCCGGTCTTCACGGACAACTCATCCCCCCCCGGCCGTACCGCAGTCATTTC
AAGTGGCCCACCTACACGCTCCCACTGGCAGCGGCAAGAGTACTAAAGTGCCGGCT
GCATATGCAGCCCAAGGGTACAAGCTGCAGGG
This HC256 DNA fragment was also obtained by the known method of chain reaction of polymerization using oligonucleotides cr1 and rc4.

 PRI me R 2. Obtaining the plasmid pH256.

 The synthesized HC256 DNA fragment is hydrolyzed with restriction enzymes PstI and BamHI, the DNA is precipitated with ethanol and dissolved in 50 μl of distilled water. 10 μl of the restriction enzyme treated DNA fragment is ligated with the DNA of the vector plasmid pEL5A treated with restriction enzymes PstI and BamHI. The obtained ligase mixture transform cells of E. coli strain PLT90. Transformed cells are plated on plates with 1.2% LB agar containing 50 μg / ml ampicillin. The grown colonies are checked for the presence of recombinant plasmids. For this, bacterial cells are lysed, plasmid DNA is isolated, which is hydrolyzed with restriction enzymes PstI and BamHI.

 The plasmid DNA hydrolyzate from the selected recombinant strain HC86 has 2 DNA bands on the electrophoregram of 6400 and 256 nucleotides in size, which corresponds to the size of the vector and the synthesized DNA fragment of HC256. When determining the nucleotide sequence of plasmid DNA, it was found that the synthesized DNA fragment in plasmid pH256 through the BamHI site is attached to the C-terminal portion of E. coli beta-galactosidase. Thus, the pH256 plasmid encodes a recombinant protein containing the HCV protein NS3 amino acid sequences fused to the E. coli beta-galactosidase sequence.

 Similarly, the plasmid pH256F was obtained in which the HC256 DNA fragment is directly under the control of the bacteriophage promoter croLacZ lambda. This plasmid DNA provides the synthesis of an NS3 HCV protein that is free of the amino acid sequences of E. coli galactosidase run.

PRI me R 3. The strain E. coli HC80 containing the plasmid rNS256, grown in 100 ml of LB medium at 30 ^about With a density of 8x10 cells / ml. Thereafter, the temperature was raised to 39 ^{° C} and cells were grown for an additional 2 hours. Cells were collected by centrifugation at 4000 rev / min for 15 min. Cells are lysed by ultrasound and proteins are isolated according to the method described (EMBO J. 1984, 3, 1429).

The isolated proteins are analyzed in 10% PAG according to the standard Laemmli method (Nature, 227, 680-685, 1970). As markers of molecular masses of proteins, a Pharmacia kit containing molecular weight markers from 10 to 160 kD is used. As a control, a similarly obtained cell lysate of E. coli strain PLT90 containing the vector plasmid pEL5A and not containing the plasmid pHC256 obtained by us is used. A comparative analysis of the protein composition shows that the E. coli strain HC256 containing the plasmid pH256 expresses a hybrid polypeptide with a molecular weight of 120-130 kDa. This polypeptide is called HC80. Amino acid sequence of the hybrid polypeptide (beta-galactosidase sequence not shown), determined on the basis of the nucleotide sequence of the cloned DNA fragment encoding a portion of the NS3 gene is as follows:
CPFGHAVGIFRAAVCTRGVAK AVDFV
PVESMETTMRSPVFTDNSSPP AVPQS
FQVAHLHAPTGSGKSTKVPAA YAAQG
Yk
PRI me R 4. Control of antigenic activity.

Control of antigenic activity of drugs is carried out by immunoblotting. For this, the electrophoresis procedure is carried out (as described in Example 3), then the electrophoretically separated proteins are transferred to the BH85 nitrocellulose membranes using a 24 V, 400 mA electroblotting apparatus for 1 h. Transfer quality is checked by staining the membranes with a 0.2 Ponceau S solution in 3% TCA for 5 min at room temperature. The paint is washed twice for 30 minutes with TBS buffer (0.15 M NaCl, 20 mm Tris-HCl, pH 7.4) with 0.05% Tween-20 at room temperature. The next step is the blocking of nitrocellulose membranes with immobilized proteins with a solution of 5% skimmed milk powder prepared in 0.1 M Na-phosphate buffer, pH 7.4, for 30 min at room temperature. After blocking the membrane for 1 hour at ³⁷ ° C was treated with sera containing antibodies to HCV NS3 protein, a dilution of 1: 100. Then, TBS membranes were washed three times with 0.05% Tween-20 for 30 min at room temperature. Detection of specific antibodies is performed by incubation of the filter with the antispecies peroxidase conjugate at ³⁷ ° C for one hour. Next, repeat the procedure three times washing. The reaction is checked by adding 100 μl of 30% hydrogen peroxide and 50 ml of a solution of 4-chloro-1-naphthol (20 mg in 0.1 M Tris-Hcl, pH 8.0). Analysis shows that the C80 polypeptide binds to antibodies to the HCV NS3 protein.

 Thus, the present invention is a polypeptide having the properties of an HCV NS3 protein, interacting with antibodies to an HCV NS3 protein, allowing the detection of antibodies to HCV.

Claims (3)

1. The polypeptide obtained in the bacterial strain Escherichia coli, transformed with a recombinant plasmid containing a DNA fragment of the nucleotide sequence R and amino acid sequence R ₁ described in the description, where R and R ₁ = 0 or R is the nucleotide sequence encoding betagalactosidase, and R ₁ - amino acid sequence of beta-galactosidase,
capable of binding antibodies to hepatitis C virus NS 3 protein.  2. DNA fragment HC 256 obtained by chemical synthesis or polymerase chain reaction with the nucleotide sequence described in the description.  3. The bacterial strain Escherichia coli VKPM N - B-6255 - producer of the polypeptide HC 80 fused with beta-galactosidase E. coli.