JPH09313188A - Gene of hepatitis g virus - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a novel hepatitis G virus gene which is the genome RNA of hepatitis G virus having a specific base sequence, enables easy detection of hepatitis G virus and is useful in the elucidation on the relation to hepatopathy and as a diagnostic agent and the like. SOLUTION: This gene is a novel genome RNA of hepatitis G virus having the base sequence represented by the formula. A primer is set on the basis of the base sequence of a complementary DNA or a homologous DNA and hepatitis G virus can be readily detected and the relation of the virus to hepatopathy will be elucidated by using the primer. Further, this primer can be used as a diagnostic agent for hepatitis G. This hepatitis G virus gene is obtained by separating the genomic RNA of hepatitis G virus from the serum of a patient complicated with hepatitis non A, non B, and non C and liver cell carcinoma in a usual manner, synthesizing cDNA using the RNA as a template, further preparing a cDNA library and cloning the cDNA library with the PCR technique using a primer specific to the helicase region of the virus genome.

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to hepatitis G virus gene, hepatitis G virus protein, and uses thereof.

[0002]

BACKGROUND OF THE INVENTION Hepatitis G virus (sometimes referred to as GBV virus) is a recently discovered RNA virus of the flavivirus family, and is currently GBV-A and GBV.
The existence of three types of -B and GBV-C has been reported. A
Since there are hepatitises that cannot be explained only by ~ E hepatitis virus, hepatitis G virus has been studied as a cause of non-AE hepatitis.

GBV-A and GBV-B were detected in the sera of tamarin used in infection experiments, but there has been no report of detection of the genome from humans so far.

The detection of the GBV-C genome is carried out by the method of Simons et al. (Nature Medicine 1: 564-569, 199) in the United States.
5) That is, GBV-A, GBV-
Degenerate primer that amplifies a site corresponding to helicase from the serum of an antibody-positive person against B
Polymerase Chain Reaction (PCR)
Detected the human GBV-C genome. However, among the cases detected by them, there are four cases in which chronic hepatitis is clear, and the details of the relationship between this virus and liver damage have not been clarified yet.

Recently, in Japan, Yoshi et al.
It was reported that the GBV-C genome was detected in 3 of the 6 non-A, non-B, non-C fulminant hepatitis patients searched (Lancet 346: 1131-1132, 1995). The relationship with However, this detection is carried out by PCR using primers derived from the helicase region, which is prone to mutation, in the hepatitis G virus genome.
, The base sequence of the helicase region was only determined, and the sequences of other regions have not been elucidated.

In order to detect the hepatitis G virus and further investigate the relationship with the liver damage in Japanese, it is necessary to determine the nucleotide sequence of the hepatitis G virus genome mainly present in Japan and elucidate the structure. Is desired. In addition, in order to detect viruses, it is desired to elucidate not only the sites where mutations are likely to occur, such as the above-mentioned helicase region, but also highly conserved regions with few mutations, such as the 5'terminal untranslated region.

[0007]

As described above, non-A ~
Isolation and identification of hepatitis G virus as a causative virus of hepatitis E is an important issue, and it is particularly desired to study viruses existing in Japan.

Therefore, an object of the present invention is to isolate a hepatitis G virus gene, determine its nucleotide sequence, and utilize this nucleotide sequence to detect a hepatitis G virus in the serum of hepatitis patients. Is to provide. Another object is to provide a hepatitis G virus protein and a method for detecting hepatitis G virus using the hepatitis G virus protein.

[0009]

The present inventors isolated the hepatitis G virus genome from the sera of patients with non-A, non-B, and non-C liver diseases, and isolated its helicase region, 5'end untranslated. The present invention has been completed by determining the base sequences of a part of the region, core-envelope region, and polymerase region.

That is, according to the present invention, SEQ ID NOs: 1, 5 and
Hepatitis G virus genomic RNA having a nucleotide sequence of 9, 13 or 17, DNA complementary to the hepatitis G virus genomic RNA having a nucleotide sequence of SEQ ID NO: 2, 6, 10, 14 or 18, and SEQ ID NO: 3 DNA having a nucleotide sequence of 7, 11, 15 or 19 and being homologous to the hepatitis G virus genomic RNA. In addition, it is a DNA having a nucleotide sequence encoding the amino acid sequence represented by SEQ ID NO: 4, 8, 12 or 16.

Furthermore, according to the present invention, SEQ ID NOs: 4, 8 and
There is also provided a hepatitis G virus protein consisting of a polypeptide containing the amino acid sequence represented by 12 or 16.

The present invention also provides a recombinant DN in which a DNA complementary to the hepatitis G virus genomic RNA is incorporated.
A and a transformant transformed with the recombinant DNA, further culturing the transformant, and separating the hepatitis G virus protein from the resulting culture, hepatitis G It also relates to a method for producing viral proteins.

Furthermore, the present invention detects hepatitis G virus using a primer set based on the nucleotide sequence of DNA complementary to the hepatitis G virus genomic RNA or DNA homologous to RNA. Provide a way.

Further, the present invention is characterized in that hepatitis G virus is detected by an antigen-antibody reaction using at least a part of hepatitis G virus protein as an antigen, or an antigen-antibody reaction using an antibody against the antigen.
It is a method for detecting hepatitis C virus.

Furthermore, the present invention is a diagnostic agent for hepatitis G containing at least a part of the protein or an antibody against the protein as an active ingredient.

Further, the present invention is a hepatitis G vaccine containing at least a part of the above protein as an active ingredient.

Here, "hepatitis G virus genomic RNA
"DNA homologous to" means that in the DNA base sequence, uracil (U) in the corresponding RNA base sequence is
All have the same sequence except that they are replaced with (T).

Hereinafter, the present invention will be described in detail.

Nucleotide sequence of hepatitis G virus genomic RNA
Determination of the first, the present inventors have non A, non-B, non-C hepatitis, targeted cirrhosis, cases that were considered hepatoma, separating the hepatitis G virus genome RNA from patient serum, the nucleotide sequence It was determined. Cases, for HB _S antigen RIA method, HVC antibody is confirming the negative in the second generation antibodies.

Hepatitis G virus genomic RNA was isolated, cloned, and the nucleotide sequence was determined as follows.

The viral genomic RNA extracted by the guanidine method was used to synthesize a single-stranded cDNA (DNA complementary to the hepatitis G virus genomic RNA) using reverse transcriptase and random primers. Lanc
The cDNA was amplified by PCR using degenerate primers as described in et 346: 1131-1132, 1995. This primer has a nucleotide sequence derived from the helicase region of GBV-C reported by Simons et al. Amplified cDNA
The A fragment was detected by agarose electrophoresis and then staining with ethidium bromide. Expected size (expe
DNA fragment having a cted size) and considered to be positive was recovered from an agarose gel and used as a plasmid vector pBluescrip.
It was cloned at t and the nucleotide sequence was determined by the dideoxy method. As described in detail in the Examples below, cloning is performed by digesting the amplified cDNA fragment with a suitable restriction enzyme and introducing it into a plasmid, incorporating it into E. coli, culturing the obtained recombinant, and culturing the cDNA-containing plasmid. Was isolated to clone the hepatitis G virus cDNA.

The result of determining the nucleotide sequence of the cDNA as described above is shown as SEQ ID NO: 2 in the sequence listing.
The sequence of hepatitis G virus genomic RNA was derived from the nucleotide sequence of SEQ ID NO: 2 and is shown as SEQ ID NO: 1. SEQ ID NO: 3 is a DNA homologous to hepatitis G virus genomic RNA
The nucleotide sequence of

These are base sequences corresponding to the helicase region of GBV-C. The homologous DNA of SEQ ID NO: 3
It has 77% homology with GBV-C when compared to the American type prototype reported by Simons et al.

Further, the deduced amino acid sequence encoding the hepatitis G virus protein derived from SEQ ID NO: 2 is shown in SEQ ID NO: 4. Amino acid sequence comparison shows 97% homology.

To determine the nucleotide sequence of the portion other than the helicase region of the hepatitis G virus genome, a gene cDNA is amplified by PCR using a primer considered to be homologous or complementary to a portion of the GB hepatitis virus genome, and the helicase region is amplified. It was carried out by cloning in the same manner as was carried out in. In this way, the base sequence of the following portion was determined. The% in parentheses is the homology when compared to the American prototype GBV-C as above.

Core-Envelope region SEQ ID NO: 5: RNA SEQ ID NO: 6: cDNA SEQ ID NO: 7: Homologous DNA (87%) SEQ ID NO: 8: Amino acid (93%) Part of polymerase region SEQ ID NO: 9: RNA SEQ ID NO: 10 : CDNA SEQ ID NO: 11: Homologous DNA (88%) SEQ ID NO: 12: Amino acid (100%) Part of polymerase region SEQ ID NO: 13: RNA SEQ ID NO: 14: cDNA SEQ ID NO: 15: Homologous DNA (86%) SEQ ID NO: 16: amino acid (93%) 5'terminal untranslated region SEQ ID NO: 17: RNA SEQ ID NO: 18: cDNA SEQ ID NO: 19: homologous DNA (89%) The 5'terminal untranslated region shown in SEQ ID NO: 17 has a mutation. Since it is a small number and highly conserved region, hepatitis G virus can be advantageously detected by using a primer set based on this sequence.

Detection of hepatitis G virus from test sample
Out as described above, it revealed by the present inventors G
Using the base sequence of hepatitis B virus genomic RNA,
The hepatitis G virus can be easily detected from the test sample.

C from patient sera for virus detection
The DNA sample is prepared as follows. That is, about 5 times the amount of guanidine solution was added to a small amount of serum and mixed, and then phenol extraction was performed, and the extracted RNA was precipitated with ethanol. Using the thus obtained viral genomic RNA as a template, cDNA is synthesized using, for example, reverse transcriptase and random primers.
As the reverse transcriptase, MMLV reverse transcriptase, AMV reverse transcriptase, Tth DNA polymerase and the like can be used.

A specific region of the cDNA obtained above is amplified by PCR using a primer based on the nucleotide sequence of the hepatitis G virus genomic RNA of the present invention. Specifically, a DNA complementary to the hepatitis G virus genomic RNA shown in SEQ ID NO: 2, 6, 10, 14 or 18.
Or a DNA homologous to the hepatitis G virus genomic RNA shown in SEQ ID NO: 3, 7, 11, 15 or 19
Detection of hepatitis G virus by amplifying a certain portion specific to hepatitis G virus genomic RNA with a primer set based on the sequence of You can

Depending on how the primers are set, the cDNA
Viruses can be detected or mutations can be examined by checking whether or not a certain portion of A. can be amplified. In addition, the presence or absence of mutation can be checked by examining the pattern of cleavage with a specific restriction enzyme after amplification with appropriate primers.

The primer has an appropriate length, for example, 17
A synthetic DNA having a length of ˜35 bases, which has a sequence homologous to the hepatitis G virus genomic RNA and a complementary sequence, may be used. For example, a primer or the like composed of DNA having the nucleotide sequence represented by SEQ ID NOs: 20 to 29 can be exemplified. Those of SEQ ID NOs: 20-23 used in Example 4 are particularly preferred. These primers may be synthesized using, for example, an automated DNA synthesizer manufactured by Applied Biosystems (ABI).

Amplification of DNA by PCR is carried out according to a conventional method.
Heat denature the DNA, anneal the primer to it,
Next, thermostable polymerase, dNTP (dATP, dGTP, dCT
(P, dTTP) is added to extend the DNA chain. The region of interest can be amplified by repeating the steps of heat denaturation, primer annealing, and DNA chain extension.

The amplified cDNA, or the cDNA fragment amplified and treated with a restriction enzyme as appropriate, is subjected to agarose gel electrophoresis, polyacrylamide gel electrophoresis, etc.
It can be separated and detected by means such as ethidium bromide staining. The position of the band that appears depends on the type of primer used.

As another method, DNA, RNA or synthetic oligonucleotide complementary to viral RNA can be used as a probe, which can be immobilized on a microtiter plate to capture the viral RNA.
That is, the above-mentioned plate is treated with a test serum exposed to viral RNA by treatment with detergent, protease or the like, washed with a buffer, and another DNA, RNA or synthetic oligonucleotide complementary to viral RNA is added. Can be hybridized and detected using means such as signal amplification with branched-chain DNA.

In addition, DN complementary to these viruses
A, RNA, or synthetic oligonucleotides
The amplification product by PCR using viral RNA extracted from liver or its cDNA can be used as a probe for detecting nucleic acid bound to dot blot, Southern blot, Northern blot, or other membranes.

When the cDNA of hepatitis G virus RNA obtained by the above operation is further cloned to determine the base sequence, the method for determining the base sequence described above may be used. That is, DNA amplified by PCR and separated is treated with an appropriate restriction enzyme (eg EcoRI, Bam).
HI, HindIII, etc.) or blunt-ended, and then inserted into a cloning vector cleaved with the same restriction enzyme or blunt-ended, and introduced into a transformable host for transformation, The recombinant DNA of interest can be cloned by tetracycline resistance or ampicillin resistance.

As the vector DNA, a phage vector such as M13 phage vector, a plasmid vector such as pUC18, pUC19, etc. can be used, and E. coli, yeast, etc. can be used as a host.

The nucleotide sequence may be determined from the recombinant DNA thus cloned. That is, among the obtained tetracycline-resistant or ampicillin-resistant transformants, the desired clone is secondarily screened by colony hybridization. The nucleotide sequence of a clone showing a positive result by this colony hybridization can be determined by a usual nucleotide sequencing method, for example, Sanger method, Maxam-Gilbert method, or the like.

Hepatitis G Virus Protein Next, the expression of hepatitis G virus protein will be described. All or part of the gene encoding the hepatitis G virus protein was excised from the obtained clone by the method described in the section for determining the nucleotide sequence, ligated to the downstream of an appropriate promoter, enhancer, etc., and then It is introduced into a suitable host and transformed. LacZ as a promoter,
Ptac, LacI, etc. are mentioned, and as a host, XLI-Blue, TB
1, JM107 and the like.

To obtain the hepatitis G virus protein of the present invention, the transformant may be cultured in a generally used medium and purified by a commonly used method. Examples of the medium include LB medium containing ampicillin, TB
Examples of the medium include 2XYT medium. In order to improve the gene expression efficiently, isopropyl-1-thio-β-D-galactoside (IPTG),
Glucose or the like can also be added.

Culturing is usually carried out at 37 ° C. for 6 to 7 hours, and if necessary, aeration and stirring can be carried out. After culturing, the bacterial cells are collected and suspended in, for example, a buffer solution, and then frozen and thawed,
After boiling treatment and the like, centrifugation is performed to obtain a supernatant.

Separation and purification of the hepatitis G virus protein from the obtained supernatant may be carried out according to commonly known protein purification methods. For example, salting out, centrifugation, various chromatographies, electrophoresis and the like are appropriately combined for purification.

Examples of various chromatographies include gel filtration, ion exchange chromatography, reverse phase chromatography, affinity chromatography and the like. The purity and the approximate molecular weight of the purified product are confirmed by SDS (sodium lauryl sulfate) polyacrylamide gel electrophoresis, Western blotting and the like. Analysis of the amino acid sequence of the purified protein can also be performed by an automated Edman analysis method using a gas phase protein sequencer.

G of the present invention produced by the above method
Hepatitis C virus protein is a diagnostic agent for hepatitis G or G
It can be used as a hepatitis C virus vaccine.
Using the hepatitis G virus protein of the present invention, hepatitis G virus antibodies can be detected as described below.

First, a hepatitis G virus protein was immobilized on a microtiter plate, test serum was added to the solid phase, and the mixture was washed with a buffer solution. The antibody bound to the hepatitis G virus protein was treated with an alkaline phosphite. The antibody can be detected by reacting with an anti-human immunoglobulin (IgG) antibody labeled with zease or pen oxidase, washing with a buffer solution, adding a chromogenic substrate, and detecting the change in absorbance with a densitometer. it can.

Further, the detection of hepatitis G virus antigen using an antibody against hepatitis G virus protein is carried out as follows.

First, two or more kinds of monoclonal antibodies are prepared by immunizing an animal such as a rat with the hepatitis G virus protein. Immobilize one of these antibodies on a microtiter plate, add test serum to it, react with it, wash with a buffer, react the bound viral antigen with another monoclonal antibody, and wash again with a buffer. To do. Anti-rat mouse immunoglobulin
The antibody can be detected by reacting it with (IgG) antibody, washing with a buffer solution, adding a chromogenic substrate, and detecting a change in absorbance with a densitometer.

When the hepatitis G virus protein of the present invention is administered as a hepatitis G vaccine, it is usually administered by injection (subcutaneous or intramuscular). The dose varies depending on whether it is an animal or a human, age, route of administration and frequency of administration, and can be varied over a wide range, but generally 0.01 to 1
μg / kg body weight / day. The hepatitis G vaccine of the present invention is
The hepatitis G virus protein as an active ingredient can be administered as a composition with a suitable diluent and a pharmacologically usable carrier. The administration may be once a day, and may be administered several times within 1 to 6 months.

The hepatitis G vaccine of the present invention also contains additives such as stabilizers, buffers, preservatives, tonicity agents,
It is usually provided in a unit dose ampoule or multi-dose container or tube. The composition may be in powder form for reconstitution with a suitable carrier, eg, pyrogen-free, sterile water, when used.

[0050]

EXAMPLES Hereinafter, the present invention will be described more specifically with reference to examples. However, the present invention is not limited to these examples.

[0051]

Example 1 Separation of Hepatitis G Virus Genome RNA Serum of a patient with hepatocellular carcinoma with non-A, non-B, non-C liver cirrhosis 10
For 0 μL, 4.2M guanidine thiocyanate, 0.1M Tri
42% s-HCl (pH 7.5), 0.5% N-lauryl sarcosyl solution
After adding 5 μL and 4-μL of 2-mercaptoethanol,
Mix by tumbling for minutes.

Thereafter, the mixture was extracted 3 times with a 4: 1 mixed phenol-chloroform solution and once with chloroform to remove proteins, followed by ethanol precipitation. 70 of the precipitate
% And 100% ethanol respectively, and the resulting pellets were used as purified hepatitis G virus genomic RNA.

[0053]

Example 2 Cloning and nucleotide sequence of hepatitis G virus gene
Genomic RNA obtained in the decision (1) Cloning Example 1 of hepatitis G virus gene, 50mM Tris-HCl (pH
8.3), 75 mM KCl, 10 mM DTT, 3 mM MgCl ₂ , 1 mM dNTPs mix (4 types of deoxynucleoside triphosphates consisting of dATP, dCTP, dGTP, dTTP; manufactured by TOYOBO), 60 μg / ml random primer (manufactured by TAKARA), 10U / ml M-MLV reverse transcriptase
Each solution (manufactured by GIBCO BRL) was added to make a total volume of 20 μL. Next, the resulting solution was subjected to reverse transcription reaction at 42 ° C. for 30 minutes to obtain cDNA.

Next, using this cDNA as a template, Yoshiba
Et al., Lancet 346: 1131-1132, 1995, primers specific for the helicase region of the hepatitis G virus genome.
(SEQ ID NOS: 30, 31) were used for amplification by PCR reaction. The reaction is 10 times for 1-5 μL of the above cDNA solution.
mM Tris-HCl (pH8.0), 50 mM KCl, 1.5 mM MgCl ₂ , 0.1% Tr
iton X-100, 0.2 mM dNTP, 4 μg / ml each of sense and antisense primers, and 30 U / ml Taq D
NA polymerase (manufactured by Perkin Elmer Cetus) was added, and the total amount was 25 μL. This sample was cycled at 94 ° C for 4 minutes for 1 cycle, 94 ° C for 30 seconds, 53 ° C for 1 minute and 72 ° C for 1 minute as 40 cycles, and 72 ° C for 7 minutes as 1 cycle.
Cycled.

The PCR product was electrophoresed on a 1-3% agarose gel, the band visualized under ultraviolet light was cut out by staining with ethidium bromide, and the QIAEX gel extraction kit (QIAEX) was used.
GEN) was used to recover the DNA fragment with the expected mobility.

Next, the ends of the DNA are aligned (restriction enzyme Ec
(treated with oRI and BamHI) or inserted into a blunted M13 phage vector to obtain a recombinant plasmid. Escherichia coli JM109 was transformed with this recombinant and cultured for 12 to 16 hours to form plaques, whereby phages incorporating the hepatitis G virus cDNA fragment were obtained.

(2) Determination of nucleotide sequence Escherichia coli JM105 was infected with the phage obtained by the above method,
After sufficiently proliferating, bacterial cells were separated, and phages were recovered using polyethylene glycol. Then, the solution was mixed with phenol and chloroform at a ratio of 4: 1 twice and once with chloroform to extract single-stranded DN of the phage.
A was collected. Using this, the nucleotide sequence of DNA was determined by the dideoxy method of Sangar et al.

The result is shown in SEQ ID NO: 2. SEQ ID NO: 2
The sequence of the hepatitis G virus genomic RNA helicase region of the present invention can be determined from the sequence No. 1, and the result is shown in SEQ ID NO: 1. Further, from SEQ ID NO: 1, the nucleotide sequence of DNA homologous to hepatitis G virus genomic RNA can be determined, and the result is shown in SEQ ID NO: 3. Furthermore,
From SEQ ID NO: 2, the deduced amino acid sequence encoding the hepatitis G virus protein can be determined. in this case,
The portion that is considered to encode the hepatitis G virus protein is the 2nd to 100th nucleotides in the nucleotide sequence of SEQ ID NO: 2.
The amino acid sequence considered to be 99 nucleotide sequences and deduced from the nucleotide sequence is shown in SEQ ID NO: 4.

Further, the primers for amplifying cDNA were changed to the following primers and the same operation as above was carried out to determine the nucleotide sequences of other regions of hepatitis G virus genomic RNA.

Using the primers having the nucleotide sequences shown in SEQ ID NOs: 32 and 33, the cDNA sequence shown in SEQ ID NO: 6 was determined. From this, the RNA sequence of SEQ ID NO: 5 and the homologous DNA sequence of SEQ ID NO: 7 were determined. The deduced amino acid sequence is as shown in SEQ ID NO: 8. This sequence is considered to be the core-envelope region.

Using the primers having the nucleotide sequences shown in SEQ ID NOs: 34 and 35, the cDNA sequence shown in SEQ ID NO: 10 was determined. From this, the RNA sequence of SEQ ID NO: 9 and SEQ ID NO:
Eleven homologous DNA sequences were determined. The deduced amino acid sequence is as shown in SEQ ID NO: 12. This sequence is considered part of the polymerase region.

Using the primers having the nucleotide sequences shown in SEQ ID NOs: 36 and 37, the cDNA sequence shown in SEQ ID NO: 14 was determined. From this, the RNA sequence of SEQ ID NO: 13 and SEQ ID NO:
Fifteen homologous DNA sequences were determined. The deduced amino acid sequence is shown in SEQ ID NO: 16. This sequence is also considered to be part of the polymerase region.

Using the primers having the nucleotide sequences shown in SEQ ID NOs: 38 and 39, the cDNA sequence shown in SEQ ID NO: 18 was determined. From this, the RNA sequence of SEQ ID NO: 17 and SEQ ID NO:
Nineteen homologous DNA sequences were determined. This sequence is considered to be the 5'end untranslated region.

[0064]

Example 3 Confirmation of Expression of Protein (1) Expression and Purification of Protein The hepatitis G gene fragment was added to pMAL-C2 in the host strain XL1-Blue in the same manner as in the method used for determining the nucleotide sequence described above. Cloned. PM in host strain XL1-Blue using IPTG
The expression of hepatitis G virus helicase gene fragment cloned in AL-C2 was induced, cultured at 37 ° C for 3 to 4 hours, and then transferred to a centrifuge tube, 12000 rpm, 30 seconds (4
(° C) Collect the cells from the E. coli culture solution by centrifugation and
After washing with mM Tris-HCl (pH 7.4), 1 x Column buffe
r (10 mM sodium phosphate, 0.5 M sodium chloride, 1 mM
It was dissolved in sodium azide, 10 mM β-mercaptoethanol and 1 mM EGTA), frozen (-20 ° C) and thawed twice, and then heated at 100 ° C for 5 minutes to obtain an expressed protein.

Amylose resin was packed in a 2.5 × 10 cm column and washed with 8 times the amount of 1 × Column buffer.
Inject crude extract of expressed protein at a rate of 1 ml / min. After washing with 8 times more 1 × Column buffer,
Pour the solution containing 10 mM maltose into the column buffer,
The protein was extracted.

(2) Confirmation of expression of protein Next, the protein obtained in (1) was subjected to SDS-polyacrylamide gel electrophoresis, and the protein was separated on the nylon membrane by Western blotting after separating by molecular weight. It was transcribed. The expressed protein was detected by using the antiserum of the same patient as the primary antibody and the anti-human 1gG antibody labeled with alakaliphosphatase as the secondary antibody. A band of 46.5 kilodalton, which is considered to be a fusion protein of helicase protein and maltose binding protein, was detected.

[0067]

Example 4 cDNA 20 obtained from 100 μL of patient serum
The following PCR reaction was performed using 5 μL of the μL.
As a primer, DNA having the nucleotide sequences shown in SEQ ID NOs: 20 to 23 was synthesized and used.

The reaction was performed by the nested PCR method. 1stP
The CR reaction solution was prepared by adding 15 μL of sterile distilled water to 10 × PCR buffer [500 mM KCl, 100 mM Tris-HCl (pH 8.8), 15 mM MgCl ₂ , 1
% Triton X-100] 2.5 μL, 10 mM dNTP [N = A, C, T, G] 0.5
μL, Taq DNA polymerase [5000 units / ml; manufactured by Wako] 0.15 μL, and SEQ ID NOS: 20 and 22 [each 0.1 μg / μL] were added in an amount of 1.0 μL.

In a reaction tube (0.5 μL), add the above reaction solution and c
DNA was added, 2 drops of liquid paraffin was added, and the mixture was set in a thermal cycler heated to 94 ° C. The cycle of the 1st PCR reaction is 94 ° C for 4 minutes, then 94 ° C for 1 minute, and 53 ° C for 2 minutes.
For 30 minutes at 72 ° C for 1.5 minutes.
Incubated at 7 ° C for 7 minutes and stored at 4 ° C.

18 μL of sterile distilled water was used for the 2nd PCR reaction solution.
The primers with the changed SEQ ID NOS: 21 and 23 were used. The 2nd reaction solution and 2 μL of the 1st PCR product were placed in a reaction tube, and liquid paraffin was added dropwise as in the 1st PCR. The cycle of the 2nd PCR reaction is
The 30 cycles were changed to 35 cycles.

Hepatitis G virus is the second PCR product 5 μ
The presence or absence can be determined by the presence or absence of the 121 bp band when L is electrophoresed on a 3% agarose gel and then stained with ethidium bromide.

FIG. 1 shows the results of the above-mentioned test using non-A non-B non-C hepatitis patient serum, non-A non-B non-C non-C liver cirrhosis patient serum, and normal human serum.

[0073]

INDUSTRIAL APPLICABILITY According to the present invention, the nucleotide sequences of the 5'terminal untranslated region, helicase region, core-envelope region, and polymerase region of hepatitis G virus genomic RNA have been elucidated. Since the nucleotide sequence of the translation region was also determined, the hepatitis G virus can be easily detected using this nucleotide sequence. The hepatitis G virus is regarded as important as a causative virus for non-A, non-B, and non-C liver cancer, and it is very useful that the present invention can easily detect the hepatitis G virus. Also,
The hepatitis G virus protein of the present invention is useful as a diagnostic agent for hepatitis G, hepatitis G vaccine, and the like.

[0074]

[Sequence list]

SEQ ID NO: 1 Sequence length: 100 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Genomic RNA sequence G GAG CGG AUG CGG ACC GGU AGG CAC CUC GUG UUU UGU CAC UCA AAG GCG 49 Glu Arg Met Arg Thr Gly Arg His Leu Val Phe Cys His Ser Lys Ala 5 10 15 GAG UGC GAG CGC CUG GCC GGU CAG UUU UCC UCU AGG GGG GUG AAC GCC 97 Glu Cys Glu Arg Leu Ala Gly Gln Phe Ser Ser Arg Gly Val Asn Ala 20 25 30 AUU 100 Ile 33 SEQ ID NO: 2 Sequence Length: 100 Sequence Type: Nucleic Acid Number of Strands: Single Strand Topology: Linear Sequence Type: cDNA to Genomic RNA Sequence AATGGCGTTC ACCCCCCTAG AGGAAAACTG ACCGGCCAGG CGCTCGCACT CCGCCTTTGA 60 GTGACAAAAC ACGAGGTGCC TACCGGTCCG CATCCGCTCC 100 SEQ ID NO: 3 Sequence length: 100 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid (DN homologous to genomic RNA)
A) Sequence GGAGCGGATG CGGACCGGTA GGCCACCTCGT GTT
TTGTCAC TCAAAGGCGG AGTGCGAGCG 60 CCTGGCCGGT CAGTTTTCCT CTAGGGGGGT GAA
CGCCAT 100 SEQ ID NO: 4 Sequence length: 33 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Protein sequence Glu Arg Met Arg Thr Gly Arg His Leu Val Phe Cys His Ser Lys Ala 5 10 15 Glu Cys Glu Arg Leu Ala Gly Gln Phe Ser Ser Arg Gly Val Asn Ala 20 25 30 Ile 33 SEQ ID NO: 5 Sequence length: 412 Sequence type: Nucleic acid Strand number: Single strand Topology: Direct Chain type: Genomic RNA sequence A AGC CUU CGG GUG AGG GCG GGU GGC AUA UUC UUU UCC UUA CCG AUC AUG 49 Ser Leu Arg Val Arg Ala Gly Gly Ile Phe Phe Ser Leu Pro Ile Met 5 10 15 GCA GUC CUU CUG CUU CUC UUC GUU GUG CAG GCC GGG GCC AUU CUG GCC 97 Ala Val Leu Leu Leu Leu Phe Val Val Gln Ala Gly Ala Ile Leu Ala 20 25 30 CCG GCC ACA CAU GCU UGU GGA GCG AAU GGG CAA UAU UUC CUC ACG AAU 145 Pro Ala Thr His Ala Cys Gly Ala Asn Gly Gln Tyr Phe Leu Thr Asn 35 40 45 UGC UGU GCC UUA GAG GAC AUA GGG UUC UGC CUG GAG GGU GGA UGC CUU 193 Cys Cys Ala Leu Glu Asp Ile Gly Phe Cys Leu Glu Gly Gly Cys Leu 50 55 60 GUG GCC UUG GGC UGC ACA AUU UGU ACU GAC CGU UGC UGG CCA CUG UAU 241 Val Ala Leu Gly Cys Thr Ile Cys Thr Asp Arg Cys Trp Pro Leu Tyr 65 70 75 80 CAG GCG GGU UUG GCC GUG CGG CCU GGC AAG UCC GCC GCC CAG UUG GUC 289 Gln Ala Gly Leu Ala Val Arg Pro Gly Lys Ser Ala Ala Gln Leu Val 85 90 95 GGG GAA CUC GGA AGC CUU UAC GGG CCC UUA UCG GUG UCC GCC UAC GUG 337 Gly Glu Leu Gly Ser Leu Tyr Gly Pro Leu Ser Val Ser Ala Tyr Val 100 105 110 GCG GGC AUC UUA GGG CUU GGG GAG GUC UAU UCG GGG GUC CUU ACC AUC 385 Ala Gly Ile Leu Gly Leu Gly Glu Val Tyr Ser Gly Val Leu Thr Ile 115 120 125 GGG GUG GCG UUG ACG CGC CGG GUC UAC 412 Gly Val Ala Leu Thr Arg Arg Val Tyr 130 135 SEQ ID NO: 6 Sequence length: 412 Sequence type: Number of nucleic acid chains : Single strand Topology: Linear Sequence type: cDNA to Genomic RNA sequence GTAGACCCGG CGCGTCAACG CCACCCCGAT GGTAAGGACC CCCGAATAGA CCTCCCCAAG 60 CCCTAAGATG CCCGCCACGT AGGCGGACAC CGATAAGGGC CCGTA AAGGC TTCCGAGTTC 120 CCCGACCAAC TGGGCGGCGG ACTTGCCAGG CCGCACGGCC AAACCCGCCT GATACAGTGG 180 CCAGCAACGG TCAGTACAAA TTGTGCAGCC CAAGGCCACA AGGCATCCAC CCTCCAGGCA 240 GAACCCTATG TCCTCTAAGG CACAGCAATT CGTGAGGAAA TATTGCCCAT TCGCTCCACA 300 AGCATGTGTG GCCGGGGCCA GAATGGCCCC GGCCTGCACA ACGAAGAGAA GCAGAAGGAC 360 TGCCATGATC GGTAAGGAAA AGAATATGCC ACCCGCCCTC ACCCGAAGGC TT 412 SEQ ID NO: 7 SEQ Length: 412 sequences Type: Nucleic Acid Number of Strands: Single Strand Topology: Linear Sequence Type: Other Nucleic Acid (DNA homologous to Genomic RNA) Sequence AAGCCTTCGG GTGAGGGCGG GTGGCATATT CTTTTCCTTA CCGATCATGG CAGTCCTTCT 60 GCTTCTCT GTTGTGCACAGGTCGGTCGCAT GATGGCTGCAA TGA TCTGCCTGGA 180 GGGTGGATGC CTTGTGGCCT TGGGCTGCAC AATTTGTACT GACCGTTGCT GGCCACTGTA 240 TCAGGCGGGT TTGGCCGTGC GGCCTGGCAA GTCCGCCGCC CAGTTGGTCG GGGAACTCGG TC AGCCCTACTACCT CTGG CCATCTTAGCTGG GT GGCGTTGACG CGCCGGGTCT AC 412 SEQ ID NO: 8 Sequence Length: 137 Sequence Type: Amino Acid Number of Chains: Single Strand Topology: Linear Sequence Type: Protein Sequence Ser Leu Arg Val Arg Ala Gly Gly Ile Phe Phe Ser Leu Pro Ile Met 5 10 15 Ala Val Leu Leu Leu Leu Phe Val Val Gln Ala Gly Ala Ile Leu Ala 20 25 30 Pro Ala Thr His Ala Cys Gly Ala Asn Gly Gln Tyr Phe Leu Thr Asn 35 40 45 Cys Cys Ala Leu Glu Asp Ile Gly Phe Cys Leu Glu Gly Gly Cys Leu 50 55 60 Val Ala Leu Gly Cys Thr Ile Cys Thr Asp Arg Cys Trp Pro Leu Tyr 65 70 75 80 Gln Ala Gly Leu Ala Val Arg Pro Gly Lys Ser Ala Ala Gln Leu Val 85 90 95 Gly Glu Leu Gly Ser Leu Tyr Gly Pro Leu Ser Val Ser Ala Tyr Val 100 105 110 Ala Gly Ile Leu Gly Leu Gly Glu Val Tyr Ser Gly Val Leu Thr Ile 115 120 125 Gly Val Ala Leu Thr Arg Arg Val Tyr 130 135 137 SEQ ID NO: 9 Sequence length: 244 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Genomic RNA Sequence G AUU CGA CGG ACC UCA UGC UAC AAG UUG CUA CGC CAG CAA AUA CUC UCU 49 Ile Arg Arg Thr Ser Cys Tyr Lys Leu Leu Arg Gln Gln Ile Leu Ser 5 10 15 GCA GCU GUA GCU GAG CCC UAC UAC GUG GAU GGC AUA CCC GUC UCA UGG 97 Ala Ala Val Ala Glu Pro Tyr Tyr Val Asp Gly Ile Pro Val Ser Trp 20 25 30 GAA GCU GAC GCG CGA GCG CCG GCG AUG GUC UAC GGU CCU GGC CAA AGU 145 Glu Ala Asp Ala Arg Ala Pro Ala Met Val Tyr Gly Pro Gly Gln Ser 35 40 45 GUC ACC AUU GAC GGA GAG CGC UAC ACC CUU CCG CAC CAG CUG CGG AUG 193 Val Thr Ile Asp Gly Glu Arg Tyr Thr Leu Pro His Gln Leu Arg Met 50 55 60 CGG AAU GUG GCC CCU UCU GAG GUU UCA UCC GAG GUC AGC AUC GAG AUU 241 Arg Asn Val Ala Pro Ser Glu Val Ser Ser Glu Val Ser Ile Glu Ile 65 70 75 80 GGG 244 Gly 81 SEQ ID NO: 10 Sequence length: 244 Sequence type: Nucleic acid chain Number of: Single-stranded Topology: Linear Sequence type: cDNA to Genomic RNA sequence CCCAATCTCG ATGCTGACCT CGGATGAAAC CTCAGAAGGG GCCACATTCC GCATCCGCAGAG CTCTTGTGCGGA AGGGTGTAGC GCTCTCCGTC AATGGTGACA CTT TGGCCAG GACCGTAGAC 120 CATCGCCGGC GCTCGCGCGT CAGCTTCCCA TGAGACGGGT ATGCCATCCA CGTAGTAGGG 180 CTCAGCTACA GCTGCAGAGA GTATTTGCTG GCGTAGCAAC TTGTAGCATG AGGTCCGTCG 240 AATC 244 SEQ ID NO: 11 Sequence length: 244 Sequence type: Nucleotide sequence number: 244 Sequence type: Nucleotide sequence type: 244 sequence type: Nucleic acid sequence type: 244 other nucleic acid (Genomic RNA homologous DNA) sequence GATTCGACGG ACCTCATGCT ACAAGTTGCT ACGCCAGCAA ATACTCTCTG CAGCTGTAGC 60 TGAGCCCTAC TACGTGGATG GCATACCCGT CTCATGGGAA GCTGACGCGC GAGCGCCGGC 120 GATGGTCTAC GGTCCTGGCC AAAGTGTCAC CATTGACGGA GAGCGCTACA CCCTTCCGCA 180 CCAGCTGCGG ATGCGGAATG TGGCCCCTTC TGAGGTTTCA TCCGAGGTCA GCATCGAGAT 240 TGGG 244 SEQ ID NO: 12 length of sequence : 81 Sequence type: Amino acid Number of chains: Single strand Topology: Linear Sequence type: Protein sequence Ile Arg Arg Thr Ser Cys Tyr Lys Leu Leu Arg Gln Gln Ile Leu Ser 5 10 15 Ala Ala Val Ala Glu Pro Tyr Tyr Val Asp Gly Ile Pro Val Ser Trp 20 25 30 Glu Ala Asp Ala Arg Ala Pro Ala Met Va l Tyr Gly Pro Gly Gln Ser 35 40 45 Val Thr Ile Asp Gly Glu Arg Tyr Thr Leu Pro His Gln Leu Arg Met 50 55 60 Arg Asn Val Ala Pro Ser Glu Val Ser Ser Glu Val Ser Ile Glu Ile 65 70 75 80 Gly 81 SEQ ID NO: 13 Sequence length: 121 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Genomic RNA sequence C AUC UUG GGC GAU CCG GGG CGG GUU GCC AAG GCG GUG CUG GGG GGG GCU 49 Ile Leu Gly Asp Pro Gly Arg Val Ala Lys Ala Val Leu Gly Gly Ala 5 10 15 UAC GCC UUC CAG UAC ACC CCA AAC CAG CGG GUU AGG GAG AUG CUG AAA 97 Tyr Ala Phe Gln Tyr Thr Pro Asn Gln Arg Val Arg Glu Met Leu Lys 20 25 30 CUG UGG GAG UCA AAG AAA ACU CCG 121 Leu Trp Glu Ser Lys Lys Thr Pro 35 40 SEQ ID NO: 14 Sequence length: 121 Sequence type: Nucleic acid Number of strands: Single-stranded topology : Type of linear sequence: cDNA to Genomic RNA sequence CGGAGTTTTC TTTGACTCCC ACAGTTTCAG CATCTCCCTA ACCCGCTGGT TTGGGGTGTA 60 CTGGAAGGCG TAAGCCCCCC CCAGCACCGC CTTGGCAACC CGCCCCGGAT CGCC CAAGAT 120 G 121 SEQ ID NO: 15 Sequence length: 121 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid (DN homologous to Genomic RNA
A) Sequence CATCTTGGGC GATCCGGGGC GGGTTGCCAA GGC
GGTGCTG GGGGGGGGCTT ACGCCTTCCA 60 GTACACCCCA AACCAGCGGG TTAGGGAGAT GCT
GAAACTG TGGGAGTCAA AGAAAACTCC 120 G
121 SEQ ID NO: 16 Sequence length: 40 Sequence type: Amino acid Number of chains: Single strand Topology: Linear Sequence type: Protein sequence Ile Leu Gly Asp Pro Gly Arg Val Ala Lys Ala Val Leu Gly Gly Ala 5 10 15 Tyr Ala Phe Gln Tyr Thr Pro Asn Gln Arg Val Arg Glu Met Leu Lys 20 25 30 Leu Trp Glu Ser Lys Lys Thr Pro 35 40 SEQ ID NO: 17 Sequence length: 204 Sequence type: Number of nucleic acid strands : single strand topology: linear sequence type: Genomic RNA sequence AUAGGUGGGU CUUAAGGGUU GGUUAAGGUC CCUCUGGCGC UUGUGGCGAG AAAGCGCACG 60 GUCCACAGGU GUUGGUCCUA CCGGUGUAAU AAGGACCCGA CGUCAGGCUC GUCGUUAAAC 120 CGAGCCCGUU ACCCACCUGG GCAAACAACG CCCACGUACG GCCCACGUCG CCCUUCAAUG 180 UCUCUCUUGA CCAAUAGGCU UAGC 204 SEQ ID NO: 18 SEQ length: 204 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: cDNA to Genomic RNA sequence GCTAAGCCTA TTGGTCAAGA GAGACATTGA AGGGCGACGT GGGCCGTACG TGGGCGTTGT 60 TTGCCC AGGT GGGTAACGGG CTCGGTTTAA CGACGAGCCT GACGTCGGGT CCTTATTACA 120 CCGGTAGGAC CAACACCTGT GGACCGTGCG CTTTCTCGCC ACAAGCGCCA GAGGGACCTT 180 AACCAACCCT TAAGACCCAC CTAT 204 SEQ ID NO: 19 Sequence length: 204 Sequence type: Nucleotide type: Nucleotide type: Nucleotide type Nucleic acid (DNA homologous to Genomic RNA) sequence ATAGGTGGGT CTTAAGGGTT GGTTAAGGTC CCTCTGGCGC TTGTGGCGAG AAAGCGCACG 60 GTCCACAGGT GTTGGTCCTA CCGG: ATAAGGACCCGA CGTCAGGCTC GTCGTTCGAC sequence: CGTCAGCCTC: CCTGCA CCAC: CCTGCA: CCTGC: CCGTCA: CCGT: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid (synthetic DNA) Sequence CACTATAGGT GGGTCTTAAG 20 SEQ ID NO: 21 Sequence length: 20 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid (synthetic DNA) Sequence GCGCACGGTC CACAGGTG TT 20 SEQ ID NO: 22 Sequence length: 20 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid (synthetic DNA) Sequence GCCTATTGGT CAAGAGAGAC 20 SEQ ID NO: 23 Sequence Length: 20 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid (synthetic DNA) Sequence GGGCGACGTG GACCGTACGT 20 SEQ ID NO: 24 Sequence length: 20 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid (synthetic DNA) Sequence TCGGGTGAGG GCGGGTGGCA 20 SEQ ID NO: 25 Sequence length: 20 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid (synthetic DNA) Sequence ACCGATCATG GCAGTCCTTC 20 SEQ ID NO: 26 Sequence length: 20 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear sequence type : Other nucleic acid (synthetic DNA) sequence GTACGTGGG C GTTGTTTGCC 20 SEQ ID NO: 27 Sequence length: 20 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid (synthetic DNA) sequence CCCGCCTGAT ACAGTGGCCA 20 SEQ ID NO: 28 Sequence Length: 20 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid (synthetic DNA) Sequence ACCCGGCGCG TCAACGCCAC 20 SEQ ID NO: 29 Sequence length: 20 Sequence type : Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid (synthetic DNA) Sequence GCTTGTGGAG CGAATGGGCA 20 SEQ ID NO: 30 Sequence length: 20 Sequence type: Nucleic acid Number of strands: Single Chain topology: Linear Sequence type: Other nucleic acid (synthetic DNA) Sequence TCYTTGATGA TDGAACTGTC 20 (Y = T or C, D = A, G, or T) SEQ ID NO: 31 Sequence length: 20 Sequence type : Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid ( Synthetic DNA) Sequence TATGGGCATG GHATHCCYCT 20 (H = A, C, or T, Y = C or T) SEQ ID NO: 32 Sequence length: 20 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid (synthetic DNA) Sequence TACAGCCGGG GTAGCCCAAG 20 SEQ ID NO: 33 Sequence length: 20 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid ( Synthetic DNA) Sequence CACGTCAGGT TCGGGACCGG 20 Sequence Number: 34 Sequence Length: 20 Sequence Type: Nucleic Acid Number of Strands: Single Strand Topology: Linear Sequence Type: Other Nucleic Acid (Synthetic DNA) Sequence GTGACCCCTA CCCACGTGGT 20 Sequence Number: 35 Sequence Length: 23 Sequence Type: Nucleic Acid Number of Strands: Single Strand Topology: Linear Sequence Type: Other Nucleic Acid (Synthetic DNA) Sequence AGTTCTGAGT CTTCAGTCTC CGT 23 SEQ ID NO: 36 Sequence Length : 24 Sequence type: Nucleic acid Number of strands: Single strand Topology: Direct Chain type of sequence: Other nucleic acid (synthetic DNA) sequence GGACTTCCGG ATAGCTGAGA AGCT 24 SEQ ID NO: 37 Sequence length: 20 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other Nucleic Acid (Synthetic DNA) Sequence GCGTCCACAC AGATGGCGCA 20 SEQ ID NO: 38 Sequence Length: 20 Sequence Type: Nucleic Acid Number of Strands: Single Strand Topology: Linear Sequence Type: Other Nucleic Acid (Synthetic DNA) Sequence CGGTCATCCT GGTAGCCACT 20 SEQ ID NO: 39 Sequence length: 20 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid (synthetic DNA) sequence TGGTCCTTGT CAACTCGCCG 20

[Brief description of drawings]

FIG. 1: Nested P using SEQ ID NOs: 20, 22 and 21, 23
It is an agarol gel electrophoresis figure which shows the result of having detected hepatitis G virus genomic RNA by CR.

[Explanation of symbols]

 1: Size marker (φ × 174 DNA / Hae III) 2: Positive sera 3: Negative sera 4: Negative sera 5: Negative control (distilled water) 6: Positive sera 7: Negative sera 8: Positives Serum 9: Positive serum 10: Positive serum

─────────────────────────────────────────────────── ───

[Procedure amendment]

[Submission date] June 3, 1996

[Procedure amendment 1]

[Document name to be amended] Drawing

[Correction target item name] Fig. 1

[Correction method] Change

[Correction contents]

FIG.

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁶ Identification code Office reference number FI Technical display location C07K 16/10 C07K 16/10 C12N 1/21 C12N 1/21 C12P 21/02 C12P 21/02 C C12Q 1/68 7823-4B C12Q 1/68 A 1/70 7823-4B 1/70 G01N 33/53 G01N 33/53 D 33/569 33/569 L 33/576 33/576 Z // (C12N 15 / 09 ZNA C12R 1:92) (C12N 1/21 C12R 1:19) (C12P 21/02 C12R 1:19)

Claims (14)

[Claims] 1. A hepatitis G virus genomic RNA having a nucleotide sequence represented by SEQ ID NO: 1, 5, 9, 13 or 17. 2. The DNA complementary to the hepatitis G virus genomic RNA according to claim 1, which has the nucleotide sequence represented by SEQ ID NO: 2, 6, 10, 14 or 18. 3. The DNA homologous to the hepatitis G virus genomic RNA according to claim 1, which has the nucleotide sequence represented by SEQ ID NO: 3, 7, 11, 15 or 19. 4. A hepatitis G virus protein comprising a polypeptide containing the amino acid sequence represented by SEQ ID NO: 4, 8, 12 or 16. 5. A DNA having a nucleotide sequence encoding the amino acid sequence represented by SEQ ID NO: 4, 8, 12 or 16. 6. A recombinant DNA incorporating the DNA according to claim 2 or 5. 7. A transformant transformed with the recombinant DNA according to claim 6. 8. The method for producing a protein according to claim 4, which comprises culturing the transformant according to claim 7 and separating the protein according to claim 4 from the obtained culture. 9. A method for detecting hepatitis G virus using a primer set based on the nucleotide sequence of the DNA according to claim 2 or 3. 10. A method for detecting hepatitis G virus, which comprises detecting hepatitis G virus by an antigen-antibody reaction using at least a part of the protein according to claim 4 as an antigen. 11. A method for detecting hepatitis G virus, which comprises detecting hepatitis G virus by an antigen-antibody reaction using an antibody against the protein according to claim 4. 12. A hepatitis G diagnostic agent comprising at least a part of the protein according to claim 4 as an active ingredient. 13. A hepatitis G diagnostic agent comprising an antibody against the protein of claim 4 as an active ingredient. 14. A hepatitis G vaccine containing at least a part of the protein according to claim 4 as an active ingredient.