IE83236B1 - Hepatitis C virus epitopes - Google Patents

Description

HEPATITIS C VIRUS EPITOPES GENELABS TECHNOLOGIES, INC.

HEPATITIS C VIRUS EPITOPES . Field of Invention This invention relates to specific peptide viral anti- gens which are immunoreactive with sera from patients in- fected with parenterally transmitted non-A, non-B hepatitis virus (PT-NANBH, now called Hepatitis C Virus), to poly- nucleotide sequences which encode the peptides, to an ex- pression system capable of producing the peptides, and to methods of using the peptides for detecting PT-NANBH infec- tion in human sera.

. References Atkins, et al., Cell _5_2:413-423 (1990).

Ausubel, F. M., et al., Current Protocols in Molecular Biology, John Wiley and Sons, Inc., Media PA.

Bradley, D.W., et al., J. Infec. Dis., 148:2 (1983).

Bradley, D.W., et al., J Gen. Virol., 69:1 (1988).

Bradley, D.W. et al., Nat. Acad. Sci., USA, 84:6277 (1987).

Proc.

Chomczynski, P., et al., Anal Biochem, 162:156 (1987).

Choo, Q.-L., et al, Science, 244:359 (1989).

Current Protocols in Molecular Biology, Wiley Inter- science, Chapter 10.

Dienstag, J.L., et al, Sem Liver Disease, 6:67 (1986) Gubler, U., et al, Gene, 25:263 (1983).

Hunyh, T.V., et al, in DNA Cloning Techniques: A Prac- tical Approach (D. Glover, ed.) IRL Press (1985).

Kuo, G., et al., Science, 244:362 (1989).

Maniatis, T., et al. Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory (1982).

Miller, J. H., Experiments in Molecula; Genetics., Cold Spring Harbor Laboratories, Cold Spring Harbor, NY Biochem. Biophys. (1972).

Mullis, R., U. S. Patent No. 4,683,202, issued July 28, 1987.

Mullis, K., et al., U. S. Patent No. 4,683,195, issued July 28, 1987.

Reyes, G., et al, Science, 247:1335 (1990).

Sanger, F., et al., Proc. Natl. Acad. Sci. USA 1g:5463 (1977).

Scharf, S. J., et al., Science g;;:1076 (1986). selected Method in Cellular Immunoloqv, (Mishell, B.D., et al. eds) W.H. Freeman and Co., pp416-440 (1980).

Smith. D.B., et al, Gene, 67:31 (1988).

. Background Viral hepatitis resulting‘ from a ‘virus other than hepatitis A virus (HAV) and hepatitis B virus (HBV) has been referred to as non-A, non-B hepatitis (NANBH). More recently, it has become clear that NANBH encompasses at least two, and perhaps more, quite distinct viruses. one of these, known as enterically transmitted NANBH or ET- NANBH, is contracted predominantly in poor-sanitation areas where food and drinking water have been contaminated by fecal matter. The molecular cloning of a portion of this virus, referred to as the hepatitis E virus (HBV), has recently been described (Reyes et al.).

The second NANB virus type, transmitted NANBH, or PT-NANBH, is transmitted by parenter- al routes, typically by exposure to blood or blood prod- known as parenterally ucts. Approximately 10% of transfusions cause PT-NANBH infection, and about half of these go on to a cmronic disease state (Dienstag).

Human sera documented as having produced post-trans- fusion NANBH in human recipients has been used successfully to produce PT-NANBH infection in chimpanzees (Bradley).

RNA isolated from infected chimpanzee sera has been used to construct CDNA libraries in an expression vector for immu- noscreening with chronic-state human PT—NANBH serum. This procedure identified a PT-NANBH specific CDNA clone and the viral sequence was then used as a probe to identify fragments making up 7,300 contiguous basepairs of a PT- NANBH viral agent (EPO patent application 88310922.5, filed 11.18.88). The same procedure was used by the present inventors to derive two of the PT-NANBH peptide and polynucleotide sequences disclosed herein. The sequenced viral agent has been named HCV (HCV) (above EPO patent application).

Heretofore, one immunogenic peptide encoded by the (Choo, Kuo, .EPO This peptide, designated C-100, HCV viral agent has application 883l0922.5). has been used in immunoassays of PT-NANBH sera and found been reported to react immuno—specifically with up to 80% of the chronic NANBH samples, and about 15% of acute NANBH samples (Kuo).

It is desirable to provide one or a collection of peptide antigens which are immunoreactive with a greater percentage of PT—NANBH-infected blood, acute and chronic PT—NANBH infection.’ including both EP 0 318 216 discloses a family of cDNA sequences derived from hepatitis C virus (HCV). The sequences encode antigens which react immunologically with antibodies present in individuals with non-A non-B hepatitis (NANBH), but which are generally absent from (HAV) or hepatitis B virus (HBV), and are also absent from control individuals infected with. hepatitis A ‘virus individuals.

EP 0 388 232 discloses polypeptides and new HCV sequences and describes their application in anti-HCV production PCR technology and recombinant DNA technology. 268S~2689 (1990) describes a CDNA clone closely associated with a non—A. immunoassays, probe diagnostics, antibody non-B hepatitis. The cDNA clone was isolated by immunoscreening with mixed sera from non-A, non-B hepatitis (NANBH) carrier and convalescent chimpanzees.

The recombinant proteins produced by this CDNA clone reacted specifically with sera of patients in the chronic phase of NANBH. infectious The presence of this sequence in RNA of shown by RNA blot of PCR possibly plasma was hybridisation and by Southern blot analysis amplified products.

. Summary of the Invention It is one general object of the invention to provide recombinant polypeptides immunoreactive with sera from humans infected with hepatitis C virus (HCV), including a peptide which is immunoreactive with a high percentage HCV-infected peptides which are immunoreactive with sera associated of sera from chronic individuals, and with acute HCV infection.

It is another object of the invention to provide an HCV polynucleotide sequence encoding a sequence for recombinant production of the peptide antigens, and a diagnostic method for detecting HCV-infected human sera using the peptide antigens.

The invention includes, in one aspect, a peptide antigen which is immunoreactive with sera from humans infected with HCV which is identified by SEQ ID No. 6.

In another aspect, the invention includes diagnostic kits for use in screening human blood containing antibodies specific against HCV infection.

The kit includes at least one peptide antigen which is immunoreactive with sera from humans infected with hepatitis C virus (HCV) which is identified by SEQ ID No. 6.

In one embodiment of the present invention, the antigen is immobilised on a solid support. The binding of HCV-specific antibodies to the immobilized antigen is detected by a reporter—labeled anti-human antibody which acts to label the solid support with a detectable reporter.

The kit is used in a method for detecting HCV infection in an individual by: (i) reacting serum from an HCV-infected test individual with the above peptide antigen,. and (ii) examining the antigen for the presence of bound antibody.

The peptide antigens are produced, in accordance with another aspect of the invention, using an expression system for expressing a recombinant peptide antigen which is immunoreactive with sera from humans infected with hepatitis C virus (HCV). A selected expression vector containing an open reading frame (ORF) of a polynucleotide which encodes the peptide is introduced into a suitable host, which is cultured under conditions which promote expression of the OR? in the expression vector.

In one embodiment, the polynucleotide is inserted into an expression site in a lambda gtll phage vector, and the vector is introduced into an E. coli host.

The following E.coli host has been deposited which contains a vector including the coding sequences of the antigens shown in parentheses: ATCC No. 40901 (SEQ ID No. S). pGEX and pET are two other vectors which have been used to express HCV antigens. It will be appreciated that determination of other appropriate vector and host combinations for the expression of the above sequences are within the ability of one of ordinary skill in the art.

Also forming part of the invention are polynucleotides which encode polypeptides immunoreactive with sera from humans infected with hepatitis C virus (HCV). One polynucleotide of the present invention encodes a polypeptide wherein the polypeptide includes an immunoreactive portion of a peptide sequence which is identified by SEQ ID No. 6.

These and other objects and features of the invention will become more fully apparent when the following detailed description is read in conjunction with the accompanying drawings.

. Brief Description of the Drawings Figure 1 illustrates the steps in producing overlapping linking fragments of a nucleic acid segment, in accordance with the methods of the present invention; Figure 2 shows the positions of overlap primer regions and linking regions along a 7,300 basepair portion of the HCV genome.

Figure 3 shows the DNA coding sequence of the clone 40 insert. The underlined sequences correspond to an R, primer region.

Figure 4 shows the DNA coding sequence of a clone insert. The underlined sequences correspond, respectively, to the F7, F3, and F9 primer regions.

Figure 5 shows the DNA and protein coding sequences for a 409l(abc) clone insert. The "A" region of this sequence is delineated by boxes, the "B" region by a box and a triangle, and the "C" region by a triangle and an asterisk.

Figure 6 shows the DNA and protein coding sequences for a 409-1—1(c-a) clone insert.

Figure 7 illustrates the groups of clones which have been obtained from the HCV genome in the region correspond- ing to the 4091(abc) clone insert.

Figure 8A shows the DNA and protein coding sequences for_;he pGEX-GG1 insert. The three G's above the first line indicate where substitutions were made to generate the clone pGEX-CapA. Figure 8B shows the DNA and protein sequences for the pGEX-CapA insert coding sequence. The primers used in polymerase chain reactions to generate carboxy and amino terminal deletions are indicated below the nucleotide line. The sequences of the primers are The actual primers is the reverse indicated in the sense (coding strand). sequence of the NC (non-coding) complement of the indicated sequence. Coding primers are underlined; reverse (noncoding) primers are double-under- lined. Sequences shown in capital letters are exact matches. Sequences in lowercase letters are "mismatched" sequences used to introduce the terminal restriction sites (NcoI at the 5' ends and BamHI at the 3' ends). The three nucleotides which have been altered to remove the "slippery codons" at positions 24, 27, and 30 are indicated by bold type with the wild type A residues shown above the se- quence.

Figure 9 shows a hydropathicity plot of the HCV-core protein encoded by pGEX-CapA. The relative location of the primers, used to generate carboxy and amino terminal deletions, are indicated relative to the protein coding sequence by arrows.

Figure 10 shows an epitope map of the HCV capsid protein region.

. Detailed Description of the Invention I. Definitions The terms defined below have the following meaning herein: . "Parenterally transmitted non-A, non-B hepatitis viral agent (PT-NANBH)" means a virus, virus type, or virus class which (i) causes parenterally transmitted infectious hepatitis, (ii) is transmissible in chimpanzees, (iii) is serologically distinct from hepatitis A virus (HAV), hepa- titis B virus (HBV), and hepatitis E virus (HEV).

. "HCV (HCV)" means a PT—NANBH viral agent whose polynucleotide sequence includes the sequence of the 7,300 basepair region of HCV given in the Appendix, and varia- tions of the sequence, such as degenerate codons, or variations which may be present in different isolates or strains of HCV.

. Two nucleic acid fragments are "homologous" if they are capable of hybridizing to one another under hybridization conditions described in Maniatis gt glp, QB; gigp, pp. 320-323, using the following wash conditions: 2 x SCC, 0.1% SDS, room temperature twice, 30 minutes each; then 2 X SCC, 0.1% SDS, 50°C once, 30 minutes; then 2 x SCC, room temperature twice, 10 minutes each, homologous sequences can be identified that contain at most about 25- homologous % basepair mismatches. More preferably, nucleic acid strands contain 15-25% basepair mismatches, even more preferably 5-15% basepair mismatches. These degrees of homology can be selected by using more stringent wash or hybridization conditions for identification of clones from gene libraries (or other sources of genetic material), as is well known in the art.

. A DNA fragment is "derived from" HCV if it has substantially the same basepair sequence as a region of the HCV viral genome which was defined in (2) above.

. A protein is "derived from" a PT-NANBH or HCV viral_agent if it is encoded by an open reading frame of a cDNA or RNA fragment derived from a PT-NANBH or HCV viral agent, respectively.

II. Molecular Clone Selection by Immunoscreening As one approach toward identifying a molecular clone of a PT-NANBH agent, cDNA libraries are prepared from in- fected sera in the expression vector lambda gtll. CDNA se- quences are then selected for expression of peptides which are immunoreactive with PT-NANBH-infected sera. Recombi- nant proteins identified by this approach provide candi- dates for peptides which can serve as substrates in diag- nostic tests. Further, the nucleic acid coding sequences identified by this approach serve as useful hybridization probes for the identification of further PT-NANBH coding sequences.

In order to make immunoscreening a useful approach for identifying clones originating from PT-NANBH coding sequen- ces, a well-defined source of PT-NANBH virus is important.

To generate such a source, a chimpanzee (#771; Example 1A) was infected with transmissible PT-NANBH agents using a Factor VIII concentrate as a source (Bradley). The Factor VIII concentrate was known to contain at least two forms of parenterally transmitted NANB hepatitis (PT-NANBH). In ad- dition to a chloroform-sensitive agent, which has subse- quently been called HCV (HCV), a chloroform-resistant form of PT-NANBH was (Bradley, 1983): In the method illustrated in Example 1, infected serum also transmitted in the concentrate was pelleted, without dilution, by centrifugation, and cDNA libraries were generated from the resulting pelleted virus (Example 1B and 1C). treated in the same fashion.

Sera from infected human sources were cDNA libraries were generat- ed, e.g., by a random primer method using the RNA extracted from pelleted sera as starting material (Example 1B and 1c) . suitable vector, for example, lambda gtll, for expression and screening of peptide antigens, and lambda gtlo, for Lambda gtll is a particularly useful expression vector which contains a The resulting CDNA molecules were then cloned into a hybridization screening (Example 1C(iv)). unique EcoRI insertion site 53 base pairs upstream of the translation ‘termination codon of the beta-galactosidase gene. Thus, an inserted sequence is expressed as a beta- galactosidase fusion protein which contains the N—terminal portion of the beta-galactosidase gene, the heterologous peptide, and optionally the C-terminal region of the beta- (the C-terminal portion being ex- pressed when the heterologous peptide coding sequence does galactosidase peptide not contain a translation termination codon). This vector also produces a temperature-sensitive repressor (cI857) which causes viral lysogeny at permissive temperatures, e.g., 32°C, and leads to viral lysis at elevated tempera- tures, e.g., 42°C. Advantages of this vector include: (1) highly efficient recombinant clone generation, (2) ability to select lysogenized host cells on the basis of host-cell growth at permissive, but not non-permissive, temperatures, and (3) high levels of recombinant fusion protein produc- tion. Further, since phage containing a heterologous in- sert produces an inactive beta-galactosidase enzyme, phage with inserts are typically identified using a beta-galacto— sidase colored—substrate reaction.

In the screening procedure reported in Examples 1-3, individual CDNA libraries were prepared from the serum of one PT-NANBH infeced chimpanzee (#771) and four PT—NANBH infected humans (designated EGM, BV, WEH, and AG). five libraries were immunoscreened using PT-NANBH positive 111 lambda gtll These human or chimpanzee sera (Example 2): clones were identified which were immunoreactive with at of these 111 clones, mined for insert hybridization with normal DNA. least one of the sera. 93 were exa- The in- serts were radioactively labelled and used as probes against HindIII/EcoRI doubly-digested human peripheral lymphocyte (PBL) DNA (Example 3). Approximately 46% (43/93) of the inserts hybridized with normal human PBL DNA Inserts from 11 PT-NANBH- immunopositive clones derived from chimpanzee #771 sera and were therefore not pursued. were characterized as exogenous to normal human PBL DNA Of these 11 clones 2 PT-NANBH clones were one clone (Example 3). identified having the following characteristics. (clone 40) was clearly exogenous by repeated hybridization tests against normal human PBL DNA, had a relatively small insert size (approximately 0.5 kilobases), and was quite unreactive with negative control serum. The second clone (clone 36) was shown to be reactive with multiple PT-NANBH antisera, had a relatively large insert size (approximately 1.5 kilobases), and was exogenous by hybridization testing against normal human PBL DNA. The immunoreactive charac- teristics of clones 36 and 40 are summarized in Table 1 (Example 3). Clone 36 was immunoreactive with chimpanzee #771 sera and two HCV-positive human sera, AG and BV. The clone 36 antigen did not immunoreact with the negative con- trol sera SKF. #771 sera and was cleanly nonreactive when the negative Clone 40 was immunoreactive with chimpanzee control sera was used for screening.

The DNA sequence of clone 36 was determined in part and is shown in Figure 4. This sequence corresponds to nucleotides 5010 to 6516 of the HCV sequence given in the Appendix. The DNA sequence was also determined for the clone 40 insert (Figure 3). This sequence is homologous to the HCV sequence (Appendix) in the region of approximately nucleotides 6515 to 7070. panzee #771 clones, homologous to clone 40 by hybridization and sequence ana- The inserts of two other chim- clones 44 and 45, were found to be The sequences for clones 36 and 40 are contiguous sequences, with the clone 36 sequences being located 5’ of the clone 40 sequences as presented in the lysis (Example 4).

Appendix. Accordingly, these two clones represent isola- tion of a significant block of the HCV genome by the above- described immunoscreening methods.

The four lambda gt11 clones 36, 40, 44, deposited in the Genelabs Culture Collection, Incorporated, 505 Penobscot Drive, Redwood City, CA 94063.

Further, the lambda gtll clones of clones 36 and 40 were deposited with the American Type Culture Collection, 12301 Parklawn Dr., Rockville MD, 20852, numbers ATCC No. 40901 and ATCC 40893. and 45 were Genelabs and given the deposit III. PT-NANBH Sequence Identification by Hybridization Methods.

The polynucleotides identified in section II can be employed as probes in hybridization methods to identify further HCV sequences, and these can then be used as probes to identify additional sequences. The polynucleotides can be directly cloned or fragmented by partial digestion to generate random fragments. The resulting clones can be immunoscreened as described above to identify HCV antigen coding sequences.

To illustrate how the inserts of clones 36 and 40 can be used to identify clones carrying HCV sequences, the insert of clone 40 was isolated and used as a hybridization probe against the individual CDNA libraries established in lambda gtlo (see above). Using the clone 40 probe approxi- mately 24 independent hybridization-positive clones were plaque purified (Example 5). The positive signals arose with different frequencies in cDNA libraries from the different serum sources, suggesting that the hybridization signals were from the serum sources, rather than resulting from some common contaminant introduced during the CDNA synthesis or cloning (Table 2). one of the clones, 108 , which tested positive by hybridization with the clone 40 insert, had an insert of approximately 3.7 kb (Example 6).

Since it had such a large insert, clone 1085 was chosen for further analysis. The serum source of this CDNA clone was EGM human PT-NANBH serum (Example 1).

The insert of 1085 was isolated by EcoRI digestion of the lambda gtlo clone, electrophoretic fractionation, and electroelution (Example 6). The isolated insert was treated with DNase I to generate random fragments (Example 6), and the resulting digest fragments were inserted into lambda gtll phage vectors for immunoscreening. The lambda gtll clones of the 108~2-5 fragments were immunoscreened (Example 6) using human (BV and normal) and chimpanzee #771 serum. Twelve positive clones were identified by first round immunoscreening with the human and chimp sera. Seven of the 12 clones were plaque purified and rescreened using chimpanzee #771 serum. Partial DNA sequences of the insert DNA were determined for two of the resulting clones, designated 3281 and 3282. contained sequences essentially identical to clone 40 These two clones (Example 6). _,The clone 36 insert can be used in a similar manner to probe the original CDNA library generated in lambda gtlo.

Specific subfragments of clone 36 may be isolated by Polymerase chain reaction or after cleavage with restric- tion endonucleases. These fragments can be radioactively labelled and used as probes against the cDNA libraries generated in lambda gtlo (Example 1C). In particular, the ' terminal sequences of the clone 36 insert are useful as probes to identify clones overlapping this region.

Further, the sequences provided by the terminal clone 36 insert sequences and the terminal clone 40 insert sequences are useful as specific sequence primers in first- strand DNA synthesis reactions (Maniatis et al.; Scharf et al.) using, for example, chimpanzee #771 sera generated RNA Synthesis of the second-strand of the cDNA The above procedures identify or as substrate. is randomly’ primed. produce cDNA molecules corresponding to nucleic acid regions that are 5’ adjacent to the known clone 36 and 40 insert sequences. These newly isolated sequences can in turn be used to identify further flanking sequences, and so on, to identify the sequences composing the HCV genome. As described above, after new HCV sequences are isolated, the polynucleotides can be cloned and immunoscreened to identify specific sequences encoding HCV antigens.

IV. Generating Overlapping Cloned Linking Fragments This section describes a nmthod for producing and identifying HCV peptides which may be useful as HCV- diagnostic antigens. The present method is used to generate a series of overlapping linking fragments which span a segment of nucleic acid. The application of the method to generating a series of overlapping linking frag- ments which span a 7,300 basepair segment of the HCV genome, whose sequence is given in the Appendix, will be described with reference to Figures 1 and 2.

As a first step in the method, and with reference to Figure 1, the nucleic acid of interest is obtained in double-strand DNA form. Typically, this isolating genomic DNA fragments or by producing cDNAs from RNA species present in a sample fluid. The latter method is used to generate double-strand DNA from NANBH viral RNA present in serum from chimpanzees or humans with known PT- NANBH infection. Here RNA in the sample is isolated, e.g., by guanidinium thiocyanate extraction of PEG precipitated is done by virions, and reacted with a suitable primer for first strand cDNA synthesis.

First-strand CDNA priming may be by random primers, oligo dT primers, or sequence-specific primer(s). The primer conditions are selected to (a) optimize generation of cDNA fragments which collectively will span the nucleic and (b) produce CDNA fragments which are preferably equal to or greater than about 1,000 basepairs in length. In one method applied to HCV RNA, the first-strand synthesis is carried out using sequence- acid segment of interest, specific primers which are complementary to spaced regions along the length of the known HCV genomic sequence. The primer position are indicated at A, B, C, and D in Figure 2, which shows a map of the HCV genome segment. The basepair locations of the primers in the HCV genome are given in Example 7 below. Following first strand synthe- sis, the second cDNA strand is synthesized by standard methods.

The linking fragments in the method are produced by sequence—specific amplification of the double-strand DNA obtained as above, using pairs of overlap-region primers to be described. According to an important advantage of the methods of the present invention, it is possible to generate linking fragments even when the amount of double- strand DNA is too low for direct sequence-specific amplifi- cation. This limitation was found, for example, with HCV cDNA’s produced from NANBH-infected serum. Here the amount of double-stranded DNA available for amplification is first amplified nonspecifically by a technique known as Sequence- Independent Single-Primer Amplification (SISPA).

The SISPA technique is detailed in co-owned U.S.

Patent application for "RNA and DNA Amplification Tech- niques", 224,961, filed July 26, 1988. The method as applied to amplification of HCV cDNA fragments is known-sequence Serial No. also described in Example 7. Briefly, linker primers are attached to opposite ends of double- stranded DNA in a DNA sample. the common end sequences for primer-initiated amplifica- These linkers then provide using primers complementary to the linker/primer Typically, the SISPA method is carried out for using thermal cycling to tion, sequences. -30 cycles of amplification, achieve successive denaturation and primer-initiated polymerization of second strand DNA.

Figure 1 illustrates the SISPA amplification of duplex DNA, to form amplified fragments which have known-sequence regions P, As seen, the fragment mixture includes at least some fragments which (a) overlap at regions H with other fragments in the mixture and (b) contain complete linking regions between adjacent Piand PH4 regions. Collectively, each linking region bounded by the associated overlap regions making up the segment is present in at least one DNA fragment.

The production of overlapping linking fragments, in accordance with the methods of the present invention, is (PCR) In practic- carried out using the polymerase chain reaction method described in U.S. Patent No. 4,683,195. ing this step of the method, first the total segment of interest is divided into a series of overlapping intervals bounded by regions of known sequence, as just described.

In Figure 2, the 7,300 basepair segment of the HCV genome has been divided into 10 intervals, each about 500-1,000 basepairs in length. The intervals are designated accord- ing to the forward Fiand reverse Q primers used in amplify- ing the sequence, as will be described. The selection of the intervals is guided by (a) the requirement that the basepair sequence at each end of the interval be known, and (b) a preferred interval length of between about 500 and 2,000 basepairs.

In the method applied to the 7,300 basepair segment of the HCV genome, the regions of overlap between the ten intervals were additionally amplified, to verify that the SISPA-amplified cDNA sample contained sufficient HCV CDNA to observe PCR-amplification of HCV linking fragments, and that HCV regions along the entire length of the genome were available for amplification. Each overlap region in the segment can be defined by a pair of primers which includes a forward primer F, and a reverse primer R, which are complementary to opposite strands of opposite ends of the overlap region. The primers are typically about 20 base- pairs in length and span an overlap region of about 200 basepairs. The eleven overlap regions in the HCV segment and the regions corresponding to the forward and reverse primers in each region are given in Example 8.

The primers E/R, are added to the amplified DNA material in a PCR reaction mix, and the overlap region bounded by the primers is amplified by 20-30 thermal cycles. The reaction material is then fractionated, e.g., by agarose gel electrophoresis, and probed for the presence e.g., by Southern blotting using a radiolabeled oligonucleotide probe of the desired sequence, (Southern), which is specific for an internal portion of the overlap region. As described in Example 8, this method was successful in producing amplified fragments for each of the eleven E/Rioverlap regions in the HCV genome segment. The overlap-region fragments may be used as probes for the (two) linking fragments connected by the It is emphasized, that this amplification step was employed to confirm the presence of amplifiable CDNA along the length of the HCV genome, and not as an essential step in producing the desired linking corresponding overlap region. however, fragments. The step is omitted from Figure 1.

The linking fragments E/Rjare produced by a two-primer PCR procedure in which the SISPA-amplified DNA fragments are amplified by a primer pair consisting of the forward primer Fiof one overlap region and the reverse primer Q of an adjacent overlap region. The ten overlap regions in the HCV segment and the regions corresponding to the forward and reverse primers in each region are given in Example 9.

Typical amplification conditions are give in Example 9.

The amplified fragments in each reaction mixture are e.g., confirm the expected fragment size. isolated and purified, by gel electrophoresis, to Southern blots may be probed with oligonucleotide probes complementary to internal regions located between the fragment ends, to confirm the expected sequence of the fragments. As shown at the bottom in Figure 1, the method generates the complete set of linking fragments, where each fragment is bounded by an overlap region Piand PH, The method, as applied to generating ten overlapping linking fragments of the 7,300 basepair HCV genome, is described in Example 9. As demonstrated by size criteria on gel electrophoresis and by sequence criteria by Southern blotting, the method was successful in generating all ten of the overlapping fragments spanning the HCV genome.

It will be appreciated that the amplification method above flanking sequence can be applied to the generation of DNA fragments corresponding to the insert sequences of clones 36 and 40, which have also been obtained by immunoscreening. The linker primers flanking the inserts are easily used to generate sequences corre- sponding to the clone inserts. For example, two-primer amplification of the SISPA-amplified cDNA fragments (Exam- ple 7) using the Fn/Rgprimer pair (the sequences of which are given in Example 8) is carried out under conditions similar to those described in Example 9. The amplified fragment mixture is fractionated by agarose electrophoresis on 1.0 % agarose, and the expected band cut from the gel and eluted.

The purified amplified fragment is treated with the Klenow fragment of DNA polymerase I to assure the molecules are blunt-ended. The fragment is then ligated to EcoRI linkers (Example 10). The mixture is digested with EcoRI and inserted into the lambda gtll vector. The resulting clones contain the entire coding.sequences of either the clone 36 or clone 40 inserts.

.,Alternatively, the original amplified 36/40 fragment (primers Fn/RQ (Boehringer Mannheim, as per manufacturer's instructions) is briefly treated with Exonuclease III to generate a family of fragments with different 5’ ends.

The digestion products are treated as above and ligated into the lambda gt11 vector. The resulting plaques are then immunoscreened. different sets of primers, other than the can be used to directly Further, Fm/R9 primers described above, generate sequence encoding all, or portions, of clones 36 and 40. corresponding to a portion of the 3’ and all of the insert For example, primers Fuflg can generate a fragment sequences of the insert of clone 36 (Figure 4) sequences of clone 40 (Figure 3). Also, primers Fnflh can be used to directly generate a fragment corresponding to a portion of the 5' sequences present in the insert of clone (Figure 4).

V. PT-NANBH Immunoreactive Peptide Fragments Several novel peptide antigens which are immunoreac- tive with sera from human and chimpanzee NANBH-infected sera have been generated from the NANBH linking fragments produced above, in accordance with the methods of the present invention. Further, this method has confirmed antigenic regions previously identified by CDNA library immunoscreening (Section II above). The antigen peptides derived from linking fragments are preferably produced in a method which involves first digesting each of the above linking fragments with DNaseI under partial digestion conditions, yielding DNA digest fragments predominantly in the 100-300 basepair size range, as illustrated in Example . The digest fragments may be size fractionated, for example by gel electrophoresis, to select those in the desired size range.

The digest fragments from each linking fragment are then inserted into a suitable expression vector. one exemplary expression vector is lambda gt11, the advantages of which have been described above.

For insertion into the expression vector, the digest fragments may be modified, if needed, to contain selected restriction—site linkers, such as EcoRI linkers, according the digest frag- to conventional procedures. Typically, ments are blunt-ended, ligated with EcoRI linkers, and introduced into EcoRI-cut lambda gtll. techniques are well known in the art (e.g., al.).

The resulting viral genomic library may be checked to Such recombinant Maniatis et confirm that a relatively large (representative) library has been produced for each linking fragment. This can be done, in the case of the lambda gtll vector, by infecting a suitable bacterial host, plating the bacteria, and exami- ning the plaques for loss of beta-galactosidase activity, as evidenced by clear plaques.

The presence of a digest-fragment insert in the clear plaques can be confirmed by amplifying the phage DNA, using primers specific for the regions of the gtll phage flanking the EcoRI insert site, as described in Example 10B. The results in Table 3 show that a large percentage of the plaques tested in each linking fragment library contained a digest-fragment insert.

The linking-fragment libraries may also be screened for peptide antigens which are immunoreactive with human or chimpanzee sera identified with PT-NANBH chronic, convales- or acute infection. cent, One preferred immunoscreening method is described in Example 10B. Here recombinant pro- tein produced by the phage-infected bacteria is transferred from the plaques to the filter. After washing, the filter is incubated with test serum, and then reacted with repor- ter-labeled anti-human IgG antibody. peptide antigen on the filter is then assayed for the pre- The presence of the sence of the reporter. As seen from Table 3, several of the linking-fragment libraries were positive for immunore- active peptides in the primary screen.

The immunoscreening method just described can be used to identify library plaques from each of the linking libra- ries which are immunoreactive with sera from human or chim- panzee with known chronic, convalescent, or acute PT-NANBH infection. one exemplary screening procedure is given in Example 11, where the ten HCV linking—fragment libraries are screened with known PT-NANBH (a) human chronic serum, (b) chimpanzee acute pooled sera and (c) chimpanzee chronic pooled sera. Of the ten libraries examined, only the F}/Rm library did not give positive immunoreaction with any of the three sera. Several of the fragment libraries, inclu- ding F3/R4, F6/Rn, F12/R7, and F7/R3 showed five or more positive reactions with chimpanzee acute sera, indicating that these libraries each express one or more peptide anti- gens which are useful for detecting chimapanzee or human acute PT-NANBH infection.

The fragment library F3/R, corresponds to an internal fragment of clone 36 insert (Section II; Figure 4). Accor- dingly, the linking fragment method confirmed that this DNA region encodes a useful antigen. Further, the fragment library Fuflg contains the sequences present in the clone 40 insert (Section II: Figures 3 and 4). The results in Table 4 indicate that at least one peptide antigen effective to detect the presence of chronic-infection serum was isolated from the F3/R9 fragment library.

VI. Immunoreactive 4091 Peptides A. Immunoreactive Screening Two of the immunoreactive plaques identified by immu- designated 4091(abc) and 409 were tested for immunoreactivity against well- noreactive screening, 1(c-a), documented PT-NANBH chronic immunoreactivity to the 51 HCV peptide antigen (Kuo).

The 51 HCV peptide antigen has previously been identi- sera which showed strong fied as immunoreactive against a high percentage of human PT-NANBH chronic sera. The 51 antigen is encoded by the sequence between basepairs 3731 and 3857 in the HCV genome (Appendix) and is itself contained in a larger peptide an- tigen C-100 encoded by the sequence between basepairs 3531 and 4442. The latter peptide is employed in a commercial diagnostic kit for detection of human HCV (Ortho/Chiron). The kit is reported to react positively with about 80% of human chronic PT-NANBH samples, and about % of human acute PT-NANBH sera, as noted above.

The 4091 phage was identified by immuno- screening and plaque purified, infection (C-a) as outlined above. A related clone, designated 4091(abc), was described in the parent to the present application (U. 8.

Ser. No. 07/505,611, Clone 4091(abc) was designated 4091 in the parent The a, regions of the 409-1—1(abc) sequence (see Figure 5). The Application herein incorporated by reference). application. b and c designations refer to three 51 coding sequence was isolated by polymerase chain reaction using oligonucleotide primers complementary to the ends of the 51 coding region, and cloned into lambda gt11,for expression under induction conditions of a fused beta-galactosidase protein which includes the 51 antigen peptide region. The 51 phage was identified and plaque purified by similar methods.

The 4091(c-a) and 51 antigens were compared by plaque immunoscreening with a panel of 28 sera from normal (2 donors), human PT—NANBH-chronic (6 donors), chimpanzee chimpanzee PT—NANBH-acute (5 donors), with the As can be seen in normal (7 donors), and chimpanzee PT—NANBH-chronic (8 donors), results shown in Table 5 in Example 12.

Table 5, the 51 and 4091(c-a) peptides reacted with most of the human and chimpanzee chronic sera, although the 4091(c—a) peptide detected a higher percentage of human chronic sera samples (83% vs 66%). The chronic human serum which was detected by the 409—1—1(c-a) peptide, but not by 51 was from a patient (BV) who died of fulminant NANBH infection. Because the 51 antigen is contained within the C-100 antigen in the commercially available kit format (Ortho/Chiron), it was of interest to determine whether the C-100 antigen gave a broader range of reactivity with the test sera. The results are shown at the right in Table 5 The only human NANBH serum that was tested was the This serum below. above BV serum which was not detected by 51. was also not immunoreactive with the C-100 antigen (0/1).

Nor was the C-100 antigen reactive with any of the five acute chimp sera which were tested (0/5). It is also noted that the 4091(c-a) antigen is immunoreactive with 3 of the 5 acute chimpanzee sera tested, The results indicate that compared with only 1 out of 5 for the 51 antigen. the 4091(c-a) antigen has broader immunospecificity with PT—NANBH sera, and thus would provide a superior diagnostic agent. The results obtained with 4091(c—a) are compara- ble_to the results obtained using 4091(abc).

It is noted here that the 4091(abc) coding sequence is contained in the In/R5 linking fragment and does not overlap the sequence of the C-100 (and 51) coding region which is in the F4/R5 and F,/R6 linking fragments. The relatively long coding sequence of the 4091(abc) peptide illustrates that larger size digest fragments (substantial- ly greater than 300 basepairs) are generated in the partial digest step used in producing digest fragments for antigen expression.

The 4091(abc) peptide, has the amino acid presented as SEQ ID N0:10. corresponding to the insert in the 4091 clone is given sequence which is The DNA coding sequence in Figure 5 and is presented as SEQ ID NO:9.

The 409-1—1(c-a) peptide, has the amino acid sequence presented as SEQ ID NO:8. The DNA coding sequence corresponding to the insert in the 4091(c-a) clone is given in Figure 6 and is presented as SEQ ID NO:7. The relationship between the 4091(c-a) and 4091(abc) is Briefly, 4091(c-a) consists of coding sequence of outlined in Example 12. a carboxy terminal region of 4091(abc) moved to the amino terminus of the 4091 coding sequence, with a truncation of the remaining 3' 4091(abc) coding se- quence. peptide antigen which is More generally, a immunoreactive with sera from humans with HCV infection is described. Such identifiable by the methods of the present invention. peptide antigens are readily Antigens obtained from the region corresponding to the HCV sequences encoding the 4091 antigens were further character- ized as follows. The primers shown in Table 7 were used to generate a family of overlapping amplified fragments derived from this region. Several templates were used for the DNA amplification reactions (Table 8). The relation- ships of the coding sequences of the resulting clones to each other are graphically illustrated in Figure 7. The amplified fragments were then cloned into lambda gt11 vectors (Example 13). then immunoscreened Seven of the nine clones tested positive by These cloned fragments (Example 13). preliminary immunoscreening (Table 9). were These seven clones were then tested against a more extensive battery of PT- NANBH serum samples, including numerous human clinical samples. The sensitivity of the antigens, in decreasing order, for reactivity with the serum used for screening was as follows: 33cu > 33c > 4091(c-a) > 4091-F1R2 > 409-l-l(abC) ~ 409la > 51 > 4091(C+270). be seen from these results all of the alternative clones, with the exception of 4091(c+270), However, although 33cu and in this assay they AS can provided a more sensitive antigen than 51. 33c were very sensitive antigens, reacted slightly with serum which was known to be negative for HCV and may therefore be less specific. Accordingly, the 4091 series appears preferable for use as diagnostic antigens since they are more specific to HCV-induced antibodies.

The immunoscreening was extended to include the clone 36 and 45 encoded epitopes: the insert of clone 45 is essentially the same as the insert of clone 40 (Example 4).

As can be seen from the results presented in Table 11, the antigens produced by clones 36 and 40, while not as sensitive as 4091(c-a), do yield HCV—specific immunopo- sitive signals with selected samples. Accordingly, the two methods presented in the present invention, (i) immuno- screening of CDNA libraries generated directly from sera- derived RNA, and (ii) immunoscreening of amplified-fragment can both be seen to be effective methods of identifying cDNA confirmation of the clone 36 and 40 encoded libraries, sequences encoding viral antigens.

Further, antigens by identification of antigens corresponding to these HCV' regions using the amplified—fragment library method validates the usefulness of the amplified-fragment method.

B. Peptide Purification The recombinant peptides of the present invention can be purified by standard protein purification procedures which may include differential precipitation, molecular sieve chromatography, ion-exchange chromatography, isoelec- tric focusing, gel electrophoresis and affinity chromatog- raphy. In the case of a fused protein, such as the beta- galactosidase fused proteins prepared as above, the fused protein can be isolated readily by affinity chromatography, by passing cell lysis material over a solid support having surface-bound anti-beta-galactosidase antibody. For example, purification of a beta-galactosidase/fusion protein, derived from 4091(c-a) coding sequences, by affinity chromatography is described in Example 14.

A fused. protein containing the 409-1—1(a) peptide fused with glutathione-S-transferase (Sj26) protein has also been expressed using the pGEX vector system in E. coli KM392 cells (Smith). advantage that the fused protein is generally soluble and This expression system has the therefore can be isolated under non—denaturing conditions.

The fused Sj26 protein can be isolated readily by glutathi- This method of expressing this fusion protein is given in Example 15 and is applicable to any of the other antigen coding one substrate affinity chromatography (Smith). sequences described by the present invention.

Also vector, such as the lambda gtll or pGEX vectors described sequence and included in the invention is an expression above, containing the 4091(a) coding expression control elements which allow expression of the coding region in a suitable host. The coding sequence is contained in the sequence given above corresponding to 2755-3331 of the HCV elements generally include a promoter, translation initia- basepairs The control genome. tion codon, and translation and transcription termination sequences, and an insertion site for introducing the insert In the case of the two vectors illu- strated in Example 15, the control elements control the synthesis of the protein which is fused with the heterolo- Such expression vectors can be into the vector. gous peptide antigen. readily constructed for the other antigen coding sequences described by the present invention.

The lambda gt11 vectors containing the following coding regions have been deposited with The American Type 12301 Parklawn Dr., Rockville MD, 20852: the 4091(abc) coding region, designated gt11/- 4091(abc), ATCC No. 40876; the 4091(c-a) region, designated gt11/4091(c-a) ATCC No. 40792; clone 36, designated gtll/36, ATCC No. 40901; designated gt11/40, ATCC No. 40893.

Culture Collection, coding and, clone 40, VII_,_Immunoreactive Clones of the HCV—Capsid Antigen At the 1990 Congress of Hepatology a region of the full-length HCV nucleic acid nucleotide residues 325-970, containing the HCV non-coding, sequence was presented, structural core protein and envelope protein coding sequen- ces as capsid parts of a polyprotein sequence. During the course of experiments performed in support of the present invention, the coding region that corresponds to the capsid protein was more clearly defined.

Polymerase Chain Reaction primers were constructed from selected HCV sequence which would generate amplifica- tion products of nucleotides 325-970 of the full length HCV These primers, SF2(C) and SR1(C), The primers contained non- genome (see Appendix). are presented in Example 16. complementary sequences which encoded restriction enzyme cleavage sites to facilitate subsequent cloning manipula- tions. The primers were used in amplification reactions containing SISPA-amplified HCV cDNA molecules (Example 7) as substrate. The resulting amplification products were cloned into the pGEX and pET vectors (Example 16). The pGEX vector allows expression of inserted coding sequences as fusion proteins to the Sj26 protein, glutathione-s- transferase. Insertion into the pET vector allows expres- sion of the inserted coding sequences independent of fusion sequences.

These clones were then immunologically screened using sera known to be reactive with HCV-antigens (Example 17).

Several clones in both vectors were identified which were immunoreactive with the anti-HCV sera (in pGEX, clones 14, , 56, 60, and 65, Example 17, Table 13). that the fusion proteins which. were produced from the It was observed clones in pGEX were smaller than expected.

.,Clone 15 was selected for scaled up production of the Sj26/HCV—antigen fusion protein. The fusion protein product (approximately 29 kd) was smaller than the expected fusion product (approximately 50 kd, Example 17). Further, the yield of the fusion protein from this preparation was unexpectedly low. A Clones 15 and 56 were chosen for nucleic acid sequenc- ing of the HCV-antigen containing inserts (Example 18).

The sequences of the two clones were very similar with the exception that clone 15 had a termination codon starting at nucleotide position 126. This result suggested that the amino terminal 42 amino acids encoded by the HCV insert were immunogenic in regard to the anti—HCV sera used for immunoscreening.

To test the suggestion that the amino terminus of the HCV polyprotein was antigenic, a synthetic oligopeptide was corresponding to amino acid residues 6-24 of Figure 8A: this peptide had very strong immunoreactivity with anti—HCV sera as tested by ELISA. c1 and NC105) generate a clone corresponding to this region (Figure 10, C1NC105, SEQ ID NO:25). Three other synthetic peptides were tested, one of which was strongly immunoreactive with constructed essentially PCR primers (Figure 8, were designed to anti-HCV sera (amino acid residues 47-74, Figure 8A) and two which were weakly immunoreactive (amino acid residues 39-60 and 101-121, confirm the presence of a strong antigenic region at the Figure 8A). These synthetic peptides amino-terminal end of the HCV polyprotein in the capsid protein region.

The sequence of clone 56, designated pGEX-GG1-56, is shown in Figure 8A and is presented in the sequence listing as SEQ ID N0:1l. longflopen reading frame.

The sequence shows that the clone has a When production of the fusion protein was induced, a fusion protein smaller than the expected product was produced, similar in size to the clone product. The nucleotide sequence of the clones revealed a region which is prone to translational frameshifting, AAAAAAAAAA (Atkins et a1., Wilson et al.). Such a nucleo- tide sequence may contribute to the low protein yields when these clones are expressed in E. coli. In an effort to improve the level of fusion protein expression the third nucleotide position of several codons through this region was changed to a G resulting in the sequence AGAAGAAGAA (Example 20): the changes had no effect on the protein coding sequence Figure 8A).

This modified insert was cloned into the pGEX vector and (amino acid residues 8-10, the resulting plasmid named pGEX-CapA.

A hydropathicity plot was generated for the protein coding sequences of the insert of pGEX—GG1 (Example 19, The results of this analysis indicated that the approxi- Figure 9). carboxy-terminal region of the encoded protein, mately amino acid residues 168?182, had the potential for being a membrane spanning segment. Since it was unlikely that the membrane spanning segment would provide a strong antigen and since overproduction of proteins with these regions can adversely affect the growth of bacterial cells, a series of carboxy terminal deletions were generated from pGEX-CapA (Example 20).

To generate the carboxy terminal deletions PCR primers were designed to be complementary to various regions of the pGEX-CapA insert encoded protein. The primers used to generate the carboxy terminal deletions are given in Table 14 and the location of the primers relative to the insert coding sequence is presented in Figure 8B. The carboxy terminal deletion fragments were cloned into the pGEX vector and Sj26/HCV—insert fusion proteins were produced.

These fusion proteins were then screened with anti-HCV sera epitope map generated for the immunoreactive polypeptides (see Figure 10). Clones C1NC270, C1NC360, and C1NC450 all expressed high levels of the Sj26/HCV fusion proteins. Further, these fusion proteins all corresponded to the size predicted from their nucleic acid coding sequences. Clones C1NC520 and C1NC58o gave poor yields of fusion proteins suggesting that when the hydrophobic region of amino acid residues 168-182 is present it may in part be and an responsible for the poor protein yields previously ob- tained.

The deletion analysis was continued to further dissect the antigenic regions of the pGEX-CapA encoded HCV antigen.

A series of amino terminal deletions (primers in Table 15) combined with carboxy terminal deletions were generated the locations of all the primers are illustrated in Figure 8B.

The results of the deletion analysis are presented in combined with using PCR primers: Table 16 and in Figure 10. These results, the synthetic peptide data presented above, suggest that the capsid protein (which comprises the N-terminus of the HCV polyprotein) has two dominant immunoreactive regions.

Both of these immunoreactive regions are useful use as diagnostic antigens. The region comprising the first 35 amino acids spans one of the epitopes and the region spanning residues 34-90 encompasses the other strongly immunoreactive domain.

In summary, all of the pGEX clones containing the N- terminus of the HCV polyprotein and either 34, 90, 120 or 150 residues produced large quantities of fusion protein which_ was shown to be efficiently recognized by HCV positive sera. Expression of the PCR inserts containing amino acid residues 34-90 was also strongly immunoreactive, whereas inserts encoding residues 90-120 or 90-150 were not immunoreactive, demonstrating that these regions were not recognized by human sera. This result suggests that the regions important for the production of recombinant antigens is contained between residues 1 through 90.

Analyses of the pGEXC1NC450 protein and the pET360 protein showed that the inclusion of these antigens in Western and ELISA formats permitted the identification of HCV positive sera which had been previously identified as either HCV negative or HCV indeterminate. Accordingly, the inclusion of these epitopes permits the generation of an improved screening system (Example 21).

VIII. Anti-HCV Antigen Antibodies Antibodies specific against the recombinant antigens of the present invention are also described. Typically, to prepare antibodies, a host animal, such as a rabbit, is immunized with the purified antigen or fused protein antigen. The host serum or plasma is collected following an appropriate time interval, and this serum is tested for antibodies specific against the antigen. Example 15 describes the production of rabbit serum antibodies which are specific against the 4091 antigens in the Sj26/4091(a) and beta-galactosidase/409- 1-1(c-a) applicable to the other antigens of the present invention. fusion protein. These techniques are equally The gamma globulin fraction or the IgG antibodies of immunized animals can be obtained, for example, by use of saturated ammonium sulfate or DEAE Sephadex, or other techniques known to those skilled in the art for producing polyclonal antibodies.

Alternatively, the purified antigen or fused antigen protein may be used for producing monoclonal antibodies.

Here the spleen or lymphocytes from an immunized animal are removed and immortalized or used to prepare hybridomas by methods known to those skilled in the art. To produce a human—human hybridoma, a human lymphocyte donor is select- ed. A donor known to be infected with an HCV virus (where infection has been shown for example by the presence of anti—virus antibodies in the blood) may serve as a suitable lymphocyte donor. isolated from a Lymphocytes can be peripheral blood sample or spleen cells may be used if the donor is subject to splenectomy. Epstein-Barr virus (EBV) can be used to immortalize human lymphocytes or a human fusion partner can be used to produce human—human hybrido- mas. Primary in vitro immunization with peptides can also be used in the generation of human monoclonal antibodies.

Antibodies secreted by the immortalized cells are screened to determine the clones that secrete antibodies of the desired specificity, for example, using the Western blot method described in Example 15.

IX. Utility A. Diagnostic Method and Kit The antigens identified by SEQ ID No.: 6 obtained by the methods of the used as a invention can be anti—HCV present diagnostic agent for antibodies present in HCV—infected. sera. As noted. above, many of the antigens described provide the advantage over known,HCV antigen reagents 51 and C-100 in that they are immunoreactive with a vdder range of PT-NANBH infected sera, particularly acute—infection sera. This is particu- larly true of combinations of the 4091 antigens with the HCV-core protein antigens as described in Section VII above. The antigens 4091(c-a) combined in an ELISA test kit and tested against HCV test kits produced by Abbott and Ortho. of the present invention consistently identify more HCV+ samples and Cap45O have been The antigen with a high degree of specificity which is comparable to or better than the Abbott and Ortho test kits.

In one preferred diagnostic configuration, test serum is reacted with a solid phase reagent having a surface- bound HCV antigen identified by SEQ ID No.: 6 obtained by the methods of the present invention.

After binding anti—HCV antibody to the reagent and removing unbound serum components by washing, the reagent is reacted with reporter-labeled anti-human antibody to bind reporter to the reagent in proportion to the amount of bound anti—PT-NANBH antibody on the solid The reagent is again washed to remove unbound and the amount of reporter associated Typically, the reporter is support. labeled antibody, with the reagent is determined. an enzyme which is detected by incubating the solid phase in the presence of a suitable fluorometric or colorimetric substrate.

The solid surface reagent in the above assay is prepared by known techniques for attaching protein material to solid support material, such as polymeric beads, dip These attachment methods generally include non-specific adsorption of the sticks, 96-well plate or filter material. protein to the support or covalent attachment of the protein, typically through a free amine group, to a chemically reactive group on the solid support, such as an activated carboxyl, hydroxyl, or aldehyde group.

In a second diagnostic configuration, known as a homogeneous assay, antibody binding to a solid support produces some change in the reaction medium which can be directly detected in the medium. Known general types of homogeneous assays proposed heretofore include (a) spin- labeled reporters, where antibody binding to the antigen is detected by a change in reported mobility (broadening of the spin splitting peaks), (b) fluorescent reporters, where binding is detected by a change in fluorescence efficiency, (c) enzyme reporters, where antibody binding effects enzyme/substrate interactions, and (d) liposome-bound reporters, where binding leads to liposome lysis and release of encapsulated reporter. The adaptation of these methods to the protein antigens of the present invention follows conventional methods for preparing homogeneous assay reagents.

In each of the assays described above, the assay method involves reacting the serum from a test individual with the protein antigen and examining the antigen for the presence of bound antibody. The examination may involve attaching a labeled anti-human antibody to the antibody being examined, either IgM (acute phase) or IgG (convales- cent or chronic phase), and measuring the amount of reporter bound to the solid support, as in the first method, or may involve observing the effect of antibody binding on a homogeneous assay reagent, as in the second method.

Also forming part of the invention is an assay system or kit for carrying out the assay method just described.

The,kit generally includes a support with surface-bound (identified by SEQ ID No.: 6), antibody for recombinant HCV antigen and a reporter—labeled anti—human detecting surface-bound anti-PT—NANBH—antigen antibody.

As discussed in Section III above, peptide antigens associated with several of the linking-fragment libraries are immunoreactive with acute NANBH sera from chimpanzees, indicating that the peptides would be useful for detecting acute NANBH infection in human serum. In particular, one or more peptide antigens produced by the linking fragment F3/R9 (reactive with chronic sera), F3R4, F613", FHRN Ffiq, or Ffig (which are shown in Example 11 to produce one or more peptide antigens which are immunoreactive with can be combined with the 4091 antigens to provide a diagnostic composition capable of libraries, acute chimpanzee sera) immunoreacting with a high percentage of both chronic and acute human NANBH serum samples. Further, as discussed in section VII above inclusion of the HCV-capsid protein antigens add an extra level of sensitivity.

A third diagnostic configuration involves use of the anti-HCV antibodies, described in Section VI above, capable of detecting HCV specific antigens. The HCV antigens may be detected, for example, using an antigen capture assay where HCV antigens present in candidate serum samples are reacted with an HCV specific monoclonal antibody. The monoclonal antibody is bound to a solid substrate and the antigen is then detected by a second, different labelled anti-HCV antibody: present invention which are directed against HCV specific the monoclonal antibodies of the antigens are particularly suited to this diagnostic method.

B. .Peptide Vaccine The HCV antigens identified by the methods of the e.g. 409-1—1(c-a) and HCV—core protein antigens, can be formulated for use in a HCV vaccine. The present invention, vaccine can be formulated by standard methods, for example, saline, buffered salines, and the like.

The immunogen is administered using standard techniques for in a suitable diluent such as water, complete or incomplete adjuvants, antibody induction, such as by subcutaneous administration of physiologically compatible, sterile solutions containing inactivated or attenuated virus particles or antigens. An immune response producing amount of virus particles is typically administered per vaccinizing injection, typically in a volume of one milliliter or less.

A specific example of a vaccine composition includes, in a pharmacologically acceptable adjuvant, a recombinant 409l(c-a) periodic intervals until a significant titer of anti-HCV peptide. The vaccine is administered at antibody is detected in the serum. Such vaccines can also comprise combinations of the HCV antigens.

C. Passive Immunoprophylaxis The anti-HCV antibodies of the invention can be used as a means of enhancing an anti-HCV immune response since antibody-virus complexes are recognized by macrophages and other effector cells. The antibodies can be administered in amounts similar to those used for other therapeutic administrations of antibody. For example, globulin is administered at 0.02-0.1 ml/lb body weight during the early incubation of other viral diseases such as measles and hepatitis B to interfere with viral Thus, example, the 4091(c—a) antigen can be passively adminis- tered alone in a "cocktail" with other anti-viral antibod- pooled gamma rabies, entry into cells. antibodies reactive with, for ies or in conjunction with another anti-viral agent to a host infected with a PT-NANBH virus to enhance the immune response and/or the effectiveness of an antiviral drug.

The following examples illustrate various aspects of the invention, but are in no way intended to limit the scope thereof.

Materials E. coli DNA polymerase I (Klenow fragment) was obtained from Boehringer Mannheim Biochemicals (Indianapo- lis, IN). T4 DNA ligase and T4 DNA polymerase were obtained from New England Biolabs (Beverly, MA); Nitrocel- lulose filters were obtained from Schleicher and Schuell (Keene, NH).

Synthetic oligonucleotide linkers and primers were prepared using commercially available automated oligonu- custom designed cleotide synthesizers. Alternatively, synthetic oligonucleotides may be purchased, for example, from Synthetic Genetics (San Diego, CA). cDNA synthesis kit and random priming labeling kits were obtained from Boehringer-Mannheim Biochemical (BMB, Indianapolis, IN).

Example 1 Construction of NANB-containing cDNA libraries A. Infection of a Chimpanzee with HCV A chimpanzee (#771) was inoculated with a Factor VIII preparation which was known to cause parenterally transmit- ted,non-A non-B hepatitis (PT-NANBH) treated with the Factor VIII concentrate (Bradley). infection ultrastructural changes in liver tissue were in human patients Post- observed by electron microscopy and ALT (alanine amino transferase) elevation was observed in the infected chimpanzee. These observations are consistent with PT- NANBH infection.

B. Isolation of RNA from Sera serum was collected from the above described infected chimpanzee (#771) and four human PT-NANBH clinical sources (EGM, BV, CC and WEH). Ten milliliters of each undiluted serum was pelleted by centrifugation at 30K, for 3 hours in an SW40 rotor, at 4%L RNA was extracted from each result- ing serum pellet using the following modifications of the hot phenol method of Feramisco et al. Briefly, for each individual serum sample, the pellet was resuspended in 0.5 ml of 50 mM NaOAc, pH=4.8, containing 1% SDS. An equal volume of 60%Iphenol was added and incubated for 15 minutes at GWT with occasional vortexing. This mixture was transferred to a 1.5 ml microfuge tube and spun for two minutes at room temperature in a table top microfuge. The aqueous phase was transferred to a new microfuge tube. To the aqueous phase, 50 pl of 3 M NaOAc, and two volumes of 100% ethanol were added. pH=5.2, This solution was held at -70%: for approximately 10 minutes and then spun in a microfuge at TT for 10 minutes. The resulting pellet was resuspended in 100 pl of sterile glass distilled water. To this solution 10 pl of NaOAc, pH=5.2, and two volumes of 100% ethanol were added. The solution was held at -70%:for at least 10 minutes. The RNA pellet was recovered by centrifugation in a microfuge at 12,000 X g for 15 minutes at 59C. under vacuum.

The pellet was washed in 70% ethanol and dried C. Synthesis of cDNA (i) First Strand Synthesis The synthesis of CDNA molecules was accomplished as follows. The above described RNA preparations were each resuspended in 26 pl of sterile glass distilled water (treated with diethyl pyrocarbonate, Maniatis et al.), 5 pl of 10 X reaction buffer (0.5 M Tris Hcl, pH=8.5; 0.4 M Kcl; 0.1 M Mgclz; 4 mM DTT), (dGTP, dATP, dTTP, and dCTP, each at a concentration of 5 mM), 0.25 pl of "P-dCTP, 2 pl AMV reverse transcriptase, and 2 pl of RNASIN (Promega), in a pl of a nucleotide solution pl random primer, total reaction volume of 50 pl. This mixture was incubated for one hour at 41C. (ii) Second Strand CDNA Synthesis To the first strand synthesis reaction mixture the following components were added: 55 pl of 2 }( second strand synthesis buffer (50 mM Tris Hcl, pH=7.0; 60 mM Kcl); 2 pl RNase H; 5 pl DNA polymerase I, and 2 pl of the above described nucleotide solution. The reaction was incubated for one hour at 12, followed by a one hour incubation at room temperature. The reaction mixture was extracted with an equal volume of 1:1 phenol/chloroform, followed by an extraction using 24:1 chloroform/isoamyl alcohol. To each reaction mixture 1 pl of 10 mg/ml tRNA was added as carrier. The cDNA was precipitated by the addition of two volumes of 100% ethanol and chilling at - 76 for 15 minutes. The cDNA was collected by centrifu- gation, the pellet washed with 70% ethanol and dried under vacuum. ."(iii) Preparation of the Double Stranded cDNA for cloning To provide vector compatible ends each of the double stranded cDNA preparations was tailed with EcoRI linkers in the following manner.

The CDNA was treated with EcoRI methylase under the The cDNA pellet was resuspended in pH=7.5; 1 mM following conditions: pl 1x methylase buffer (50 mM Tris Hcl, EDTA; 5 mM DTT), 2 pl 0.1 mM S-adenosyl-methionine (SAM) and 2 pl EcoRI methylase (New England Biolabs). The reaction was incubated for 30 minutes at 37°C. TE buffer (10 mM Tris-Hcl, pH=7.5; 1 mM EDTA, pH=8.0) was added to achieve a final volume of 80 pl. The reaction mixture was extracted with an equal volume of phenol/chloroform (1:1) and then with an equal volume of chloroform/isoamyl alcohol (24:1).

The CDNA was precipitated with two volumes of ethanol.

To maximize the number of blunt ends for the addition of linkers (Maniatis et al, 1982) the CDNA was then treated with the Klenow fragment of DNA polymerase I. The pelleted CDNA was resuspended in 11.5 pl of distilled water. The following components were added to the resuspended CDNA: 4 pl of 5 X NTB (10 X NTB stock solution: 0.5 M Tric.Cl pH=7.2; 0.1 M MgSO4; 1 mM dithiothreitol (DTT); 500 pg/ml bovine serum albumin (BSA)); 3 pl 0.1 M Mgclz, 1.5 pl IOGATC (a solution containing 10 mM of each nucleotide G, A, T, and C), and 1 pl Klenow (Boehringer Mannheim Biochemicals).

The reaction mixture was incubated at room temperature for minutes. The reaction ‘mixture was extracted with phenol/chloroform and chloroform isoamyl alcohol as described above, and then precipitated with two volumes of ethanol.

The CDNA pellet was resuspended in 12 pl distilled water. To the resuspended linkers the following components were added: 5 pl EcoRI phosphorylated linkers (New England Biolabs), 2 pl 10x ligation buffer (0.66 M Tris.Cl pH=7.6, 50 mM MgCly 50 mM DTT, 10 mM ATP) and 1 pl T4 DNA ligase.

The follow- ing morning the reaction was incubated at 67°C for three The reaction was incubated at 14°C overnight. minutes to inactivate the ligase, then momentarily chilled.

To the ligation reaction mixture 2.5 pl of 10 X high salt restriction digest buffer (Maniatis et al.) and 2.5 pl of EcoRI enzyme were added and the mixture incubated at 37°C for at least. 6 hours to overnight. To remove excess linkers the digestion mixture was loaded onto a 1.2% agarose gel and the reaction components size fractionated Size fractions of the 0.3-1.3 Kb and 1.3-7 Kb electroeluted NA45 paper (Schleicher and Schuell). The NA45 paper, with the eluted CDNA bound to it, was placed in a 1.5 ml microfuge tube containing 0.5 ml of elution solution (50 mM arginine, 1 M Nacl, pH=9.0). The tube was‘ then placed at 67°C for approximately one hour to allow the CDNA to be eluted from The solution was then by electrophoresis. ranges were onto the paper into the solution. phenol/chloroform, chloroform/isoamyl alcohol extracted and precipitated with two volumes of ethanol. The resulting cDNA pellets were resuspended in 20 pl TE (pH=7.5). (iv) (Cloning of the CDNA into Lambda Vectors The linkers used in the construction of the cDNAs contained an EcoRI site which allowed for direct insertion of the amplified cDNAs into lambda gtlo and gtll vectors (Promega, Madison WI). Lambda vectors were purchased from the manufacturer (Promega) which were already digested with EcoRI and treated with bacterial alkaline phosphatase, to remove the 5' phosphate and prevent se1f—ligation of the vector.

The EcoRI-linkered cDNA preparations were ligated into both lambda gtlo and gtll (Promega). ligation reactions were as follows: (Promega, 0.5 mg/ml); 0.5 or 3 pl of insert CDNA; 0.5 pl 10 X ligation buffer (0.5 M Tris-Hcl, pH=7.8; 0.1 M Mgclz; 0.2 M DTT; 10 mM ATP; 0.5 g/ml BSA), 0.5 pl T4 DNA ligase (New England Biolabs) and distilled water to a final reaction The conditions of the 1 pl vector DNA volume of 5 pl.

The ligation reaction tubes were placed at 14°C overnight (12-18 hours). The ligated cDNA was packaged the following morning by standard procedures using a lambda DNA packaging system (GIGAPAK, Stratagene, LaJolla, CA), and then plated at various dilutions to determine the titer and recombinant frequency of the libraries. A standard X-gal blue/white assay was used to screen the lambda gtll E. coli HG415 (from Dept.of Pathology, Stanford School of which allows only plaque formation by recombinant clones, was used for plating the The standard strain, E. coli C600hF" may be used as an alternative to E. coli HG415. libraries (Miller; Maniatis et al.).

Howard Gersenfeld, Medicine) plating bacteria, lambda gtlo libraries.

Example 2 Screening the CDNA library for production of PT-NANBfl antigens The five lambda gt11 libraries generated in Example 1 were screened for specific HCV encoded viral antigens by immunoscreening. The phage were plated for plaque forma- tion using the Escherichia coli bacterial plating strain E. coli KM392 (Kevin Moore, DNax, Palo Alto, CA). tively, E. coli Y1088 may be used..

Alterna- The fusion proteins expressed by the lambda gt11 clones were screened with serum antibodies (Young et al.) from the following sources: chimpanzee #771 and various human PT-NANBH sera (including EGM, BV, WEH and AG).

From the lambda gt11 libraries (Example 1) approxi- mately 111 independent clones gave a positive immunological reaction with at least one of the chimp or human PT-NANBH sera. These phage clones were plaque purified and the recombinant phage grown for DNA purification (Maniatis et al.).

Example 3 Genomic Hybridization Screening of Immunopositive Clones out of the 111 plaque purified recombinant phage, obtained as in Example 2, 93 were isolated (Maniatis et al.) and digested with EcoRI as per the manufacturer's instructions (Bethesda Research Laboratories, Gaithersburg, MD). Approximately 1.0 microgram of each digested phage DNA sample was loaded into sample wells of 1.0% agarose gels prepared using TAE (0.04 m Tris Acetate, 0.001 M EDTA). separated.

The DNA samples were then electrophoretically DNA bands were visualized by ethidium bromide staining (Maniatis et al.). Inserts were clearly identi- fied for each of the 93 clones, purified by electroelution using NA45, and then radioactively labelled by nick translation (Maniatis et al.).

Human peripheral blood lymphocyte (PBL) DNA was restriction digested with HindIII and EcoRI, loaded on a 0.7% agarose gel (as above, except 10 pg of DNA was loaded per lane) and the fragments separated electrophoretically.

The DNA fragments in the agarose gels were transferred to (Southern) and the genomic DNA probed with the nick-translated lambda gtll inserts which nitrocellulose filters were prepared above.

The filters were washed (Southern; Maniatis et al.) Forty-three of the 93 lambda clone inserts displayed a positive hybridization reaction with the human PBL DNA. clearly did not hybridize with the PBL DNA, were 11 inserts derived from chimp #771 clones which were also clearly Of these 11 clones, two of and exposed to X-ray film.

Among the remaining inserts which immunopositive from Example 2. the clones had the immunoreactive characteristics summa- rized in Table 1. Chimpanzee #771 and humans Ag, BV and WEH were chronimc PT—NANBH sera samples and SKF was a normal human serum sample.

Table 1 sera Clone Designation #771 + + AG + - BV + - WEH - - Clone 40 (original clone screening designation 3041) was clearly exogenous, i.e., not derived from normal human DNA, as evidenced by repeated hybridization tests against normal human PBL DNA, and a second clone, designated clone 36 (original clone screening designation 3034), was not only exogenous but also reactive with multiple PT-NANBH antisera.

Example 4 w Sequencing of Clones DNA sequencing was performed on clones 36 and 40 as described in Example 3. Commercially available sequencing primers (New England Biolabs) homologous to flanking lambda sequences at the 5' and 3' ends of the inserts were initially used for sequencing. As sequencing progressed primers were constructed to correspond to newly discovered sequences. Synthetic oligonucleotide primers were prepared using commercially available automated oligonucleotide synthesizers. Alternatively, custom «designed synthetic oligonucleotides may be purchased, for example, from Synthetic Genetics (San Diego, CA).

DNA sequences were determined for the complete insert of clone 40 (presented as SEQ ID NO:1 and also shown in Figure 3); this sequence corresponds to nucleotides 6516 to 7070 of the HCV genome (Appendix). Subsequently, the inserts present in clones 44 and 45 (2 other clones of the 11 clones identified in Example 3) were found to cross- hybridize to the clone 40 insert. Partial sequencing of clones 44 and 45 showed that the sequences obtained from these two clones matched the sequence of clone 40. A par- tial sequence of the clone 36 insert was determined and is presented as SEQ ID NO: 3; the complete sequence is pre- sented as SEQ ID NO:S and is also shown in Figure 4. The sequence of clone 36 corresponds to nucleotides 5010 to 6515 given in the Appendix.

Example 5 Screening of the cDNA librarv in lambda qtlo The cDNA libraries in lambda gtlo, were screened for the presence of sequences generated in Example 1, homologous to the clone 40 insert.

The lambda gt10 libraries were plated at a density of approximately 10‘ plaques/plate and plaques lifts were prepared according to Maniatis et al. Filters were indexed using india ink to allow alignment of the filters with the parent plate from which the plaque lift was performed. The bacteria and phage particles were lysed, and the nitrocel- lulose filters were processed and baked as previously described (Maniatis et al.). The prehybridization solu- tion, per filter, consisted of the following: 5.4 ml prehybridization buffer (50 ml of 1 M Tris HCl, pH=7.5; 2 ml of 0.5 M EDTA, pH=8.0; 50 ml of 10% SDS; 150 ml of 20 X SSC (Maniatis et al.); and, 238 ml of glass distilled water); 6.0 ml formamide; 0.4 ml 50 X Denhardt solution (5 g FICOLL; albumin; brought to a total volume of 500 ml with glass distilled water); sperm DNA (10 mg/ml). Each filter was placed in a plastic bag and the prehybridization solution was added. The bag was sealed and incubated at 37%2overnight with intermittent g polyvinylpyrrolidone; 5 g bovine serum and 0.2 ml of single-stranded salmon mixing of contents.

The clone 40 lambda DNA was isolated (Maniatis et al.) and digested with EcoRI. The resulting fragments were fractionated on an agarose gel and visualized by ethidium The DNA fragment corresponding to the clone 40 insert, approximately 500 bromide staining (Maniatis et a1.). base pairs, was isolated from the agarose by electroelution onto NA45. The aqueous suspension of the purified fragment was extracted once with a 1:1 phenol/chloroform solution, and once with a 24:1 chloroform/isoamylalcohol solution.

The DNA was then precipitated with ethanol and resuspended in sterile water.

,The clone 40 insert was radioactively labelled by nick translation and used to probe the lambda gtlo plaque lift filters. The prehybridization solution was removed from the filters. Each filter was hybridized with probe under the following conditions: 5.0 ml of hybridization buffer (5 ml of 1 M Tris HCl, pH=7.5; 0.2 ml of 0.5 M EDTA, pH=8.0; 5.0 ml of 10% SDS; 14.9 ml of 20 X SSC (Maniatis et al.); 10 g of dextran sulfate; and, glass distilled water to a total volume of 50 ml); 5.0 ml formamide; 0.4 ml 50 X Denhardt's solution (5 g FICOLL; 5 g polyvinylpyrrolidone; g bovine serum albumin; brought to a total volume of 500 ml with glass distilled water); and 0.2 ml of single- stranded salmon sperm DNA (10 mg/ml). To this hybridiza- tion mix was added 50-250 pl of denatured probe (boiled 5- minutes and quick-chilled on ice), resulting in approxi- mately 10‘cpm of labelled probe per filter. The hybridiza- tion mix containing the labelled probe was then added to the plastic bag containing the filters. The bag was resealed and placed under a glass plate in a 37%2water bath overnight with intermittent mixing of contents.

The next day the hybridization solution was removed and the filters washed three times, for 5 minutes each, in X SSC (Maniatis et al.) containing 0.5% SDS, at room temperature. The filters were then washed for one hour in 2 X SSC, containing 0.5% SDS, at SUC. then washed for 15-60 minutes in 0.1 X SSC, containing 0.1% SDS, at SGT and finally 2 X SSC, 15 minutes, 2-3 X at room The washed filters were dried and then The filters were temperature. exposed to X-ray film for detection of positive plaques.

Approximately 24 plaques from the lambda gtlo librar- ies were plaque purified from the approximately 200 plaques which tested positive by the hybridization screen (Table 2).

Analysis of lambda gt10 CDNA Library Clones Homologous to the Clone 40 insert The clones identified in Example 5 which have homology to the clone 40 insert were analyzed by standard restric- tion analysis and the insert sizes were determined. The original frequencies of positive hybridization signals per plate using the clone 40 insert as probe against the different cDNA sources are shown in the last column of Table 2. That these positive signals arose with different frequencies for the different CDNA sources in the lambda gt10 library suggests that the hybridization signals originated from the sera source rather than common contami- nation introduced during cDNA synthesis or cloning.

One of the clones (1085) from the EGM—generated cDNA library identified by hybridization with the clone 40 insert, had an insert of approximately 3.7 kb and. was chosen for further analysis. The insert was isolated by EcoRI digestion of the clone, electrophoretic fraction- ation, and electroelution (Example 5). The insert was treated with DNase I under conditions resulting in partial digestion (Maniatis et al.) to generate random fragments.

The resulting fragments were inserted into lambda gt11 vectors for expression. The lambda gt11 clones were then immunoscreened (Example 2) using human (BV and normal) and chimpanzee #771 sera. Twelve positive clones were identi- fied by first round immunoscreening with the human and Seven of the 12 clones were plaque purified and rescreened using chimp serum (#771). Partial DNA sequences of the insert DNA were determined for two of the resulting clones that had the largest sequences, designated 3281 and 3282. The 2 clones had sequences essen- tially identical to clone 40. chimp sera.

Example 7 Preparing Amplified HCV cDNA Fragments A. Preparing cDNA fragments A plasma pool obtained from a chimpanzee with chronic PT—NANBH was obtained from the Centers for Disease Control (CDC) (Atlanta, GA). After direct pelleting or PEG precipitation, RNA was extracted from the virions by guanidinium thiocyanate—phenol-chloroform extraction, according to published methods (Chomczynski). The pelleted RNA was used for CDNA synthesis using oligo dT or random primers, or HCV sequence—specific primers and a commercial CDNA kit (Boehringer-Mannheim).

In one method, synthesis of first strand CDNA was achieved by addition of four primers, designated A, B, C, and D, having the sequences shown below. These sequences are complementary to the HCV genomic regions indicated: A: 5’-GCGGAAGCAATCAGTGGGGC-3’, complementary to basepairs 394-413; B: 5'—GCCGGTCATGAGGGCATCGG-3', complementary to basepairs 2960-2980; C: 5’-CGAGGAGCTGGCCACAGAGG-3', complementary to basepairs 5239-5258; and D: 5’-TGGTTCTATGGAGTAGCAGGCCCCG-3’, basepairs 7256-7280. second strand cDNA synthesis was performed by the method of Gubler and Hoffman. out under standard cDNA synthesis methods given in the complementary to The reactions were carried commercial kit.

B. Amplifying the CDNA Fragments The CDNA from above was blunt ended and ligated to the linker/primer having the following sequence: ’-GGA ATT CGC GGC CGC TCG-3’ A—strand 3’-TT CCT TAA GCG CCG GCG AGC-5’ B—strand Linker/primer: The CDNA and linker were mixed at a 1:100 molar ratio in the presence of 0.3 to 0.6 Weiss units of T4 DNA ligase.

To 100 pl of 10 mM Tris-Cl buffer, pH 8.3, containing 1.5 mM MgCl2 and 50 mM Kcl (Buffer A) was added about 1 X 10-3 pg of the linker-ended CDNA, 2 pM of linker/primer A (A- single primer amplification)-amplified DNA fragments.

This results (sequence-independent Example 8 Preparing Primer-Pair Eragments Amplified CDNA fragments from Example 7 were mixed with 100 pl Buffer A, 1 pM of equal molar amounts of one of the primer pairs given below, 200 pM each of dATP, dCTP, dGTP, and dTTP, and 2.5 units of Thermus aguaticus DNA polymerase (Taq polymerase). Each primer pair includes a forward (upstream) primer F, which is identical to the coding strand at the upstream end of an overlap region Piof duplex genomic DNArand a reverse primer K-which is comple- mentary to the coding at the downstream end of the region R. The sets of primers each define an overlap region of about 200 basepairs, and the spacing between adjacent overlapping primer regions (i.e., between adjacent pairs of R/& pairs) is about 0.5-1 kilobase. The regions of HCV which are complementary to the primers are given below: F" basepairs 183-201; R" basepairs 361-380 Fm, basepairs 576-595; Rm, basepairs 841-860 F2, basepairs 1080-1100; R2, basepairs 1254-1273 F3, basepairs 1929-1948; R3, basepairs 2067-2086 F" basepairs 2754-2733; R" basepairs 2920-2940 Fy basepairs 3601-3620; Ry basepairs 3745-3764 F6, basepairs 4301-4320; R6, basepairs 4423-4442 F", basepairs 4847-4865; R", basepairs 4715-4734 FW basepairs 5047-5066; Rn basepairs 5200-5216 F" basepairs 5885-5904; R" basepairs 6028-6047 F9, basepairs 6902-6921; R9, basepairs 7051-7070 Polymerase Chain Reaction (PCR) amplification of the SISPA-amplified CDNA fragments with each Fyflg primer pair was carried out under conditions similar to those used above, with about 25 cycles.

The amplified fragment mixtures from above were each 1.5% transferred to nitrocellulose filters (Southern). agarose and Hybrid- ization of the nitrocellulose-bound fragments, each with an fractionated by electrophoresis on internal-sequence oligonucleotide probe confirmed that each fragment contained the expected sequences. Hybridization was carried out with an internal oligonucleotide radiola- standard beled by polynucleotide kinase, according to methods.

Example 9 Preparing Linking Fragments This example describes preparing large overlapping linking fragments of the HCV sequence. SISPA-amplified CDNA fragments from Example 7 were mixed with 100 pl Buffer A, 1 pM of equal molar amounts of forward and reverse primers in each of the primer pairs given below, 200 pM each of dATP, dCTP, dGTP, and dTTP, and 2.5 units of Ehgrmgg aguaticus DNA polymerase (Taq polymerase), as in Example 8.

Each primer pair includes a forward primer Fi and a reverse primer 3, where E is the forward primer for one overlap region P" and Rj is the reverse primer of the adjacent overlap region. Thus each linking fragment spans two adjacent overlap regions. The sets of primers each define a linking fragment of about 0.5-1 kilobases. The sequences of the primer pairs are given in Example 8. The overlap- ping linking fragments of the HCV sequence (Appendix) spanned by each primer pair is given below: fl/Rm, basepairs 183-860 Fm/R2, basepairs 576-1273 F3/R3, basepairs 1080-2086 F3/R4, basepairs 1929-2940 E}/R5, basepairs 2754-3762 Pg/Pg, basepairs 3601-4442 F}/Rn, basepairs 4301-4865 F"/R7, basepairs 4715-5216 By/R8, basepairs 5047-6047 F}/R9, basepairs 5885-7070 Two-primer amplification of the SISPA-amplified CDNA fragments with each R/Q primer pair was carried out under conditions similar to those described above, with about 25 cycles.

The amplified fragment mixtures from above were each fractionated by agarose electrophoresis on 1.2 % agarose, and transferred to nitrocellulose filters (Southern) for hybridization with radiolabeled internal oligonucleotide probes as above. The analysis confirmed that each linking contained the two end—primer sequences from fragment adjacent overlap regions. The sequences contained in each of the linking fragments are indicated in the Appendix.

Example 10 Preparing Cloned Peptide Fragments A. DNA Fragment Digestion Each of the ten linking fragments from Example 9 was suspended in a standard digest buffer (o.5M Tris HC1, pH 7.5; 1 mg/ml BSA; lOmM MnC12) to a concentration of about 1 mg/ml and digested with DNAse I at room temperature for various times (1-5 minutes). These reaction conditions were determined from a prior calibration study, in which the incubation time required to produce predominantly 100- 300 basepair fragments was determined. The material was extracted with phe- nol/chloroform before ethanol precipitation.

The fragments in the digest mixture were blunt-ended and ligated with EcoRI linkers. were analyzed by electrophoresis (5-10V/cm) on 1.2% agarose gels, using PhiX174/HaeIII and lambda/HindIII size markers.

The 100-300 bp fraction was eluted onto NA45 (Schleicher and Schuell), which were then placed into 1.5 ml microtubes with eluting solution (1 M Nacl, 50 mM arginine, pH 9.0), and incubated at 67°C for 30-60 minutes.

The eluted DNA was phenol/chloroform extracted and then The pellet was The resultant fragments strips precipitated with two volumes of ethanol. resuspended in 20 pl TE buffer (0.01 M Tris HCl, pH 7.5, 0.001 M EDTA).

B. Cloning the Digest Fragments Lambda gt11 phage vector (Young et al.) was obtained from Promega Biotec (Madison, WI). This cloning vector has a unique EcoRI cloning site 53 base pairs upstream from the beta—galactosidase translation termination codon. The partial digest fragments from each linking fragment in Part A were introduced into the EcoRI site by mixing 0.5-1.0 pg EcoRI-cleaved lambda gt11, 0.3-3 pl of the above sized frag- ments, 0.5 pl lOX ligation buffer (above), 0.5 pl DNA ligase (200 units), and distilled water to 5 pl. The mixture was incubated overnight at 14°C, followed by in yitrg packag- ing, according to standard methods (Maniatis, pp. 256-268).

The packaged phage were used to infect E. coli strain KM392, obtained from Dr. Kevin Moore, DNAX (Palo Alto, CA).

Alternatively, E. coli strain Y1090, available from the American Type Culture Collection (ATCC No. 37197), could be A lawn of KM392 cells infected with about 101—lU‘pfu of the phage stock from above was prepared on a 150 mm plate and incubated, inverted, for 5-16 hours at 37°C. The used. infected bacteria were checked for loss of beta—galactosi- dase activity (clear plaques) in the presence of X-gal using a standard X-gal substrate plaque assay method (Maniatis).

Identification of single plaques containing a digest- fragment insert was confirmed as follows. Clear single plaques (containing the progeny of a single phage) were removed from the plate and suspended in extraction buffer (Maniatis) to release the phage DNA. The phage extract was added to the above DNA amplification mixture in the pre- sence of primers which are about 70 basepairs away in ei- ther direction from the EcoRI site of lambda gtll. Thus phage containing a digest-fragment insert will yield an amplified digest fragment of about 140 basepairs plus in- sert. Phage DNA amplification was carried out as described above, with 25 cycles of amplification. The reaction mate- rial from each plaque tested was fractionated on 1.5% aga- rose, and examined for the size of amplified digest frag- ments. Non-recombinant phage gave a 140 basepair band, and recombinant phage, a band which is 140 basepair plus the insert sequence in size. The results are shown in column 2 (REC Freq) of Table 3 below, for the six linking—fragment libraries indicated in the first column in Table 3 below.

The denominator in the column-2 entries is the total number of plaques assayed by primer amplification. The numerator is the number of clear plaques containing fragment inserts.

Thus, 3/15 means that 3 plaques tested positive by PCR out of a total of 15 clear plaques assayed.

Table 3 -Library‘ REC Fregz 1° Screen3 PA[REC‘ F2R3 #2 3/15 2 0.33 FBR4 #1 7/12 0 ' F4R5 #3 9/10 10 0.37 F5R6 #5 11/12 37 1.35 F7R8 #7 0/12 1 - FBR9 #10 3/12 58 7.73 ’- Libraries constructed by partial DNasel Digestion of indicated linking clone — Recombinant frequency determined by PCR with insert flanking lambda gtll primers ’- Primary screening with chronic human PT—NANBH serum (1:l00) on l.5XlO phage — PA/REC indicates the number of positive areas detected per actual number of recombinant plated The library of digest fragments constructed for each linking fragment was screened for expression of peptides which are immunoreactive with a human PT—NANBH serum. The lawn of phage—infected bacteria was overlaid with a nitro- cellulose sheet, transferring PT—NANBH recombinant peptides from the plaques to filter paper. The plate and filter were indexed for matching corresponding plate and filter positions.

The filter was removed after 6-12 hours, washed three times in TBS buffer (10 mM Tris, pH 8.0, 150 mM NaCl), blocked with AIB (TBS buffer with 1% gelatin), washed again in TBS, and incubated overnight with of antiserum (diluted to 1:100 in AIB, 12-15 ml/plate). The sheet was washed twice in TBS and then incubated with alkaline-phosphatase- conjugated anti-human IgG to attach the labeled antibody at filter sites containing antigen recognized by the anti- serum. After a final washing, the filter was developed in a substrate medium containing 33 pl NET (50 mg/ml stock solution maintained at 4°C) mixed with 16 pl BCIP (50 mg/ml stock solution maintained at 4°C) in 5 ml of alkaline phos- phatase buffer (100 mM Tris, 9.5, 100 mM Nacl, 5 mM MgC12).

Reacted substrate precipitated at points of antigen produc- tion, as recognized by the antiserum.

The total number of plaques which showed antigen-posi- tive reaction (positive areas PA) in the primary screen are given in the third column in Table 3. The fourth column in the table is the frequency of positive areas per total num- ber of recombinant phage screened (x 10%. This last column is therefore a measure of the relative immunogenicity of antigen expressed from a particular linking fragment using this particular serum sample.

Example 11 Screening Digest Fragments The digest-fragment libraries of each of the ten link- ing fragments from Example 9 were screened with sera from a human patient with chronic PT—NANBH and with pooled sera from chimpanzees with acute PT—NANBH infection and chronic PT—NANBH infection. Individual chronic and acute chimpan- zee sera from 5 chimpanzees were obtained from the Centers for Disease Control.

The digest-fragment libraries from the linking frag- ments indicated in Table 4 below were screened with each of the three sera, using the screening procedure described in Example 10. The total number of positive areas observed in each plate (making up one fragment library) is given in the table. ses represent the number of positive areas which were The entries in the table which are not in parenthe- confirmed by plaque purification, i.e., by replating plaques from the positive areas at low dilution and con- firming an positive area (secondary screen). Typically about 90-95 percent of the positive areas in the primary screen tested positive by secondary screening. The entries in parentheses indicate positive areas which have not been confirmed in a secondary screen.

As seen from Table 4, all but one of the linking frag- ment libraries contained sequences encoding peptide antigens which are immunoreactive with either chronic human or chimpanzee infected sera. Five of the libraries contain sequences encoding antigens which are immunoreactive with acute sera, indicating that one or more of the antigens in this group are effective to detect acute-infection serum.

Three of these latter libraries -— F3/R4, F"/R7, and F7/R3 -- gave over 10 positives in each library. These data are not corrected for the recombinant frequency in a particular library and therefore do not reflect the comparative immunogenicity of the various linking fragments.

Table 4 Acute Pool P.P. Clones Chronic Pool P.P. Clones Human P.P. Clones F1Rl0 0 O 0 FlOR2 4 2 4 FZR3 4 0 1 F3R4 0 10 10 F4R5 5 O 7 F5R6 34 o (42) F6R12 (400) 5 1o(2oo) F12R7 2 17(2oo) 9(2oo) F7R8 o 20 1o(13o) F8R9 60 0 1 ( ) = not plaque purified P.P. = Plaque Pure Acute Pool = CDC Panel of Chimps Chronic Pool CDC Panel of Chimps Example 12 Immunoscreenina for 409—1—1-Antiqen A. Plaque Immunoscreening Several clear plaques identified in the primary screen of the FHGQ linking fragment were replated and plaque puri- fied. One of the purified plaques was designated gt11/409- 1-1(c-a). The digest fragment contained in clone 409 1(c—a) corresponds to two sets of base pairs present in the HCV genome and present in clone 4091(abc). For ease of reference three regions (a, b, and c,) have been designated in the 4091(abc) clone (see below and Figure 5). The longest homology of base pairs corresponds approximately to nucleotides 2754 to 3129 of the Appendix (the "a" region, see Figure 5, region delineated by boxes) and the shorter homology corresponds approximately to nucleotides 3242 to of the Appendix (the "c" region, see Figure 5): nor- mally the "c" region is located approximately 112 nucleo- tides distal the 3' end of the "a" region (see Figure 5).

The complete sequence of the gt11/4091(c-a) insert is given in Figure 6 and presented as SEQ ID NO:7. This clone arose through a ligation event between two independent DNaseI fragments generated from the Fuflg linking clone and has ATCC No. 40792. 1(abc), has been described in co-owned patent application Ser. No. 505,611 and has ATCC No. 40876.

A lambda gt11 clone corresponding to the immunoreac- A related clone, designated 409 tive sequence reported in the EPO application 88310922.5, and designated 51, was prepared by primer-specific amplification of the amplified cDNA fragments generated in Example 7. The 51 sequence corresponds to basepairs 3730-3858 of the HCV sequence (Appendix), in the linking fragment F5/R6 . are 20 basepair oligomers complementary to the forward and The primers used for fragment amplification reverse sequences of the 3732-3857 basepair 51 sequence.

Both oligomers have EcoRI sites incorporated into their ends and the forward oligomer is designed to ensure a con- tiguous open reading fram with the beta-galactosidase gene.

The amplified 51 sequence was purified by agarose gel electrophoresis, and cloned into lambda gt11 phage. Ampli- fication and cloning methods were as described above.

Phage containing the 51 sequence were identified and purified by primary and secondary screening, respectively, with human PT-NANBH serum, also as described above.

The purified gtll/4091(c-a) and gtll/51 clones were each mixed with negative lambda gtll phage, plated and immunoscreened with a number of different donor sera from normal and NANBH-infected humans and chimpanzees, as indi- cated in Table 5 below. Each plate was divided into seve- ral equal-area sections, and the corresponding sections on the nitrocellulose transfer filter were separately screened with the donor sera indicated, using the immunoscreening method described in Example 11. The number of positives detected for each group of sera by the 51 and 409—l—1 (c—a) peptides are shown, as well as a comparison with the C-100 test in the ELISA format, in Table 5.

Table 5 Source Diagnosis # Donors # Positive S-l-1 409-l-1 (c—a) C-100 Human Normal 2 O 0 NT Human ANAB 6 4 5 O/1' Chimp Normal 7 0 O 0/5 Chimp Acute 5 1 3 0/5 Chimp Chronic 8 7 7 5/5 VT, not tested; * only BV serum was tested; N/5 means N positives out of five sera tested.

. Western Blot Screening For Western blot screening, gtll/409l(c-a) phage from Example 11 was used to infect E. coli BNNlO3 temperature-sensitive bacteria.

These bacteria were obtained from the American Type Culture Collection.

The bacterial host allows expression of a beta—galactosidase/peptide antigen fused protein encoded by the vector under temperature induction conditions (Hunyh).

Infected bacteria were streaked, grown at 32°C overnight or until colonies were apparent, and individual colonies were replica plated and examined for growth at 32% and 42C. Bacterial colonies which grew at 3?, but not 42%, indicating integration of the phage genome, were used to inoculate 1 ml of NZYDT (Maniatis) broth A saturated overnight bacterial culture was used to inoculate a 10 ml culture, which was incubated with aeration to an O.D. of about .2 to .4, typically requiring 1 hour incubation. The culture was then brought to 43°C quickly in a 49% water bath and shaken for 15 minutes to induce lambda gtll peptide synthesis, and incubated further at 37°C for 1 hour.

The cells were pelleted by centrifugation, and 1 ml of the pelleted material was resuspended in 100 ul of lysis buffer (62 mM Tris, pH 7.5 containing 5% mercaptoethanol, 2.4 % SDS and % glycerol). Aliquots (about 15 pl) were loaded directly onto gels and fractionated by SDS-PAGE. resis, the fractionated bands were transferred by electro- After electropho- elution to nitrocellulose filters, according to known methods (Ausubel et al.).

'The lysate was treated with DNaseI to digest bacterial DNA, as evidenced by a gradual loss of viscosity in the lysate. An aliquot of the material was diluted with Triton X-1O07"and sodium dodecyl sulfate (SDS) to a final concen- tration of 2% Triton X-1007" and 0.5% SDS. material was removed by centrifugation and the supernatant was fractionated by SDS polyacrylamide electrophoresis (SDS-PAGE).PAGE, A portion of the gel was stained, to identify the peptide antigen of interest, and the corre- sponding unstained band was transferred onto a nitrocellu- Non-solubilized lose filter.

The 51 antigen coding sequence (Example 11) was glutathione-S-transferase fusion also expressed as a protein using the pGEX vector system, according to pub- lished methods (Smith). The fusion protein obtained from bacterial lysate and fractionated by SDS-PAGE were trans- ferred to a nitrocellulose filter for Western blotting, as above.

Western blotting was carried out substantially as described in Example 10. Briefly, the filters were blocked with AIB, then reacted with the serum samples identified in Table 5, including human and chimpanzee normal, chronic NANBH, and hepatitis B (HBV) sera sample. The presence of specific antibody binding to the nitrocellulose filters was assayed by further immunobinding of alkaline-phosphatase The results of the Western blot analysis with the Sj26/51 fusion protein and /4091(c— a) fusion proteins are shown in Table 6. labelled anti—human IgG.

The data confirm that 4091(c-a) and 51 peptide antigens are specifi- cally immunoreactive with human and chimpanzee NANBH antisera.

Table 6 Source Diagnosis # Donors # Positive Sj26 flgal 51 409-l-l(c-a) Human Normal 2 O 0 Human NANB 7 5 5 Human HBV 1 0 O Chimp Normal 5 O O Chimp NANB 6 5 5 Chimp HBV 1 O 0 Example 13 Generation of Alternative Clones Alternative clones were generated from the region iden- tified in Example 12 as encoding antigen specifically immu- noreactive with human and chimpanzee NANBH antisera. The primers shown in Table 7 were selected from the HCV or 409- l—1(abc) coding sequences to generate a variety of over- lapping clones.

Table 7 grime; Seggence C-Fl CCGAATTCGCGGTGGACTTTATCCCTGT 33C-R1 CCGABTTCCAGAGCAACCTCCTCGATG 409l(c-a)F CCGAATTCCGCACGCCCGCCGAGBCTAC 4091-F1 CCGAATTCTCCACCACCGGAGAGATCCC 409-lR2 CCGAATTCCACACGTATTGCAGTCTATC 4091-F3 CCGAATTCGTCACCCAGRCAGTCGAT 409l-R5 CCGAATTCCCCTCCCAAAATTCAAGATGG 409l(c-a)R CCGAATTCGCCAGTCCTGCCCCGACGTT 409lCR CCGAATTCGTCCTGGCACACGGGAAG The primers shown in Table 7 were used in DNA amplifica- tion reactions as described in Examples 7B and 8: the pri- mers and templates used in each reaction are shown in Table 8. The amplified fragments were then treated with the Klenow fragment of DNA polymerase I, under standard condi- tions (Maniatis et al.), to fill in the ends of the mole- cules. The blunt-end amplified fragments were digested with EcoRI under standard conditions and cloned into lambda gtll expression vectors essentially as described in Example B. The resulting inserts are aligned for comparison in Figure 7.

Table 8 Generated Fragment Template Egimggg c cDNA' 33-C-F1 and 4091-R2 33CU cDNA' 33-C-F1 and 33-C-R1 409-1—l(F1R2) gtll 4091(c—a) 409—1—1—Fl and 409-l—l—R2 4091(a) gtll 409l(c-a) 409—1—l—F1 and 409lcaR 409l(c) gtll 409-l-l(c-a) 409lcaF and 4091CR 4091(c+270) gtll 409l(c-a) 4091caF and 409l-R2 409—1—1u gtll 4091(c-a) 4091-F3 and 409-1—1caR * Amplified CDNA fragments from Example 7 Example 13 Immunoscreeninq of the Alternative Clones The alternative clones generated in Example 12 were im- munoscreened essentially as described in Example 10B.

Clones 4091(abc) and 4091(c-a), generated in Example 12, were also included in the following immunoscreenings.

The results of the preliminary immunoscreening are shown in Table 9.

Table 9 GLI—1 Egg 33c + No‘ 33cu + ND 4091 (abc) + ND 4091 (F1R2) + ND 4091 (a) + ND 4091 (ca) + ND 409—l—1 (C) — — 4091 (c+270) + ND 4091 u - - *Not Done The GLI—1 sera was a human chronic PT-NANBH sera. If a clone tested negative with GLI—1 it was further examined by screening with FEC, a human chronic PT-NANBH sera.

The seven of the 9 alternative clones which tested posi- tive by the above preliminary immunoscreening were more ex- tensively screened against a battery of sera. In addition, clone C100 (see Background) was included in the screening.

The results of this more exhaustive screening are presented in Table 10.

Table 10 Smum ANWGEN 4094-1 4094-1 4094-1 4094-1 4094-1 5-L1 C100 33C 33Cu abc FIR2 a c+27O ca SKHJ - - - - . " FEd+) + +3 +3 +1 +2 +2 +2+2 BV - +2 +3 I +1 +1 - +1 - Bar - +2 +2 I - . . .

PP(-) - - - - - - - . .

AP - +1 +2 - I - . I - CP + +2 +3 +2 +3 +3 I +3 +2 1 - - . . _ 3 - - I - - - I I . - — I - - +1 - — - - - +1 +3 +1 +1 +1 - +1 +1 7 - +2 +3 +1 +2 +2 _ - +2 +1 38 - - I +1 I I - - I 39 - - +1 I +1 - - I I 40 + +1 +2 +1 +1 - I +1 +1 41 + +2 +3 +1 +1 +1 - +2 +1 42 + +2 +3 +1 +1 +1 - +2 +1 43 - - - - - — - - I I — - - - - I +1 I I - - I I 46 + +1 +2 +1 +2 +1 - +1 I 47 + +1 +2 +2 +2 +3 2 +3 +1 318 — +3 +3 +1 +3 +3 — +3 - A7 - +3 +3 +1 +1 +3 - +3 +3 C7 - +2 +3 - — - - - - A3 — +3 +3 +1 +2 +1 - +2 — B7 — +2 +3 I +3 +3 — +3 I C12 + +2 +3 — - - - - - The serum samples used for screening were identified as follows: SKF, PT-NANBH negative; FEC, PT—NANBH positive; BV, community acquired NANBH; Bar, PT-NANBH positive; PP (pre-inoculation PT-NANBH negative; AP (acute HCV pooled chimpanzee serum), PT—NANBH positive; and, CP (chronic HCV pooled chimpanzee serum) PT- NANBH positive. The numbered serum samples correspond to human clinical serum samples which were PT-NANBH positive. pooled chimpanzee serum), The PP, CP, and AP sera were pooled sera samples from 5 different chimpanzees: the chimpanzee serum samples were obtained from the Centers for Disease Control. The scoring system presented in Table 10 is a qualitative scoring system defined as follows: (-), a clear negative; (+), (l+), (2+), (3+), increasing strength of positive signal, with (3+) being the strongest signal; and (I) stands for Indeterminate, where two readings were different and not repeated.

In view of the data presented in Table 10 the sensitivi- ty of the antigens in terms of immunoscreening is 33cu > 33c > 4091(c-a) > 4091-F1R2 > 409-l-1(abC) 2 409—1—1a > 51 > 4091—(c+270). sitive antigens, they reacted with high background against Although 33cu and 33c were sen- all sera. Accordingly, the 4091 series are more useful as diagnostic antigens since they are more specific to HCV induced antibodies.

The immunoscreening was further extended to include the clone 36 and 45 (corresponds to clone 40) encoded epitopes which were identified above. Table 11 shows the results of the immunoscreening.

Table 11 PANEL I: SEROCONVERSION SPECIMENS SERUM ANTIGEN C-100 33C 5.1.1 409l 36 45 gtll (c-a) GL1-1 + 4+ 2+ 4+ - 3+ - FEC + 4+ 3+ 4+ 3+ - - BV - 3+ - 3+ - - - SKF(norm) - - - - - ' ' 1-N01/D69 - I - - - - - 2- "/D124 - + - - - - - - "/D146 - 4- "/D211 - -N00/D22 - 6- "/D29 — 7- "/D41 — 3- "/D60 - 9- "/D137 + -N240/DO - 11- "/D45 - 12- "/D71 - 13- "/D89 - 14- "/D106 - - "/D155 - 16-N228/DO - 17- "/D31 - 18- "/D41 - 19- "/D51 - - "/D73 - 21- "/D93 - - "/D127 -N192/D114 24- "/D184 - "/0224 26- "/D280 -N176/D0 - 28- "/D66 - 29- "/D77 - - "/D94 — - "/D200 —N170/D0 - 33- "/D27 - 34- "/D49 - - "/D64 - - "/D183 37- "/D278 IIHHHHH HHHHIH + 4+ 4+ IIHIH SERUM ANTIGEN c—1oo 33c 5.1.1 4091 36 45 gt11 19-a) -N144/D63 - I — — _ _ .. 39- "/1372 - I - - .. - - 40- "/1391 + 2+ + 2+ - .. _ 41- "/D289 + 4+ + 3+ 2+ — _ 42- "/D233 + 4+ 3+ 4+ 2+ - - 43-N122/DO - I - — — .. _ 44- "/1351 - I I I - _ _ 45- "/D57 - 2+ 1 + - — — 46- p_ "/1372 + 2+ - 3+ I — - 47- "/D94 + 3+ + 4+ + - - 48- "/D199 +- 4+ 2+ 4+ + - - 49-N31/DO — I - - - - - 50- "/D140 — - — — — — — 51- "/D154 — - - — — - - 52- "/D170 — - - - - - — 53- "/D210 - - - — - - - 54- "/D266 - - — — - - "/D336 - - - - - - - 56- "/D394 — — — - — - — 57-N16/D0 - - - — - — - 58- "/D47 — — — — - - - 59- "/D62 - - - - - — - 60- "/D83 — - - - - - - 61- "/0137 — - - - — - - 61- "/D167 - - - — - - - 63- "/D197 - - - - - - — - "/0370 - - - - The screening sera GLI—1, FEC, BV, and SKF have been defined above. The numbered sera samples correspond to human clinical serum samples which were PT—NANBH positive: these samples were obtained from Dr. Francoise Fabiani- Lunel, Hospital La Pitie Salpetriere, Paris, France. As can be seen from the results presented in Table 11, the antigens produced by clones 36 and 40, while not as sensi- tive as 409—1—1(c-a), do yield HCV-specific immunopositive signals.

Example 14 Isolation of 4091 Fusion Protein Sepharose 4B beads conjugated with anti-beta galacto- sidase were purchased from Promega. The beads were packed ha 2 ml column and washed successively with phosphate- buffered saline with 0.02% sodium azide and 10 ml TX buffer (10 mM Tris buffer, pH 7.4, 1% aprotinin).

BNN103 lysogens infected with gt11/409l(c-a) from Example 12 were used to inoculate 500 ml of NZYDT broth.

The culture was incubated at 32°C with aeration to an o.D. of about .2 to .4, then brought to 43°C quickly in a 43°C water bath for 15 minutes to induce gtll peptide synthesis, and incubated further at 37%: for 1 hour. The cells were pelleted by centrifugation, suspended in 10 ml of lysis buffer (10 mM Tris, pH 7.4 containing 2% Triton X-100"‘and 1% aprotinin added just before use.’ The resuspended cells were frozen in liquid nitrogen, then thawed, resulting in substantially complete cell lysis. The lysate was treated with DNaseI to digest bacterial and phage DNA, as evidenced by a gradual loss of viscosity in the lysate. Non—so1ubi- lized material was removed by centrifugation.

The clarified lysate material was loaded on the Sepharose column, the ends of the column were closed, and the column was placed on a rotary shaker for 2 hrs. at room temperature and 16 hours at 4°C. After the column settled, it was washed with 10 ml of TX buffer. was eluted with 0.1 M carbonate/bicarbonate buffer, pH10.

A total of 14 ml of the elution buffer was passed through the column, and the fusion protein eluted in the first 4-6 The fused protein ml of eluate.

The first 6 ml of eluate from the affinity column were concentrated in Centriconnhflo cartridges (Amicon, Danvers, Mass.). The final protein concentrate was resuspended in 400 ul PBS buffer. Protein purity was analyzed by SDS-PAGE.

A single prominent band was observed.

Example 15 Preparation of Anti1-1(c—a) Antibodv The 4091(c-a) digest fragments from lambda gtll were released by EcoRI digestion of the phage, and the "A" region purified by gel electrophoresis. The purified frag- ment was introduced into the pGEX expression vector (Smith). Expression of glutathione s-transferase fused protein (Sj26 fused protein) containing the 4091(a) coli strain KM392 The fusion protein was isolated from lysed peptide antigen was achieved in E. (above). bacteria, and isolated by affinity chromatography on a column packed with glutathione-conjugated beads, according to published methods (Smith).

The Sj26/4091(a) injected subcutaneously in Freund's adjuvant in a rabbit. purified fused protein was Approximately 1 mg of fused protein was injected at days 0 and 21, and rabbit serum was collected on days 42 and 56.

A purified Sj26/51 fused protein was similarly prepared using the an amplified HCV fragment encoding the 51 fragment. The fused Sj26/51 protein was used to immunize a second rabbit, following the same immunization schedule. A third rabbit was similarly immunized with purified Sj26 protein obtained from control bacterial lysate.

Minilysates from the following bacterial cultures were prepared as described in Example 12: (1) KM392 cells infected with pGEX, pGEX containing the 51 insert, and pGEX containing the 4091(a) and (2) BNNl03 infected with lambda gtll containing the 51 insert and The minilysates insert; gtll containing the 409-1—l(c-a) insert. were fractionated by SDS-PAGE, and the bands transferred to nitrocellulose filters for Western blotting as described in Example 12. Table 12 shows the pattern of immunoreaction which was observed when the five lysate preparations (con- taining the antigens shown at the left in the table) were screened with each of the three rabbit immune sera. Summa- rizing the results, serum from control (Sj26) rabbits was immunoreactive with each of the sj26 and sjze fused protein antigens. Serum from the animal immunized with Sj26/51 fused protein was reactive with all three Sj-26 antigens and with the beta-gal/51 fusion protein, indicating the presence of specific immunoreaction with the 51 antigen.

Serum from the animal immunized with sj26/4091(a) fused protein was reactive with all three Sj-26 antigens and with the beta-gal/409-1—1(c-a) fusion protein, indicating the presence of specific immunoreaction with the 4091(a) antigen. None of the sera were immunoreactive with beta- galactosidase (obtained from a commercial source).

Table 12 Antigens Antibody Sj26 51/Sj26 409l(a)/- Sj26 Sj26 + + + -l-l/ (Sj26) + + + —1-1/ <5-bal) — + ' 4091(a) (sj25) + + + 4091(c—a) (3-gal) - - + Anti1-1(a) antibody present in the sera from the animal immunized with the Sj26/4091(a) is purified by affinity chromatography, following the general procedures described in Example 12, but where the ligand derivatized to the Sepharose beads is the purified beta-gal/4091(c- a) fusion protein, rather than the anti—beta—galactosidase antibody.

Example 16 Cloning the HCV Capsid Protein Coding Sequences The example describes the cloning of HCV coding sequences which encodes the N-terminal region of the HCV capsid protein.

The protein sequence of the HCV—capsid associated antigen corresponds to the nucleotide residues 325-970 of the full length HCV sequence (see Appendix A). The following sequences were used as PCR primers to clone this region: sF2(C), 5' end starting at nucleotide 325 of the full length HCV sequence (Appendix), 5'-GCGCCCATGGGCACG- ATTCCCAAACCTCA; and SR1(C), 3' end starting at nucleotide 969 of the full length HCV sequence (Appendix), 5’—GCCGG— ATCCCTATTACTC(G/A)TACACAAT(A/G)CT(C/T)GAGTT(A/G)G. The anticipated size of the fragment generated using the SF2(C)/SR1(C) primer pair was 644 base pairs.

SISPA-amplified CDNA fragments from Example 7 were mixed with 100 pl Buffer A, 1 pM of equal molar amounts of each SR2 and SF1 primer given above, 200 pM each of dATP, dCTP, dGTP, and dTTP, and 2.5 units of Thermus aguaticus DNA polymerase (Taq polymerase), as in Example 8.

Specific amplification of the SISPA-amplified CDNA fragments with the capsid primer pair given above was carried out under conditions similar to those described in Example 7, with 1 minute at 72°C and about 30 cycles.

The amplified fragment mixtures from above were each fractionated by agarose gel electrophoresis on duplicate 1.2% agarose gels, and one of the gels transferred to nitrocellulose filters (southern) for hybridization with with a radioactively labelled oligonucleotide (Southern) having the following sequence: sF3(M/E), 5’ end starting at nucleotide 792 of the full length HCV sequence (Appen- dix), 5'-GCGCCCATGGTTCTGGAAGACGGCGTG. This oligonucleotide corresponds to a sequence internal to the amplification product generated by using the sF2(C) and SR1(C) primers.

Eight out of 15 PCR products were identified which gave a positive hybridization signal with the internal probe.

The vectors pGEX (Example 15) and pET (NOVAGEN, 565 Science Drive, Madison, WI 53711) were chosen for bacterial expression of protein sequences encoded by the inserts.

The pGEX vector provided expression of the inserted coding sequences as fusion proteins to Sj26 (see Examples 12 and ) and the pET vector provided expression of the cloned sequences alone. To clone the capsid sequences, the amplification product bands were excised from the duplicate gel.y The DNA was extracted from the agarose and doubly- digested with NcoI and BamHI. A pGEX vector containing the BamHI/NcoI cloning sites was also doubly digested with BamHI and NcoI. ligated under standard conditions and the ligation mixture The vector and extracted DNA were then transformed into bacterial cells.

The bacterial transformants were cultured under ampicillin selection, and the plasmid DNA isolated by alkaline lysis (Maniatis et al.). The isolated plasmid DNA was digested with NcoI and BamHI. were then electrophoretically separated on an agarose gel.

The digestion products The gel was transferred to nitrocellulose and probed with radioactively labelled SF3 as above. Twelve clones were confirmed to have the insert of interest by the Southern blot analysis.

Clones were generated in the pET vector in essentially the same manner.

Example 17 Immunological Screening of the Putative HCV capsid Protein Clones This example describes the immunological screening of the putative HCV capsid protein clones which were obtained in Example 18.

Of the twelve clones obtained in Example 16, protein mini-lysates of 7 clones (clones # 8, 14, 15, 56, 60, 65, and 66) were prepared as described in Example 12. These mini-lysates were fractionated as described and transferred Table 13 shows the pattern of immunoreaction which was observed when to nitrocellulose for Western Blot analysis. the 7 lysate preparations were screened with the indicated sera.

Table 13 Clone I sera SKF FEL A6 1- B9 BV r—_ _ - T _ —". 14 — + + + + - + + + + 56 - + + + + 60 - + + + + 65 - + + + + SJ26 - - - — - 51 - + + + — 4091 - - + + - The serum samples used for screening were identified as follows: SKF, HCV negative; FEC, HCV positive; BV, community acquired HCV; A6 and B9 correspond to human clinical serum samples which were HCV positive.

Immunoreactive bands identified on the Western blot were all smaller than the expected size of 50 kd (based on the predicted coding sequence of the cloned inserts, see below).

Clone 15 was chosen for scale-up production of the Sj26 fusion protein (Smith et al.). A one liter prepara- tion of clone 15 yielded about 200 pg of purified immunore- active material. The bulk of the immunoreactive material appeared in a major doublet band which ran at approximately 29 kd. low: typically with the pGEX system a one liter protein The yield from this preparation was unexpectedly preparation yields in the range of 50-100 mg fusion protein.

Example 18 Nucleic Acid Sequences of Clones 15 and 56 The inserts of clones 15 and 56 (discussed in Example 17) were sequenced as per the manufacturer's instructions Cleveland OH) dideoxy chain termination technique (Sanger, 1979). Each (US Biochemical Corporation, using the of the clones had an open reading frame contiguous with the Sj26 reading frame of the pGEX vector. The sequences of the clone inserts were near identical with only a few minor sequence variations: the sequence of clone 15 had a termination codon starting at nucleotide position 126. The sequence data for clone 56 is presented as SEQ ID NO:ll and in Figure 8A.

The sequencing of the inserts revealed the unusual feature of a run of adenine residues from nucleotide position 25 to position 34 (Figure 8A): such sequences are similar to sequences known to promote translation frame- shifting (Wilson et a1., Atkins et al.). The open reading frame contiguous with the Sj26 coding sequence predicts a protein of approximately 23.5 kd. Accordingly, given the approximately 26 kd size of the Sj26 protein fragment in this construct (Smith et al.), the complete fusion protein would be predicted to be approximately 50 kd.

Example 19 Hvdropathicitv Plot of the Protein Encoded by Clone 56 The SOAP program from Intellicenetics PC/GENE"‘soft- ware package was used to generate the hydropathicity plot of Figure 9. The SOAP program uses the method of Kyte et al. to plot the hydropathicity of the protein along its se- quence. The interval used for the computation was 11 amino acids. In Figure 9, the hydrophobic side of the plot corresponds to the positive values range and the hydrophil- ic side to the negative values range.

The hydopathicity plot indicates (i) the hydrophilic nature of the amino terminus of the capsid protein, (ii) the relatively hydrophobic nature of the region of amino acid residues approximately 122 to 162, and (iii) the hydrophobic nature of amino acid residues approximately 168-182.

Further, the region of amino acid residues 168-182 demonstrates potential for being a membrane spanning segment (Klein et a1.).

Example 20 Deletion Analysis of the Clone 56 Protein Coding Region This example describes the generation of a series of carboxy and amino terminal deletions of the HCV capsid pro- tein and the effect of these deletions on the immunoreacti- vity of the resulting proteins.

A. Carboxy Terminal Deletions of Clone 56.

As one step to improve the expression of the HCV capsid protein, the putative region of translational frameshifting was modified to reduce the probability of a frameshift occurring in this region. In each AAA codon, encoding lysine, (nucleotide positions 25 to 33, Figure 8A) the third nucleotide in each codon (positions 27, 30 and 33, Figure 8A) was changed from A to G using standard PCR mismatch techniques (Ausubel et al., Mullis, Mullis et al.).

Figure 8A by the three G's placed over the corresponding The sites of these substitutions are indicated in A's. The sequence of the modified pGEX clone was con- firmed as in Example 19 and the clone was named pGEX-CapA.

The insert sequence of clone pGEX-CapA is shown in Figure 8B and presented as SEQ ID NO: 13.

The deletion clones were generated using the PCR In Table 14 the BamHI site is italicized and the termination codon is underlined.

Table 14 CARBOXY TERMINAL DELETION PRIMERS primers given in Table 14.

. Cl 5’-CGA TCC ATG GGC ACG AAT CCT AAA CC . NC580 5’-G GCC GGA TCC Egg GGC CGA AGC GGG CAC AG . NC520 5’-G GCC GGA TCC IE5 ACC AGG AAG GTT CCC TGT TGC 4. NC45O 5’-G GCC GGA TCC 11; GGC CCT GGC ACG GCC TCC . NC36O 5’-G GCC GGA TCC IIA CAA ATT GCG CGA CCT ACG CC 6. NC270 5’-G GCC GGA TCC TTA GCC CTC ATT GCC ATA GAG Amplification reactions were carried out essentially as described in Example 16 using primer C1 paired with each of the NC primers and purified plasmid pGEX-CapA as template: the amplification reaction was 1 minute at 95°, annealed 2 minutes at 50° and 3 minutes at 72° for 20 cycles.

The following sequence comparisons are given relative to the nucleic acid sequence presented in Figure 8B. The C1 primer corresponds to the common 5' end of the pGEX-CapA insert which contains an NcoI site near the initiating methionine. The sequence of the NC primers each start at the nucleotide position indicated, for example, the homolo- gous sequence of the NC580 primer ends at nucleotide posi- tion 580. A termination codon is inserted at that posi- tion, following a BamHI site. The positions of the primers given in Table 14 are indicated in Figure 8B. The approxi- mate locations of the primers relative to the protein sequence are indicated in Figure 9.

The resulting amplification products were electrophor- etically size fractionated on a polyacrylamide gel and the DNA products of the appropriate sizes electroeluted from the gel. the pGEX and the pET vectors for expression. The sequences The amplification products were cloned into both of the inserts were confirmed as described in Example 18. _The pGEX vectors containing the carboxy-terminal dele- tions were transformed into E. coli and the fusion proteins Expression of the fusion The cells were then harvested at 6,000 rpm for 10 minutes. The E. coli were then lysed in MTPBS buffer (150 mM NaCl; 16 mM Na2HPO,,; 4 mM NaH2PO4, pH=8.0) after which 1% "TRITON X-100," 3 pg/ml DNase I, and 1 mM PMSF were added. The lysates were centrifuged at 15,000 rpm for 20 minutes. The supernatants were discarded and the pellets resuspended in 8M urea. The purified essentially as follows. protein was induced with IPTG for 3-4 hours. components of the resuspenion were separated by HPLC using a "BIO-GEL SPPW" column. was the predominant peak: Typically, the fusion protein the location of the fusion pro- tein was confirmed by Western Blot analysis. Clones ClNC270, ClNC360, and C1NC450 all expressed Sj26 fusion proteins at high levels: the fusion proteins all corre- sponded to the size predicted from the insert coding se- quence fused to the Sj26 protein and were immunoreactive with HCV-positive sera (Western Blots were performed as described in Example 17). Although the supernatants were discarded substantial amounts of the fusion proteins were also present in the supernatants. Clones ClNC520 and C1NC580 gave poor yeilds of fusion proteins.

An epitope map of the HCV capsid region is presented the location of the immunoreactive protein coding sequences corresponding to inserts C1NC450, ClNC360, in Figure 10: and C1NC270 are indicated. The sequences of ClNC450, C1NC360, and C1NC270 are presented in the Sequence Listing as SEQ ID NO:l5, SEQ ID NO:l7, and SEQ ID NO:l9, respec- tively.

B. Amino Terminal Deletions of Clone 56.

Amino terminal deletion clones were generated using the PCR primers given in Table 15.

Table 15 _ AMINO TERMINAL DELETION PRIMERS 1. C100 GAG CCC ATG GGT GGA GTT TAC TTG TTG CC 2. C270 GAG CCC ATG GGC TGC GGG TGG GCG GG 3. C360 GAG CCC ATG GGT AAG GTC ATC GAT ACC Amplification reactions were carried out essentially as described above using the primer pairs presented in Table 16 and purified plasmid pGEX-CapA as template: the amplification reaction included was 1 minute at 95°, annealed 2 minutes at 50°, and 3 minutes at 72° for 20 cycles.

Table 16 NH2Primer COOH Primer Protein Produced? Immunoreactive? C100 NC450 LOW YES NC360 YES YES NC270 YES YES C270 NC45O YES NO NC360 YES NO C360 NC450 YES NO The following sequence comparison are given relative to the nucleic acid sequence presented in Figure 8B where the above described A to G substitutions have been made for the sequence of pGEX-CapA. The NC660 primer corresponds to the common 3’ end of the pGEX-CapA insert which contains a BamHI site near the end of the insert. The sequence of the C primers each start at the nucleotide position indicated, for example, the sequence of the NC100 primer begins at nucleotide position 100. Each of the C primers introduces an in-frame initiation codon in the resulting amplification product. The positions of the primers given in Table 15 are indicated in Figure 8B.

The resulting amplification products were cloned into the pGEX and pET vector for expression as described above.

The sequences of the inserts were confirmed.

The’ pGEX vectors containing the carboxy-terminal deletions were transformed into E. coli, protein mini- lysates prepared, and the immunoreactivity of the proteins analyzed by Western Blots as described above. The results of the analysis are presented in Table 16. Clones C100NC270 and C10ONC360 expressed Sj26 fusion proteins at high levels: the fusion proteins corresponded to the size predicted from the insert coding sequence fused to the Sj26 protein.

An epitope map of the HCV capsid region is presented in Figure 10: the location of the protein coding sequences corresponding to inserts C10ONC270, C100NC360, C27ONC360, and C270NC450 are indicated. The sequences for C1OONC270 and C1OONC360 are presented in the Sequence Listing as SEQ ID NO:21 and SEQ ID NO:23, respectively.

Example 21 Expanded Immunoscreeninq Using the Capsid Antigen This example describes three different comparisons of the immunoreactivity of the various HCV antigens of the present invention to several battery of sera.

A. Effectiveness of Cap450 Antigen.

Table 17 shows the results of 50 human sera samples from patients suspected of NANB hepatitis infection. The ELISA assays were performed essentially as described by Tijssen using the following 3 antigens: C100, 4091(c— a), C33u, Cap45O (the protein product of the pGEX-C1NC450 clone), and with 409-1—1(c-a) and cap4150 in one well which was optimized to give the most sensitive results. These ELISA data were compared with the Abbott C100 test.

Patient serum was scored positive for Sj26 fusion pro- teins (4091 ca, 33u, 51, and Cap450) if the absor- bance was three times the absorbance of that serum on Sj26 native protein. A sample was scored positive on pET anti- gens (cap360) if the absorbance was three times the mean of the absorbance of negative control sera. A patient serum was scored positive on the combined 4091 ca/cap45O assay if the absorbance was equivalent or greater than that of control positive sera. Samples within 10% of the control positive sera were scored weak positives.

[Samples 1-19: Chronic active hepatitis proven by biopsy.

HBS Ag(-) .

Samples 20-44: Acute viral hepititis HBsAg(1), ISM Anti- HBC(-), IgM anti-HAV(-).

Samples 45-50: Chronic active hepatitis proven by biopsy.

HBsAg(-).

Table 17 Korean Panel II (I) \l O\ U‘ -{> La) ID I4 + + + + + + Combined Sample 4091 (c-a) # +CAP45O 13 14 16 17 18 23 24 3383 4072 4242 44 + + + + + + + + + + + * = positive (low) Combined Sample 4091 Cap 409l (c-a) # C100 (c-a) C33u 450 +CAP450 26 4816 - — — — - 27 5322 — - -— - - 28 6603 — — - — - 29 7923 - - - - — 9033 - - — - - 31 9768 - - - — - 32 9775 - — — - — 33' 10197 + - -— + w+ 34 10200 — — — — - 10409 — — — — - 36 10811 —- — — — - 37 11209 - + + + ND 38 12245 - — - — - 39 12143 - - - — - 40 12519 - - - - - 41 13510 - — — - — 42 14018 -- - — — - 43 14188 — - — - - 44 13437 — — - — - 45 863 - - — - — 46 3354 — — - — - 47 12640 — + + + + 48 13095 — * + — w+ 49 14501 — — — — - 50 14345 + + + + + * = positive (low) The results demonstrate that the Cap450 protein has good sensitivity for detecting the presence of anti-HCV an- tibodies in sera samples. and 47) were detected.

Three additional samples (6, 37, Further, these results indicate that the combination of Cap450 and 4091(c—a) can be used to produce a kit which is very effective for detection of anti-HCV antibodies in human sera samples.

B. Cap45O and Cap360.

The results in Table 18 demonstrate the effectiveness of the Cap450 and Cap360 antigen (the protein product encoded by of pET-C1NC360) to detect HCV antibodies present in human sera. The samples were tested for the presence of HCV by ELISA using each individual antigen shown, or with 4091 (c-a) and Cap450 antigens combined in one well.

Table 18 Combined ELISA 4091 Cap (409—l-1) SERUM PATIENT DIAGNOSIS C100 5-I-1 (c-a) C33u 360 +Cap45O -l31Acute Hepatitis; Pt "C.0." - - - - - - lk-l32Acute Hepatitis; Pt "C.O." - — - - - - NE-143Acute Hepatitis; Pt "C.0." — — — - - - "G-285 Acute Hepatitis; Pt "C.O. " ND ND ND ND ND - G—15OAcute P.T. Hepatitis; Pt "G.L. " — - I I + + G-l5lAcute P.T. Hepatitis; Pt "G.L. " - - I - + + G-l52Acute P.T. Hepatitis; Pt nG.L. II __ _ _ _ + + G-153Acute P.T. Hepatitis; Pt "G.L. " - — I - + 4' G-286Acute P.T. Hepatitis; Pt "G.L. " ND ND ND ND ND + @-43 Fulminant Liver Disease - - - - - - %-1 Community Acquired Hepatitis ND I + + + + G—lO9Community Acquired Hepatitis + - + + + + G-1l4Community Acquired Hepatitis ND - - - - - f—128Community Acquired Hepatitis + — I + + + -3 Community Acquired H? Hepatitis — — - - - - PATIENT DIAGNOSIS -126 Community Acquired Hepatitis C100 1 (C‘a) C33u Cap 360 Combined (409—1-1) +Cap4S0 F—l27Community Acquired Hepatitis Idiopath. Comm. Ac.

Hepatitis Community Acquired Hepatitis B Community Acquired Hepatitis B 'Community Acquired Hepatitis B Community Acquired Hepatitis B %-31 Community Acquired Hepatitis B G—45 Community Acquired Hepatitis B p-38 Fulminant Hepatitis B G-41 Community Acquired Hepatitis C Hepatitis C -13 ik-12 Hepatitis C IL:-e Hepatitis C ‘k—49 EtOH Cirrhosis |k-2s EtOH Cirrhosis lk-11OEtOH Cirrhosis EtOH cirrhosis |k,4e lk—272 Infant Liver Transplant ‘E-274 Infant Liver Transplant lk-1s ’k—123INc LT |k—122 INC LT "G-125 No Diagnosis lk-124No Diagnosis These results indicate that the combination of antigen and Cap360 or Cap450 result in a effective 1(c-a) diagnostic tool for detection of HCV infection. additional samples (G150,G151, G110, G125, and G124) were detected with these ELISA’s compared with C100 test alone. c. pET360 The results in Table 19 demonstrate the effectiveness of the pET360 to detect HCV antibodies present in human sera .

ELISA using each individual antigen shown, or with 4091 The samples were tested for the presence of HCV by (c—a) and pET360 antigens combined in one well.

Table 19 Combined 409—l—l 4091 (c—a) C100 51 (c—a) C33u pET360 + pET36O A + - + + - + 3 + + + + - + c + - - + - + D + + + - + + E + - w+ + + + F _ _ _ _ _ _ G + - w+ + + + H - - + + + + I _ _ _ _ _ - J _ _ _ _ _ _ x — - - + + + L _ _ _ _ ,_ _ M _ _ _ _ _ _ N — w+ - + + + o + w+ + + + + p + w+ + + + + Q These results indicate that the combination of antigen 409-l-l(c- a) and pET36O result in a effective diagnostic tool for detection of Three additional samples were detected with these HCV infection.

ELISA's compared with C100 test alone.

Although the invention has been described with reference to particular embodiments, methods, construction and use, it will be apparent to those skilled in the art that various changes and modifica- tions can be made without departing from the invention.

SEQUENCE LISTING (1) GENERAL INFORMATION: (i) APPLICANT: Reyes, Gregory Kim, Jungsuh P.

Moeckli, Randolph Simonsen, Christian C. (ii) TITLE OF INVENTION: Hepatitis C Virus Epitopes (iii) NUMBER OF SEQUENCES: 26 (iv) CORRESPONDENCE ADDRESS: (A) ADDRESSEE: Peter J. Dehlinger (B) STREET: 350 Cambridge Ave., suite 100 (C) CITY: Palo Alto (D) STATE: CA (E) COUNTRY: USA (F) ZIP: 94306 (V) COMPUTER READABLE FORM: (A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS (D) SOFTWARE: Patentln Release #l.0, Version #l.25 (vi) CURRENT APPLICATION DATA: (A) APPLICATION NUMBER: (B) FILING DATE: (c) CLASSIFICATION: (vii) PRIOR APPLICATION DATA: (A) APPLICATION NUMBER: US 505,611 (3) FILING DATE: 06-APR-1990 (vii) PRIOR APPLICATION DATA: (A) APPLICATION NUMBER: US 594,854 (8) FILING DATE: O9-OCT-1990 (viii) ATTORNEY/AGENT INFORMATION: (ix) (A) NAME: Fabian, Gary R. (8) REGISTRATION NUMBER: 33,875 (C) REFERENCE/DOCKET NUMBER: 4600-076.21 TELECOMMUNICATION INFORMATION: (A) TELEPHONE: (415) 323-8302 (2) INFORMATION FOR SEQ ID NO:l: (ii) (iii) (iV) (Vi) (vii) (ix) (Xi) GAA TTC CTC GTG CAA GCG TGG AAG TCC AAG Glu Phe Leu Val Gln Ala Trp Lys Ser Lye Lys Thr Pro Met Gly Phe TCG TAT GAT ACC CGC TGC TTT GAC TCC Ser Tyr Asp Thr Arg Cya Phe Asp Ser Thr Val Thr Glu Ser Asp Ile SEQUENCE CHARACTERISTICS: (A) LENGTH: 561 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear MOLECULE TYPE: CDNA to mRNA HYPOTHETICAL: NO ANTI-SENSE: NO ORIGINAL SOURCE: (A) ORGANISM: Hepatitis C Virus (8) STRAIN: coc IMMEDIATE souacs: (3) CLONE: 3o4—12—1 FEATURE: (A) NAME/KEY: cns (B) LOCATION: l..561 SEQUENCE DESCRIPTION: SEQ ID NO:l: AAA ACC CCA ATG GGG TTC ACA GTC ACT GAG AGC GAC ATC CGT Arg CGC Arg CTT Leu 65 AGC Ser CTC Leu CAG Gln TAC Tyr 1 4 5 CTC Leu GGA Gly ACG Thr GTG Val 50 ACC Thr GGC Gly GCC Ala GTG Val GAG Glu 130 ATA Ile AAG Lys GAG Glu GCC Ala AAT ASH GTA Val CGG Arg TGT Cys 115 GCC Ala ACA Thr AGG Arg GAG Glu ATC Ile TCA Ser CTG Leu GCA Ala 100 GGC Gly GCG Ala CCC Pro TCA Ser GTC Val 180 INFORMATION GCA Ala AAG Lys AGG Arg ACA Thr 85 GAC Asp GCG Ala CCC Pro TGC Cys 165 TAC Tyr ATC Ile TCC Ser GGG Gly 70 TGT Cys GAC Asp AGC Ser GGG Gly 150 TCC Ser TAC Tyr TAC Tyr CTC Leu 5 GAG Glu AGC Ser CGA AI-'9 TTA Leu CTG Leu 13 5 TCC Ser CTC Leu ID NO:2: CAA Gln 40 ACC Thr TGT Cys GCC Ala GTC Val 120 CCC Pro AAC Asn ACC Thr TGT Cys GAG Glu TGC Cys GGT Gly GCA Ala 105 GTT Val GCC Ala CCA Pro GTG Val CGG Arg 18 5 TGT Cys AGG Arg GGC Gly AAC Asn 90 GGG Gly ATC Ile TTC Phe CAA Gln TCA Ser 170 GAA Glu GAC Asp CTT Leu TAT Tyr 7 5 ACC Thr CTC Leu TGT Cys ACG Thr CCA Pro 155 TTC Phe CTC Leu TAT Tyr 60 CGC Arg CTC Leu CAG Gln GAA Glu GAG Glu 140 GCC Ala GAC Asp 4 5 AGG Arg ACT Thr GAC Asp ‘Ace Ser 125 TAC Tyr CAC His CCC PIC GGG Gly TGC Cys TGC Cys TGC Cys 110 ATG Met GAC Asp GAC Asp GGC Gly CGC Arg TAC Tyr 9 5 ACC Thr GGG Gly ACC Thr TTG Leu GGC Gly 175 GCC Ala CCT Pro GCG Ala 80 ATC Ile ATG Met GTC val AGG Arg GAG Glu 160 GCT Ala (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: (B) TYPE: amino acid (D) TOPOLOGY: (ii) MOLECULE TYPE: protein amino acids linear (xi) SEQUENCE DESCRIPTION: Phe Leu Val Gln Ala Trp Lys Ser Lys Thr Phe Ser Thr Val Tyr Asp Arg Cys Asp Ala Ile Gln Thr Glu Glu Tyr Cys Cys Asp Leu Thr Glu Leu Val Ala Ile Ser Lys Arg Thr Asn Ser Arg Gly Glu Asn Cys Gly Tyr Asn Thr 90 Thr Ser Gly Val Leu Thr Cys Gly Ala Ala Ala Ala Leu Ala Arg Cys Arg Gly Val 120 Val Cys Leu Val Ile Cys Gly Asp Asp Ala Leu Ala Phe Thr Glu Ala Ser Asp Arg Gln Pro Ala Pro Pro Gly Pro Pro Ser Asp Val Ser Val Ile Thr Ser Cys Ser Ser Asn Val Leu Thr Glu Phe Arg 185 Lys Arg Tyr Tyr SEQ ID NO:2: P150 Gly 175 (2) INFORMATION FOR SEQ ID NO:3: (ii) (iii) _ (Vi) (vii) (ix) (Xi) Asn Ser ACT Thr ACC Thr GGG Gly GGT Gly CGC Arg GTG Val 50 SEQUENCE CHARACTERISTICS: (A) LENGTH: 252 base pairs (8) TYPE: (C) STRANDEDNESS: double (D) TOPOLOGY: nucleic acid linear MOLECULE TYPE: CDNA to mRNA HYPOTHETICAL: NO ANTI-SENSE: NO ORIGINAL SOURCE: (A) ORGANISM: Hepatitis HCV Virus (B) STRAIN: cnc IMMEDIATE SOURCE: (B) CLONE: 3o3—1—4 FEATURE: (A) NAME/KEY: cns (B) LOCATION: 1..252 SEQUENCE DESCRIPTION: SEQ ID NO:3: AAA GAC CTT CTG GAA GAC Lye Asp Leu Glu Asp 10 GTG Val Trp Leu ATG GCT AAG GAG GTT Met Ala Lys Glu val 25 AAC Asn TTC Phe Ile Cys TTC Phe CGT AAG CCA GCT CGT Arg Lys Pro Ala Arg 40 CTC ATC Ile Leu Val GTG Val ATG Met GCT Ala 55 TAC Tyr GAC Asp GAA Glu Cys Lye AAT Asn GTA val GTT Val CCC PIC GTT Val 60 ACA Thr CAG Gln GAT Asp 45 ACC Thr CCA PIC CCT Pro AAG Lys ATA Ile GGC Gly CTC Leu GAC Asp GTG Val CCC Pro TTG GCC GTG ATG GGA AGC TCC TAC GGA TTC CAA TAC TCA CCA GGA CAG 240 Leu Ala Val Met Gly Ser Ser Tyr Gly Phe Gln Tyr Ser Pro Gly Gln 65 70 75 80 CGG GTT GAA TTC 252 Arg Val Glu Phe (2) INFORMATION FOR SEQ ID NO:4: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 84 amino acids (8) TYPE: amino acid (0) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4: Asn Ser Val Trp Lys Asp Leu Leu Glu Asp Asn Val Thr Pro Ile Asp l 5 10 15 Thr Thr Ile Met Ala Lye Asn Glu Val Phe Cys Val Gln Pro Glu Lys 25 30 Gly Gly Arg Lys Pro Ala Arg Leu Ile Val Phe Pro Asp Leu Gly Val 40 45 Arg Val Cys Glu Lys Met Ala Leu Tyr Asp Val Val Thr Lys Leu Pro 50 55 60 Leu Ala Val Met Gly Ser Ser Tyr Gly Phe Gln Tyr Ser Pro Gly Gln 65 70 75 80 Arg Val Glu Phe INFORMATION FOR SEQ ID NO:5: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: (3) TYPE: nucleic acid base pairs GAA Glu GTG Val GAG Glu 65 (ii) (iii) (iV) (Vi) (vii) (ix) (Xi) TTC Phe TGC cys GAA Glu GCC Ala 50 GCG Ala (C) STRANDEDNESS: double (D) TOPOLOGY: linear MOLECULE TYPE: CDNA to mRNA HYPOTHETICAL: NO ANTI-SENSE: NO ORIGINAL SOURCE: (A) ORGANISM: Hepatitis C Virus FEATURE: (A) NAME/KEY: cos (B) LOCATION: IMMEDIATE SOURCE: ‘(B) CLONE: 3034 ..l512 SEQUENCE DESCRIPTION: TTC Phe AAG Lys TAC Tyr GCC Ala ACA Thr CCC Pro TTG Leu GGG Gly GAA Glu TTG Leu GTA Val ACG Thr CGA Arg TTG Leu CTG Leu GGG Gly AGG Arg 70 GAC Asp CGG Arg TCG Ser ATG Met 55 TTG Leu GGG Gly GAG Glu CAA Gln 40 CTC Leu GCG Ala GTG Val GAG Glu ACT Thr AGG Arg CGC Arg CCT PEO GAT Asp GGA Gly SEQ ID NO:5: CTA Leu TCA Ser TGC Cys CCC Pro TCA Ser 75 TTC Phe GAG Glu TCC Ser 60 CCC Pro AGG Arg AGA Arg CCC Pro 45 CCC Pro TTT Phe GTA Val ATA Ile TCT Ser GCG Ala CCG Pro ACA Thr GTG Val CCC Pro CTC Leu GAT Asp GCA Ala GCC Ala AGC Ser ACC Thr GAC Asp 145 AGA Arg CCG Pro CAT His CGG Arg TTG Leu 225 ATT Ile TCC Ser GCT Ala TGG Trp Lys 130 GAG Glu TTC Phe CTA Leu GGC Gly AAG Lye 210 ACG Thr AGG Arg 1 15 CGG Arg GCC Ala GTG Val TGT Cys 195 GAG Glu GGC Gly GCT Ala CAT His 100 CAG Gln GTG Val GAG Glu CAG Gln GAG Glu 180 CGG Arg CTC Leu GAC Asp AGC Ser 85 GAC Asp GAG G lu ATT Ile ATC Ile GCC Ala 165 ACG Thr ACG Thr GCC Ala AAT Asn 245 CAG Gln TCC Ser ATG Met TCC Ser 150 TGG Trp CCA Pro GTG Val ACC Thr 230 ACG Thr CCT Pro GGC Gly GAC Asp 135 CCC P130 CCT PIO GTC Val 215 ACA Thr GAT Asp GGC Gly 120 GTT Val CCA Pro 200 AGC Ser ACA Thr GCT Ala GCT Ala 105 TTC Phe GCA Ala TGG Trp CCC Pro 18 S ACT Thr TTT Phe TCC Ser CCA Pro 90 GAG Glu ATC Ile GAT Asp GAA Glu GCG Ala 170 GAC Asp TCC Ser GAA Glu GGC Gly TCT Ser 250 TCT Ser CTC Leu ACC Thr CCG Pro ATC Ile 155 CGG Arg TAC Tyr CCT Pro TCA Ser AGC Ser 235 GAG Glu ATA I le ACG Arg CTT Leu 140 CCG PIC GAA Glu CCT Pro ACC Thr 220 CCC PIC AAG Lys GAG Glu GTT Val 125 GTG Val CGG Arg GAC Asp GTG Val 205 TCA Ser GCC Ala GCA Ala GCC Ala 110 GAG Glu GCG Ala AAG Lys TAT Tyr CCT Pro 190 TCT Ser ACT Thr CCT PIG ACT Thr 9 5 AAC Asn TCA Ser GAG Glu TCT Ser AAC Asn 175 GTG Val CCG PIC ACT Thr TCC Ser TCT Ser 255 Too Cys CTC Leu GAA Glu GAG Glu CGG Arg 1 60 CCC PEG GTC Val CCT PIC GCC Ala GGC Gly 240 GGC Gly TGC Cys GAG Glu GTC val TAC Tyr 305 GTC Val CTC Leu TCC Ser 385 GTA Val CCC Pro GGG Gly AGT Ser 290 TCT Ser CTG Leu GTG Val ACA Thr AAG Lys 370 TTT Phe ACC Thr CCC Pro GAG Glu 275 AGT Ser TGG Trp CCC PIG TAT Tyr TTT Phe 355 GAG Glu GGT Gly CAC His GAC Asp 260 CCT Pro GAG Glu ACA Thr ATC Ile TCC Ser 340 GAC Asp GTT Val GAA Glu TAT Tyr ATC Ile 420 TCC Ser GGG Gly GCC Ala GGC Gly AAT Asn 325 AGA Arg GCT Ala GGG Gly 405 AAC Asn GAC Asp GAT Asp AAC Asn GCA Ala 310 GCA Ala ACC Thr CTG Leu GCA Ala TGC Cys 390 GCA Ala TCC Ser GCT Ala CCG Pro GCG Ala 295 CTA Leu TCA Ser CAA Gln GCG Ala 375 AGC Ser GTG Val GAG Glu GAT Asp 280 GAG Glu GTC Val AGC Ser CGC Arg GTT Val 360 CTG Leu sac Asp TGG Trp TCC Ser 265 CTT Leu GAT Asp ACC Thr AAC Asn AGT Ser 345 TCA Ser ACG Thr GTC Val Lys 425 TAT Tyr AGC Ser GTC Val CCG Pro TCG Ser 330 CAC Asp CCC Pro CGT Arg 410 GAC Asp TCC Ser GAC Asp GTG Val TGC Cys 315 TTG Leu TGC Cys AGC Ser GTG Val CCA Pro 395 CTT Leu TCC Ser GGG Gly TGC Cys 300 CTA Leu CAA Gln CAT His Lys 380 CAT His CTG Leu ATG Met TCA Ser 285 TGC Cys GCG Ala CGT Arg AGG Arg TAC Tyr 365 TCA Ser GCC Ala GAA Glu CCC Pro 270 TGG Trp TCA Ser GAB Glu CAC His CAG Gln 350 CAG Gln AAC Asn GCC Ala AGA Arg GAC Asp 430 CCC PIC TCA Ser ATG Met GAA Glu CAC His 335 GAC Asp TTG Leu Lys 415 AAT A511 CTG Leu ACG Thr TCT Ser CAG Gln 320 AAT BSD GTA Val CTA Leu TCC Ser 400 GTA Val ACA Thr CAG Gln GAT Asp 465 TCA Ser CCA PIC CCT Pro 450 AAG Lys CCA Pro ATA Ile 435 GGC Gly GGA Gly GAC Asp AAG Lys GTG Val CCC PIC CAG Gln 500 INFORMATION ACT Thr GGG Gly CGC Arg TTG Leu 485 CGG Arg (1) SEQUENCE (A) ACC Thr GGT Gly GTG Val 470 GTT Val SEQ ID NO:6: CHARACTERISTICS: LENGTH: (B) TYPE: (D) TOPOLOGY: ATC Ile CGT Arg 455 GTG Val GAA Glu amino acids ATG Met 440 GAA Glu ATG Met TTC Phe GCT Ala CCA PIC GGA Gly amino acid linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE Phe Phe Thr Glu Cys Lys Pro Leu Glu Tyr Pro Val GCT Ala ATG Met AGC Ser 490 DESCRIPTION: SEQ ID Leu Asp Gly Val Arg Leu Arg Glu Glu Val Gly Ser Gln Leu Ser Met Leu Thr AAC ASH CGT Arg GCT Ala 475 TCC Ser GAG Glu CTC Leu 460 TAC Tyr NO:6: GTT Val 445 TAC Tyr GGA Gly TTC Phe GTG Val GAC Asp TTC Phe TGC Cys TTC Phe GTG Val CAA Gln 495 GTT Val CCC Pro GTT Val 480 TAC Tyr Leu His Arg Phe Ala Pro Arg Val Gly Pro Glu Pro His Ile Thr P130 Glu 275 Leu Ala Arg Asp 280 Gly Ser P130 Ser 285 P1’O P330 PIC) Gln 500 A811 Leu_ $21‘ Ser 490 Gln 495 A811 (2) INFORMATION FOR SEQ ID NO:7: SEQUENCE CHARACTERISTICS: (A) LENGTH: 477 base pairs (B)_TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: MOLECULE TYPE: linear CDNA to mRNA HYPOTHETICAL: NO (iv) ANTI-SENSE: NO -ORIGINAL souncz: (A) ORGANISM: Hepatitis c Virus (3) STRAIN: cDc (c) INDIVIDUAL ISOLATE: (Vi) Rodney IMMEDIATE SOURCE: (B) CLONE: 4091 (c-a) (vii) FEATURE: (A) NAME/KEY: (B) LOCATION: (ix) cDs 1..477 (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:7: GAA TTC CGC ACG CCC GCC GAG ACT ACA GTT AGG Glu Phe Arg Thr Pro Ala Glu Thr Thr Val 1 5 10 GGG CTT CCC GTG CAG Gly Leu Pro Val Gln 25 TGC GAC GGA Gly AAC ACT Thr Asn Pro GGC Gly GCT Ala GGA GAG ATC CCT TTT TAC Gly Glu Ile Pro Phe Tyr 40 ACC ACC Thr Thr Lys CTC ATC Ile TTC Phe TGT Cys GGG GGG AGA CAT Lys Gly Gly Arg His 50 55 ATC AAG Ile Leu CTA Leu ATT Ile ATC Ile TCA Ser 60 CGG Arg CCC Pro 45 GCG Ala TCC Ser AAG Lys TAC Tyr CCG Pro GAA Glu ATG Met GTA Val TGC Cys GAC GAA Asp Glu 65 TAC TAC Tyr Tyr CGC Arg GTC GTC val Val GTG Val GAC TCG Asp Ser GTG Val 115 AGC CTT Ser Leu 130 GAC Asp GCT GTC Ala Val 145 GCC Ala GGT Gly GCA Ala 100 CCT PIC CGC Arg (2) INFORMATION ('1) SEQUENCE CHARACTERISTICS: (A) LENGTH: GCA Ala CTT Leu 85 ACC Thr GAC Asp ACC Thr ACT Thr AAG Lys 70 GAC Asp GAT Asp TGC Cys TTC Phe CAA Gln 150 SEQ ID NO:8: CTG Leu GTG Val GCC Ala ACC Thr 135 CGT Arg amino acids GTC Val TCC Ser CTC Leu ACG Thr 120 CGG Arg GCA Ala GTC Val ATG Met 105 GAG Glu GGC Gly (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein TTG Leu ATC Ile 90 GTC Val ACA Thr AGG Arg GGC Gly 75 CCG Pro GGC Gly ACC Thr ATC Ile ACT Thr 155 ATC Ile ACC Thr TAT Tyr CAG Gln ACG Thr 140 GGC Gly (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8: AAT Asn AGC Ser ACC Thr ACA Thr 125 ACG Thr GCC Ala GGC Gly GGC Gly 110 CCC PIC GAA Glu GTG Val GAT Asp 95 GAT Asp CAG Gln TTC Phe GCC Ala 80 TTC Phe TTC Phe GAT Asp Glu Phe Arg Thr Pro Ala Glu Thr Thr Val Arg Leu Arg Ala Tyr Met Ash Thr Pro Gly Leu Pro Val Cys Gln Asp Gly Ile Pro Ser Pro Ser Ala 145 Thr Gly Lys 50 Gly Glu Leu Tyr Arg Val Val 115 Leu 130 Val Ser INFORMATION (A) (B) (C) (D) (ii) (iii) (Vi) TYPE: STRANDEDNESS: TOPOLOGY: Phe Leu Leu Val Ala Asn Thr ID NO:9: SEQUENCE CHARACTERISTICS: LENGTH: 558 base pairs nucleic acid double linear MOLECULE TYPE: Lys Ala Ile CDNA to mRNA HYPOTHETICAL: NO ORIGINAL SOURCE: Thr 155 (A) ORGANISM: Hepatitis c Virus (B) STRAIN: (vii) IMMEDIATE SOURCE: (B) CLONE: 4091 (abc) Ser 60 A311 TCC Ser GTA Val TGC Cys GCC Ala GTT Val 65 TTC Phe GAT Asp (ix) FEATURE: (A) NAME/KEY: (B) LOCATION: (Xi) ACC Thr ATC Ile GAC Asp TAC Tyr 50 GTC Val GAC Asp GCT Ala GGC Gly 130 l..558 SEQUENCE DESCRIPTION: ACC GGA GAG AAG Lys GAA Glu TAC Tyr GTC Val CTT Leu GTC Val 115 ATC Ile GGC Gly CTC Leu CGC Arg GTG Val GTG Val GAC Asp 100 TAC Tyr Glu GGG Gly GCC Ala GGT Gly GCA Ala ATA Ile 85 CGC Arg AGA Arg ATC Ile AGA Arg GCA Ala CTT Leu ACC Thr 70 ACC Thr ACT Thr TTT Phe CCT Pro CAT His AAG Lys GAC Asp 55 GAT Asp TGC Cys TTC Phe CAA Gln GTG Val 135 TTT Phe CTC Leu CTG Leu 40 GCC Ala ACC Thr CGT Arg 120 GCA Ala TAC Tyr ATC Ile GTC Val TCC Ser ACG Thr ATT Ile 105 GGC Gly TTC Phe GCA Ala GTC Val ATG Met TGT Cys 90 GGC Gly GGG Gly SEQ ID NO:9: AAG Lys TGT Cys TTG Leu ATC Ile ACC Thr 75 GTC Val ACA Thr AGG Arg GAG Glu GCT Ala CAT His GGC Gly CCG Pro 60 GGC Gly ACC Thr ATC Ile ACT Thr CGC Arg 140 ATC Ile TCA Ser ATC Ile 45 ACC Thr TAT Tyr CAG Gln ACG Thr GGC Gly 125 CCC Pro CCC Pro Lys AAT ASH ACC Thr ACA Thr CTC Leu 110 TCC Ser CTC Leu GCC Ala GGC Gly GGC Gly GTC Val 95 GGG Gly GGC Gly GTG Val GAT Asp GAC Asp 80 CAT Asp CAG Gln ATG Met TTC Phe 145 TAT Tyr GAC Asp GAG Glu ACC Thr Sex: CCG PIC TCC Ser ACG Thr GGG Gly 180 INFOAMATION (A) LENGTH: GTC Val CCC Pro 165 CTT Leu CTC Leu 150 CCC PIC TGT Cys GAG Glu GTG Val GAG Glu ACT Thr TGC Cys TGC Cys ACA Thr CAG Gln 185 SEQ ID NO:10: (B) TYPE: (D) TOPOLOGY: (i) SEQUENCE CHARACTERISTICS: TAT GAC GCA GGC TGT GCT Asp Ala Gly Cys Ala 155 GTT AGG CTA CGA GCG TAC Val 170 Arg Leu Arg Ala Tyr 175 GAC Asp amino acids amino acid linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE Gly Glu DESCRIPTION: SEQ ID Ile Pro Phe Tyr Gly Lys Ala Ile Gly Gly Arg His Leu Ile Arg Gly Leu Asp Val ser Ala Lys Leu Val Thr Asp Ala Leu Asp Cys Asn Thr NO:lO: Pro Leu 15 Set Phe Lys Cys His Lys Ala Leu Gly Ile Asn Ala Thr Ile Pro ser Val Gly Met Thr Gly Th: Gly Val 95 Cys Val Thr Gln Thr TGG Trp 160 ATG Met Phe Ser Leu Asp Pro Thr Phe Thr Ile Glu Thr Ile Thr Leu Pro Gln 100 105 110 Asp Ala Val Ser Arg Thr Gln Arg Arg Gly Arg Thr Gly Arg Gly Lys 115 120 125 Pro Gly Ile Tyr Arg Phe Val Ala Pro Gly Glu Arg Pro Ser Gly Met 130 135' 140 Phe Asp Ser Ser Val Leu Cys Glu Cys Tyr Asp Ala Gly Cys Ala Trp 145 150 155 160 Tyr Glu Leu Thr Pro Ala Glu Thr Thr Val Arg Leu Arg Ala Tyr Met 165 170 175 Asn Thr Pro Gly Leu Pro Val Cys Gln Asp 180 185 (2) INFORMATION FOR SEQ ID NO:ll: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 657 base pairs (3) TYPE: nucleic acid (c) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: CDNA to mRNA (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (vi) ORIGINAL SOURCE: (A) ORGANISM: Hepatitis C Virus (8) STRAIN: cnc (vii) IMMEDIATE SOURCE: (B) CLONE: GGl (ix) FEATURE: (A) NAME/KEY: cos (B) LOCATION: 1..630 ATE Met CGT Arg GGA Gly ACG Thr ATC Ile 65 TAC Tyr CTC Leu ccc Arg GGC Gly GGA Gly 145 (xi) SEQUENCE DESCRIPTION: GGC ACG AAT CCT CGC Arg GTT Val AGA Arg 50 CCC PIC CCT Pro CTG Leu CGT Arg TTC Phe 130 GGC Gly CCA Pro TAC Tyr 3 5 AAG Lye AAG Ly s TGG Trp TCT Ser AGG Arg 115 GCT Ala CAG Gln TTG Leu ACT Thr GCT Ala CCC PEG CCC Pro 100 ' GAC Asp GCC Ala Pro GAC Asp TTG Leu TCC Ser CGT Arg CTC Leu 85 CGC Arg CTC Leu AGG Arg AAA Lye GTC val CCG Pro GAG Glu CGG Arg 7 O GGC Gly ATG Met GCC Ala 150 CCT Pro AAG Lys CGC Arg CGG Arg 55 CCC Pro GGC Gly TCT Ser TTG Leu GGG Gly 135 CTG Leu SEQ ID NO: 11: CAAAAAAAAAACAAA TTC Phe AGG Arg 40 GAG Glu ccc Arg GGT Gly 120 GCG Ala CCG Pro 2 5 CAA Gln GGC Gly GAG Glu CCT Pro 105 ATA Ile CAT His Lys GGT Gly CCT PZO CCT PIO AGG Arg GGC Gly 90 GTC Val CCG PIG GGC Gly GGC Gly AGA Arg CGA Arg Acc Thr 7 5 TGC Cys TGG Trp ATC Ile CTC Leu GTC Val 155 GGT Gly GGT Gly 60 TGG Trp GGG Gly GGC Gly GAT Asp GTC Val 140 CGG Arg CGT Arg CAG Gln GGT Gly 45 AGA Arg GCT Ala TGG Trp ACC Thr 12 S GTT Val ATC Ile GTG Val CGT Arg CAG Gln GCG Ala ACA Thr 110 GCC Ala CTG Leu ACC Thr GTT Val CGC Arg CAG Gln CCC PIC GGA Gly 95 ACG Thr CCT Pro GAP.

Glu GGT Gly GCG Ala CCT Pro GGG Gly 80 TGG Trp TGC Cys GAC Asp 1 96 GGC Gly TTC Phe CAA Gln Ile 65 GTG Val CTT Leu GTG Val TCG Ser 210 CTG Leu CGC Arg 195 AGC Ser TAT Tyr GCC Ala 180 ATT Ile INFORMATION GCA Ala 165 CTG Leu TCC Ser GTG Val ACA Thr CTC Leu ACG Thr TAC Tyr GGG Gly TCT SE1‘ GGG Gly GAG Glu 215 TGC Cys CTT Leu 200 CTT Leu TTG Leu 185 TAC Tyr SEQ ID NO:l2: (B) TYPE: (D) TOPOLOGY: amino acids (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: amino acid linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE Gly Thr Asn Pro Arg Pro Gln Asp Val Tyr Leu Leu Arg Lys Thr Ser Pro Lys Ala Arg CCT Pro 170 GGA Gly DESCRIPTION: SEQ ID Lys Pro Gln Lys Lys Val Lys Phe Pro Gly Pro Arg Arg Gly Pro Glu Arg ser Gln Pro Arg Pro Glu Gly Arg GGT Gly GTG Val GTC Val TCT Ser TGC Cys GCT Ala AAT Asn 205 ACC Thr NO:12: TTC Phe TCG Ser 190 GAT Asp TCT Ser 175 TGC Cys ATC Ile TAC Tyr CCT Pro Asn Lys Arg Asn Thr Asn Gly Gly Gln Ile Val Gly Leu Gly Val Arg Ala Gly Arg Arg Gln Pro Trp Ala Gln Pro Gly Ser 210 INFORMATION (ii) (iii) (iV) (Vi) P-.13 Leu Asn Glu Pro Tyr Gly Gly Cys Pro Ser 105 Pro Ser Arg Gly Arg Trp Ser Arg Asn Leu Gly Val Ile Asp Leu Met Gly Ile Pro Leu Val 155 Ala Ala Ala His Arg Leu Gly Ala 165 Thr Pro Tyr Gly Asn Leu Gly Ala Thr Val Leu 185 Leu Leu Ser Cys Thr Leu His Val Asn Ser Gly Tyr Val Glu * * Ile Tyr Gly Ser FOR SEQ ID NO:l3: SEQUENCE CHARACTERISTICS: (A) (3) (C) (D) MOLECULE TYPE: LENGTH: 657 base pairs TYPE: STRANDEDNESS: double TOPOLOGY: nucleic acid linear CDNA to mRNA HYPOTHETICAL: NO ANTI-SENSE: NO ORIGINAL SOURCE: (A) ORGANISM: Hepatitis C Virus Asn 205 ATG Met CGT Arg GGA Gly ACG Thr ATC Ile 65 CTC Leu CGG Arg (B) STRAIN: cnc (vii) IMMEDIATE SOURCE: (B) CLONE: CapA (ix) FEATURE: (A) NAME/KEY: cos (B) LOCATION: l..657 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:l3: GGC Gly AAT Asn CCT AAA CCT CAG AAG AAC AAA Pro Lys Gln Lys 10 Pro Lys Asn Lys AAG Lye CGC Arg CCA PIC CAG GAC GTC TTC CCG Gln Asp Val Phe Pro ‘ 25 GGT Gly GGC Gly GGT Gly TAC TTG CGC AGG Tyr Leu Arg Arg 40 TTG Leu CCG Pro GGC Gly CCT Pro AGA Arg GTT Val TCG Ser AGA AAG ACT TCC GAG CGG CAA CGA GGT Arg Thr Ser Glu Arg Gln Arg Gly 50 55 60 CCT Pro TGG Trp GCT CGT Ala Arg CGG GAG GGC AGG ACC Arg Glu Gly Arg Thr 70 75 CCC PIC Pro Lye CTC Leu TAT Tyr GGC AAT GAG GGC Gly Asn Glu Gly 85 90 TGC Cys GGG Gly CCT Pro TGG Trp CCC Pro GGC Gly TCT Ser CGG Arg CCT Pro 105 AGC Ser TGG Trp GGC Gly CCC Pro 100 CGT Arg CTG Leu AAT Asn GGT Gly 120 AAG Lys GTC Val ATC Ile GAT Asp CGC Arg CGT Arg AGG Arg 115 TCG Ser CGT Arg CAG Gln GGT Gly 45 AGA Arg GCT Ala TGG Trp CCC PIC ACC Thr 125 AAC Asn ATC Ile GTG Val CGT Arg CAG Gln GCG Ala ACA Thr 110 CTT Leu ACC Thr GTT Val CGC Arg CAG Gln CCC PIC GGA Gly 95 ACG Thr GGT Gly GCG Ala CCT Pro GGG Gly 80 CCC Pro TGC Cys GGC Gly GGA Gly 145 GGC Gly TTC Phe CAA Gln (2) INFORMATION FOR (1) SEQUENCE (A) LENGTH: (B) TYPE: TTC GCC Phe Ala 130 GGC Gly GCT Ala GTG Val AAC ASH CTT Leu CTG Leu GTG Val CGC Arg 195 AGC Ser TCG Ser 210 GAC Asp GCC Ala TAT Tyr GCC Ala 180 ATT Ile AGG Arg GCA Ala 165 GTG val ATG Met GCC Ala 150 CTC Leu ACG Thr TAC Tyr GGG Gly 135 CTG Leu GGG Gly TCT Ser GGG Gly GAG Glu 215 TAC Tyr GCG Ala AAC Asn TGC Cys CTT Leu 200 ATA Ile CAT His CTT Leu TTG Leu 185 TAC Tyr SEQ ID NO:14: CHARACTERISTICS: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein CCG Pro GGC Gly CCT Pro 170 CAC His GGA Gly amino acids CTC Leu GTC Val 155 GTG Val GTC Val TCC Ser GTC Val 140 rec Cys CCC PIO ACC Thr (xi) SEQUENCE DESCRIPTION: SEQ ID NO:l4: GGC Gly GTT Val TCT Ser GCT Ala Asn 205 GCC Ala CTG Leu TTC Phe TCG Ser 190 GAT Asp GAA Glu TCT Ser 175 TGC Cys CTT Leu GAC Asp 160 TAC Tyr CCT Pro Met Gly Thr Asn Pro Lys Pro Gln Lys Lys Asn Lys Arg Asn Thr Asn Arg Arg Pro Gln Asp Val Lys Phe Pro Gly Gly Gly Gln Ile Val Gly Ser 210 P170 INFORMATION Arg Arg Arg Ser 55 Pro Glu Gly Asn Ser Arg Leu Gly Gly 135 Leu Ala Gly Asn Ser Leu 200 Glu * 215 SEQ ID NO:l5: (i) SEQUENCE CHARACTERISTICS: (A) (B) (C) (D) nucleic acid linear LENGTH: 453 base pairs TYPE: STRANDEDNESS: double TOPOLOGY: Asn 205 ATG Met CGT Arg GGA Gly ACG Thr ATC Ile 65 TAC Tyr (ii) MOLECULE TYPE: CDNA to mRNA (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: N0 (vi) ORIGINAL souacz: (A) ORGANISM: Hepatitis C Virus (B) STRAIN: CDC (vii) IMMEDIATE souacn: (B) CLONE: ClNC450 (ix)'FEATURE: (xi) SEQUENCE DESCRIPTION: GGC Gly CGC Arg GTT Val AGA Arg 50 CCT Pro (A) NAME/KEY: CD5 (8) LOCATION: 1..4s3 CCT AAA CCT CAG AAG Pro Lys Pro Gln Lys 10 AAG Lys AAC Asn ACG Thr AAT Asn CCG Pro GGT Gly GGC Gly CAG GAC GTC TTC Gln Asp Val Lys Phe 25 CCA PIO GGC Gly CCT PIC AGA Arg TTG Leu CCG Pro AGG Arg TAC TTG CGC Tyr Leu Arg 40 GAG Glu CAA Gln CGG Arg 55 TCG Ser CCT Pro CGA Arg ACT Thr TCC Ser CGG GAG GGC AGG ACC Arg Glu Gly Arg Thr 70 75 CCC PIO CGT Arg Lys Ala TGC Cys CTC TAT GGC GAG GGC Leu Tyr Gly Glu Gly 85 90 CCC Pro Trp Asn SEQ ID NO:l5: GGT Gly TTG Leu GGT Gly 60 GGG Gly CGT Arg CAG Gln GGT Gly 45 GCT Ala TGG Trp AAC Asn ATC Ile CGT Arg CAG Gln GCG Ala ACC Thr GTT Val CGC Arg CAG Gln CCC Pro GGA Gly 95 GGT Gly GCG Ala CCT Pro GGG Gly 80 TGG Trp CTC Leu CGG Arg GGC Gly GGA Gly 145 Ile 65 TCT S81.‘ CCC Pro 100 CGT Arg TCG Ser CGC Arg CGT Arg AGG Arg 115 GAC Asp CTC Leu TTC Phe 130 GCC Ala GCC Ala AGG Arg GGC Gly GCT Ala INFORMATION FOR (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 150 amino acids (8) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID Gly Thr Asn Pro Arg Pro Gln Asp Val Tyr Leu Leu Arg Lys Thr Ser 50 Pro Lys Ala Arg GGC Gly TCT Ser AAT A811 TTG Leu ATG Met GGG Gly 135 GCC Ala 150 CGG Arg GGT Gly 120 TAC Tyr CCT Pro 105 ATA Ile SEQ ID NO:l6: Val Lys AGC Ser GTC Val Pro Gln Lys Lys Pro Gly Pro Arg Arg Gly Pro Glu Arg Arg Pro P230 TGG Trp ATC Ile CTC Leu GGC Gly GAT Asp GTC Val 140 NO:l6: ACC Thr 125 GGC Gly ACA Thr 110 GCC Ala Asn Lys Arg Asn Gly Gly Gln Ile Arg Leu Gly Val Arg Gly Arg Arg Thr Trp Ala Gln GAC Asp ACG Thr Thr TGC Cys Arg Ala Gly 80 Tyr Pro Trp Pro Leu Gly 145 INFORMATION FOR (ii) (iii) (iV) (vi) (vii) (ix) (Xi) Ala Ala Arg Tyr Gly Aan Glu Gly Cys Ser Pro Arg Arg Ser Arg Asn Leu Gly Lys "120 Met Ala Asp Leu Gly Tyr Ile Ala 150 SEQ ID NO:l7: SEQUENCE CHARACTERISTICS: (A) LENGTH: 360 base pairs (B) TYPE: (C) STRANDEDNESS: (D) TOPOLOGY: nucleic acid double linear MOLECULE TYPE: CDNA to mRNA HYPOTHETICAL: NO ANTI-SENSE: NO ORIGINAL SOURCE: (A) ORGANISM: Hepatitis C Virus (3) STRAIN: coc IMMEDIATE souacs: (B) CLONE: C1NC36O FEATURE: (A) NAME/KEY: CDS (B) LOCATION: l..360 SEQUENCE DESCRIPTION: SEQ ID NO:17: Val Ile Asp Thr Leu Pro Leu Val Gly Ala Gly Trp Ala Gly Trp Gly Ser Arg Pro Ser Trp Gly Pro Thr Asp Pro Thr Cys 125 Pro Leu 130 ATG Met CGT Arg GGA Gly ACG Thr ATC Ile 65 TAC Tyr CGG Arg GGC ACG Gly Thr CGC Arg CCA Pro GTT TAC Val Tyr AGA Arg 50 AAG Lys CCC Pro AAG Lys CCT Pro TGG Trp CTG Leu AGG Arg 115 CGT Arg CAG Gln ACT Thr GCT Ala CCC Pro 100 INFORMATION GAC Asp TTG Leu CGT Arg CTC Leu 85 CGT Arg CGC Arg (i) SEQUENCE GTC Val GAG Glu CGG Arg 70 GGC Gly CCT PIC AAG Lye CGC Arg CGG Arg 55 GGC Gly CAG Gln TTC Phe AGG Arg TCG GAG Glu CGG Arg AAG Lys CCG Pro GGC Gly CAA Gln GGC Gly GAG Glu CCT Pro 105 SEQ ID NO:l8: CHARACTERISTICS: (A) LENGTH: 119 amino acids (B) TYPE: (D) TOPOLOGY: linear amino acid (ii) MOLECULE TYPE: protein GGT Gly AGG Arg GGC Gly 90 S91‘ GGC Gly AGA Arg CGA Arg ACC Thr 75 TGG Trp GGT Gly GGT Gly 60 GGG Gly GGC Gly (xi) SEQUENCE DESCRIPTION: SEQ ID NO:l8: CGT Arg CAG Gln GGT Gly 45 GCT Ala TGG Trp CCC Pro ATC Ile GTG Val CGT Arg CAG Gln GCG Ala ACA Thr 110 ACC Thr GTT Val CGC Arg CAG Gln CCC Pro GGA Gly 95 GAC Asp GGT Gly GCG Ala GGG Gly 80 Thr Asn Pro Lys Asp Val Leu Pro Set Glu Arg Arg Leu 85 Arg Gly Arg 115 S81.‘ Arg Asn Pro Lye Arg Arg Pro Gly Self Pro 105 INFORMATION FOR SEQ ID NO:l9: (ii) (iii) (iV) (Vi) SEQUENCE CHARACTERISTICS: (A) (3) (C) (D) LENGTH: 273 base pairs TYPE: nucleic acid STRANDEDNESS: double TOPOLOGY: linear MOLECULE TYPE: Lye Asn Lys P230 CDNA to mRNA HYPOTHETICAL: NO ANTI-SENSE: NO ORIGINAL SOURCE: (A) ORGANISM: Hepatitis C Virus STRAIN: Arg Asn Thr Asn Thr 1 Val ATG Met CGT Arg GGA Gly ACG Thr ATC Ile 65 TAC Tyr (Vii) IMMEDIATE SOURCE: (B) CLONE: ClNC27O (ix) FEATURE: (A) NAME/KEY: (B) LOCATION: l..273 (Xi) SEQUENCE DESCRIPTION: GGC Gly CGC Arg GTT Val AGA Arg 50 ACG Thr CCA Pro TAC Tyr AAG Lys TGG Trp AAT Asn CAG Gln ACT Thr GCT Ala CCC PIC INFORMATION (ii) MOLECULE TYPE: SEQUENCE CHARACTERISTICS: CCT Pro TTG Leu TCC Ser CGT Arg CTC Leu 85 AAA Lys GTC Val CCG PIC GAG Glu CGG Arg 70 TAT Tyr CCT CAG AAG AAG Lys CGC Arg ccc Arg 55 GGC Gly TTC Phe AGG Arg 40 TCG Ser GAG Glu CCG Pro CAA Gln GGC Gly GAG Glu SEQ ID NO:20: SEQ ID NO:l9: AAG AAC Lye Asn GGT GGC Gly Gly CCT AGA Pro Arg CCT CGA Pro Arg AGG Arg ACC Thr 75 GGC Gly 90 (A) LENGTH: 90 amino acids (8) TYPE: amino acid (D) TOPOLOGY: linear protein GGT Gly TTG Leu GGT Gly 60 TGG Trp CGT Arg CAG Gln GGT Gly 45 GCT Ala AAC ASH ATC Ile GTG val CGT Arg CAG Gln ACC Thr CGC Arg CAG Gln GGT Gly GCG Ala CCT PIC GGG Gly (xi) SEQUENCE DESCRIPTION: Gly Thr Asn Pro Lye Pro Gln Lys Lys 10 Arg Pro Gln Asp 25 Val Tyr Leu Leu Pro Arg Arg 40 Arg Lys Thr Ser Gln Pro Glu Arg Ser 55 Pro Lye Ala Arg Arg Pro Glu Gly Arg Pro Leu Glu Gly 90 Pro Trp Tyr Gly Asn INFORMATION FOR SEQ ID NO:2l: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 183 base pairs (8) TYPE: (c) STRANDEDNESS: double (D) TOPOLOGY: nucleic acid linear MOLECULE TYPE: (ii) CDNA to mRNA (iii) HYPOTHETICAL: NO (iv) ANTI—SENSE: NO (vi) ORIGINAL SOURCE: (A) ORGANISM: Hepatitis c Virus (B) STRAIN: coc (vii) IMMEDIATE SOURCE: (B) CLONE: C10ONC27O (ix) FEATURE: Gly Pro Arg Leu Thr Trp SEQ ID NO:20: Val Lys Phe Pro Gly Gly Gly Gln Ile Gly Val 45 Arg Gly Arg Arg Ala Gln Asn Lys Arg Asn Thr Asn Gly ATG Met CGC Arg CAG Gln CCC PIC (A) NAME/KEY: cos (B) LOCATION: l..183 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2l: GGT GGA Gly Gly GTT Val TAC Tyr TTG Leu ACT Thr GCG Ala ACG Thr AGA Arg AAG Lys TCC Ser AAG Lys GCT Ala CGT Arg CCT Pro ATC Ile CCC Pro CTC Leu GGG TAC TGG Gly Tyr Trp 50 55 CCT Pro CCC Pro INFORMATION FOR (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: (8) TYPE: CCG Pro GAG Glu CGG Arg 40 TAT Tyr CGC Arg CGG Arg GGC Gly sag ID NO:22: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: AGG Arg GAG Glu AAT ASH amino acids SEQ ID Met Gly Gly Val Tyr Leu Leu Pro Arg Arg Arg Ala Thr Arg Lys Thr ser Glu Arg Ser Gln Pro Ile Pro Lys Ala Arg Arg Pro Glu GGC Gly CCT P130 AGA Arg CAA Gln CCT Pro CGA Arg GGC Gly AGG Arg ACC Thr 45 GGC TA Gly 60 GAG Glu NO:22: GGT Gly TGG Trp GGT Gly GCT Ala GTG Val CGT Arg CAG Gln Gly Pro Arg Leu Gly Val Gln Pro Arg Gly Arg Arg Gly Arg Thr Trp Ala Gln Pro Gly Tyr Pro Trp Pro Leu Tyr Gly Asn Glu Gly (2) INFORMATION FOR SEQ ID NO:23: (i) SEQUENCE CHARACTERISTICS: (A) (B) (C) (0) (ii) (iii) (iv) (Vi) ANTI-SENSE: MOLECULE TYPE: nucleic acid STRANDEDNESS: double TOPOLOGY: linear LENGTH: 270 base pairs TYPE: CDNA to mRNA HYPOTHETICAL: NO ORIGINAL SOURCE: (A) ORGANISM: Hepatitis C Virus (B) STRAIN: (vii) IMMEDIATE SOURCE: (B) CLONE: C1OONC360 (ix) FEATURE: (A) NAME/KEY: cos (B) LOCATION: l..27O (xi) SEQUENCE DESCRIPTION: ATG Met GGT GGA GTT Gly Gly Val CGC Arg GCG ACG AGA Ala Thr Arg CAG Gln CCT ATC CCC Pro Ile Pro TAC TTG Tyr Leu AAG ACT Lye Thr AAG GCT Lys Ala TTG Leu TCC Ser CGT Arg CCG PIO GAG Glu ccc Arg 40 CGC AGG Arg Arg CGG TCG Arg Ser CCC GAG Pro Glu SEQ ID NO:23: GGC Gly CAA Gln GGC Gly CCT PIC CCT P150 AGG Arg AGA Arg CGA Arg ACC Thr 45 TTG Leu GGT Gly TGG Trp GGT Gly GCT Ala GTG Val CGT Arg CAG Gln CCC Pro GGA Gly 65 GAC Asp CCT Pro TGG Trp GGG Gly 50 TAC Tyr TCT Ser TGG Trp CTC Leu CCC Pro CGG Arg CGT Arg AGG Arg 85 INFCPMATION FOR CCC PIC CCC Pro 70 TCG Ser CTC Leu 55 CGC Arg TAT Tyr GGC Gly GGC AAT GAG GGC Gly Asn Glu Gly 60 TCT Ser CGG Arg CCT PIC AGC Ser TGC GGG TGG GCG Cys Gly Trp Ala TGG GGC CCC ACA Trp Gly Pro Thr TTG TA Leu 90 SEQ ID NO:24: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 89 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE Gly Gly Val Tyr Ala Thr Arg Lys Pro Ile Pro Lys Gly Pro Tyr Trp Trp Leu Leu Ser Arg Arg Arg DESCRIPTION: SEQ ID Arg Arg Arg Ser Pro Glu Gly Asn Ser Arg NO:24: Gly Pro Arg Leu Gln Pro Arg Gly Gly Arg Thr Trp 45 Glu Gly Cys Gly 60 Pro Ser Trp Gly Gly Val Arg Arg Ala Gln Ala Thr 80 ATG Met CGT Arg GGA Gly INFORMATION FOR SEQ ID NO:25: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 106 base pairs (3) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: CDNA to mRNA (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: N0 (vi) ORIGINAL SOURCE: (A) ORGANISM: Hepatitis C Virus (8) STRAIN: cuc (vii) IMMEDIATE SOURCE: (B) CLONE: ClNClO5 (ix) FEATURE: (A) NAME/KEY: cos (3) LOCATION: l..106 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:25: GGC ACG AAT CCT AAA CCT CAG AAG AAG AAC AAA CGT AAC ACC AAC Gly Thr Asn Pro Lys Pro Gln Lys Lys Asn Lys Arg Asn Thr Asn CGC CCA CAG GAC GTC AAG TTC CCG GGT GGC GGT CAG ATC GTT Arg Pro Gln Asp Val Lys Phe Pro Gly Gly Gly Gln Ile Val GTT TTA A Val Leu INFORMATION FOR SEQ ID NO:26: GGT Gly (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 35 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:26: Met Gly Thr Asn Pro Lye Pro Gln Lye Lys Asn Lye Arg Asn Thr Asn 1 5 10 15 Arg Arg Pro Gln Asp Val Lys Phe Pro Gly Gly Gly Gln Ile Val Gly ’ 20 25 30 Gly Val Leu

Claims (16)

CLAIMS:

1. A recombinant polypeptide identified by SEQ ID No.: 6 and immunoreactive with sera from humans infected with hepatitis C Virus (HCV).

2. A polypeptide according to claim 1, which is produced by the expression vector contained in an Escherichia coli host identified by ATCC No. 40901.

3. An immunoreactive polypeptide for detecting the presence of Hepatitis C Virus antibodies in a serum sample, comprising a polypeptide produced by the expression vector contained in an Escherichia coli host identified by ATCC No. 40901, where said polypeptide is identified by SEQ ID NO: 6.

4. A diagnostic kit for use in screening human blood containing antibodies specific against hepatitis C virus (HCV) infection comprising a recombinant polypeptide of any of claims 1, 2, or 3 and binding of said means for detecting the antibodies to the polypeptide.

5. A kit of claim 4, wherein said detecting means includes a solid support to which said poly- peptide is attached, and a reporter-labeled anti-human antibody, wherein binding of said serum antibodies to said polypeptide can be detected by binding of the reporter-labeled antibody to said solid support.

6. A method of detecting hepatitis C virus (HCV) infection in an individual, comprising 129 reacting serum from an HCV-test individual with any of the polypeptides of claims 1, 2, or 3, and examining the polypeptide for the presence of bound antibody.

7.'7. A method of claim 6, wherein the polypeptide is attached to a solid support, said reacting includes reacting the serum with the support, and subsequently reacting the support with a reporter-labeled anti- human antibody, and said examining includes detecting the presence of reporter-labeled antibody on the solid support.

8. An expression vector for expressing a recombinant polypeptide antigen which is immuno- reactive with sera from humans infected with hepatitis C virus (HCV), comprising a selected expression vector containing an open reading frame (ORF) having a polynucleotide sequence which encodes a polypeptide antigen that is identified by see ID NO: 5.

9. An expression vector of claim 8, where the expression vector is.a lambda gtll phage vector.

10. An expression vector of claim 9, where said expression vector is contained in the deposited E. coli strain ATCC No. 40901.

11. An expression system for expressing a recombinant polypeptide antigen which is immuno- reactive with sera from humans infected with hepatitis C virus (HCV), comprising a host cell containing an expression vector of claim 8, where said cell is capable of supporting expression of the open reading frame in the selected expression vector.

12., 12. An expression system of claim 11, wherein the expression vector is a lambda gt11 phage vector, the host is E. coli, and the host containing the introduced vector is identified by ATCC No. 40901.

13. A method of producing a polypeptide which is immunoreactive with sera from humans infected with hepatitis C virus (HCV), comprising introducing into a suitable host an expression vector of claims 8 or 9, where the vector is designed to express the OR? in said host, and culturing said host under conditions resulting in the expression of the ORF sequence.

14. A method of claim 13, wherein the expression vector is a lambda gt11 phage vector, the host is E. coli, and the host containing the introduced vector is identified by ATCC No. 40901.

15. A recombinant polynucleotide that encodes a‘ polypeptide immunoreactive with sera from humans infected with hepatitis C virus (HCV), that is identified by SEQ ID NO: 6.

16. A polynucleotide of claim 15, where the sequence of said polypeptide is encoded by the polynucleotide sequence presented as SEQ ID NO: 5. F. R. KELLY & CO., AGENTS FOR THE APPLICANTS.