EP0585381A1 - THE ASTROVIRUS HUMAN GASTROENTERITIS AGENTS AND MOLECULAR CLONING OF CORRESPONDING cDNAs - Google Patents

THE ASTROVIRUS HUMAN GASTROENTERITIS AGENTS AND MOLECULAR CLONING OF CORRESPONDING cDNAs

Info

Publication number
EP0585381A1
EP0585381A1 EP92913046A EP92913046A EP0585381A1 EP 0585381 A1 EP0585381 A1 EP 0585381A1 EP 92913046 A EP92913046 A EP 92913046A EP 92913046 A EP92913046 A EP 92913046A EP 0585381 A1 EP0585381 A1 EP 0585381A1
Authority
EP
European Patent Office
Prior art keywords
seq
astrovirus
polypeptide
lambda
group
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP92913046A
Other languages
German (de)
French (fr)
Inventor
Jungsuh P. Kim
Suzanne M. Matsui
Harry B. Greenberg
Gregory R. Reyes
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Genelabs Technologies Inc
Leland Stanford Junior University
Original Assignee
Genelabs Technologies Inc
Leland Stanford Junior University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Genelabs Technologies Inc, Leland Stanford Junior University filed Critical Genelabs Technologies Inc
Publication of EP0585381A1 publication Critical patent/EP0585381A1/en
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/08—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses
    • C07K16/10—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses from RNA viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/12011—Astroviridae
    • C12N2770/12022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes

Definitions

  • This invention relates to the identification of Astrovirus genomic nucleic acid sequences, to specific immunoreactive polypeptide viral antigens, to poly- nucleotide sequences which encode these polypeptide antigens, to an expression system capable of producing the polypeptide antigens, to methods of using the polypeptide antigens for detecting Astrovirus infection in human sera, to methods using Astrovirus nucleic acid sequences to detect Astrovirus in feces or other bodily secretions, and to antibodies directed against these polypeptide antigens.
  • a group of serologically diverse viruses have been implicated in common source outbreaks of gastroenteritis (Kapikian et al. ; Greenberg et al. (1989); Dolin et al.). These viruses include Astroviruses, caliciviruses, Norwalk and the Norwalk-like viruses (also called small round-structured viruses (SRSVs) ) , parvoviruses, coronaviruses, toroviruses, pestiviruses. It has been estimated that up to 65% of all cases of acute gastroenteritis in the United States are attributable to viral agents (Blacklow et al. (1982)).
  • SRSVs small round-structured viruses
  • Astrovirus have also been implicated in outbreaks in gastroenteritis involving adults in the following settings: 1) elderly patients in residential care facilities (Gray et al., Oshiro et al.), 2) a third of adults who ingested contaminated oysters (Kurtz et al. (1989)), and 3) a group of teachers and students who drank water from a contaminated source (Kurtz et al. (1989)).
  • Animal Astroviruses that are morphologically indistinguishable from antigenically distinct from human Astrovirus have also been identified in diarrheal stool samples from a variety of species (Kjeldsberg et al.). Two previous studies have attempted a systematic examination of Astrovirus gastroenteritis in adult human volunteers.
  • Each of these Astrovirus serotypes has been successfully adapted for population in trypsin supplemented tissue culture (LLCMK2 Rhesus monkey kidney cells), however, at relatively low titers (Lee et al.).
  • Hyperimmune rabbit sera group- and serotype- specific
  • a group-reactive monoclonal antibody (8E7) have recently been produced (Herrmann, et al. (1989)).
  • Rabbit antisera to specific Astrovirus serotypes have been used in a neutralization assay (Hudson et al.), while the group-reactive monoclonal antibody and a hyperimmune rabbit serum have been incorporated into an Astrovirus ELISA (Herrmann, et al.
  • the Astrovirus genome is composed of plus-sense, single-stranded RNA with a 3'-end poly (A) tail (Herring et al. , Monroe et al., Willcocks et al.).
  • the genome is -7.2 Kb in length (Monroe et al.) and encodes three structural proteins that range in mass from 20-35 kDa (Willcocks et al. , Monroe et al.). To date, the nucleic acid and amino acid composition of the Astrovirus genome have not been determined.
  • the present specification discloses methods effec ⁇ tive for the isolation and expression of Astrovirus genomic sequences. Summary of the Invention
  • Another object of the present invention is to pro ⁇ vide a recombinantly produced Astrovirus polynucleotide which encodes an Astrovirus polypeptide which is immu- noreactive with sera from rabbits immunized with Astro ⁇ virus infectious inoculum.
  • Specific embodiments of these polynucleotides are those which encode an immunoreactive portion of any one of the following sequences: SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO: 12, and SEQ ID NO:14.
  • poly ⁇ nucleotides which encode such polypeptides include: SEQ ID NO:l, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:ll, and SEQ ID NO:13.
  • the present invention also includes Astrovirus derived polypeptides produced by bacterial cells con ⁇ taining a vector selected from the group consisting of lambda-A2, lambda-All, lambda-A13 and lambda-A33 (these are lambda gtll vectors containing the designated inserts, see Example 3).
  • the present invention also provides a recombinant Astrovirus polypeptide which is immunoreactive with sera from rabbits immunized with Astrovirus infectious inoculum.
  • Such recombinant polypeptides include those having matching and substantially the same sequence as one of the following polypeptides: SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14.
  • the recombinant polypeptide may also include portions of other proteins, such as in-frame fusions to the lacZ encoded -galactosidase protein. 8
  • Such recombinant polypeptides can be obtained from bacterial cells containing, for example, lambda gtll vectors with any of the described inserts, including lambda-A2, lambda-All, lambda-A13 and ' lambda-A33.
  • the invention includes, in one aspect, a method for the detection of Astrovirus in human stool samples and in environmental samples.
  • the method includes the partial purification of polynucleotides present in the stool sample or concentration of polynucleotides from environmental samples, followed by hybridization to oligonucleotide probes specific for the Astrovirus polynucleotide.
  • the method also includes means for detecting the binding of the probes to polynucleotides present in the stool or environmental sample.
  • Such detection means include the standard detection methods of labelling the probe by biotinylation or radioactive isotopes.
  • the method may include generation of cDNA molecules from RNA templates present in the partially purified sample and sequence independent amplification of the resulting cDNA molecules.
  • Oligonucleotide probes and oligonucleotide primers specific for the Astrovirus poly ⁇ nucleotide are also defined by the present invention. Both the probes and primers can be derived from the above-described Astrovirus coding sequences.
  • Another aspect of the present invention is a diag ⁇ nostic kit and a method for use in screening human blood containing antibodies specific against Astrovirus antigens.
  • the kit contains a recombinant Astrovirus polypeptide antigen which is immunoreactive with sera from rabbits immunized with Astrovirus infectious inoculum, and means for detecting the binding of said antibodies to the antigen.
  • Polypeptide antigens include ⁇ ding an immunoreactive portion of any of the above de ⁇ scribed Astrovirus epitopes may be used in this regard.
  • the kit may include a solid support to which the polypeptide antigen is attached and a reporter-labeled anti-human antibody. In this case the binding of anti- Astrovirus serum antibodies to the antigen can be detected by binding of the reporter-labeled antibody to the solid surface.
  • Yet another aspect of the present invention includes an expression system and a method of producing an Astrovirus polypeptide which is immunoreactive with sera from rabbits immunized with Astrovirus infectious inoculum.
  • the method includes introducing into a suit ⁇ able host a recombinant expression system containing an open reading frame (ORF) , where the ORF has a polynucleo ⁇ tide sequence which encodes an Astrovirus polypeptide immunoreactive with sera from rabbits immunized with Astrovirus infectious inoculum.
  • the vector is designed to express the ORF in the selected host.
  • the host is then cultured under conditions resul ⁇ ting in the expression of the ORF sequence.
  • a number of expression systems can be used in this regard including the lambda gtll expression system in an Escherichia coll host.
  • Other expression systems include expression vec ⁇ tors for use in yeast, bacterial, insect, and mammalian cells.
  • Also forming part of the invention is a vaccine for immunizing an individual against Astrovirus infection.
  • the vaccine includes a recombinant Astrovirus polypeptide antigen which is immunoreactive with sera from rabbits immunized with Astrovirus infectious inoculum.
  • Such polypeptide antigens may include an immunoreactive portion of the above described Astrovirus coding sequences.
  • the polypeptide antigen is typically prepared in a pharmacologically acceptable adjuvant.
  • the invention further includes antibodies specific against a polypeptide having a sequence selected from the following group: SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, 10
  • Antibodies can also be generated against the Astrovirus-specific antigen produced by bacterial cells transformed with one of the following ' vectors: lambda- A2, lambda-All, lambda-A13 and lambda-A33. These antibodies may be polyclonal or monoclonal.
  • the antibo ⁇ dies can be used in a method of producing passive im ⁇ munity in an individual against Astrovirus, which includes administering the antibodies parenterally to the individual.
  • Figure 1 illustrates that an A43 clone specific probe only hybridizes to nucleic acid from Astrovirus infected cells.
  • Figure 2 shows that an A43 clone specific probe hybridizes to nucleic acid from cells infected with other Astrovirus serotypes.
  • Figure 3 shows CsCl density gradient separation of an Astrovirus preparation with corresponding antigenic and hybridization analysis.
  • Figure 4A illustrates that nucleic acid from infected cells is RNase sensitive.
  • Figure 4B shows that the Astrovirus RNA is plus-sense RNA.
  • Figure 5 shows the alignment of the following se ⁇ quences: A35, SEQ ID N0:1; A43, SEQ ID NO:3; and Al, SEQ ID NO:7.
  • Figure 6 shows how new Astrovirus sequences can be identified by an epitope spanning method.
  • Figure 7 shows the results of a Northern blot analysis indicating the presence of two populations of Astrovirus-specific, poly(A)+ RNA.
  • Astrovirus genomic RNA (7.2 Kb) is recognized by clone A43- and clone A39- specific probes, while a subgenomic RNA (2.8 Kb) is recognized by only one of two A39-specific probes.
  • the Astrovirus polynucleotide refers to variations of the disclosed sequences, such as degenerate codons, or variations in sequence which may be present in isolates or strains of Astrovirus which are immuno- logically cross reactive with the Serotype 1 isolate.
  • Two nucleic acid fragments are "homologous" if complementary strands are capable of hybridizing to one another under hybridization conditions described in Maniatis et al.. op. cit.. pp. 320-323, using the following wash conditions: 2 x SCC, 0.1% SDS, room temperature twice, 30 minutes each; then 2 x SCC, 0.1% SDS, 50°C once, 30 minutes; then 2 x SCC, room temperature twice, 10 minutes each, homologous sequences can be identified that contain at most about 25-30% basepair mismatches. More preferably, homologous nucleic acid strands contain 15-25% basepair mismatches, even more preferably 5-15% basepair mismatches. These degrees of homology can be selected by using more stringent wash or hybridization conditions for identification of clones from gene libraries (or other sources of genetic mate ⁇ rial) , as is well known in the art.
  • a protein is an Astrovirus polypeptide or derived from an Astrovirus polypeptide if it is encoded 12 by an open reading frame of a cDNA or RNA fragment repre senting the Astrovirus agent.
  • a protein having substantially the same sequence as one of the sequences determined for the disclosed Astrovirus epitopes is defined as a protein having amino- acid substitutions in the protein coding sequence which do not eliminate the antigenic properties of the protein (i.e. neutral substitutions). Neutral substitutions not adversely affecting overall antigenic function are reasonably predictable by one of ordinary skill in the art by utilizing currently available primary and secondary structure analysis (Needleman et al; Doolittle; Taylor et al, 1989; Hopp et al.) coupled with a matrix defining the relatedness between different amino acids (Taylor et al, 1989; Dayhoff; Schulz et al) . Proteins having sequence substitutions can be tested for immunore- activity with sera (e.g.. Examples 3 and 6), polyclonal, or specific monoclonal antibodies as described in the present disclosure. 5. LLCMK2 cells infected with serotype 1
  • Al LLCMK2 Astrovirus are referred to as "Al LLCMK2". This is not to imply that this is a line of LLCMK2 cells that is continuously infected with Astrovirus.
  • cDNA molecules From the partially purified nucleic acid mixture two groups of cDNA molecules were generated, one using oligo d(T) as a primer and the second using random priming for first strand cDNA synthesis (Example 2A) .
  • the resulting mixtures of cDNA molecules were amplified using the Sequence-Independent Single-Primer Amplification (SISPA) method which allows the amplification of a mixture of DNA regardless of the specific sequences of the DNA molecules (Example 2B) .
  • SISPA Sequence-Independent Single-Primer Amplification
  • this sequence independent ampli ⁇ fication is accomplished by attaching linkers of known sequence to the ends of the double-strand DNA molecules present in a mixture, typically using blunt-end ligation.
  • linkers then provide the end sequences for primer- initiated amplification, using primers complementary to the linker sequences.
  • the SISPA method (Reyes et al.) is carried out for 20-30 cycles of amplification, using thermal cycling to achieve successive denaturation and primer-initiated polymerization of second strand DNA (Mullis; Mullis et al.).
  • the SISPA amplification pro ⁇ vides the advantage of enriching by amplification the Astrovirus genomic polynucleotides present in the start ⁇ ing sample.
  • the two sets of amplified cDNA molecules from above were then cloned into the lambda gtll vector (Example 2C) which allows expression of proteins encoded by the newly introduced cDNA sequences produced as in-frame fusions to 0-galactosidase (Young et al.).
  • the plaques generated by plating the recombinant phage were then screened for pro ⁇ duction of polypeptide antigens reactive with hyper ⁇ immune rabbit serum produced against Serotype A2, and not reactive with pre-immunization rabbit serum (Example 3) .
  • Candidates initially identified by the immunoscreening 14 were plaque purified and re-screened.
  • Example 3 Ten clones were ultimately selected for further study (A35, A43, A39, Al, A2, All, A13, A14, A21, and A33) (Example 3). These clones were specifically reactive with the hyperimmune serum and not reactive with the serum from the unim- munitized rabbit.
  • the sizes of the cDNA inserts are given in Table 1.
  • the clones were further immunologically characte ⁇ rized by expanded immunological screening including the hyper-immune rabbit serum (HI) paired with pre-immune rabbit sera, and an Astrovirus specific monoclonal antibody, 8E7 (Herrmann et al. (1988)), paired with pre- immune mouse sera.
  • HI hyper-immune rabbit serum
  • 8E7 Astrovirus specific monoclonal antibody
  • Table 2 none of the cloned inserts encode the previously identified 8E7 Astrovirus epitope which had been shown to be an Astrovirus group specific antigen (Herrmann et al. (1988)).
  • Example 5B Further hybridization studies (Example 5B) showed the following cross-hybridization relationships between the clones (Table 3) .
  • Table 3 When clone A43 was used as a probe, clones A35, Al, A2, and A13 cross-hybridized. These results indicate that the clones were derived from 15 a contiguous segment of the Astrovirus genome. Clones A39, All, A14, A21, and A33 did not cross-hybridize with any other clones and appear to represent independent epitopes.
  • the cloned inserts were labeled and hybridized to cDNAs generated from Astrovirus-infected and uninfected cellular mRNA (Example 5C) .
  • SISPA amplified cDNAs were generated from both the Al LLCMK2 (Astrovirus infected) and LLCMK2 (uninfected) cell line (Example 2B) . All the probes hybridized specifically to SISPA amplified cDNA from Al LLCMK2, but not to SISPA amplified cDNA from the LLCMK2 uninfected cell line.
  • the inserts of clones A43, A35, A39, All, and A33 hybridized strongly to the Al LLCMK2 cDNA.
  • the A14 insert hybridized weakly and the A21 insert hybridized with moderate strength to the Al LLCMK2 cDNA.
  • the hybridization probes used were the radiolabeled cDNA inserts of lambda gtll clones A43, A35, A39, All, A14, A21, and A33.
  • the results of the hybridization analysis demonstrated (Example 5D, Table 4, and Figure 1) that the insert sequences hybridized specifically to RNA extracted from the Al LLCMK2 cells (i.e., Astrovirus infected cells) . No hybridization was seen with RNA isolated from the uninfected cell line. This data further supports that the cloned sequences correspond to Astrovirus- derived coding sequences.
  • Poly(A)+ RNA was also extracted from Al LLCMK2 (Astrovirus infected) cells and LLCMK2 (uninfected) cell line (Example 1) .
  • the isolated polyA+ RNAs were gel fractionated and transferred to a nitrocellulose filter.
  • the filter bound RNA was then hybridized to a clone A43- specific probe and to two different clone A39-specific probes (Example 9) .
  • clone A39 contained an internal mutated SISPA linker sequences (SEQ ID NO:15, nucleotides 192-223), one A39-specific probe represented an insert sequence from the region 5' to the mutated linker (SEQ ID NO:15, nucleotides 18-191) and the other represented an insert sequence from the region 3' to the mutated linker (SEQ ID NO:15, nucleotides 241-417).
  • the results of this hybridization analysis demonstrated the presence of two populations of 17 poly(A)+, Astrovirus-specific RNA in Astrovirus-infected cell lysates.
  • Both A43 and A39 (3' of mutated linker) clone-specific probes hybridized with the 7.2 Kb genomic RNA ( Figure 7 , lanes 1 and 3).
  • a 2.8 Kb subgenomic RNA was detected by the clone A39 probe
  • A39, Al, A14, and A21 were subcloned into a vector useful for DNA sequence analysis and the insert sequences determined (Example 6) : the sequence data for the clones are presented in the Sequence Listing.
  • the cloned insert sequences were examined for homologies at both the nucleic acid and amino acid levels with the sequences compiled in "GENBANK" data set. This search indicated that the cloned insert sequences do not represent previously characterized nucleic acid or amino acid sequences.
  • the immunoreactive clones identified above can be used to obtain a complete set of overlapping genomic cDNA clones.
  • the lambda gtll clone A43 insert can be isolated and employed as a probe against cDNA libraries established in lambda gtlO.
  • the lambda gtlO libraries are generated essentially as was described in Example 2C for libraries in lambda gtll which were used for immunoscreening.
  • the inserts from clones identified in this fashion can then be isolated by EcoRI digestion of the lambda gtlO clone, electrophoretic fractionation of the digest products, and electroelution of the band corresponding to the insert DNA (Maniatis et al. ; Ausubel et al.) .
  • the isolated insert can then be treated with DNase I to generate random fragments (Maniatis et al.) , and the resulting digest fragments inserted into lambda gtll phage vectors for immunoscreen ⁇ ing.
  • oligonucleotide primers may be used to isolate specific overlapping segments for in-phase insertion into any selected expres ⁇ sion vector.
  • Inserts from the immunoreactive clones identified above can be used in a similar manner to probe the origi- nal cDNA library generated in lambda gtlO.
  • Specific subfragments of the inserts may also be isolated by polymerase chain reaction or after cleavage with restric ⁇ tion endonucleases. These subfragments can be radioac- tively labeled and used as probes against the cDNA libra- ries generated in lambda gtlO.
  • the 5' and 3' terminal sequences of the inserts are useful as probes to identify clones which overlap this region.
  • sequences provided by the end- terminal sequences of the clone inserts are useful as specific sequence primers in first-strand DNA synthesis reactions (Maniatis et al.; Scharf et al.) using, for example, Al LLCMK2 cellular RNA and A43 terminal sequenc ⁇ es ( Figure 6) .
  • partially purified Astro ⁇ virus nucleic acid can be prepared from stool samples obtained from an infected volunteer (see Example 8) or from cell culture derived material. Synthesis of the second-strand of the cDNA is randomly primed (Boehringer Mannheim, Indianapolis IN) ( Figure 6, El) .
  • the above procedures identify or produce cDNA molecules correspon- ding to nucleic acid regions that are adjacent to the known clone A43 insert sequences. These newly isolated sequences can in turn be used to identify further flank ⁇ ing sequences, and so on, to identify overlapping cDNA clones from which the entire Astrovirus genome can be determined. As described above, after new Astrovirus genomic sequences are isolated, the polynucleotides can be cloned and immunoscreened to identify specific sequen ⁇ ces encoding Astrovirus antigens.
  • the polymerase chain reaction (Mullis) can be used to clone gaps between known epi ⁇ topes.
  • the terminal sequences from any of the Astrovirus clones can be used as one primer in the polymerase chain reaction (e.g., Figure 6, A43) and terminal sequences from unrelated clones (A39, A14, and A21) can be used as the second primer ( Figure 6, El) .
  • Figure 6 illustrates a produc- tive polymerase chain reaction generating an epitope spanning region using, for example, A43 and El.
  • Astrovirus genomic sequence will be helpful (i) in studying and establishing Astrovirus relatedness to other viruses, and (ii) in the isolation of sequences from viruses related to Astrovirus but which are as yet uncloned.
  • the invention includes antibodies specifically directed against the recombinant antigens of the present invention.
  • a host animal such as a rabbit
  • the purified antigen or fused protein antigen may be generated using a variety of coding sequence derived from other proteins, such as ⁇ - galactosidase or glutathione-S-transferase.
  • the host serum or plasma is collected following an appropriate time interval, and this serum is tested for antibodies specifically directed against the antigen.
  • Example 7 describes the production of rabbit serum antibodies which are specific against the A43 antigens in the SJ26/A43 fusion protein.
  • the gamma globulin fraction or the IgG antibodies immunized animals can be obtained, for example, by use o saturated ammonium sul ate or DEAE Sephadex, or other techniques known to those skilled in the art for producing polyclonal antibodies.
  • purified antigen or fused antigen protein may be used for producing monoclonal antibodies.
  • the spleen or lymphocytes from an immunized animal are removed and immortalized or used to prepare hybridomas by methods known to those skilled in the art.
  • a human lymphocyte donor is selected.
  • An individual known to be infected with an Astrovirus may serve as a suitable lymphocyte donor.
  • Lymphocytes can be isolated from a peripheral blood sample.
  • Epstein-Barr virus (EBV) can be used to immortalize human lymphocytes or a human fusion partner can be used to produce human-human hybridomas.
  • Primary in vitro immunization or sensation with viral specific polypeptides can also be used in the generation of human monoclonal antibodies.
  • Antibodies secreted toy the immortalized cells are screened to determine the clones that secrete antibodies of the desired specificity, for example, using the ELISA or Western blot method (Ausubel et al.) .
  • the antigens obtained by the methods of the present invention are advantageous for use as diagnostic agents for Astrovirus antibodies present in the serum of an Astrovirus-infected individual; particularly, the anti ⁇ gens represented by clones A43, A35, A39, Al, A2, All, A13, A14, A21, and A33.
  • test serum is reacted with a solid phase reagent having a surface-bound Astrovirus antigen obtained by the methods of the present invention, e.g., the A43 insert encoded antigen.
  • the reagent After binding anti-Astrovirus antibody to the reagent and removing unbound serum components by washing, the reagent is reacted with reporter-labeled anti-human antibody to bind reporter to the reagent in proportion to the amount of bound anti-Astrovirus antibody on the solid support. The reagent is again washed to remove unbound labeled antibody, and the amount of reporter associated with the reagent is determined.
  • the reporter is an enzyme which is detected by incubating the solid phase in the presence of a suitable fluorometri ⁇ or colorimetric substrate.
  • the solid surface reagent in the above assay is prepared by known techniques for attaching protein material to solid support material, such as polymeric beads, dip sticks, 96-well plate or filter material. These attachment methods generally include non-specific adsorption of the protein to the support or covalent attachment of the protein, typically through a free amine group, to a chemically reactive group on the solid support, such as an activated carboxyl, hydroxyl, or aldehyde group.
  • homogeneous assay In a second diagnostic configuration, known as a homogeneous assay, antibody binding to a solid support produces some change in the reaction medium which can be directly detected in the medium.
  • Known general types of homogeneous assays proposed heretofore include (a) spin- labeled reporters, where antibody binding to the antigen is detected by a change in reported mobility (broadening of the spin splitting peaks) , (b) fluorescent reporters, where binding is detected by a change in fluorescence efficiency, (c) enzyme reporters, where antibody binding effects enzyme/substrate interactions, and (d) liposome- bound reporters, where binding leads to liposome lysis and release of encapsulated reporter.
  • spin- labeled reporters where antibody binding to the antigen is detected by a change in reported mobility (broadening of the spin splitting peaks)
  • fluorescent reporters where binding is detected by a change in fluorescence efficiency
  • enzyme reporters where antibody binding effects enzyme/substrate interactions
  • liposome- bound reporters where binding leads to
  • the assay method involves reacting the serum from a test individual with the protein antigen and examining the antigen for the presence of bound antibody.
  • the examining may involve attaching a labeled anti-human antibody to the antibody being examined, either IgM (acute phase/primary response) or IgG (convalescent or chronic phase/secondary response) , and measuring the amount of reporter bound to the solid support, as in the first method, or may involve 24 observing the effect of antibody binding on a homogeneous assay reagent, as in the second method.
  • kits for carrying out the assay method just described.
  • the kit generally includes a support with surface-bound recombinant Astrovirus antigen (e.g. , the A43 insert encoded antigen) , and a reporter labeled reporter-labeled anti-human antibody for detecting surface-bound anti-Astrovirus-antigen antibody.
  • a support with surface-bound recombinant Astrovirus antigen e.g. , the A43 insert encoded antigen
  • a reporter labeled reporter-labeled anti-human antibody for detecting surface-bound anti-Astrovirus-antigen antibody.
  • one or more polypeptide antigens produced by clones A43, Al, or A35 can be combined with antigens produced by A39, A2, All, A13, A14, A21, and A33 in Astrovirus diagnostic kits.
  • a single recombinant polypeptide containing multiple antigens such as shown in Figure 5, can be included in such kits.
  • antigens can be combined with any number of antigens from other gastroenteritis-causing viruses including rotaviruses, pestiviruses , caliciviruses, Astroviruses, parvoviruses, coronaviruses, toroviruses, adenoviruses, Norwalk virus, and the
  • Norwalk-like viruses (LeBaron et al.) . Some members of the Norwalk-like virus family include the following variants: Hawaii, Snow Mountain, Montgomery County, Taunton, A ulree, Sapporo, and Otofuke. These antigens can be obtained in a number of ways, for example, rotavirus can be cultivated (LeBaron et al.) and viral antigenic proteins can be isolated from the viral capsid. Polypeptides of calciviruses (Terashima et al.) , and Norwalk viruses (Greenberg et al. (1981)) can be isolated as well. Kits containing antigens of selected gastroenteritis viruses provide a diagnostic composition capable of immunoreacting with a broad spectrum of human viral gastroenteritis serum samples.
  • a third diagnostic configuration involves use of the anti-Astrovirus antibodies, described in Section IV 25 above, capable of detecting Astrovirus specific antigens.
  • the Astrovirus antigens may be detected, for example, using an antigen capture assay where Astrovirus antigens present in candidate serum, fecal material or environmentally derived samples (e.g. sewage effluents and food sources, such as shellfish) are reacted with an Astrovirus specific monoclonal antibody.
  • the anti- Astrovirus monoclonal antibody is bound to a solid substrate and the antigen is then detected by a second, different labeled anti-Astrovirus antibody: the monoclonal antibodies of the present invention which are directed against Astrovirus specific antigens are particularly suited to this diagnostic method.
  • the antigen capture assay diagnostic configuration can also be expanded to include antibodies directed against other gastroenteritis virus families including rotaviruses, pestiviruses, caliciviruses, Astroviruses, parvoviruses, coronaviruses, toroviruses, adenoviruses, and the Norwalk-like viruses.
  • antigen-detection systems may include antibodies directed against Norwalk virus (Greenberg et al.(1978)), calciviruses (Nakata et al.), pestivirus (Yolken et al.), and rotavirus (Dennehy et al.).
  • the present invention provides an easily renewable source of Astrovirus antigen and antibody reagents for use in diagnostics.
  • these reagents can be used in solid phase radioimmunoassays for Astrovirus antigen and a radioimmunoassay for antibody to the Astrovirus (Greenberg et al. (1989)).
  • the monoclonal and polyclonal Astrovirus antibodies of the present invention can also be used in the immune electron microscopy technique (Kapikian et al.) .
  • the Astrovirus nucleic acid sequences identified by the method of the present invention provide sequences which can be used as hybridization probes for the identi ⁇ fication of the presence of Astrovirus coding sequences in a sample.
  • Primers useful for the Polymerase Chain Reaction (PCR) can be derived from any of the nucleic acid sequences listed in the Sequence Listing or obtained from the inserts of clones A2, All, A13, or A33. Further, any Astrovirus sequence, identified as described above in Section III, can be used in this capacity.
  • these primers are two nucleic acid sequences consisting of 8 or more colinear nucleotides, where the two sequences are separate by a defined distance, e.g. 500 bases, and are homologous to opposite strands.
  • Astrovirus specific nucleic acid sequences can also be used as hybridization probes to detect the presence of the Astrovirus in a sample as was done, for instance, in Example 5C or 5D. Kits containing such PCR primers and hybridization probes can also contain similar primers useful for the identification of other gastroenteritis viruses.
  • Kits based on any of the above diagnostic methods are useful tools to aid in the rapid determination of whether gastroenteritis viruses are the agents responsible for outbreaks of human gastroenteritis. Further, although person-to-person transmission is an important aspect of viral gastroenteritis, the initiating event for most outbreaks of viral gastroenteritis is contamination of a common source (Lebaron et al.). Since enteric viruses cannot multiply outside their host, in contrast to bacterial pathogens, the original inoculum present in the common source determines infectivity of the source. Accordingly, the above-described kits are 27 also useful for identification and verification of contaminated sources (e.g., shellfish or water-source).
  • contaminated sources e.g., shellfish or water-source
  • the Astrovirus antigens identified by the methods of the present invention can be formulated for use in an Astrovirus vaccine.
  • the vaccine can be formulated by standard methods, for example, in a suitable diluent such as water, saline, buffered salines, complete or incomplete adjuvants, and the like.
  • the immunogen is administered using standard techniques for antibody induction, such as by subcutaneous administra ⁇ tion of physiologically compatible, sterile solutions containing inactivated or attenuated virus particles or antigens.
  • An immune response-producing amount of viral antigen is typically administered per vaccinizing injection, typically in a volume of one milliliter or less.
  • a specific example of a vaccine composition includes, in a pharmacologically acceptable adjuvant, a recombinantly produced A43 polypeptide.
  • the vaccine is administered at periodic intervals until a significant titer of anti-Astrovirus antibody is detected in the serum.
  • Such a vaccine may be useful to (i) generate short- term immunity in uninfected community members against Astrovirus infection when outbreaks of gastroenteritis have been identified as Astrovirus-induced, and (ii) for long-term active immunoprophylaxis of Astrovirus infections.
  • the anti-Astrovirus antibodies of the invention can be used as a means of enhancing an anti-Astrovirus immune response since antibody-virus complexes are recognized by macrophages and other effector cells.
  • the antibodies can be administered in amounts similar to those used for other therapeutic administrations of antibody. For example, pooled gamma globulin is administered at 0.02- 0.1 ml/lb body weight during the early incubation of other viral diseases such as rabies, measles and hepatitis B to interfere with viral entry into cells.
  • antibodies reactive with, for example, the A43 antigen can be passively administered alone in a "cocktail" with other anti-viral antibodies or in conjunction with another anti-viral agents to a patient infected with Astrovirus to enhance the immune response and/or the effectiveness of an antiviral drug.
  • col DNA polymerase I (Klenow fragment) was obtained from Boehringer Mannheim Biochemicals (Indianapolis, IN) .
  • T4 DNA ligase and T4 DNA polymerase were obtained from New England Biolabs (Beverly, MA) ; Nitrocellulose filters were obtained from Schleicher and Schuell (Keene, NH) .
  • Synthetic oligonucleotide linkers and primers were prepared using commercially available automated oligonu- cleotide synthesizers. Alternatively, custom designed synthetic oligonucleotides may be purchased, for example, from Synthetic Genetics (San Diego, CA) . cDNA synthesis kit and random priming labeling kits were obtained from Boehringer-Mannheim Biochemical (BMB, Indianapolis, IN) . The cell line LLCMK2 and Al LLCMK2 (monkey kidney cell line infected with Astrovirus type 1) were obtained from John E. Herrmann, Ph.D., Division of Infectious Diseases, University of Massachusetts Medical Center. Anti-Astrovirus type 1 rabbit hyperimmune sera HI was obtained from John E. Herrmann.
  • Mouse monoclonal antibody 8E7 (Herrmann et al. (1988)), which recognizes all five types of Astrovirus, was obtained from John E. Herrmann. Cells infected with Astrovirus Serotypes 2, 4, and 5 were also obtained from John E. Herrmann.
  • EXAMPLE 1 Partial Purification of the Astrovirus The Al LLCMK2 cells and LLCMK2 cell lines were cultivated as previously described (Lee et al.; Kurtz et al. (1979, 1984)). Cell cultures were harvested and pelleted at 3,000 X g for 30 minutes at 4°C. The resulting pellet was placed on ice while the supernatant was pelleted at 100,000 X g for 2 hours at 4°C. The low- speed and high-speed pellets were combined and resuspen- ded in 20 ml TNMC buffer (50 mM Tris-HCl, pH 8.0, 100 mM NaCl, 25 mM MgCl 2 , 25 mM CaCl 2 ) and placed on ice.
  • 20 ml TNMC buffer 50 mM Tris-HCl, pH 8.0, 100 mM NaCl, 25 mM MgCl 2 , 25 mM CaCl 2
  • the pellet suspension was extracted extensively with "BLACO-TRON" (trichlorotrifluoroethane; Baron-Blakeslee, San Francisco, CA) and the aqueous phase saved from each extraction.
  • the extracted aqueous phase was pelleted at 100,000 Xg for 2 hours at 4°C.
  • the resulting pellet was resuspended in 2 ml TNMC.
  • Half of this partially 30 purified material was used for RNA extraction and half was purified further in a CsCl gradient.
  • the presence of viral antigen was monitored at each step by ELISA (rabbit HI detection — Lee et al. , Kurtz et al. (1984) ; 8E7 capture — Herrmann et al.).
  • the negative control sample from cell line LLCMK2 was processed in tandem with Al LLCMK2.
  • Nucleic acid was extracted from the partially purified Astrovirus material by a one-step guanidinium/- phenol extraction procedure (Chomczynski et al.). RNA was precipitated using 2 volumes of ethanol and overnight storage at -70°C.
  • EXAMPLE 2 Cloning cDNA Molecules Derived From the Astrovirus Genome A. Preparing cDNA fragment libraries.
  • Example 1 Approximately 10 ⁇ q of the nucleic acid prepared in Example 1 was transcribed into cDNA, according to the method of Gubler et al. using an oligo-(dT) primer. Separately, to generate a second cDNA library, approximately 10 ⁇ q of the nucleic acid prepared in Example 1 was transcribed into cDNA using random primers (Boehringer Mannheim) by the method of Persons et al. To ensure that the resulting cDNA molecules had blunt ends, the cDNAs in each of the above preparations were treated with T4 DNA polymerase in the presence of all four nucleotides (Maniatis et al.). B. Amplifying the cDNA Fragments
  • the resulting cDNA molecules were amplified using the Sequence-Independent Single Primer Amplification
  • SISPA RNA and DNA Amplifica ⁇ tion Techniques
  • the cDNA and linker were mixed at a 1:100 molar ratio in the presence of 0.3 to 0.6 Weiss units of T4 DNA ligase.
  • Tag polymerase Thermus aguaticus DNA polymerase
  • the reaction mixture was heated to 94°C for 30 seconds for denaturation, allowed to cool to 50°C for 30 seconds for primer annealing, and then heated to 72°C for 0.5-3 minutes to allow for primer extension by Tag poly- merase.
  • the replication reaction involving successive heating, cooling, and polymerase reaction, was repeated an additional 25 times with the aid of a Perkin-Elmer Cetus DNA thermal cycler.
  • the amplified cDNA fragments were digested with EcoRI. Excess linkers were removed by passage through "SEPHACRYL 300" (Pharmacia, Piscataway NJ) .
  • RNA obtained from the cell line LLCMK2 was treated as above except the LLCMK2 amplified cDNA molecules were not digested with EcoRI.
  • Phosphatase-treated lambda gtll phage vector arms were obtained from Promega Biotec (Madison, WI) .
  • the lambda gtll (Huynh) vector has a unique EcoRI cloning 32 site 53 base pairs upstream from the ⁇ -galactosidase translation termination codon.
  • the amplified Al LLCMK2 cDNAs from Part B were introduced into the EcoRI site by mixing 0.5-1.0 ⁇ q EcoRI-cleaved gtll, " 0.3-3 ⁇ l of the above cDNA molecules, 0.5 i 10X ligation buffer (above), 0.5 pi DNA ligase (200 units), and distilled water to 5 __1.
  • the mixture was incubated overnight at 14°C, followed by in vitro packaging, according to standard methods (Maniatis et al., pp. 256-268).
  • the packaged phage were used to infect Escherichia coli strain KM392, obtained from Dr. Kevin Moore, DNAX (Palo Alto, CA) .
  • E. coli strain Y1090 available from the American Type Culture Collection (ATCC #37197), could be used.
  • Lawns of KM392 cells infected with serial dilutions of the packaged phage were used to determine the phage titer.
  • For immunoscreening about 10 4 pfu of the recombinant phage were plated per 150 mm plate (Maniatis et al.) .
  • EXAMPLE 3 Immunoscreening of Lambda gtll Clones
  • the cDNA libraries in lambda gtll (Example 2) , random primed (rp) or oligo-d(T) primed (dT) were immunoscreened using pre- and post-Astrovirus immunization rabbit sera which had a high titer of antibody (ELISA titer ⁇ 1:1000; Lee et al.; Kurtz et al. (1984)) to Astrovirus.
  • the sera were pre-adsorbed with lysates of E.
  • each serum was diluted 400 fold with AIB (TBS buffer, 10 mM Tris, pH 8.0, 150 mM NaCl; with 1% gelatin) for immunoscreening (Young et al.; Ausubel et al.) . 33
  • AIB TBS buffer, 10 mM Tris, pH 8.0, 150 mM NaCl; with 1% gelatin
  • 3 clones from the oligo-d(T) primed library (designated lambda-A35, lambda-A43, and lambda-A39) and 7 clones from the random primed library (designated lambda- Al, lambda-A2, lambda-All, lambda-A13, lambda-A14, lambda-A21, and lambda-A33) remained reactive.
  • the sizes of the cDNA inserts were determined by EcoRI digestion of the lambda gtll clones followed by electrophoretic separation of the digest fragments on an agarose gel, run in parallel with DNA size-standards.
  • Reactive plaques were detected (Young et al.; Ausubel et al " .) after incubation with the test sera by using an alkaline phosphatase- conjugated anti-IgG second antibody (Pierce, Rockford IL) .
  • the A35, A43, and A39 cDNA clones were tested for similarity to human and E. coli genes by Southern blot hybridization (Southern; Maniatis et al.). Human lymphocyte genomic DNA and E. coli strain 1088 genomic 35
  • DNA were each digested with EcoRI and Hindlll. These DNA fragments in these digests were electrophoretically separated on a 1% agarose gel in parallel lanes. The DNA fragments were transferred to nitrocellulose (Southern) . Radioactively labeled probes of the A35, A43, and A39 lambda gtll cDNA insert were made as follows. Primers of known' lambda gtll sequences which flanked the cDNA insert (5'-GGCAGACATGGCCTGCCCGG-3' and 5'- TCGACGGTTTCCATATGGGG-3') were used to amplify the cDNA insert by the polymerase chain reaction (PCR) method of Mullis.
  • PCR polymerase chain reaction
  • the typical PCR cycle involved the following steps: melting at 94°C for 30 seconds, followed by an ⁇ nealing at 50°C for 1 min. , and extension at 72°C for 30 seconds. The reactions were repeated for 30 cycles.
  • the PCR products were digested with EcoRI and electrophoreti ⁇ cally resolved using a preparative 1.5% agarose gel. The clone-specific, amplified fragment was identified by size and electrophoresis continued to transfer the DNA band completely onto a NA45 membrane (Schleicher & Schuell, Keene, NH) .
  • the DNA was eluted from the membrane using a high salt buffer (Schuell & Schuell, Keene, NH) . , extracted once with phenol:chloroform (1:1), and ethanol precipitated. After ethanol precipitation, the DNA was used as the template for random-primed DNA labeling (Boehringer Mannheim, Indianapolis, IN) .
  • nitrocellulose filters were hybridized with radiolabeled probes made from each of A35, A43, and A39. None of the three clones demonstrated a positive signal with either the human or E. coli genomic DNAs.
  • the inserts were used as templates for random-primed DNA labeling (Boehringer Mannheim, Indianapolis IN) to generate 32 P labeled insert-probes.
  • the filters were then separately hybridized with labeled insert-probes. The result of this hybridization study showed the cross hybridization pattern presented in Table 3.
  • the cDNAs ' were transferred from the gel to nitrocellulose paper by standard proce ⁇ dures (Maniatis et al.).
  • the nitrocellulose filters were hybridized to the radiolabeled probes.
  • Hybridization was carried out in 50% formamide and IX hybridization buffer (5X Denhardts solution (Maniatis et al.), 5X SSC (Maniatis et al.), 50 mM NaH 2 P0 4 , 1 mM sodium pyrophosphate/Na 2 HP0 4 , 100 ⁇ q/ ⁇ a.1 denatured salmon sperm DNA, 100 ⁇ q/ml ATP.
  • the hybridization probes used were the radiolabeled cDNA inserts of lambda gtll clones A43, A35, A39, All, A14, A21, and A33, prepared as de ⁇ scribed above.
  • the insert probes hybridized to nucleic acid from the infected cell line only. No hybridization could be demonstrated with nucleic acid isolated from the uninfec ⁇ ted cell lines.
  • a typical dot-blot analysis is shown in Figure 1 where the A43 clone insert was used as a probe.
  • Astrovirus was prepared from Al LLCMK2 tissue culture cells as described above in Example 1. This Astrovirus preparation was further purified by overnight centrifugation on a 40-55% CsCl gradient, at 100,000 X g maintained at 4°C. Fractions (0.25 ml each) were collected by bottom puncture. Ten fractions spanning the density range of 1.27 to 1.46 g/ml were examined ( Figure 3) .
  • the Astrovirus antigen peak determined by ELISA
  • Nucleic acid was extracted from the 10 fractions using a one-step guanidinium/phenol extraction procedure (Chomczynski et al.) and prepared for RNA dot blot hybri ⁇ dization analysis according to the recommendations of the 39 manufacturer of the "MINIFOLD I" apparatus (Schleicher and Schuell, Keene, NH) .
  • Hybridization to A43-specific, radiolabelled probe was carried out in 50% formamide and IX hybridization buffer (5X Denhardts solution (Maniatis et al.), 5X SSC (Maniatis et al.), 50 mM NaH 2 P0 4 , 1 mM sodium pyrophosphate/Na 2 HP0 4 , 50 mg denatured salmon sperm DNA/500 ml, 50 mg ATP/500 ml) .
  • the hybridization probe used was specific for the A43 insert. The probe was generated by polymerase chain amplification of the EcoRI fragment of clone A43 and labelled as described in Example 5B.
  • filters were washed in (i) 2X SSC at room temperature for 15 minutes, and (ii) O.IX SSC with 0.1% SDS at 65°C for 1 hr. Filters were dried and then exposed to X-ray film.
  • the Astrovirus antigen peak corresponded to the peak hybridization seen on the RNA blot probed with the A43-specific probe ( Figure 3) .
  • the Nature of the Astrovirus Genomic Nucleic Acid (i) The Astrovirus genome is an RNA molecule.
  • the nucleic acid extracted from Al LLCMK2 cells (Example 1) was treated with RNaseA and DNasel as per the manufacturer's suggestions (both enzymes were obtained from Boehringer Mannheim, Indianapolis IN) .
  • the samples were then prepared for Dot-blot hybridization as described above.
  • the probe was the A43 clone specific probe used in Example 5F.
  • the Astrovirus genome is of positive polarity.
  • Single-stranded oligonucleotide probes corresponding to both the positive strand of A43 (i.e., coding) and negative strand of A43 were synthesized by standard procedures.
  • the oligonucleotides were radiolabeled by phosphorylating the synthetic oligonucleotide primers with ⁇ -[ 32 P]ATP (Richardson) .
  • the nucleic acid from Al LLCMK2 cells was prepared for hybridization as above. Hybridization was carried out in 30% formamide and IX hybridization buffer (see above) at 42 * C. The filters were washed in 2X SSC (Maniatis et al.) at room temperature for 30 minutes.
  • primers contained lambda sequences flanking the cDNA insertion site and sequences encoding a Hindlll restriction site in one primer and a Xhol site in the second primer.
  • the amplified fragments were digested with Hindlll and Xhol and the resulting fragments cloned into the "BLUESCRIPT KS+" vector.
  • sequences of the cDNA inserts were determined as per the manufacturer's instructions using the dideoxy chain termination technique (Sanger, 1979) .
  • Each of the . clones had a single open reading frame, contiguous with the ⁇ -galactosidase reading frame of the lambda gtll vector.
  • the sequence data is presented in the Sequence Listing as follows: A35, SEQ ID N0:1; A43, SEQ ID NO:3; A39, SEQ ID NO:15; Al, SEQ ID NO:7; A14, SEQ ID NO:9; and A21, SEQ ID NO:11.
  • SEQ ID NO:15 contains the end- terminal SISPA sequences (SEQ ID NO:15 residues 1-17 and 428-444) used in the amplification reactions. Sequences were compared with "GENBANK” sequences at both nucleic 42 acid and amino acid levels. The "GENBANK” search indicated that these sequences did not represent previously characterized nucleic acid or amino acid sequences. The DNA sequences of the 6 clones were aligned for comparison. As expected from the cross-hybridization data presented above in Example 5, the clones A43, A35, and Al had overlapping sequences ( Figure 5) and clones A39, A14, and A21 had independent sequences. The sequence given in Figure 5 is also presented as SEQ ID NO:13.
  • Antibodies can be generated against any of the cloned Astrovirus antigen coding sequences.
  • the insert digest fragments from the lambda gtll clone A43 is released by EcoRI digestion of the phage, and the insert region purified by gel electrophoresis.
  • the puri ⁇ fied fragment is introduced into the pGEX expression vec ⁇ tor (Smith) in-frame with the glutathione S-transferase protein.
  • Expression of glutathione S-transferase fused protein (Sj26 fused protein) containing the A43 encoded polypeptide antigen can be achieved in E. coli strain KM392.
  • the fusion protein is isolated from lysed bacteria by affinity chromatography on a column packed with glutathione-conjugated beads, according to published methods (Smith) .
  • the purified SJ26/A43 fused protein can be injected subcutaneously in Freund's adjuvant in a rabbit. Typi ⁇ cally, approximately 1 mg of fused protein is injected at days 0 and 21, and rabbit serum collected on days 42 and 56. 43
  • the above procedure can also be used to generate antibodies against the ff-galactosidase/A43 polypeptide antigen fusion protein where the fusion protein is isolated by affinity chromatography using, for example, p-amiobenzyl 1-thio ⁇ -D-galactopyranoside-agarose.
  • the specificity of the antibodies can be evaluated by Western blot screening (Ausubel et al.).
  • Western blot screening lambda gtll/A43 phage from Example 3 is used to infect E. coli BNN103 temperature-sensitive bac ⁇ teria. These bacteria can be obtained from the American Type Culture Collection, Rockville MD. The bacterial host allows expression of a beta-galactosidase/- polypeptide antigen fused protein encoded by the vector under temperature induction conditions (Hunyh) .
  • Minilysates are prepared from the infected bacteria as follows. The infected bacteria are streaked, grown at 32°C overnight or until colonies were apparent, and indi ⁇ vidual colonies replica plated and examined for growth at 32°C and 42°C. Bacterial colonies which grew at 32°C, but not 42°C, indicating integration of the phage genome, are used to inoculate 1 ml of NZYDT (Maniatis) broth A. This saturated overnight bacterial culture is used to inocu ⁇ late a 10 ml culture, which is incubated with aeration to an O.D. of about .2 to .4, typically requiring 1 hour incubation.
  • NZYDT Maniatis
  • the culture is then brought to 43°C quickly in a 43°C water bath and shaken for 15 minutes to induce lambda gtll polypeptide synthesis, and incubated further at 37°C for 1 hour.
  • the cells are pelleted by centrifuga- tion, and 1 ml of the pelleted material resuspended in 100 ⁇ l of lysis buffer (62 mM Tris, pH 7.5 containing 5% mercaptoethanol, 2.4 % SDS and 10% glycerol) .
  • Lysates were also prepared from bacterial strains of KM392 cells containing (a) pGEX, and (b) pGEX containing 44 the A43 insert (described above) , essentially as just described, omitting the initial temperature-selection steps.
  • the lysates are treated with DNasel to digest bacte- rial DNA, as evidenced by a gradual loss of viscosity in the lysate.
  • An aliquot (typically about 15 ⁇ l) of the DNase-treated lysate is diluted with "TRITON X-100" and sodium dodecyl sulfate (SDS) to a final concentration of 2% "TRITON X-100” and 0.5% SDS.
  • SDS- PAGE SDS polyacrylamide electrophoresis
  • the filters are blocked with AIB, then reacted with serum samples from the rabbits immunized as described above.
  • the presence of specific antibody binding to the nitrocellulose filters can also be assayed by immunobinding of alkaline-phosphatase labeled anti- rabbit IgG.
  • the results of the Western blot analysis are expected to show positive anti-Astrovirus antibody reac ⁇ tions with lysates from pGEX-A43 and lambda gtll/A43, but not with lysates from the pGEX and non-infected control strains. Reactivity with lambda gtll/A43 indicates specificity for the Astrovirus encoded portion of the fusion protein.
  • anti- -galactosidase antibodies (commercially available) are expected to react only with the fusion protein derived from the lambda gtll/A43 infected lysate.
  • Anti-A43 antibody present in the sera from the ani ⁇ mal immunized with the SJ26/A43 can be purified by affin ⁇ ity chromatography, where the ligand derivatized to the 45
  • SEPHAROSE beads is the purified beta-gal/A43 fusion protein.
  • Human anti-A43 antibodies from sera derived from an Astrovirus infected human subject can be obtained in essentially the same way by derivatizing the A43 antigen-polypeptide to the support beads and passing the sera over the support.
  • a human volunteer is orally administered an Astrovirus infectious inoculum (Kurtz et al. (1979)).
  • Clinical stool specimens are obtained from the patient. The presence of virus particles is detected by immune electron microscopy (IEM) (Kapikian et al.).
  • IEM immune electron microscopy
  • a pre- infection stool from the volunteer serves as the negative control in the following procedures.
  • Approximately 7.5 grams of the Astrovirus-positive stool specimen is mixed with sufficient TNMC buffer (50 mM Tris-HCl, pH 8.0, 100 mM NaCl, 25 mM MgCl 2 , 25 mM CaCl 2 ) to make a 10% (w/v) fecal suspension.
  • the suspension is shaken vigorously and pelleted at 3,000 Xg for 30 minutes at 4°C.
  • the resulting pellet is placed on ice while the supernatant is pelleted at 100,000 Xg for 2 hours at 4°C.
  • the high-speed pellet is resusp
  • the pellet suspension is extracted extensively with "BLACO-TRON" (trichlorotrifluoroethane; Baron-Blakeslee, Inc., San Francisco, CA) and the aqueous phase saved from each extraction.
  • the extracted aqueous phase is pelleted at 100,000 Xg for 2 hours at 4°C and the resulting pellet resuspended in 2 mis TNMC.
  • This suspension is layered on top of a 20% sucrose cushion overlaying a CsCl cushion (1.5 g/ml) and spun at 80,000 Xg for 3 hours at 4°C using a Beckman SW28.
  • the band at the interface is collected by side puncture.
  • the presence of Astrovirus antigen is monitored at each step by ELISA (Herrmann et al. ; Lee et al.; Kurtz et al.).
  • the negative control stool and other IEM Astrovirus- positive infection stool samples from the same volunteer are processed in tandem.
  • Nucleic acid is extracted from partially purified stool by a one-step guanidinium/phenol extraction proce ⁇ dure (Chomczynski et al.).
  • Example 8A Preparing cDNA fragments. Approximately 10 ⁇ q of the nucleic acid prepared in Example 8A can be transcribed into cDNA, as described in Example 2A.
  • the resulting cDNA molecules are amplified using the Sequence-Independent Single Primer Amplification (SISPA) method as described above in Example 2C.
  • SISPA Sequence-Independent Single Primer Amplification
  • EXAMPLE 9 Northern Blot Hybridization Analysis Poly (A)+ RNA, from Astrovirus-infected and control uninfected cell (Example 1) lysates, was isolated from 500 ⁇ q of total RNA on an oligo (dT)-cellulose column, essentially as described by Sambrook, et al . The recovered poly (A)+ fraction was ethanol precipitated, washed with 70% ethanol, and the final pellet resuspended in 6 ⁇ l diethyl pyrocarbonate (DEPC)-treated water in preparation for electrophoresis.
  • DEPC diethyl pyrocarbonate
  • RNA samples were loaded into wells in a 1,2% (w/v) agarose-6.6% (w/v) formaldehyde gel and run at 5 V/cm for 4 hr (Irminger, et al.). After electrophoresis was 47 complete, the gel was rinsed with distilled water, equilibrated in 10X SSC (Maniatis, et al.), and RNA was transferred to a nitrocellulose filter (Schleicher and Schuell) by overnight capillary transfer in 2OX SSC.
  • 10X SSC Maniatis, et al.
  • the membrane was subsequently baked in a vacuum oven (80°C for 2 hr) and incubated at 42°C for at least 4 hr with a solution that contained 50% formamide, 5X SSPE (Maniatis, et al . ) , 2X Denhardt's solution, 0.1% SDS, 10 mM glycine, and 100 ⁇ g/ml each denatured fragmented salmon testes DNA and wheat germ tRNA.
  • 5X SSPE Maniatis, et al .
  • 2X Denhardt's solution 0.1% SDS
  • 10 mM glycine 0.1% SDS
  • 100 ⁇ g/ml each denatured fragmented salmon testes DNA and wheat germ tRNA.
  • Astrovirus clone-specific probes (one A43- specific probe; and one A39-specific probe which represented an insert sequence from the region 5' to the internal mutated SISPA linker (SEQ ID NO:15, nucleotides 18-191) and the other represented an insert sequence from the region 3' to the mutated linker (SEQ ID NO:15, nucleotides 241-417)) were separately added to the hybridization vessel containing the membrane and incubated overnight at 42°C.
  • the membrane was washed successively (2X SSC, 0.1% SDS, room temperature, 20 min; followed by IX SSC, 0.1% SDS, 65°C, 20 min; then 0.2X SSC, 0.1% SDS, 65°C, 20 min; and a brief rinse with 2X SSC) and prepared for autoradiography. Between hybridizations with different probes the blot was stripped of probe (Maniatis, et al . ) .
  • lanes 1, 3 and 5 contain poly (A)+ RNA extracted from cells of the Astrovirus-infected cell line and lanes 2, 4 and 6 contain poly (A)+ RNA extracted from cells of un-infected cell line (Example 1) .
  • Lanes 1 and 2 were probed with the Astrovirus clone A43-specific probe.
  • Lanes 3 and 4 were probed with the probe specific to the 48
  • Lanes 5 and 6 the probe specific to the 5' half of clone A39.
  • the Astrovirus clone A43-specific probe hybridizes with 7.2 Kb, poly (A)+ RNA " extracted from Astrovirus-infected cells (lane 1) .
  • the probe specific to the 3' half of clone A39 hybridizes with both genomic (7.2 Kb) and subgenomic (2.8 Kb) poly(A)+ RNAs found in Astrovirus- infected cell lysates (lane 3) .
  • a probe specific to the 5' half of clone A39 does not recognize cellular or viral poly(A)+ RNA (lane 5), suggesting that the sequences 5' of the internal SISPA linker are not Astrovirus specific.
  • the Astrovirus specific sequences 3' of the internal SISPA site are presented as SEQ ID NO:5. None of these Astrovirus clone-specific probes hybridizes with any poly(A)+ RNA from uninfected cells (lanes 2, 4 and 6) .
  • AAA CAA TCA GAA TAT GAA CAA CAA GTG GTG AAG TCT ATC AAG CCT CAG 142 Lys Gin Ser Glu Tyr Glu Gin Gin Val Val Lys Ser lie Lys Pro Gin 35 40 45
  • Lys Pro lie Pro Ala Leu Arg Thr Thr Lys Pro Lys Thr Cys Pro Glu 1 5 10 15
  • AAA CAA TCA GAA TAT GAA CAA CAA GTG GTG AAG TCT ATC AAG CCT CAG 142 Lys Gin Ser Glu Tyr Glu Gin Gin Val Val Lys Ser He Lys Pro Gin 35 40 45
  • GGT GCC AAA CCT TCC CGT CGA TGT GAT CTC TTG GGA AAG ATA AGC CTC 192 Gly Ala Lys Pro Ser Arg Arg Cys Asp Leu Leu Gly Lys He Ser Leu 50 55 60

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Virology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Immunology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Oncology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Communicable Diseases (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

L'invention concerne des antigènes polypeptides qui sont immunoréactifs avec des sérums de lapins immunisés avec l'astrovirus. Les antigènes sont utiles dans des procédés diagnostiques pour détecter une infection due à l'astrovirus chez les êtres humains. Sont également décrits des clones de fragments génomiques correspondants contenant des polynucléotides codant les séquences de structure de lecture ouverte pour les polypeptides antigéniques.The present invention relates to polypeptide antigens that are immunoreactive with sera from rabbits immunized with astrovirus. The antigens are useful in diagnostic methods for detecting infection due to astrovirus in humans. Also disclosed are clones of corresponding genomic fragments containing polynucleotides encoding the open reading structure sequences for the antigenic polypeptides.

Description

THE ASTROVIRUS HUMAN GASTROENTERITIS AGENTS AND MOLECULAR CLONING OF CORRESPONDING cDNAs
This work was supported in part by NIH Grants DK01811 and Merit Review, Veterans Administration. Accordingly, the United States government has certain rights in this invention. This application is a continuation-in-part of co-pending, co-owned U.S. Patent Application Serial No. 07/702,731, filed 20 May 1991.
Field of the invention
This invention relates to the identification of Astrovirus genomic nucleic acid sequences, to specific immunoreactive polypeptide viral antigens, to poly- nucleotide sequences which encode these polypeptide antigens, to an expression system capable of producing the polypeptide antigens, to methods of using the polypeptide antigens for detecting Astrovirus infection in human sera, to methods using Astrovirus nucleic acid sequences to detect Astrovirus in feces or other bodily secretions, and to antibodies directed against these polypeptide antigens.
References
Adler, J.L., et al., J. Infect. Dis. 119:668 (1963). Appleton, H. , et al., Lancet 1:1297 (1975). Ausubel, F. M. , et al., Current Protocols in Molecular Biolocrv. John Wiley and Sons, Inc. , Media PA.
Blacklow, N.R. , et al., Am. J. Public Health, 22:1321 (1982) . Chomczynski, P., et al.. Anal. Biochem. 162:156 (1987) .
Cubitt, W.D., et al. J. Infect. Dis. 156:806 (1987) Dennehy, P.H., et al. , J. Clin. Microbiol. 26:1630 (1988) . Dolin, R., et al., J. Infect. Dis. 15.5:365 (1987). Gray, J.J., et al., J. Med. Virol. 22:377 (1987). Greenberg, H.B. et al., J. Virol. 22:994 (1981). Greenberg, H.B., et al., in Viral Diarrheas of Man and Animals. Eds.: Saif, L.J., et al., CRC, Boca Raton (1989), pp. 137-159.
Gubler, U., et al.. Gene 25:263 (1983). Harlow, E., et al.. Antibodies: A Laboratory Manual- Cold Spring Harbor Laboratory Press (1988) .
Herring, A.J. , et al., J. Gen. Virol. 5_3:47 (1981). Herrmann, J.E., et al., J. Infect. Dis. 158:182 (1988) .
Herrmann, J.E., et al., J. Infect. Dis. 161:226 (1990) .
Hudson, R.W., et al. , Arch. Virol. 108:33 (1989). Hunyh, T.V. , et al, in DNA Cloning Techniques: A Practical Approach (D. Glover, ed.) IRL Press (1985).
Irminger, J.C., et al., Proc. Natl. Acad. Sci., U.S.A. 84:6330 (1987).
Johnson, P.C., et al. J. Infect. Dis. 161:18 (1990) Kapikian, A.Z., et al. , in Virology., 2nd edition, Eds.: Field, B.N., et al.. Raven, New York (1990), pp. 671-693.
Kjeldsberg, E., et al.. Arch. Virol. 84:135 (1985). Kim, J.P., et al., J. Cell. Biochem. Suppl. 13E WH160:293 (1989). Kurtz, J.B., et al., J. Clin. Pathol. 3):948 (1977). Kurtz, J.B., et al., Med. Microbiol. Immunol. 161:227 (1978).
Kurtz, J.B., et al., J. Med. Virol. 2:221 (1979). Kurtz, J.B., et al., Lancet 2:1405 (1984). Kurtz, J.B., et al.. In Enteric Infection: Mechanisms. Manifestations, and Management (M.J.G. Farthing and G.T. Keusch, eds.) Raven Press (1989). LeBaron, C.W. , et al., "Viral Agents of Gastroenteritis," in Morbid. Mortal. Weekly Rep., Centers for Disease Control 11 (April 27, 1990).
Lee, T.W., et al., J. Gen. Virol. 52:421 (1981). Madeley, C.R. , et al., Lancet 2:451 (1975). Madore, H.P., et al., J. Virol. 5_8:489 (1986B) . Mania is, T. , et al. Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory (1982) .
Miller, J. H. , Experiments in Molecular Genetics.. Cold Spring Harbor Laboratories, Cold Spring Harbor, NY (1972) . Monroe, S.S., et al., J. Virol. 15:641 (1991).
Mullis, K. , U. S. Patent No. 4,683,202, issued July 28, 1987.
Mullis, K., et al., U. S. Patent No. 4,683,195, issued July 28, 1987. Nakata, S., et al., J. Clin. Micro. 2£:2001 (1988). Oshiro, L.S., et al., J. Infect. Dis. 143:791 (1981) .
Persons, D. A., et al., Biotechniques 4.:402 (1986). Reyes, G.R. , et al.. Science 2i2:1335 (1990). Richardson, C.C., in Procedures in Nucleic Acid Research, Eds.: Cantoni, G.L., et al. Harper and Row, New York (1971), Vol. 2, p. 815.
Sambrook, J. , et al. Molecular Cloning: A Laboratory Manual, 2nd Edition. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 7.26-7.29 (1989). Sanger, F., et al. , Proc. Natl. Acad. Sci. USA 24:5463 (1977).
Scharf, S. J., et al.. Science 233:1076 (1986). Smith. D.B., et al. Gene, 67:31 "(1988). Southern, E., Methods in Enzymology 19:152 (1980). Terashi a, H. , et al. Arch. Virol. 28:1 (1983). Willcocks, M.M. , et al.. Arch. Virol. H2:73 (1990) Yolken, R., et al., Lancet i:517 (1989). Young, R.A. , et al., Proc. Natl. Acad. Sci. U.S.A. 80:1194 (1983).
Background of the Invention
A group of serologically diverse viruses have been implicated in common source outbreaks of gastroenteritis (Kapikian et al. ; Greenberg et al. (1989); Dolin et al.). These viruses include Astroviruses, caliciviruses, Norwalk and the Norwalk-like viruses (also called small round-structured viruses (SRSVs) ) , parvoviruses, coronaviruses, toroviruses, pestiviruses. It has been estimated that up to 65% of all cases of acute gastroenteritis in the United States are attributable to viral agents (Blacklow et al. (1982)). While viral induced gastroenteritis typically lasts only 1 to 2 days, its overall effect on days lost from work or school may be substantial (National Center for Health Statistics, series 10, No. 85, (1972); DHEW Publication (HRA) 74- 1512, Washington DC, Government Printing Office (1973)).
Human Astrovirus was first identified in 1975 in infants with diarrhea with a maternity unit (Appleton et al., Madeley et al.). Subsequently, the virus has been found in association with epidermic and endemic gastroenteritis worldwide (Kurtz et al. (1989)). Astrovirus most frequently causes a watery diarrhea that may last for several days. Children in the 1-3 year age group tend to demonstrate the most overt signs of infection (Kurtz et al., (1977)). In one study, 87% of the surveyed children developed antibodies to Astrovirus by age 10 (Kurtz et al. (1978)). Astrovirus have also been implicated in outbreaks in gastroenteritis involving adults in the following settings: 1) elderly patients in residential care facilities (Gray et al., Oshiro et al.), 2) a third of adults who ingested contaminated oysters (Kurtz et al. (1989)), and 3) a group of teachers and students who drank water from a contaminated source (Kurtz et al. (1989)). Animal Astroviruses that are morphologically indistinguishable from antigenically distinct from human Astrovirus have also been identified in diarrheal stool samples from a variety of species (Kjeldsberg et al.). Two previous studies have attempted a systematic examination of Astrovirus gastroenteritis in adult human volunteers. In one study in England, fecal filtrates from one strain of Astrovirus (JW) were administered to volunteers (Kurtz et al (1979)). Only one (DM) of eight volunteers developed marked diarrhea on day 6 and shed Astrovirus in feces on days 5 and 6 post-inoculation. Subsequently, two of nine volunteers administered the DM fecal filtrate shed Astrovirus in stools, but did not become clinically ill. A second study in the U.S. investigated the infectivity of the Marin County agent
(type 5 Astrovirus) that was isolated from a nursing home outbreak (H. Greenberg and K. Midthun, unpublished data (1987)). Only one of 19 volunteers developed symptoms, suggesting relatively low pathogenicity of Astrovirus in adult volunteers. Serologic responses to Astrovirus infection were found in 35-50% of asymptomatic volunteers in both studies.
Five serotypes of human Astrovirus have been identified to date (Kurtz et al. (1984)). Studies from Oxford, England, found that serotype 1 Astrovirus accounted for 72% of community-acquired infections, while serotypes 2, 3, 4, and 5 were each found at a frequency of 6-7% in this region between 1975 and 1986 (Kurtz et al. (1989)). In the U.S., the CDC has determined that antibodies to all five serotypes of Astrovirus are present in the American gamma globulin pool (LeBaron et al.). Each of these Astrovirus serotypes has been successfully adapted for population in trypsin supplemented tissue culture (LLCMK2 Rhesus monkey kidney cells), however, at relatively low titers (Lee et al.). Hyperimmune rabbit sera (group- and serotype- specific) and a group-reactive monoclonal antibody (8E7) have recently been produced (Herrmann, et al. (1989)). Rabbit antisera to specific Astrovirus serotypes have been used in a neutralization assay (Hudson et al.), while the group-reactive monoclonal antibody and a hyperimmune rabbit serum have been incorporated into an Astrovirus ELISA (Herrmann, et al. (1990)) that has been used in epidemiologic studies. A prior study of hospitalized children indicated that 3-5% of hospital admissions for diarrhea are due to Astrovirus (Ellis et al.). The true incidence of Astrovirus gastroenteritis, however, remains to be definitively established.
The Astrovirus genome is composed of plus-sense, single-stranded RNA with a 3'-end poly (A) tail (Herring et al. , Monroe et al., Willcocks et al.). The genome is -7.2 Kb in length (Monroe et al.) and encodes three structural proteins that range in mass from 20-35 kDa (Willcocks et al. , Monroe et al.). To date, the nucleic acid and amino acid composition of the Astrovirus genome have not been determined.
The present specification discloses methods effec¬ tive for the isolation and expression of Astrovirus genomic sequences. Summary of the Invention
It is one general object of the present invention to provide a purified Astrovirus polynucleotide which con¬ tains at least one sequence selected from the following group: SEQ ID NO:l, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, and SEQ ID NO:13.
Another object of the present invention is to pro¬ vide a recombinantly produced Astrovirus polynucleotide which encodes an Astrovirus polypeptide which is immu- noreactive with sera from rabbits immunized with Astro¬ virus infectious inoculum. Specific embodiments of these polynucleotides are those which encode an immunoreactive portion of any one of the following sequences: SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO: 12, and SEQ ID NO:14. Specific poly¬ nucleotides which encode such polypeptides include: SEQ ID NO:l, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:ll, and SEQ ID NO:13.
The present invention also includes Astrovirus derived polypeptides produced by bacterial cells con¬ taining a vector selected from the group consisting of lambda-A2, lambda-All, lambda-A13 and lambda-A33 (these are lambda gtll vectors containing the designated inserts, see Example 3). The present invention also provides a recombinant Astrovirus polypeptide which is immunoreactive with sera from rabbits immunized with Astrovirus infectious inoculum. Such recombinant polypeptides include those having matching and substantially the same sequence as one of the following polypeptides: SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14. The recombinant polypeptide may also include portions of other proteins, such as in-frame fusions to the lacZ encoded -galactosidase protein. 8
Such recombinant polypeptides can be obtained from bacterial cells containing, for example, lambda gtll vectors with any of the described inserts, including lambda-A2, lambda-All, lambda-A13 and' lambda-A33. The invention includes, in one aspect, a method for the detection of Astrovirus in human stool samples and in environmental samples. The method includes the partial purification of polynucleotides present in the stool sample or concentration of polynucleotides from environmental samples, followed by hybridization to oligonucleotide probes specific for the Astrovirus polynucleotide. The method also includes means for detecting the binding of the probes to polynucleotides present in the stool or environmental sample. Such detection means include the standard detection methods of labelling the probe by biotinylation or radioactive isotopes. The method may include generation of cDNA molecules from RNA templates present in the partially purified sample and sequence independent amplification of the resulting cDNA molecules. Oligonucleotide probes and oligonucleotide primers specific for the Astrovirus poly¬ nucleotide are also defined by the present invention. Both the probes and primers can be derived from the above-described Astrovirus coding sequences. Another aspect of the present invention is a diag¬ nostic kit and a method for use in screening human blood containing antibodies specific against Astrovirus antigens. The kit contains a recombinant Astrovirus polypeptide antigen which is immunoreactive with sera from rabbits immunized with Astrovirus infectious inoculum, and means for detecting the binding of said antibodies to the antigen. Polypeptide antigens inclu¬ ding an immunoreactive portion of any of the above de¬ scribed Astrovirus epitopes may be used in this regard. The kit may include a solid support to which the polypeptide antigen is attached and a reporter-labeled anti-human antibody. In this case the binding of anti- Astrovirus serum antibodies to the antigen can be detected by binding of the reporter-labeled antibody to the solid surface.
Yet another aspect of the present invention includes an expression system and a method of producing an Astrovirus polypeptide which is immunoreactive with sera from rabbits immunized with Astrovirus infectious inoculum. The method includes introducing into a suit¬ able host a recombinant expression system containing an open reading frame (ORF) , where the ORF has a polynucleo¬ tide sequence which encodes an Astrovirus polypeptide immunoreactive with sera from rabbits immunized with Astrovirus infectious inoculum. In this approach the vector is designed to express the ORF in the selected host. The host is then cultured under conditions resul¬ ting in the expression of the ORF sequence. A number of expression systems can be used in this regard including the lambda gtll expression system in an Escherichia coll host. Other expression systems include expression vec¬ tors for use in yeast, bacterial, insect, and mammalian cells.
Also forming part of the invention is a vaccine for immunizing an individual against Astrovirus infection.
The vaccine includes a recombinant Astrovirus polypeptide antigen which is immunoreactive with sera from rabbits immunized with Astrovirus infectious inoculum. Such polypeptide antigens may include an immunoreactive portion of the above described Astrovirus coding sequences. The polypeptide antigen is typically prepared in a pharmacologically acceptable adjuvant.
The invention further includes antibodies specific against a polypeptide having a sequence selected from the following group: SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, 10
SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO: 12, and SEQ ID NO:14. Antibodies can also be generated against the Astrovirus-specific antigen produced by bacterial cells transformed with one of the following' vectors: lambda- A2, lambda-All, lambda-A13 and lambda-A33. These antibodies may be polyclonal or monoclonal. The antibo¬ dies can be used in a method of producing passive im¬ munity in an individual against Astrovirus, which includes administering the antibodies parenterally to the individual.
These and other objects and features of the inven¬ tion will become more fully apparent when the following detailed description is read in conjunction with the accompanying drawings.
Brief Description of the Drawings
Figure 1 illustrates that an A43 clone specific probe only hybridizes to nucleic acid from Astrovirus infected cells.
Figure 2 shows that an A43 clone specific probe hybridizes to nucleic acid from cells infected with other Astrovirus serotypes.
Figure 3 shows CsCl density gradient separation of an Astrovirus preparation with corresponding antigenic and hybridization analysis.
Figure 4A illustrates that nucleic acid from infected cells is RNase sensitive. Figure 4B shows that the Astrovirus RNA is plus-sense RNA. Figure 5 shows the alignment of the following se¬ quences: A35, SEQ ID N0:1; A43, SEQ ID NO:3; and Al, SEQ ID NO:7.
Figure 6 shows how new Astrovirus sequences can be identified by an epitope spanning method. 11
Figure 7 shows the results of a Northern blot analysis indicating the presence of two populations of Astrovirus-specific, poly(A)+ RNA. Astrovirus genomic RNA (7.2 Kb) is recognized by clone A43- and clone A39- specific probes, while a subgenomic RNA (2.8 Kb) is recognized by only one of two A39-specific probes.
Detailed Description of the Invention
Definitions The terms defined below have the following meaning herein:
1. The Astrovirus polynucleotide refers to variations of the disclosed sequences, such as degenerate codons, or variations in sequence which may be present in isolates or strains of Astrovirus which are immuno- logically cross reactive with the Serotype 1 isolate.
2. Two nucleic acid fragments are "homologous" if complementary strands are capable of hybridizing to one another under hybridization conditions described in Maniatis et al.. op. cit.. pp. 320-323, using the following wash conditions: 2 x SCC, 0.1% SDS, room temperature twice, 30 minutes each; then 2 x SCC, 0.1% SDS, 50°C once, 30 minutes; then 2 x SCC, room temperature twice, 10 minutes each, homologous sequences can be identified that contain at most about 25-30% basepair mismatches. More preferably, homologous nucleic acid strands contain 15-25% basepair mismatches, even more preferably 5-15% basepair mismatches. These degrees of homology can be selected by using more stringent wash or hybridization conditions for identification of clones from gene libraries (or other sources of genetic mate¬ rial) , as is well known in the art.
3. A protein is an Astrovirus polypeptide or derived from an Astrovirus polypeptide if it is encoded 12 by an open reading frame of a cDNA or RNA fragment repre senting the Astrovirus agent.
4. A protein having substantially the same sequence as one of the sequences determined for the disclosed Astrovirus epitopes is defined as a protein having amino- acid substitutions in the protein coding sequence which do not eliminate the antigenic properties of the protein (i.e. neutral substitutions). Neutral substitutions not adversely affecting overall antigenic function are reasonably predictable by one of ordinary skill in the art by utilizing currently available primary and secondary structure analysis (Needleman et al; Doolittle; Taylor et al, 1989; Hopp et al.) coupled with a matrix defining the relatedness between different amino acids (Taylor et al, 1989; Dayhoff; Schulz et al) . Proteins having sequence substitutions can be tested for immunore- activity with sera (e.g.. Examples 3 and 6), polyclonal, or specific monoclonal antibodies as described in the present disclosure. 5. LLCMK2 cells infected with serotype 1
Astrovirus are referred to as "Al LLCMK2". This is not to imply that this is a line of LLCMK2 cells that is continuously infected with Astrovirus.
I. Molecular Clone Selection by Immunoscreening There are five serotypes of human Astrovirus which have been identified (Kurtz et al. (1984)). The following methods can be applied to the isolation and analysis of any Astrovirus, regardless of serotype. The partial purification of the Astrovirus serotype l from the Al LLCMK2 is described in Example 1. The virus particles were isolated by centrifugation and the presence of the viral antigen monitored at each step using an ELISA assay (Example 1) . RNA was extracted from 13 the partially purified viral preparation by a one-step guanidinium/phenol extraction.
From the partially purified nucleic acid mixture two groups of cDNA molecules were generated, one using oligo d(T) as a primer and the second using random priming for first strand cDNA synthesis (Example 2A) . The resulting mixtures of cDNA molecules were amplified using the Sequence-Independent Single-Primer Amplification (SISPA) method which allows the amplification of a mixture of DNA regardless of the specific sequences of the DNA molecules (Example 2B) . Briefly, this sequence independent ampli¬ fication is accomplished by attaching linkers of known sequence to the ends of the double-strand DNA molecules present in a mixture, typically using blunt-end ligation. These linkers then provide the end sequences for primer- initiated amplification, using primers complementary to the linker sequences. Typically, the SISPA method (Reyes et al.) is carried out for 20-30 cycles of amplification, using thermal cycling to achieve successive denaturation and primer-initiated polymerization of second strand DNA (Mullis; Mullis et al.). The SISPA amplification pro¬ vides the advantage of enriching by amplification the Astrovirus genomic polynucleotides present in the start¬ ing sample. The two sets of amplified cDNA molecules from above were then cloned into the lambda gtll vector (Example 2C) which allows expression of proteins encoded by the newly introduced cDNA sequences produced as in-frame fusions to 0-galactosidase (Young et al.). The plaques generated by plating the recombinant phage were then screened for pro¬ duction of polypeptide antigens reactive with hyper¬ immune rabbit serum produced against Serotype A2, and not reactive with pre-immunization rabbit serum (Example 3) . Candidates initially identified by the immunoscreening 14 were plaque purified and re-screened. Ten clones were ultimately selected for further study (A35, A43, A39, Al, A2, All, A13, A14, A21, and A33) (Example 3). These clones were specifically reactive with the hyperimmune serum and not reactive with the serum from the unim- munitized rabbit. The sizes of the cDNA inserts are given in Table 1.
II. Expanded Characterization of the Lambda gtll clones.
A. Immunological Characterization. The clones were further immunologically characte¬ rized by expanded immunological screening including the hyper-immune rabbit serum (HI) paired with pre-immune rabbit sera, and an Astrovirus specific monoclonal antibody, 8E7 (Herrmann et al. (1988)), paired with pre- immune mouse sera. As can be seen from the data pre¬ sented in Table 2 , none of the cloned inserts encode the previously identified 8E7 Astrovirus epitope which had been shown to be an Astrovirus group specific antigen (Herrmann et al. (1988)).
B. Hybridization Characterization. The ten cloned inserts were characterized by hybridization analysis as follows. First, the cDNA inserts were isolated and used as probes in hybridization reactions with human lymphocyte genomic DNA and E. colx strain 1088 genomic DNA (Example 5A) . None of the in¬ serts hybridized with the genomic DNAs, suggesting that the clones were exogenous to these two possible sources of non-viral DNA (i.e., human genomic and E. col ) .
Further hybridization studies (Example 5B) showed the following cross-hybridization relationships between the clones (Table 3) . When clone A43 was used as a probe, clones A35, Al, A2, and A13 cross-hybridized. These results indicate that the clones were derived from 15 a contiguous segment of the Astrovirus genome. Clones A39, All, A14, A21, and A33 did not cross-hybridize with any other clones and appear to represent independent epitopes. The cloned inserts were labeled and hybridized to cDNAs generated from Astrovirus-infected and uninfected cellular mRNA (Example 5C) . SISPA amplified cDNAs were generated from both the Al LLCMK2 (Astrovirus infected) and LLCMK2 (uninfected) cell line (Example 2B) . All the probes hybridized specifically to SISPA amplified cDNA from Al LLCMK2, but not to SISPA amplified cDNA from the LLCMK2 uninfected cell line. The inserts of clones A43, A35, A39, All, and A33 hybridized strongly to the Al LLCMK2 cDNA. The A14 insert hybridized weakly and the A21 insert hybridized with moderate strength to the Al LLCMK2 cDNA. These results support the conclusion that the cloned inserts are derived from Astrovirus coding sequences.
To further support that the cloned lambda gtll inserts represented portions of the Astrovirus genome, RNA was extracted from Al LLCMK2 (Astrovirus infected) cells and LLCMK2 (uninfected) cell line (Example 1) . The hybridization probes used were the radiolabeled cDNA inserts of lambda gtll clones A43, A35, A39, All, A14, A21, and A33. The results of the hybridization analysis demonstrated (Example 5D, Table 4, and Figure 1) that the insert sequences hybridized specifically to RNA extracted from the Al LLCMK2 cells (i.e., Astrovirus infected cells) . No hybridization was seen with RNA isolated from the uninfected cell line. This data further supports that the cloned sequences correspond to Astrovirus- derived coding sequences.
In addition to Astrovirus Serotype 1, an A43 specific probe was shown to hybridize to Astrovirus Serotypes 2, 4, and 5 (Example 5F and Figure 2). 16
It was also demonstrated that when Astrovirus particles were separated on a CsCl gradient that the Astrovirus antigen activity comigrated with the presence of A43 specific sequences (Example 5E and Figure 3) . The nature of the extracted nucleic acid from which the above Astrovirus cDNAs were obtained was further investigated (Example 5G) . As shown in Figure 4A RNase A treatment (column 1) of nucleic acid extracts from Al LLCMK2 cells eliminated hybridization with the A43 clone specific probe, while DNasel treatment (column 2) had no effect. Untreated sample nucleic acid also tested positive by hybridization with the probe (column 3) . Accordingly, this result is consistent with previous results that indicated the astrovirus genome is composed of RNA (Herring et al., Monroe et al., and Willcocks et al.). Further, only single-stranded probes of negative polarity (as defined by open reading frame analysis) hy¬ bridized to the Al LLMCK2 cell derived nucleic acid (Figure 4B, spot 1) indicating that the extracted Astrovirus RNA was plus-stranded.
Poly(A)+ RNA was also extracted from Al LLCMK2 (Astrovirus infected) cells and LLCMK2 (uninfected) cell line (Example 1) . The isolated polyA+ RNAs were gel fractionated and transferred to a nitrocellulose filter. The filter bound RNA was then hybridized to a clone A43- specific probe and to two different clone A39-specific probes (Example 9) . Since clone A39 contained an internal mutated SISPA linker sequences (SEQ ID NO:15, nucleotides 192-223), one A39-specific probe represented an insert sequence from the region 5' to the mutated linker (SEQ ID NO:15, nucleotides 18-191) and the other represented an insert sequence from the region 3' to the mutated linker (SEQ ID NO:15, nucleotides 241-417). The results of this hybridization analysis (Example 9, Figure 7) demonstrated the presence of two populations of 17 poly(A)+, Astrovirus-specific RNA in Astrovirus-infected cell lysates. Both A43 and A39 (3' of mutated linker) clone-specific probes hybridized with the 7.2 Kb genomic RNA (Figure 7 , lanes 1 and 3). In addition, a 2.8 Kb subgenomic RNA was detected by the clone A39 probe
(Figure 7, lane 3). The hybridization analysis further suggests that the sequences 5' to the internal SISPA sequence in clone A39 are not Astrovirus specific.
The above results suggest that lambda gtll clones identified above by immunoscreening correspond to Astrovirus antigen coding sequences.
III. Sequence Analysis of the Astrovirus cDNA Clones. The cDNA inserts of lambda gtll clones A43, A35,
A39, Al, A14, and A21 were subcloned into a vector useful for DNA sequence analysis and the insert sequences determined (Example 6) : the sequence data for the clones are presented in the Sequence Listing. The cloned insert sequences were examined for homologies at both the nucleic acid and amino acid levels with the sequences compiled in "GENBANK" data set. This search indicated that the cloned insert sequences do not represent previously characterized nucleic acid or amino acid sequences.
Also, the DNA sequences of the 6 inserts were aligned for sequence comparison. The only cloned sequences identified as having substantial sequence overlap were clone inserts A43, A35, and Al (Figure 5). In Figure 5 the bold areas represent overlap areas between the designated clones. As can be seen in the figure, clones A43 and Al do not have any overlapping sequences: the clone A35 sequences bridge the two. This data appears to be inconsistent with the cross hybridization data which showed cross-hybridization 18 between Al and A43. The sequence data was confirmed and consistent so the cross-hybridization experiments were not pursued further. The sequencing data supports that at least two epitopes have been identified in this region, one corresponding to A43 sequences and the other to Al sequences.
The immunoreactive clones identified above can be used to obtain a complete set of overlapping genomic cDNA clones. For example, the lambda gtll clone A43 insert can be isolated and employed as a probe against cDNA libraries established in lambda gtlO. The lambda gtlO libraries are generated essentially as was described in Example 2C for libraries in lambda gtll which were used for immunoscreening. The inserts from clones identified in this fashion can then be isolated by EcoRI digestion of the lambda gtlO clone, electrophoretic fractionation of the digest products, and electroelution of the band corresponding to the insert DNA (Maniatis et al. ; Ausubel et al.) . To identify other viral epitopes, the isolated insert can then be treated with DNase I to generate random fragments (Maniatis et al.) , and the resulting digest fragments inserted into lambda gtll phage vectors for immunoscreen¬ ing. Alternatively, after sequencing, oligonucleotide primers may be used to isolate specific overlapping segments for in-phase insertion into any selected expres¬ sion vector.
Inserts from the immunoreactive clones identified above can be used in a similar manner to probe the origi- nal cDNA library generated in lambda gtlO. Specific subfragments of the inserts may also be isolated by polymerase chain reaction or after cleavage with restric¬ tion endonucleases. These subfragments can be radioac- tively labeled and used as probes against the cDNA libra- ries generated in lambda gtlO. In particular, the 5' and 3' terminal sequences of the inserts are useful as probes to identify clones which overlap this region.
Furthermore, the sequences provided by the end- terminal sequences of the clone inserts are useful as specific sequence primers in first-strand DNA synthesis reactions (Maniatis et al.; Scharf et al.) using, for example, Al LLCMK2 cellular RNA and A43 terminal sequenc¬ es (Figure 6) . Alternatively, partially purified Astro¬ virus nucleic acid can be prepared from stool samples obtained from an infected volunteer (see Example 8) or from cell culture derived material. Synthesis of the second-strand of the cDNA is randomly primed (Boehringer Mannheim, Indianapolis IN) (Figure 6, El) . The above procedures identify or produce cDNA molecules correspon- ding to nucleic acid regions that are adjacent to the known clone A43 insert sequences. These newly isolated sequences can in turn be used to identify further flank¬ ing sequences, and so on, to identify overlapping cDNA clones from which the entire Astrovirus genome can be determined. As described above, after new Astrovirus genomic sequences are isolated, the polynucleotides can be cloned and immunoscreened to identify specific sequen¬ ces encoding Astrovirus antigens.
Alternatively, the polymerase chain reaction (Mullis) can be used to clone gaps between known epi¬ topes. For example, the terminal sequences from any of the Astrovirus clones can be used as one primer in the polymerase chain reaction (e.g., Figure 6, A43) and terminal sequences from unrelated clones (A39, A14, and A21) can be used as the second primer (Figure 6, El) .
Since the genomic relationship between these two sets of epitope coding sequences are unknown the following approaches may be used to generate an epitope spanning polymerase chain reaction amplification product (Figure 6) : 20
(i) a mixture of primers from, for example, both strands of one terminus of A43 and both strands of one terminus of A14;
(ii) individual reactions of a primer from one strand of one terminus of A43 (Figure 6, A43) and a primer from one strand of one terminus of A39, A14, and A21 (Figure 6, El) , and the same primer from A43 and a primer from the opposite strand of the same terminus of A39, A14, and A21 (E2) . Figure 6 illustrates a produc- tive polymerase chain reaction generating an epitope spanning region using, for example, A43 and El.
Knowledge of the Astrovirus genomic sequence will be helpful (i) in studying and establishing Astrovirus relatedness to other viruses, and (ii) in the isolation of sequences from viruses related to Astrovirus but which are as yet uncloned.
IV. Anti-Astrovirus Antigen Antibodies In another aspect, the invention includes antibodies specifically directed against the recombinant antigens of the present invention. Typically, to prepare antibodies, a host animal, such as a rabbit, is immunized with the purified antigen or fused protein antigen. Hybrid, or fused, proteins may be generated using a variety of coding sequence derived from other proteins, such as β- galactosidase or glutathione-S-transferase. The host serum or plasma is collected following an appropriate time interval, and this serum is tested for antibodies specifically directed against the antigen. Example 7 describes the production of rabbit serum antibodies which are specific against the A43 antigens in the SJ26/A43 fusion protein. These techniques are equally applicable o the other antigens of the present invention. The gamma globulin fraction or the IgG antibodies immunized animals can be obtained, for example, by use o saturated ammonium sul ate or DEAE Sephadex, or other techniques known to those skilled in the art for producing polyclonal antibodies.
Alternatively, purified antigen or fused antigen protein may be used for producing monoclonal antibodies. Here the spleen or lymphocytes from an immunized animal are removed and immortalized or used to prepare hybridomas by methods known to those skilled in the art. To produce a human-human hybridoma, a human lymphocyte donor is selected. An individual known to be infected with an Astrovirus may serve as a suitable lymphocyte donor. Lymphocytes can be isolated from a peripheral blood sample. Epstein-Barr virus (EBV) can be used to immortalize human lymphocytes or a human fusion partner can be used to produce human-human hybridomas. Primary in vitro immunization or sensation with viral specific polypeptides can also be used in the generation of human monoclonal antibodies.
Antibodies secreted toy the immortalized cells are screened to determine the clones that secrete antibodies of the desired specificity, for example, using the ELISA or Western blot method (Ausubel et al.) .
V. Utility
Routes of transmission that have been documented fo Astrovirus and other gastroenteric viruses include water, food (particularly shellfish and salads) , aerosol, fomites, and person-to-person contact. Infectivity can last for as long as 2 days after resolution of symptoms (Greenberg et al. (1989)).
In gastroenteritis outbreaks, investigators often encounter the problem of having to take action before the etiologic agent responsible for the outbreak can be 22 identified. Because of the difficulties associated with diagnosis of gastroenteritis caused by viruses, this problem is particularly relevant for viral outbreaks. Distinguishing viral from bacterial or protozoal gastroenteritis is sometimes difficult due to the overlap of clinical symptoms. Adequate supplies of virus- specific antigen and antibodies are essential to any virus-testing system. Identification of specific Astrovirus antigens will facilitate the direct diagnosis of Astrovirus involvement in gastroenteritis outbreaks.
A. Diagnostic Methods and Kits
(i) Immunological Approaches
The antigens obtained by the methods of the present invention are advantageous for use as diagnostic agents for Astrovirus antibodies present in the serum of an Astrovirus-infected individual; particularly, the anti¬ gens represented by clones A43, A35, A39, Al, A2, All, A13, A14, A21, and A33. In one preferred diagnostic configuration, test serum is reacted with a solid phase reagent having a surface-bound Astrovirus antigen obtained by the methods of the present invention, e.g., the A43 insert encoded antigen. After binding anti-Astrovirus antibody to the reagent and removing unbound serum components by washing, the reagent is reacted with reporter-labeled anti-human antibody to bind reporter to the reagent in proportion to the amount of bound anti-Astrovirus antibody on the solid support. The reagent is again washed to remove unbound labeled antibody, and the amount of reporter associated with the reagent is determined. Typically, the reporter is an enzyme which is detected by incubating the solid phase in the presence of a suitable fluorometriσ or colorimetric substrate. 23
The solid surface reagent in the above assay is prepared by known techniques for attaching protein material to solid support material, such as polymeric beads, dip sticks, 96-well plate or filter material. These attachment methods generally include non-specific adsorption of the protein to the support or covalent attachment of the protein, typically through a free amine group, to a chemically reactive group on the solid support, such as an activated carboxyl, hydroxyl, or aldehyde group.
In a second diagnostic configuration, known as a homogeneous assay, antibody binding to a solid support produces some change in the reaction medium which can be directly detected in the medium. Known general types of homogeneous assays proposed heretofore include (a) spin- labeled reporters, where antibody binding to the antigen is detected by a change in reported mobility (broadening of the spin splitting peaks) , (b) fluorescent reporters, where binding is detected by a change in fluorescence efficiency, (c) enzyme reporters, where antibody binding effects enzyme/substrate interactions, and (d) liposome- bound reporters, where binding leads to liposome lysis and release of encapsulated reporter. The adaptation of these methods to the protein antigen of the present invention follows conventional methods for preparing homogeneous assay reagents.
In each of the assays described above, the assay method involves reacting the serum from a test individual with the protein antigen and examining the antigen for the presence of bound antibody. The examining may involve attaching a labeled anti-human antibody to the antibody being examined, either IgM (acute phase/primary response) or IgG (convalescent or chronic phase/secondary response) , and measuring the amount of reporter bound to the solid support, as in the first method, or may involve 24 observing the effect of antibody binding on a homogeneous assay reagent, as in the second method.
Also forming part of the invention is an assay system or kit for carrying out the assay method just described. The kit generally includes a support with surface-bound recombinant Astrovirus antigen (e.g. , the A43 insert encoded antigen) , and a reporter labeled reporter-labeled anti-human antibody for detecting surface-bound anti-Astrovirus-antigen antibody. In particular, one or more polypeptide antigens produced by clones A43, Al, or A35 can be combined with antigens produced by A39, A2, All, A13, A14, A21, and A33 in Astrovirus diagnostic kits. Also, a single recombinant polypeptide containing multiple antigens, such as shown in Figure 5, can be included in such kits.
Further, these antigens can be combined with any number of antigens from other gastroenteritis-causing viruses including rotaviruses, pestiviruses , caliciviruses, Astroviruses, parvoviruses, coronaviruses, toroviruses, adenoviruses, Norwalk virus, and the
Norwalk-like viruses (LeBaron et al.) . Some members of the Norwalk-like virus family include the following variants: Hawaii, Snow Mountain, Montgomery County, Taunton, A ulree, Sapporo, and Otofuke. These antigens can be obtained in a number of ways, for example, rotavirus can be cultivated (LeBaron et al.) and viral antigenic proteins can be isolated from the viral capsid. Polypeptides of calciviruses (Terashima et al.) , and Norwalk viruses (Greenberg et al. (1981)) can be isolated as well. Kits containing antigens of selected gastroenteritis viruses provide a diagnostic composition capable of immunoreacting with a broad spectrum of human viral gastroenteritis serum samples.
A third diagnostic configuration involves use of the anti-Astrovirus antibodies, described in Section IV 25 above, capable of detecting Astrovirus specific antigens. The Astrovirus antigens may be detected, for example, using an antigen capture assay where Astrovirus antigens present in candidate serum, fecal material or environmentally derived samples (e.g. sewage effluents and food sources, such as shellfish) are reacted with an Astrovirus specific monoclonal antibody. The anti- Astrovirus monoclonal antibody is bound to a solid substrate and the antigen is then detected by a second, different labeled anti-Astrovirus antibody: the monoclonal antibodies of the present invention which are directed against Astrovirus specific antigens are particularly suited to this diagnostic method. Other variations of the antigen capture assay are known in the art (Harlow et al.). The antigen capture assay diagnostic configuration can also be expanded to include antibodies directed against other gastroenteritis virus families including rotaviruses, pestiviruses, caliciviruses, Astroviruses, parvoviruses, coronaviruses, toroviruses, adenoviruses, and the Norwalk-like viruses. For example, such antigen-detection systems may include antibodies directed against Norwalk virus (Greenberg et al.(1978)), calciviruses (Nakata et al.), pestivirus (Yolken et al.), and rotavirus (Dennehy et al.). The present invention provides an easily renewable source of Astrovirus antigen and antibody reagents for use in diagnostics. For example, these reagents can be used in solid phase radioimmunoassays for Astrovirus antigen and a radioimmunoassay for antibody to the Astrovirus (Greenberg et al. (1989)). The monoclonal and polyclonal Astrovirus antibodies of the present invention can also be used in the immune electron microscopy technique (Kapikian et al.) .
(ii) Nucleic Acid Approaches 26
The Astrovirus nucleic acid sequences identified by the method of the present invention provide sequences which can be used as hybridization probes for the identi¬ fication of the presence of Astrovirus coding sequences in a sample. Primers useful for the Polymerase Chain Reaction (PCR) (Mullis; Mullis et al.) can be derived from any of the nucleic acid sequences listed in the Sequence Listing or obtained from the inserts of clones A2, All, A13, or A33. Further, any Astrovirus sequence, identified as described above in Section III, can be used in this capacity. Typically these primers are two nucleic acid sequences consisting of 8 or more colinear nucleotides, where the two sequences are separate by a defined distance, e.g. 500 bases, and are homologous to opposite strands.
Astrovirus specific nucleic acid sequences can also be used as hybridization probes to detect the presence of the Astrovirus in a sample as was done, for instance, in Example 5C or 5D. Kits containing such PCR primers and hybridization probes can also contain similar primers useful for the identification of other gastroenteritis viruses.
Kits based on any of the above diagnostic methods are useful tools to aid in the rapid determination of whether gastroenteritis viruses are the agents responsible for outbreaks of human gastroenteritis. Further, although person-to-person transmission is an important aspect of viral gastroenteritis, the initiating event for most outbreaks of viral gastroenteritis is contamination of a common source (Lebaron et al.). Since enteric viruses cannot multiply outside their host, in contrast to bacterial pathogens, the original inoculum present in the common source determines infectivity of the source. Accordingly, the above-described kits are 27 also useful for identification and verification of contaminated sources (e.g., shellfish or water-source).
B. Polypeptide Vaccine The Astrovirus antigens identified by the methods of the present invention, e.g. A43, can be formulated for use in an Astrovirus vaccine. The vaccine can be formulated by standard methods, for example, in a suitable diluent such as water, saline, buffered salines, complete or incomplete adjuvants, and the like. The immunogen is administered using standard techniques for antibody induction, such as by subcutaneous administra¬ tion of physiologically compatible, sterile solutions containing inactivated or attenuated virus particles or antigens. An immune response-producing amount of viral antigen is typically administered per vaccinizing injection, typically in a volume of one milliliter or less.
A specific example of a vaccine composition includes, in a pharmacologically acceptable adjuvant, a recombinantly produced A43 polypeptide. The vaccine is administered at periodic intervals until a significant titer of anti-Astrovirus antibody is detected in the serum. Such a vaccine may be useful to (i) generate short- term immunity in uninfected community members against Astrovirus infection when outbreaks of gastroenteritis have been identified as Astrovirus-induced, and (ii) for long-term active immunoprophylaxis of Astrovirus infections.
C. Passive Immunoprophylaxis
The effect of viral gastroenteritis agents on people with immunodeficiencies is of particular interest (Lebaron et al.). Interventions, such as the 28 administration of anti-Astrovirus immunoglobulins, that might prove successful in halting chronic Astrovirus infection of immunocompromised patients might also prove useful in other situations, such as the chronic diarrhea associated with malnourishment or in protecting unexposed community members (Lebaron et al.).
The anti-Astrovirus antibodies of the invention can be used as a means of enhancing an anti-Astrovirus immune response since antibody-virus complexes are recognized by macrophages and other effector cells. The antibodies can be administered in amounts similar to those used for other therapeutic administrations of antibody. For example, pooled gamma globulin is administered at 0.02- 0.1 ml/lb body weight during the early incubation of other viral diseases such as rabies, measles and hepatitis B to interfere with viral entry into cells. Thus, antibodies reactive with, for example, the A43 antigen can be passively administered alone in a "cocktail" with other anti-viral antibodies or in conjunction with another anti-viral agents to a patient infected with Astrovirus to enhance the immune response and/or the effectiveness of an antiviral drug.
The following examples illustrate various aspects of the invention, but are in no way intended to limit the scope thereof.
Materials E. col DNA polymerase I (Klenow fragment) was obtained from Boehringer Mannheim Biochemicals (Indianapolis, IN) . T4 DNA ligase and T4 DNA polymerase were obtained from New England Biolabs (Beverly, MA) ; Nitrocellulose filters were obtained from Schleicher and Schuell (Keene, NH) .
Synthetic oligonucleotide linkers and primers were prepared using commercially available automated oligonu- cleotide synthesizers. Alternatively, custom designed synthetic oligonucleotides may be purchased, for example, from Synthetic Genetics (San Diego, CA) . cDNA synthesis kit and random priming labeling kits were obtained from Boehringer-Mannheim Biochemical (BMB, Indianapolis, IN) . The cell line LLCMK2 and Al LLCMK2 (monkey kidney cell line infected with Astrovirus type 1) were obtained from John E. Herrmann, Ph.D., Division of Infectious Diseases, University of Massachusetts Medical Center. Anti-Astrovirus type 1 rabbit hyperimmune sera HI was obtained from John E. Herrmann. Mouse monoclonal antibody 8E7 (Herrmann et al. (1988)), which recognizes all five types of Astrovirus, was obtained from John E. Herrmann. Cells infected with Astrovirus Serotypes 2, 4, and 5 were also obtained from John E. Herrmann.
EXAMPLE 1 Partial Purification of the Astrovirus The Al LLCMK2 cells and LLCMK2 cell lines were cultivated as previously described (Lee et al.; Kurtz et al. (1979, 1984)). Cell cultures were harvested and pelleted at 3,000 X g for 30 minutes at 4°C. The resulting pellet was placed on ice while the supernatant was pelleted at 100,000 X g for 2 hours at 4°C. The low- speed and high-speed pellets were combined and resuspen- ded in 20 ml TNMC buffer (50 mM Tris-HCl, pH 8.0, 100 mM NaCl, 25 mM MgCl2, 25 mM CaCl2) and placed on ice.
The pellet suspension was extracted extensively with "BLACO-TRON" (trichlorotrifluoroethane; Baron-Blakeslee, San Francisco, CA) and the aqueous phase saved from each extraction. The extracted aqueous phase was pelleted at 100,000 Xg for 2 hours at 4°C. The resulting pellet was resuspended in 2 ml TNMC. Half of this partially 30 purified material was used for RNA extraction and half was purified further in a CsCl gradient.
The presence of viral antigen was monitored at each step by ELISA (rabbit HI detection — Lee et al. , Kurtz et al. (1984) ; 8E7 capture — Herrmann et al.). The negative control sample from cell line LLCMK2 was processed in tandem with Al LLCMK2.
Nucleic acid was extracted from the partially purified Astrovirus material by a one-step guanidinium/- phenol extraction procedure (Chomczynski et al.). RNA was precipitated using 2 volumes of ethanol and overnight storage at -70°C.
EXAMPLE 2 Cloning cDNA Molecules Derived From the Astrovirus Genome A. Preparing cDNA fragment libraries.
Approximately 10 μq of the nucleic acid prepared in Example 1 was transcribed into cDNA, according to the method of Gubler et al. using an oligo-(dT) primer. Separately, to generate a second cDNA library, approximately 10 μq of the nucleic acid prepared in Example 1 was transcribed into cDNA using random primers (Boehringer Mannheim) by the method of Persons et al. To ensure that the resulting cDNA molecules had blunt ends, the cDNAs in each of the above preparations were treated with T4 DNA polymerase in the presence of all four nucleotides (Maniatis et al.). B. Amplifying the cDNA Fragments
The resulting cDNA molecules were amplified using the Sequence-Independent Single Primer Amplification
(SISPA) method. The SISPA technique is detailed in co- owned U.S. Patent application for "RNA and DNA Amplifica¬ tion Techniques," Serial No. 224,961, filed July 26, 1988 (herein incorporated by reference) . 31
The blunt end cDNA molecules from above were ligated (Maniatis et al.) to linkers having the following se¬ quence:
5'-GGAATTCGCGGCCGCTCG-3'
3'-TTCCTTAAGCGCCGGCGAGC-5'
The cDNA and linker were mixed at a 1:100 molar ratio in the presence of 0.3 to 0.6 Weiss units of T4 DNA ligase. To 100 μl of 10 mM Tris-Cl buffer, pH 8.3, containing 1.5 mM MgCl2 and 50 mM KCl (Buffer A) was added about 1 x 10"3 μq of the linker-ended cDNA, 2 M of a primer having the sequence d(5'-GGAATTCGCGGCCGCTCG-3') , 200 /M each of dATP, dCTP, dGTP, and dTTP, and 2.5 units of Thermus aguaticus DNA polymerase (Tag polymerase) (Perkin-Elmer Cetus) . The reaction mixture was heated to 94°C for 30 seconds for denaturation, allowed to cool to 50°C for 30 seconds for primer annealing, and then heated to 72°C for 0.5-3 minutes to allow for primer extension by Tag poly- merase. The replication reaction, involving successive heating, cooling, and polymerase reaction, was repeated an additional 25 times with the aid of a Perkin-Elmer Cetus DNA thermal cycler.
The amplified cDNA fragments were digested with EcoRI. Excess linkers were removed by passage through "SEPHACRYL 300" (Pharmacia, Piscataway NJ) .
The RNA obtained from the cell line LLCMK2 was treated as above except the LLCMK2 amplified cDNA molecules were not digested with EcoRI.
C. Cloning the Amplified Al LLCMK2 cDNAs into Lambda gtll.
Phosphatase-treated lambda gtll phage vector arms were obtained from Promega Biotec (Madison, WI) . The lambda gtll (Huynh) vector has a unique EcoRI cloning 32 site 53 base pairs upstream from the ^-galactosidase translation termination codon. The amplified Al LLCMK2 cDNAs from Part B were introduced into the EcoRI site by mixing 0.5-1.0 μq EcoRI-cleaved gtll," 0.3-3 μl of the above cDNA molecules, 0.5 i 10X ligation buffer (above), 0.5 pi DNA ligase (200 units), and distilled water to 5 __1. The mixture was incubated overnight at 14°C, followed by in vitro packaging, according to standard methods (Maniatis et al., pp. 256-268). The packaged phage were used to infect Escherichia coli strain KM392, obtained from Dr. Kevin Moore, DNAX (Palo Alto, CA) . (Alternatively, E. coli strain Y1090, available from the American Type Culture Collection (ATCC #37197), could be used.) Lawns of KM392 cells infected with serial dilutions of the packaged phage were used to determine the phage titer. For immunoscreening, about 104 pfu of the recombinant phage were plated per 150 mm plate (Maniatis et al.) .
EXAMPLE 3 Immunoscreening of Lambda gtll Clones The cDNA libraries in lambda gtll (Example 2) , random primed (rp) or oligo-d(T) primed (dT) , were immunoscreened using pre- and post-Astrovirus immunization rabbit sera which had a high titer of antibody (ELISA titer ≥ 1:1000; Lee et al.; Kurtz et al. (1984)) to Astrovirus. The sera were pre-adsorbed with lysates of E. coli infected with the lambda gtll vector containing no cDNA inserts: each serum was diluted 400 fold with AIB (TBS buffer, 10 mM Tris, pH 8.0, 150 mM NaCl; with 1% gelatin) for immunoscreening (Young et al.; Ausubel et al.) . 33
In the first immunoscreening with HI serum, 10 putative reactive plaques from lambda gtll(dt) were identified from a total of 0.6 x 105 recombinant phage, and 33 putative reactive plaques from lambda gtll(rp) were identified from a total of 0.8 x 105 recombinant phage. Following a third screening for plaque purification, 3 clones from the oligo-d(T) primed library (designated lambda-A35, lambda-A43, and lambda-A39) and 7 clones from the random primed library (designated lambda- Al, lambda-A2, lambda-All, lambda-A13, lambda-A14, lambda-A21, and lambda-A33) remained reactive.
The sizes of the cDNA inserts (Table 1) were determined by EcoRI digestion of the lambda gtll clones followed by electrophoretic separation of the digest fragments on an agarose gel, run in parallel with DNA size-standards.
Table 1
Further Immunological Characterization of the Lambda gtll Clones Immunological screening of the reactive lambda gtll clones (Example 3; Table 1) was expanded to include the following paired sera: Hi, and pre-immune rabbit sera; and 8E7, and pre-immune mouse sera. The immunoreactivity 34 of the lambda gtll clones was assayed by mixing plaque purified phage with non-recombinant lambda gtll and plaque-plating at a 1:1 ratio. Reactive plaques were detected (Young et al.; Ausubel et al".) after incubation with the test sera by using an alkaline phosphatase- conjugated anti-IgG second antibody (Pierce, Rockford IL) .
The reactivities of the pre- and post-infection sera against the lambda clones are given in Table 2. Table 2
Pre-immune 8E7 mouse
As can be seen in Table 2, the protein products of all 10 clones reacted only with post-infection HI rabbit serum and not with the monoclonal 8E7 antibody.
EXAMPLE 5 Characterization of the Lambda gtll Clones
A. Hybridization Testing to Human and E. coli Genomic DNA
The A35, A43, and A39 cDNA clones were tested for similarity to human and E. coli genes by Southern blot hybridization (Southern; Maniatis et al.). Human lymphocyte genomic DNA and E. coli strain 1088 genomic 35
DNA were each digested with EcoRI and Hindlll. These DNA fragments in these digests were electrophoretically separated on a 1% agarose gel in parallel lanes. The DNA fragments were transferred to nitrocellulose (Southern) . Radioactively labeled probes of the A35, A43, and A39 lambda gtll cDNA insert were made as follows. Primers of known' lambda gtll sequences which flanked the cDNA insert (5'-GGCAGACATGGCCTGCCCGG-3' and 5'- TCGACGGTTTCCATATGGGG-3') were used to amplify the cDNA insert by the polymerase chain reaction (PCR) method of Mullis. The typical PCR cycle involved the following steps: melting at 94°C for 30 seconds, followed by an¬ nealing at 50°C for 1 min. , and extension at 72°C for 30 seconds. The reactions were repeated for 30 cycles. The PCR products were digested with EcoRI and electrophoreti¬ cally resolved using a preparative 1.5% agarose gel. The clone-specific, amplified fragment was identified by size and electrophoresis continued to transfer the DNA band completely onto a NA45 membrane (Schleicher & Schuell, Keene, NH) . The DNA was eluted from the membrane using a high salt buffer (Schuell & Schuell, Keene, NH)., extracted once with phenol:chloroform (1:1), and ethanol precipitated. After ethanol precipitation, the DNA was used as the template for random-primed DNA labeling (Boehringer Mannheim, Indianapolis, IN) .
The nitrocellulose filters were hybridized with radiolabeled probes made from each of A35, A43, and A39. None of the three clones demonstrated a positive signal with either the human or E. coli genomic DNAs.
B. Cross-Hybridization Testing Between the CDNA Clones.
The inserts of the 10 lambda gtll clones (Table 2) were isolated as described in Example 5A. These 10 36 inserts and a negative control DNA were applied to nitrocellulose filters.
The inserts were used as templates for random-primed DNA labeling (Boehringer Mannheim, Indianapolis IN) to generate 32P labeled insert-probes. The filters were then separately hybridized with labeled insert-probes. The result of this hybridization study showed the cross hybridization pattern presented in Table 3.
Table 3 Probe
*=not determined
These results show that when clone A43 was used as probe clones A35, Al, A2, and A13 cross-hybridized. The results suggest that the these clones are all derived from a contiguous region of the Astrovirus genome. Clones A39, All, A14, A21, and A33 did not cross- hybridize with any other clones.
C. Hybridization of the Lambda gtll clone Inserts to cDNAs generated from Astrovirus-infected and uninfected cellular mRNA.
The inserts of the lambda gtll clones A43, A35, A39, All, A33, A14, and A21, were isolated and radiolabeled as above. The SISPA amplified cDNAs generated from both of the Al LLCMK2 and LLCMK2 cell lines (Example 2B) were loaded onto parallel lanes of a 1% agarose gel and elec- trophoretically separated. The cDNAs' were transferred from the gel to nitrocellulose paper by standard proce¬ dures (Maniatis et al.). The nitrocellulose filters were hybridized to the radiolabeled probes. All the probes hybridized specifically to SISPA cDNA from Al LLCMK2, but not to SISPA cDNA from the LLCMK2 uninfected cell line. The inserts of clones A43, A35, A39, All, and A33 hybri¬ dized strongly to the amplified Al LLCMK2 cDNA. The A14 insert hybridized weakly and the A21 insert hybridized with moderate strength to the Al LLCMK2 cDNA.
D. Dot-Blot Analysis
To support that the cloned lambda gtll inserts re¬ presented a portion of the Astrovirus genome, RNA was extracted from Al LLCMK2 (Astrovirus infected) and LLCMK2 (uninfected) cell lines (Example 1) . The RNA prepara- tions were prepared for hybridization analysis according to the recommendations of the manufacturer of the "MINIFOLD I" apparatus (Schleicher and Schuell, Keene, NH) .
Hybridization was carried out in 50% formamide and IX hybridization buffer (5X Denhardts solution (Maniatis et al.), 5X SSC (Maniatis et al.), 50 mM NaH2P04, 1 mM sodium pyrophosphate/Na2HP04, 100 μq/τa.1 denatured salmon sperm DNA, 100 μq/ml ATP. The hybridization probes used were the radiolabeled cDNA inserts of lambda gtll clones A43, A35, A39, All, A14, A21, and A33, prepared as de¬ scribed above. Following hybridization, filters were washed in (i) 2X SSC at room temperature for 15-30 minutes, and (ii) O.IX SSC with 0.1% SDS at 65°C for l hr. Filters were dried and then exposed to X-ray film. 38
The results of the hybridization analysis are pre¬ sented in Table 4.
Table 4
The insert probes hybridized to nucleic acid from the infected cell line only. No hybridization could be demonstrated with nucleic acid isolated from the uninfec¬ ted cell lines. A typical dot-blot analysis is shown in Figure 1 where the A43 clone insert was used as a probe.
E. Comigration of Astrovirus Antigen Activity with A43 Specific Sequences.
Astrovirus was prepared from Al LLCMK2 tissue culture cells as described above in Example 1. This Astrovirus preparation was further purified by overnight centrifugation on a 40-55% CsCl gradient, at 100,000 X g maintained at 4°C. Fractions (0.25 ml each) were collected by bottom puncture. Ten fractions spanning the density range of 1.27 to 1.46 g/ml were examined (Figure 3) . The Astrovirus antigen peak, determined by ELISA
(Herrman et al.) , was centered around the fraction with density 1.37 g/ml (Figure 3).
Nucleic acid was extracted from the 10 fractions using a one-step guanidinium/phenol extraction procedure (Chomczynski et al.) and prepared for RNA dot blot hybri¬ dization analysis according to the recommendations of the 39 manufacturer of the "MINIFOLD I" apparatus (Schleicher and Schuell, Keene, NH) .
Hybridization to A43-specific, radiolabelled probe was carried out in 50% formamide and IX hybridization buffer (5X Denhardts solution (Maniatis et al.), 5X SSC (Maniatis et al.), 50 mM NaH2P04, 1 mM sodium pyrophosphate/Na2HP04, 50 mg denatured salmon sperm DNA/500 ml, 50 mg ATP/500 ml) . The hybridization probe used was specific for the A43 insert. The probe was generated by polymerase chain amplification of the EcoRI fragment of clone A43 and labelled as described in Example 5B.
Following hybridization, filters were washed in (i) 2X SSC at room temperature for 15 minutes, and (ii) O.IX SSC with 0.1% SDS at 65°C for 1 hr. Filters were dried and then exposed to X-ray film.
As can be seen from the results of the hybridization analysis (Figure 3) the A43 probe hybridized strongly to nucleic acid from fraction 5 and weakly to subsequent fractions. No hybridization could be demonstrated with nucleic acid isolated from fractions 1-4.
The Astrovirus antigen peak corresponded to the peak hybridization seen on the RNA blot probed with the A43- specific probe (Figure 3) .
F. Hybridization of an A43 Clone Specific Probe to Other Astrovirus Serotypes.
The A43-specific probe was generated as described in Example 5E. RNA was isolated (as above) from cells infected with Astrovirus serotypes 2 , 4, and 5. The RNAs were prepared for RNA dot blot hybridization as described above. In Figure 2, RNA from un-infected cells is designated by a "U" and RNAs from the Astrovirus serotypes are designated as 1-1 (infected with Serotype 40
1) to 1-5. The results shown in Figure 2 demonstrate that the A43 clone-specific probe hybridizes to nucleic acid from cells infected with other Astrovirus serotypes.
G. The Nature of the Astrovirus Genomic Nucleic Acid, (i) The Astrovirus genome is an RNA molecule. The nucleic acid extracted from Al LLCMK2 cells (Example 1) was treated with RNaseA and DNasel as per the manufacturer's suggestions (both enzymes were obtained from Boehringer Mannheim, Indianapolis IN) . The samples were then prepared for Dot-blot hybridization as described above. The probe was the A43 clone specific probe used in Example 5F.
Treatment with RNaseA (Figure 4A, column 1, R) completely eliminated hybridization with the
A43-specific, radiolabeled probe, while DNase I treatment (Figure 4A, column 2, D) had no effect. Samples which were not treated with either RNasel or DNasel are shown in Figure 4A, column 3 (U) .
(ii) The Astrovirus genome is of positive polarity. Single-stranded oligonucleotide probes corresponding to both the positive strand of A43 (i.e., coding) and negative strand of A43 were synthesized by standard procedures. The oligonucleotides were radiolabeled by phosphorylating the synthetic oligonucleotide primers with κ-[32P]ATP (Richardson) .
The nucleic acid from Al LLCMK2 cells was prepared for hybridization as above. Hybridization was carried out in 30% formamide and IX hybridization buffer (see above) at 42*C. The filters were washed in 2X SSC (Maniatis et al.) at room temperature for 30 minutes.
Only the negative sense, synthetic A43 oligonucleo¬ tide probe hybridized to the RNA extracted from Astrovirus infected cells (Figure 4B, spot 1) , indicating that the RNA is of positive polarity. No hybridization with the extracted RNA was detectable when the positive sense, synthetic A43 oligonucleotide probe was used (Figure 4B, spot 2) .
EXAMPLE 6 Sequencing of the cDNA Inserts and Sequence Comparisons The cDNA inserts of lambda gtll clones A43, A35, A39, Al, A14, and A21 were subcloned into the "BLUESCRIPT KS+" vector (Stratagene, La Jolla, CA) . Briefly, the inserts were amplified (Mullis; Mullis et al.) as described above in Example 5A except that the following primers were used: 11F-H3: TGGCTGAATATCGAAGCTTTCCATATGGGG llR-Xho: TGGATTTCCTTACTCGAGATACGGGCAGAC. These primers contained lambda sequences flanking the cDNA insertion site and sequences encoding a Hindlll restriction site in one primer and a Xhol site in the second primer. The amplified fragments were digested with Hindlll and Xhol and the resulting fragments cloned into the "BLUESCRIPT KS+" vector.
The sequences of the cDNA inserts were determined as per the manufacturer's instructions using the dideoxy chain termination technique (Sanger, 1979) . Each of the . clones had a single open reading frame, contiguous with the ø-galactosidase reading frame of the lambda gtll vector. The sequence data is presented in the Sequence Listing as follows: A35, SEQ ID N0:1; A43, SEQ ID NO:3; A39, SEQ ID NO:15; Al, SEQ ID NO:7; A14, SEQ ID NO:9; and A21, SEQ ID NO:11. SEQ ID NO:15 contains the end- terminal SISPA sequences (SEQ ID NO:15 residues 1-17 and 428-444) used in the amplification reactions. Sequences were compared with "GENBANK" sequences at both nucleic 42 acid and amino acid levels. The "GENBANK" search indicated that these sequences did not represent previously characterized nucleic acid or amino acid sequences. The DNA sequences of the 6 clones were aligned for comparison. As expected from the cross-hybridization data presented above in Example 5, the clones A43, A35, and Al had overlapping sequences (Figure 5) and clones A39, A14, and A21 had independent sequences. The sequence given in Figure 5 is also presented as SEQ ID NO:13.
EXAMPLE 7 Antibodies Generated Against Astrovirus Encoded Polypeptide Antigens
A. Generation of Antibodies
Antibodies can be generated against any of the cloned Astrovirus antigen coding sequences. For example, the insert digest fragments from the lambda gtll clone A43 is released by EcoRI digestion of the phage, and the insert region purified by gel electrophoresis. The puri¬ fied fragment is introduced into the pGEX expression vec¬ tor (Smith) in-frame with the glutathione S-transferase protein. Expression of glutathione S-transferase fused protein (Sj26 fused protein) containing the A43 encoded polypeptide antigen can be achieved in E. coli strain KM392. The fusion protein is isolated from lysed bacteria by affinity chromatography on a column packed with glutathione-conjugated beads, according to published methods (Smith) .
The purified SJ26/A43 fused protein can be injected subcutaneously in Freund's adjuvant in a rabbit. Typi¬ cally, approximately 1 mg of fused protein is injected at days 0 and 21, and rabbit serum collected on days 42 and 56. 43
The above procedure can also be used to generate antibodies against the ff-galactosidase/A43 polypeptide antigen fusion protein where the fusion protein is isolated by affinity chromatography using, for example, p-amiobenzyl 1-thio ^-D-galactopyranoside-agarose. B. Specificity Testing
The specificity of the antibodies can be evaluated by Western blot screening (Ausubel et al.). For Western blot screening, lambda gtll/A43 phage from Example 3 is used to infect E. coli BNN103 temperature-sensitive bac¬ teria. These bacteria can be obtained from the American Type Culture Collection, Rockville MD. The bacterial host allows expression of a beta-galactosidase/- polypeptide antigen fused protein encoded by the vector under temperature induction conditions (Hunyh) .
Minilysates are prepared from the infected bacteria as follows. The infected bacteria are streaked, grown at 32°C overnight or until colonies were apparent, and indi¬ vidual colonies replica plated and examined for growth at 32°C and 42°C. Bacterial colonies which grew at 32°C, but not 42°C, indicating integration of the phage genome, are used to inoculate 1 ml of NZYDT (Maniatis) broth A. This saturated overnight bacterial culture is used to inocu¬ late a 10 ml culture, which is incubated with aeration to an O.D. of about .2 to .4, typically requiring 1 hour incubation. The culture is then brought to 43°C quickly in a 43°C water bath and shaken for 15 minutes to induce lambda gtll polypeptide synthesis, and incubated further at 37°C for 1 hour. The cells are pelleted by centrifuga- tion, and 1 ml of the pelleted material resuspended in 100 μl of lysis buffer (62 mM Tris, pH 7.5 containing 5% mercaptoethanol, 2.4 % SDS and 10% glycerol) .
Lysates were also prepared from bacterial strains of KM392 cells containing (a) pGEX, and (b) pGEX containing 44 the A43 insert (described above) , essentially as just described, omitting the initial temperature-selection steps.
The lysates are treated with DNasel to digest bacte- rial DNA, as evidenced by a gradual loss of viscosity in the lysate. An aliquot (typically about 15 μl) of the DNase-treated lysate is diluted with "TRITON X-100" and sodium dodecyl sulfate (SDS) to a final concentration of 2% "TRITON X-100" and 0.5% SDS. Non-solubilized material is removed by centrifugation and the supernatant frac¬ tionated by SDS polyacrylamide electrophoresis (SDS- PAGE) . A portion of the gel is stained, to identify the polypeptide antigens of interest, and the proteins in a corresponding unstained portion of the gel transferred to a nitrocellulose filter according to known methods (Ausubel et al.).
Briefly, the filters are blocked with AIB, then reacted with serum samples from the rabbits immunized as described above. The presence of specific antibody binding to the nitrocellulose filters can also be assayed by immunobinding of alkaline-phosphatase labeled anti- rabbit IgG. The results of the Western blot analysis are expected to show positive anti-Astrovirus antibody reac¬ tions with lysates from pGEX-A43 and lambda gtll/A43, but not with lysates from the pGEX and non-infected control strains. Reactivity with lambda gtll/A43 indicates specificity for the Astrovirus encoded portion of the fusion protein. Further, anti- -galactosidase antibodies (commercially available) are expected to react only with the fusion protein derived from the lambda gtll/A43 infected lysate.
Anti-A43 antibody present in the sera from the ani¬ mal immunized with the SJ26/A43 can be purified by affin¬ ity chromatography, where the ligand derivatized to the 45
"SEPHAROSE" beads is the purified beta-gal/A43 fusion protein. Human anti-A43 antibodies from sera derived from an Astrovirus infected human subject can be obtained in essentially the same way by derivatizing the A43 antigen-polypeptide to the support beads and passing the sera over the support.
EXAMPLE 8 Preparation of Astrovirus Nucleic Acid from Infected Stool Samples
A. Partial Purification of Astrovirus Nucleic Acid.
A human volunteer is orally administered an Astrovirus infectious inoculum (Kurtz et al. (1979)). Clinical stool specimens are obtained from the patient. The presence of virus particles is detected by immune electron microscopy (IEM) (Kapikian et al.). A pre- infection stool from the volunteer serves as the negative control in the following procedures. Approximately 7.5 grams of the Astrovirus-positive stool specimen is mixed with sufficient TNMC buffer (50 mM Tris-HCl, pH 8.0, 100 mM NaCl, 25 mM MgCl2, 25 mM CaCl2) to make a 10% (w/v) fecal suspension. The suspension is shaken vigorously and pelleted at 3,000 Xg for 30 minutes at 4°C. The resulting pellet is placed on ice while the supernatant is pelleted at 100,000 Xg for 2 hours at 4°C. The high-speed pellet is resuspended in 20 mis TNMC buffer.
The pellet suspension is extracted extensively with "BLACO-TRON" (trichlorotrifluoroethane; Baron-Blakeslee, Inc., San Francisco, CA) and the aqueous phase saved from each extraction. The extracted aqueous phase is pelleted at 100,000 Xg for 2 hours at 4°C and the resulting pellet resuspended in 2 mis TNMC. This suspension is layered on top of a 20% sucrose cushion overlaying a CsCl cushion (1.5 g/ml) and spun at 80,000 Xg for 3 hours at 4°C using a Beckman SW28. The band at the interface is collected by side puncture. The presence of Astrovirus antigen is monitored at each step by ELISA (Herrmann et al. ; Lee et al.; Kurtz et al.).
The negative control stool and other IEM Astrovirus- positive infection stool samples from the same volunteer are processed in tandem. Nucleic acid is extracted from partially purified stool by a one-step guanidinium/phenol extraction proce¬ dure (Chomczynski et al.).
B. Preparing cDNA fragments. Approximately 10 μq of the nucleic acid prepared in Example 8A can be transcribed into cDNA, as described in Example 2A.
C. Amplifying cDNA Fragments.
The resulting cDNA molecules are amplified using the Sequence-Independent Single Primer Amplification (SISPA) method as described above in Example 2C.
EXAMPLE 9 Northern Blot Hybridization Analysis Poly (A)+ RNA, from Astrovirus-infected and control uninfected cell (Example 1) lysates, was isolated from 500 μq of total RNA on an oligo (dT)-cellulose column, essentially as described by Sambrook, et al . The recovered poly (A)+ fraction was ethanol precipitated, washed with 70% ethanol, and the final pellet resuspended in 6 μl diethyl pyrocarbonate (DEPC)-treated water in preparation for electrophoresis.
RNA samples were loaded into wells in a 1,2% (w/v) agarose-6.6% (w/v) formaldehyde gel and run at 5 V/cm for 4 hr (Irminger, et al.). After electrophoresis was 47 complete, the gel was rinsed with distilled water, equilibrated in 10X SSC (Maniatis, et al.), and RNA was transferred to a nitrocellulose filter (Schleicher and Schuell) by overnight capillary transfer in 2OX SSC. The membrane was subsequently baked in a vacuum oven (80°C for 2 hr) and incubated at 42°C for at least 4 hr with a solution that contained 50% formamide, 5X SSPE (Maniatis, et al . ) , 2X Denhardt's solution, 0.1% SDS, 10 mM glycine, and 100 μg/ml each denatured fragmented salmon testes DNA and wheat germ tRNA.
Following the above-described prehybridization, radiolabeled, random-primed ("PRIME-IT" Kit, Stratagene, La Jolle CA) Astrovirus clone-specific probes (one A43- specific probe; and one A39-specific probe which represented an insert sequence from the region 5' to the internal mutated SISPA linker (SEQ ID NO:15, nucleotides 18-191) and the other represented an insert sequence from the region 3' to the mutated linker (SEQ ID NO:15, nucleotides 241-417)) were separately added to the hybridization vessel containing the membrane and incubated overnight at 42°C. The membrane was washed successively (2X SSC, 0.1% SDS, room temperature, 20 min; followed by IX SSC, 0.1% SDS, 65°C, 20 min; then 0.2X SSC, 0.1% SDS, 65°C, 20 min; and a brief rinse with 2X SSC) and prepared for autoradiography. Between hybridizations with different probes the blot was stripped of probe (Maniatis, et al . ) .
The membrane was exposed to X-ray film. The resulting autoradiograms are shown in Figure 7. In Figure 7 lanes 1, 3 and 5 contain poly (A)+ RNA extracted from cells of the Astrovirus-infected cell line and lanes 2, 4 and 6 contain poly (A)+ RNA extracted from cells of un-infected cell line (Example 1) . Lanes 1 and 2 were probed with the Astrovirus clone A43-specific probe. Lanes 3 and 4 were probed with the probe specific to the 48
3' half of clone A39. Lanes 5 and 6 the probe specific to the 5' half of clone A39.
In Figure 7 the Astrovirus clone A43-specific probe hybridizes with 7.2 Kb, poly (A)+ RNA" extracted from Astrovirus-infected cells (lane 1) . In addition, the probe specific to the 3' half of clone A39 (described above) hybridizes with both genomic (7.2 Kb) and subgenomic (2.8 Kb) poly(A)+ RNAs found in Astrovirus- infected cell lysates (lane 3) . By contrast, a probe specific to the 5' half of clone A39 (described above) does not recognize cellular or viral poly(A)+ RNA (lane 5), suggesting that the sequences 5' of the internal SISPA linker are not Astrovirus specific. The Astrovirus specific sequences 3' of the internal SISPA site are presented as SEQ ID NO:5. None of these Astrovirus clone-specific probes hybridizes with any poly(A)+ RNA from uninfected cells (lanes 2, 4 and 6) .
Although the invention has been described with reference to particular embodiments, methods, construc¬ tion and use, it will be apparent to those skilled in the art that various changes and modifications can be made without departing from the invention.
49 SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: Kim, Jungsuh P.
Matsui, Suzanne M. Greenberg, Harry B. Reyes, Gregory R.
(ii) TITLE OF INVENTION: The Astrovirus Human Gastroenteritis Agent and Molecular Cloning of Corresponding cDNAs
(iii) NUMBER OF SEQUENCES: 16
(iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: Law Offices of Peter J. Dehlinger
(B) STREET: P.O. Box 60850
(C) CITY: Palo Alto
(D) STATE: CA
(E) COUNTRY: USA
(F) ZIP: 94306
(v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk
(B) COMPUTER: IBM PC compatible
(C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: Patentin Release #1.0, Version #1.25
(vii) PREVIOUS APPLICATION DATA:
(A) APPLICATION NUMBER: US 07/702,731
(B) FILING DATE: 20-MAY-1991
(C) CLASSIFICATION:
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: Fabian, Gary R.
(B) REGISTRATION NUMBER: 33,875
(C) REFERENCE/DOCKET NUMBER: 4600-0079.41
(ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: (415) 324-0880
(B) TELEFAX: (415) 324-0960 50
(2) INFORMATION FOR SEQ ID NO:l:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 225 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: double
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA to mRNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(C) INDIVIDUAL ISOLATE: Astrovirus Serotype Al
(vii) IMMEDIATE SOURCE: (B) CLONE: A35
(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..225
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l:
TCA GAA TAT GAA CAA CAA GTG GTG AAG TCT ATC AAG CCT CAG AAG AGT 48 Ser Glu Tyr Glu Gin Gin Val Val Lys Ser lie Lys Pro Gin Lys Ser 1 5 10 15
GAG CCC CAA CCA TAC TCA CAA ACT TAC GGC AAG GCA CCA ATC TGG GAA 96 Glu Pro Gin Pro Tyr Ser Gin Thr Tyr Gly Lys Ala Pro lie Trp Glu 20 25 30
TCT TAC GAT TTT GAC TGG AAT GAG GAT GAT GCC AAG TTT ATT CTG CCA 144 Ser Tyr Asp Phe Asp Trp Asn Glu Asp Asp Ala Lys Phe lie Leu Pro 35 40 45
SUBSTITUTE SHEET 51
GCG CCA TAC CGG TTG ACT AAG GCA GAT GAA ATA GTC CTT GGA TCT AAA 192 Ala Pro Tyr Arg Leu Thr Lys Ala Asp Glu lie Val Leu Gly Ser Lys 50 55 60
ATC GTC AAG CTT AGA ACG ATT ATT GAA ACA GCC 225 lie Val Lys Leu Arg Thr lie lie Glu Thr Ala
65 70 75
(2) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 75 amino acids
(B) TYPE: amino acid (D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
Ser Glu Tyr Glu Gin Gin Val Val Lys Ser lie Lys Pro Gin Lys Ser 1 5 10 15
Glu Pro Gin Pro Tyr Ser Gin Thr Tyr Gly Lys Ala Pro lie Trp Glu 20 25 30
Ser Tyr Asp Phe Asp Trp Asn Glu Asp Asp Ala Lys Phe lie Leu Pro 35 40 45
Ala Pro Tyr Arg Leu Thr Lys Ala Asp Glu lie Val Leu Gly Ser Lys 50 55 60
lie Val Lys Leu Arg Thr lie lie Glu Thr Ala 65 70 75
(2) INFORMATION FOR SEQ ID NO:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 184 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: double 52
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA to mRNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
( i) ORIGINAL SOURCE:
(C) INDIVIDUAL ISOLATE: Astrovirus Serotype Al
(vii) IMMEDIATE SOURCE: (B) CLONE: A43
(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 2..184
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:
A AAA CCA ATT CCT GCC CTG AGA ACA ACC AAG CCA AAA ACT TGC CCC 46 Lys Pro lie Pro Ala Leu Arg Thr Thr Lys Pro Lys Thr Cys Pro 1 5 10 15
GAA CCA GAA GTC GAA TCA CAA CCA CTT GAT TTG TCC CAA AAG AAA GAG 94 Glu Pro Glu Val Glu Ser Gin Pro Leu Asp Leu Ser Gin Lys Lys Glu 20 25 30
AAA CAA TCA GAA TAT GAA CAA CAA GTG GTG AAG TCT ATC AAG CCT CAG 142 Lys Gin Ser Glu Tyr Glu Gin Gin Val Val Lys Ser lie Lys Pro Gin 35 40 45
AAG AGT GAG CCC CAA CCA TAC TCA CAA ACT TAC GGC AAG GCA 184
Lys Ser Glu Pro Gin Pro Tyr Ser Gin Thr Tyr Gly Lys Ala 50 55 60
(2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS: 53
(A) LENGTH: 61 amino acids
(B) TYPE: amino acid (D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:
Lys Pro lie Pro Ala Leu Arg Thr Thr Lys Pro Lys Thr Cys Pro Glu 1 5 10 15
Pro Glu Val Glu Ser Gin Pro Leu Asp Leu Ser Gin Lys Lys Glu Lys 20 25 30
Gin Ser Glu Tyr Glu Gin Gin Val Val Lys Ser lie Lys Pro Gin Lys 35 40 45
Ser Glu Pro Gin Pro Tyr Ser Gin Thr Tyr Gly Lys Ala 50 55 60
(2) INFORMATION FOR SEQ ID NO:5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 202 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: double
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA to mRNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(C) INDIVIDUAL ISOLATE: Astrovirus Serotype Al
(vii) IMMEDIATE SOURCE:
(B) CLONE: 3' portion of clone A39 (SEQ ID NO:15)
(ix) FEATURE: 54
(A) NAME/KEY: CDS
(B) LOCATION: 1..201
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:
GTA CCT GTG ACA TTT GAA GGA AGT GCT GGA TCA CCA TTA ATA ATG AAT 48 Val Pro Val Thr Phe Glu Gly Ser Ala Gly Ser Pro Leu lie Met Asn 1 5 10 15
GTG TCA GAG GGG AGC CAT TTT GCA CGA ACA GTT CTT GCA CGC TCA ACA 96 Val Ser Glu Gly Ser His Phe Ala Arg Thr Val Leu Ala Arg Ser Thr 20 25 30
ACA CCA ACC ACT CTA GCG CGT GCA GGA GAG AGA ACC ACC TCA GAC ACA 144 Thr Pro Thr Thr Leu Ala Arg Ala Gly Glu Arg Thr Thr Ser Asp Thr 35 40 45
GTA TGG CAG GTG CTC AAT ACA GCT GTA TCT GCT GCT GAG CTT GTC ACG 192 Val Trp Gin Val Leu Asn Thr Ala Val'Ser Ala Ala Glu Leu Val Thr 50 55 60
CCT CCT CCG C 202
Pro Pro Pro 65
(2) INFORMATION FOR SEQ ID NO:6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 67 amino acids
(B) TYPE: amino acid (D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:
Val Pro Val Thr Phe Glu Gly Ser Ala Gly Ser Pro Leu lie Met ABΠ 1 5 10 15 Val Ser Glu Gly Ser His Phe Ala Arg Thr Val Leu Ala Arg Ser Thr 20 25 30
Thr Pro Thr Thr Leu Ala Arg Ala Gly Glu Arg Thr Thr Ser Asp Thr 35 40 45
Val Trp Gin Val Leu Asn Thr Ala Val Ser Ala Ala Glu Leu Val Thr 50 55 60
Pro Pro Pro 65
(2) INFORMATION FOR SEQ ID NO:7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 136 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: double
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA to mRNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(C) INDIVIDUAL ISOLATE: Astrovirus Serotype Al
(vii) IMMEDIATE SOURCE: (B) CLONE: Al
(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..135
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7: 48
AAG CTT AGA ACG ATT ATT GAA ACA GCC ATA AAG ACT CAG AAT TAT AGT
Lys Leu Arg Thr HLee HHee GGlluu TThhrr AAllaa HHee Lys Thr Gin Asn Tyr Ser 1 5 10 15
GCA TTA CCT GAA GCA GTA TTT GAG CTC GAC AAA GCA GCT TAT GAA GCA 96 Ala Leu Pro Glu Ala Val Phe Glu Leu Asp Lys Ala Ala Tyr Glu Ala 20 25 30
GGT TTG GAA GGT TTC CTC CAA AGG GTT AAA TCA AAA AAA A 136 Gly Leu Glu Gly Phe Leu Gin Arg Val Lys Ser Lys Lys 35 40 45
(2) INFORMATION FOR SEQ ID NO:8:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 45 amino acids
(B) TYPE: amino acid (D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:
Lys Leu Arg Thr He He Glu Thr Ala He Lys Thr Gin Asn Tyr Ser
10 15
Ala Leu Pro Glu Ala Val Phe Glu Leu Asp Lys Ala Ala Tyr Glu Ala 20 25 30
Gly Leu Glu Gly Phe Leu Gin Arg Val Lys Ser Lys Lys 35 40 45
(2) INFORMATION FOR SEQ ID NO:9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 289 base pairs
(B) TYPE: nucleic acid
(C) STRANDΞDNESS: double
(D) TOPOLOGY: linear 57 (ii) MOLECULE TYPE: cDNA to mRNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(C) INDIVIDUAL ISOLATE: Astrovirus Serotype Al
(vii) IMMEDIATE SOURCE: (B) CLONE: A14
(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 2..289
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:
G CGG AAT CCT GTG ACA ACA ACC CTA CAG TTC ACA CAA ATG AAC CAA 4 Arg Asn Pro Val Thr Thr Thr Leu Gin Phe Thr Gin Met Asn Gin 1 5 10 15
CCT AGT CTA GGG CAC GGT GAA GCA CCA GCT GCG ATT GGT AGA TCC ATT 9 Pro Ser Leu Gly His Gly Glu Ala Pro Ala Ala He Gly Arg Ser He 20 25 30
CCA GCA CCT GGT GAG GAG TAT AAA GTT GTC CTC ACA TTT GGA TCC CCA 14 Pro Ala Pro Gly Glu Glu Tyr Lys Val Val Leu Thr Phe Gly Ser Pro 35 40 45
ATG AGC CCT AAT GCA AAT AAC AAA CAG ACT TGG GTT AAT AAA CCT CTT 190 Met Ser Pro Asn Ala Asn Asn Lys Gin Thr Trp Val Asn Lys Pro Leu 50 55 60
GAT GCG CCT TCG GGC CAT TAC AAT GTG AAA ATT GCA AAG GAT GTT GAC 238 Asp Ala Pro Ser Gly His Tyr Asn Val Lys He Ala Lys Asp Val Asp 65 70 75 58
CAC TAT CTA ACC ATG CAG GGT TTC ACT TCT ATA GCA TCT GTT GAC TCG 286
His Tyr Leu Thr Met Gin Gly Phe Thr Ser He Ala Ser Val Asp Ser
80 85 90 95
AGG 289 Arg
(2) INFORMATION FOR SEQ ID NO:10:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 96 amino acids
(B) TYPE: amino acid (D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:
Arg Asn Pro Val Thr Thr Thr Leu Gin Phe Thr Gin Met Asn Gin Pro 1 5 10 15
Ser Leu Gly His Gly Glu Ala Pro Ala Ala He Gly Arg Ser He Pro 20 25 30
Ala Pro Gly Glu Glu Tyr Lys Val Val Leu Thr Phe Gly Ser Pro Met 35 40 45
Ser Pro Asn Ala Asn Asn Lys Gin Thr Trp Val Asn Lys Pro Leu Asp 50 55 60
Ala Pro Ser Gly His Tyr Asn Val Lys He Ala Lys Asp Val Asp His 65 70 75 80
Tyr Leu Thr Met Gin Gly Phe Thr Ser He Ala Ser Val Asp Ser Arg 85 90 95
(2) INFORMATION FOR SEQ ID NO:11: 59
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 278 base pairs
(B) TYPE: nucleic acid
(C) STRANDΞDNESS: double
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: CDNA to mRNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(C) INDIVIDUAL ISOLATE: Astrovirus Serotype Al
(vii) IMMEDIATE SOURCE: (B) CLONE: A21
(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 2..277
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:
A ATG ATT GAC CCA CCA AGA GAA GAA GCA AAA GCT GCA ATA TCA ATT 46 Met He Asp Pro Pro Arg Glu Glu Ala Lys Ala Ala He Ser He 1 5 10 15
TGT CGT CAA GCA GGA ATC AAG CCT GTT ATG ATT ACT GGC GAT AAT ATT 94 Cys Arg Gin Ala Gly He Lys Pro Val Met He Thr Gly Asp Asn He 20 25 30
AAT ACA GCA ATT GCA ATT GCA AAA AGT CTA AAT ATT TAT AAT GAT GGT 142 Asn Thr Ala He Ala He Ala Lys Ser Leu Ash He Tyr Asn Asp Gly 35 40 45
GAT TTA GCT ATT AGC GGA CTT GAA CTA GAA AAA ATT AGC GAT GAT GAA 190 Asp Leu Ala He Ser Gly Leu Glu Leu Glu Lys He Ser Asp Asp Glu 50 55 60 60
CTA ACA AAT AAT ATT GAT AAA TAT TCA GTT TAT GCT CGT GTT AAA CCT 238 Leu Thr Asn Asn He Asp Lys Tyr Ser Val Tyr Ala Arg Val Lys Pro 65 70 75
GAA GAT AAG TTA AGA ATC GTT AAT GCT TGG CAA AAA AAA A 278 Glu Asp Lys Leu Arg He Val Asn Ala Trp Gin Lys Lys 80 85 90
(2) INFORMATION FOR SEQ ID NO:12:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 92 amino acids
(B) TYPE: amino acid (D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:
Met He Asp Pro Pro Arg Glu Glu Ala Lys Ala Ala He Ser He Cys 1 5 10 15
Arg Gin Ala Gly He Lys Pro Val Met He Thr Gly Asp Asn He Asn 20 25 30
Thr Ala He Ala He Ala Lys Ser Leu Asn He Tyr Asn Asp Gly Asp 35 40 45
Leu Ala He Ser Gly Leu Glu Leu Glu Lys He Ser Asp Asp Glu Leu 50 55 60
Thr Asn Asn He Asp Lys Tyr Ser Val Tyr Ala Arg Val Lys Pro Glu 65 70 75 80
Asp Lys Leu Arg He Val Asn Ala Trp Gin Lys Lys 85 90
(2) INFORMATION FOR SEQ ID NO:13:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 434 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: double
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA to mRNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(C) INDIVIDUAL ISOLATE: Astrovirus Serotype A2
(vii) IMMEDIATE SOURCE: (B) CLONE: A43351
(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 2..433
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:
A AAA CCA ATT CCT GCC CTG AGA ACA ACC AAG CCA AAA ACT TGC CCC 46 Lys Pro He Pro Ala Leu Arg Thr Thr Lys Pro Lys Thr Cys Pro 1 5 10 15
GAA CCA GAA GTC GAA TCA CAA CCA CTT GAT TTG TCC CAA AAG AAA GAG 94 Glu Pro Glu Val Glu Ser Gin Pro Leu Asp Leu Ser Gin Lys Lys Glu 20 25 30
AAA CAA TCA GAA TAT GAA CAA CAA GTG GTG AAG TCT ATC AAG CCT CAG 142 Lys Gin Ser Glu Tyr Glu Gin Gin Val Val Lys Ser He Lys Pro Gin 35 40 45
AAG AGT GAG CCC CAA CCA TAC TCA CAA ACT TAC GGC AAG GCA CCA ATC 190 Lys Ser Glu Pro Gin Pro Tyr Ser Gin Thr Tyr Gly Lys Ala Pro He 50 55 60 62
TGG GAA TCT TAC GAT TTT GAC TGG AAT GAG GAT GAT GCC AAG TTT ATT 238 Trp Glu Ser Tyr Asp Phe Asp Trp Asn Glu Asp Asp Ala Lys Phe He 65 70 75
CTG CCA GCG CCA TAC CGG TTG ACT AAG GCA GAT GAA ATA GTC CTT GGA 286 Leu Pro Ala Pro Tyr Arg Leu Thr Lys Ala Asp Glu He Val Leu Gly 80 85 90 95
TCT AAA ATC GTC AAG CTT AGA ACG ATT ATT GAA ACA GCC ATA AAG ACT 334 Ser Lys He Val Lys Leu Arg Thr He He Glu Thr Ala He Lys Thr 100 105 110
CAG AAT TAT AGT GCA TTA CCT GAA GCA GTA TTT GAG CTC GAC AAA GCA 382 Gin Asn Tyr Ser Ala Leu Pro Glu Ala Val Phe Glu Leu Asp Lys Ala 115 120 125
GCT TAT GAA GCA GGT TTG GAA GGT TTC CTC CAA AGG GTT AAA TCA AAA 430 Ala Tyr Glu Ala Gly Leu Glu Gly Phe Leu Gin Arg Val Lys Ser Lys 130 135 140
AAA A 434
Lys
(2) INFORMATION FOR SEQ ID NO:14:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 144 amino acids
(B) TYPE: amino acid (D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:
Lys Pro He Pro Ala Leu Arg Thr Thr Lys Pro Lys Thr Cys Pro Glu 1 5 10 15
Pro Glu Val Glu Ser Gin Pro Leu Asp Leu Ser Gin Lys Lys Glu Lys 20 25 30 63
Gin Ser Glu Tyr Glu Gin Gin Val Val Lys Ser He Lys Pro Gin Lys 35 40 45
Ser Glu Pro Gin Pro Tyr Ser Gin Thr Tyr Gly Lys Ala Pro He Trp 50 55 60
Glu Ser Tyr Asp Phe Asp Trp Asn Glu Asp Asp Ala Lys Phe He Leu 65 70 75 80
Pro Ala Pro Tyr Arg Leu Thr Lys Ala Asp Glu He Val Leu Gly Ser 85 90 95
Lys He Val Lys Leu Arg Thr He He Glu Thr Ala He Lys Thr Gin 100 105 110
Asn Tyr Ser Ala Leu Pro Glu Ala Val Phe Glu Leu Asp Lys Ala Ala 115 120 125
Tyr Glu Ala Gly Leu Glu Gly Phe Leu Gin Arg Val Lys Ser Lys Lys 130 135 140
(2) INFORMATION FOR SEQ ID NO:15:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 444 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: double
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA to mRNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(C) INDIVIDUAL ISOLATE: Astrovirus Serotype Al
(vii) IMMEDIATE SOURCE: (B) CLONE: A39 64
(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..444
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:
GAA TTC GCG GCC GCT CGG CCC ACA TCA GAT AGG AAC CAA ACT GTC TCA 48 Glu Phe Ala Ala Ala Arg Pro Thr Ser Asp Arg Asn Gin Thr Val Ser 1 5 10 15
CGA CGT TTT GAG CCC AGC TCG CGT ACC GCT TTA ATG GGC GAA CAG CCC 96 Arg Arg Phe Glu Pro Ser Ser Arg Thr Ala Leu Met Gly Glu Gin Pro 20 25 30
AAC CCT TGG AGC CGA CTC CAG CTC CAG GAT GCG ATG AGC CGA CAT CGA 144 Asn Pro Trp Ser Arg Leu Gin Leu Gin Asp Ala Met Ser Arg His Arg 35 40 45
GGT GCC AAA CCT TCC CGT CGA TGT GAT CTC TTG GGA AAG ATA AGC CTC 192 Gly Ala Lys Pro Ser Arg Arg Cys Asp Leu Leu Gly Lys He Ser Leu 50 55 60
GAG CGG CCG CGA ATT AAT TCG CGG CCG CTC GAA GTA CCT GTG ACA TTT 240 Glu Arg Pro Arg He Asn Ser Arg Pro Leu Glu Val Pro Val Thr Phe 65 70 75 80
GAA GGA AGT GCT GGA TCA CCA TTA ATA ATG AAT GTG TCA GAG GGG AGC 288 Glu Gly Ser Ala Gly Ser Pro Leu He Met Asn Val Ser Glu Gly Ser 85 90 95
CAT TTT GCA CGA ACA GTT CTT GCA CGC TCA ACA ACA CCA ACC ACT CTA 336 His Phe Ala Arg Thr Val Leu Ala Arg Ser Thr Thr Pro Thr Thr Leu 100 105 110
GCG CGT GCA GGA GAG AGA ACC ACC TCA GAC ACA GTA TGG CAG GTG CTC 384 Ala Arg Ala Gly Glu Arg Thr Thr Ser Asp Thr Val Trp Gin Val Leu 115 120 125 65
AAT ACA GCT GTA TCT GCT GCT GAG CTT GTC ACG CCT CCT CCG CCG AGC 43 Asn Thr Ala Val Ser Ala Ala Glu Leu Val Thr Pro Pro Pro Pro Ser 130 135 140
GGC CGC GAA TTC 44 Gly Arg Glu Phe 145
(2) INFORMATION FOR SEQ ID NO:16:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 148 amino acids
(B) TYPE: amino acid (D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:
Glu Phe Ala Ala Ala Arg Pro Thr Ser Asp Arg Asn Gin Thr Val Ser 1 5 10 15
Arg Arg Phe Glu Pro Ser Ser Arg Thr Ala Leu Met Gly Glu Gin Pro 20 25 30
Asn Pro Trp Ser Arg Leu Gin Leu Gin Asp Ala Met Ser Arg His Arg 35 40 45
Gly Ala Lys Pro Ser Arg Arg Cys Asp Leu Leu Gly Lys He Ser Leu 50 55 60
Glu Arg Pro Arg He Asn Ser Arg Pro Leu Glu Val Pro Val Thr Phe 65 70 75 80
Glu Gly Ser Ala Gly Ser Pro Leu He Met Asn Val Ser Glu Gly Ser 85 90 95
His Phe Ala Arg Thr Val Leu Ala Arg Ser Thr Thr Pro Thr Thr Leu 100 105 110 Ala Arg Ala Gly Glu Arg Thr Thr Ser Asp Thr Val Trp Gin Val Leu 115 120 125
Asn Thr Ala Val Ser Ala Ala Glu Leu Val Thr Pro Pro Pro Pro Ser 130 135 140
Gly Arg Glu Phe 145

Claims

67 IT IS CLAIMED:
1. A purified Astrovirus polynucleotide which contains a sequence selected from the group consisting of: SEQ ID NO:l, SEQ ID NO:3, SEQ ID NO:5, SEQ ID N0:7, SEQ ID NO:9, SEQ ID NO:11, and SEQ ID NO:13.
2. A reco binantly produced Astrovirus polynucleo¬ tide which encodes a polypeptide which is immunoreactive with sera from rabbits immunized with Astrovirus infectious inoculum.
3. The polynucleotide of claim 2, which encodes a polypeptide selected from the group consisting of: SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO: 12, and SEQ ID NO:14.
4. The polynucleotide of claim 2, which is a cDNA molecule.
5. The polynucleotide of claim 4, which has a nucleic acid sequence selected from the group consisting Of: SEQ ID NO:l, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, and SEQ ID NO:13.
6. A recombinant Astrovirus polypeptide which is immunoreactive with sera from rabbits immunized with Ast¬ rovirus infectious inoculum.
7. The polypeptide of claim 6, wherein the poly¬ peptide has substantially the same sequence as a polypep¬ tide selected from the group consisting of: SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO: 12, and SEQ ID NO:14. 68
8. The polypeptide of claim 6, which includes an immunoreactive portion of a Astrovirus polypeptide encoded by a sequence selected from the group consisting of: SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO: 12, and SEQ ID NO:14.
9. The polypeptide of claim 6, which includes the entire polypeptide sequence of a polypeptide selected from the group consisting of: SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO: 12, and SEQ ID NO:14.
10. The polypeptide of claim 6, which is a hybrid protein.
11. The polypeptide of claim 10, wherein the hybrid protein comprises the polypeptide sequence of /9-galac- tosidase and a polypeptide sequence selected from the group consisting of: SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO: 12, and SEQ ID NO:14.
12. The polypeptide of claim 10, which is produced by bacterial cells containing a vector selected from the group consisting of lambda-A2, lambda-All, lambda-A13 and lambda-A33.
13. A method for the detection of Astrovirus in human stool samples comprising, partial purification of polynucleotides present in the stool sample, hybridization of oligonucleotide probes specific for the Astrovirus polynucleotide, and 69 means for detecting the binding of the probes to polynucleotides present in the stool sample.
14. The method of claim 13, wherein the partial purification includes generation of cDNA molecules from RNA templates present in the sample and sequence indepen¬ dent amplification of the resulting cDNA molecules.
15. The method of claim 13, wherein the probes are derived from DNA sequences which encode the polypeptide whose sequence is selected from the group consisting of: SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO: 12, and SEQ ID NO:14.
16. The method of claim 13, wherein said means for detecting binding of the probes to sample polynucleotides includes the biotinylation of said probes.
17. The method of claim 13, wherein said means for detecting binding of the probes to sample polynucleotides includes radioactively labelling said probes.
18. Oligonucleotide probes specific for the Astrovirus polynucleotide.
19. The probes of claim 18, wherein the probes are derived from DNA sequences which encode the polypeptide whose sequence selected from the group consisting of: SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID N0:8, SEQ ID NO:10, SEQ ID NO: 12, and SEQ ID NO:14.
20. The probes of claim 18, wherein the probes are derived from the polynucleotide sequence which selected from the group consisting of: SEQ ID N0:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, and SEQ ID NO:13.
21. Oligonucleotide primers specific for the Ast- rovirus polynucleotide.
22. The primers of claim 21, wherein the oligo¬ nucleotide sequences are derived from DNA sequences which encode the polypeptide whose sequence is selected from the group consisting of: SEQ ID NO:2, SEQ ID NO:4, SEQ ID N0:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO: 12, and SEQ ID NO:14.
23. The primers of claim 22, wherein the oligo- nucleotide sequences are derived from DNA sequences complementary to said DNA sequence.
24. A diagnostic kit for use in screening human serum containing antibodies specific against Astrovirus infection comprising a recombinant Astrovirus polypeptide antigen which is immunoreactive with sera from rabbits immunized with Astrovirus infectious inoculum, and means for detecting the binding of said antibodies to the antigen.
25. The kit of claim 24, wherein the recombinant polypeptide antigen includes an immunoreactive portion of a Astrovirus polypeptide encoded by a sequence selected from the group consisting of: SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO: 12, and SEQ ID NO:14.
26. The kit of claim 24, wherein the recombinant polypeptide antigen includes the entire polypeptide sequence of a polypeptide selected from the group con¬ sisting Of: SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO: 12, and SEQ ID NO:14.
27. The kit of claim 24, wherein the recombinant polypeptide antigen includes polypeptides produced by bacterial cells transformed with a vector selected from the group consisting of: lambda-A2, lambda-All, la bda- A13 and lambda-A33.
28. The kit of claim 24, wherein said detecting means includes a solid support to which said polypeptide is attached and a reporter-labeled anti-human antibody, wherein binding of said serum antibodies to said antigen can be detected by binding of the reporter-labeled anti¬ body to said solid surface.
29. A method of detecting Astrovirus infection in an individual comprising reacting serum from a Astrovirus-infected test individual with a recombinant Astrovirus polypeptide antigen which is immunoreactive with sera from rabbits immunized with Astrovirus infectious inoculum, and examining the antigen for the presence of bound antibody.
30. The method of claim 29, wherein the recombinant polypeptide antigen includes an immunoreactive portion of a Astrovirus polypeptide encoded by a sequence selected from the group consisting of: SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO: 12, and SEQ ID NO:14.
31. The method of claim 29, wherein the recombinant polypeptide antigen includes the entire polypeptide 72 sequence of a polypeptide selected from the group con¬ sisting of: SEQ ID NO:2, SEQ ID NO: , SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO: 12, and SEQ ID NO:14.
32. The method of claim 29, wherein the recombinant polypeptide antigen includes polypeptides produced by bacterial cells transformed with a vector selected from the group consisting of: lambda-A2, lambda-All, la bda- A13 and lambda-A33.
10
33. The method of claim 29, wherein the polypeptide antigen is attached to a solid support, said reacting in¬ cludes reacting the polypeptide antigen with the support, and subsequently reacting the support with a reporter- 15 labeled anti-human antibody, and said examining includes detecting the presence of reporter-labeled antibody on the solid support.
34. A method of producing a polypeptide which is 20 immunoreactive with sera from rabbits immunized with Ast¬ rovirus infectious inoculum, comprising introducing into a suitable host cell, a recombinant expression system containing an open reading frame (ORF) having a polynucleotide sequence which encodes a 25 Astrovirus polypeptide which is immunoreactive with sera from rabbits immunized with Astrovirus infectious inoculum, where the vector is designed to express the ORF in said host, and culturing said host cell under conditions resulting 30 in the expression of the ORF sequence.
35. The method of claim 34, wherein said polypep¬ tide includes an immunoreactive portion of a Astrovirus polypeptide encoded by a sequence selected from the group 35 consisting of: SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO: 12, and SEQ ID NO:14.
36. The method of claim 34, wherein said polypep- tide includes the entire polypeptide sequence of a polypeptide selected from the group consisting of: SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO: 12, and SEQ ID NO:14.
37. The method of claim 34, wherein the expression vector is a lambda gtll phage vector and the host is Escherichia coli.
38. The method of claim 37, wherein the lambda gtll phage vector is selected from the group consisting of: lambda-A2, lambda-All, lambda-A13 and lambda-A33.
39. An expression system for expressing a recom¬ binant Astrovirus polypeptide antigen which is im- munoreactive with sera from rabbits immunized with Astrovirus infectious inoculum, comprising a host capable of supporting expression of an open reading frame in a selected expression vector, and the selected expression vector containing an open reading frame (ORF) having a polynucleotide sequence which encodes said polypeptide antigen.
40. The expression system of claim 39, wherein said recombinant polypeptide antigen includes an immunoreac- tive portion of a Astrovirus polypeptide selected from the group consisting of: SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO: 12, and SEQ ID NO:14. 74
41. The expression system of claim 39, wherein said recombinant polypeptide antigen includes the entire polypeptide sequence of a polypeptide selected from the group consisting of: SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO: 12, and SEQ ID NO:14.
42. The expression system of claim 39, wherein the selected expression vector is a lambda gtll phage vector and the host is Escherichia coli .
43. The expression system of claim 42, wherein the lambda gtll phage vector is selected from the group consisting of: lambda-A2, lambda-All, lambda-A13 and lambda-A33.
44. A vaccine for immunizing an individual against Astrovirus infection, comprising a recombinant Astrovirus polypeptide antigen which is immunoreactive with sera from rabbits immunized with Astrovirus infectious inoculum and which includes an immunoreactive portion of a sequence selected from the group consisting of: SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO: 12, and SEQ ID NO:14; in a pharmacologically acceptable adjuvant.
45. An antibody specific against a polypeptide having a sequence selected from the group consisting of: SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO: 12, and SEQ ID NO:14.
46. The antibody of claim 45, wherein the antibody is monoclonal. 75
47. The antibody of claim 45, wherein the antibody is polyclonal.
48. A method of producing passive immunity in an individual against Astrovirus, comprising administering the antibody of claim 45 parenterally to the individual.
49. An antibody against an Astrovirus-specific polypeptide which is produced by bacterial cells trans- formed with a vector which is selected from the group consisting of: lambda-A2, lambda-All, lambda-A13 and lambda-A33.
EP92913046A 1991-05-20 1992-05-20 THE ASTROVIRUS HUMAN GASTROENTERITIS AGENTS AND MOLECULAR CLONING OF CORRESPONDING cDNAs Withdrawn EP0585381A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US70273191A 1991-05-20 1991-05-20
US702731 1991-05-20

Publications (1)

Publication Number Publication Date
EP0585381A1 true EP0585381A1 (en) 1994-03-09

Family

ID=24822366

Family Applications (1)

Application Number Title Priority Date Filing Date
EP92913046A Withdrawn EP0585381A1 (en) 1991-05-20 1992-05-20 THE ASTROVIRUS HUMAN GASTROENTERITIS AGENTS AND MOLECULAR CLONING OF CORRESPONDING cDNAs

Country Status (4)

Country Link
EP (1) EP0585381A1 (en)
JP (1) JPH07504800A (en)
CA (1) CA2102292A1 (en)
WO (1) WO1992020803A1 (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6716964B1 (en) * 1997-12-12 2004-04-06 Saint Louis University CtIP, a novel protein that interacts with CtBP and uses therefor
US7381524B2 (en) * 2003-10-10 2008-06-03 Wisconsin Alumni Research Foundation Method to detect antibodies specific for type-2 turkey astrovirus

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO9220803A1 *

Also Published As

Publication number Publication date
WO1992020803A1 (en) 1992-11-26
JPH07504800A (en) 1995-06-01
CA2102292A1 (en) 1992-11-21

Similar Documents

Publication Publication Date Title
Matsui et al. The isolation and characterization of a Norwalk virus-specific cDNA.
KR100217483B1 (en) Hepatitis c virus epitopes
CA2032381C (en) Viral agent
IE83236B1 (en) Hepatitis C virus epitopes
US6572862B1 (en) Methods and reagents to detect and characterize Norwalk and related viruses
KR0178399B1 (en) Enterically transmitted non-a/non-b hepatitis viral agent and characteristic epitopes thereof
US6156883A (en) Polyclonal and monoclonal antibodies to Norwalk virus and methods for making them
CA1341464C (en) Hepatitis e, an enterically transmitted hepatitis viral agent
WO1988003032A1 (en) Diagnosis of and vaccine for japanese encephalitis virus and related viruses
WO1994005700A2 (en) Methods and reagents to detect and characterize norwalk and related viruses
Liu et al. Molecular characterisation of very virulent infectious bursal disease viruses in Taiwan
WO1995032290A2 (en) Non-a/non-b/non-c/non-d/non-e hepatitis agents and molecular cloning thereof
WO1992016543A1 (en) NORWALK VIRUS HUMAN GASTROENTERITIS AGENT AND MOLECULAR CLONING OF CORRESPONDING cDNAs
US5789559A (en) DNA sequences of enterically transmitted non-A/non-B hepatitis viral agent
WO1996040764A2 (en) Nucleotide and amino acid sequences of hypervariable region 1 of the envelope 2 gene of hepatitis c virus
EP0585381A1 (en) THE ASTROVIRUS HUMAN GASTROENTERITIS AGENTS AND MOLECULAR CLONING OF CORRESPONDING cDNAs
US5437974A (en) DNA sequence and encoded polypeptide useful in the diagnosis of hepatitis disease
US5824649A (en) DNA sequences of enterically transmitted non-A/non-B hepatitis viral agent and characteristic epitopes thereof
JPH0584085A (en) Dna fragment encoding non-a non-b type hepatitis specific antigen, its manifestation and method for detecting non-a non-b type hepatitis virus
WO1994003605A2 (en) Compositions and methods for detecting human herpesvirus 6 strain z29

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IT LI LU MC NL SE

17P Request for examination filed

Effective date: 19931216

RIN1 Information on inventor provided before grant (corrected)

Inventor name: REYES, GREGORY, R.

Inventor name: GREENBERG, HARRY, B.

Inventor name: MATSUI, SUZANNE, M.

Inventor name: KIM, JUNGSUH, P.

18W Application withdrawn

Withdrawal date: 19950221

D18W Application withdrawn (deleted)
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 19951201