RU2043412C1 - Polypeptide designed for antibody assay to human immunodeficiency virus of the second type, dna fragment he206 encoding polypeptide e206, recombinant plasmid dna phe206 encoding polypeptide e206, strain of bacterium escherichia coli - a producer of polypeptide e206 - Google Patents

Abstract

FIELD: biotechnology. SUBSTANCE: hybrid polypeptide E206 consisting of polypeptide a product of gene env HIV-2 and β-galactosidase of E. coli is constructed. Hybrid polypeptide is synthesized by bacterial strain Escherichia coli ВКПМ NB-5872. Strain is obtained after transformation of plasmid DNA pHE206 carrying fragment of gene env HIV-2. EFFECT: construction of hybrid polypeptide indicated above. 5 cl

Description

 The invention relates to biotechnology, genetic engineering and immunology and is a hybrid polypeptide consisting of a polypeptide, a product of the env gene of human immunodeficiency virus type 2 (HIV-2) and β-galactosidase E. coli, synthesized by a bacterial strain of E. coli, carrying a recombinant plasmid containing a cloned fragment of the HIV-2 env gene (env2) and binding to antibodies to the products of the env2 gene, which allows serodiagnosis of acquired immunodeficiency syndrome (AIDS).

 AIDS occurs as a result of infection with the human immunodeficiency virus (HIV). When it enters the body, HIV affects cells of the immune system (T-lymphocytes, monocytes and macrophages) and cells of the central nervous system. The disease is characterized by a long (from 2 to 10 years) asymptomatic period during which only antibodies to viral proteins are detected in the blood of the infected person, followed by progressive degradation of the immune and central nervous system. Therefore, for urgent anti-epidemic, preventive measures and timely initiation of treatment for HIV infection, it is extremely important to develop diagnostic drugs that can detect HIV infected people in the early stages of infection.

 Numerous studies of HIV have made it possible to determine its structure, genome organization, and elucidate the expression mechanism and functions of individual viral proteins. Currently, two types of human immunodeficiency virus (HIV-1 and HIV-2) are known, having a similar genome organization and differing in the antigenic structure of viral proteins.

 HIV has the most complex genome structure of all known retroviruses. In addition to the gag, pol, and env genes that direct the synthesis of basic virion proteins and common to all retroviruses, the HIV-1 genome contains six more genes: vif, tat, rev (or art, or trs), 3'-nef, vpr, and vpu. The HIV-2 genome, unlike HIV-1, does not contain the vpu gene, but contains the vpx gene.

 The HIV-2 env gene encodes two glycoproteins with a mol.m. 110 and 32 kD, gp110 and gp32, respectively. It is known that in almost 100% of people infected with HIV-2, antibodies to the gp32 glycoprotein can be detected. In addition, antibodies to the C-terminal portion of the gp110 glycoprotein are detected in a number of HIV-infected individuals.

 Most methods of diagnosing HIV infection are based on the determination of antibodies to HIV proteins in blood serum and other biological fluids (serodiagnosis). For these purposes, various approaches are used, which apply the principle of enzyme-linked immunosorbent assay (ELISA), agglutination reactions (latex, red blood cells), immunofluorescence, immunoblotting and radioimmunoprecipitation. One of the most promising ways to improve all of these diagnostic test systems is to use recombinant HIV proteins synthesized in various expression systems as an antibody-binding subject. The use of such recombinant proteins that preserve the antigenic determinants of HIV, instead of viral antigens, not only increases the specificity and sensitivity of test systems, but also makes them safe to use. There are a significant number of developments aimed at creating recombinant proteins of HIV gene products, in particular the env gene.

 Currently, a search is underway for the polypeptides most promising for the diagnosis, treatment and prevention of AIDS. Studies are conducted both in the direction of the selection of producer cells and in the direction of choosing the most antigenic determinants and the creation of recombinant polypeptides, HIV gene products.

 The essence of this technical solution lies in the fact that the proposed original hybrid E206 polypeptide, consisting of a polypeptide of a product of a fragment of the HIV-2 genome fused with β-galactosidase E. coli, binding antibodies to the product of the HIV-2 env gene; a DNA fragment encoding the E206 polypeptide and which is part of the recombinant plasmid pHE206; E. coli strain VKPM N B-5872 containing the recombinant plasmid pHE206 and expressing protein E206.

The producer strain is characterized by the following features: cells are straight, rod-shaped, motile with peritrichous flagella, gram-negative, non-spore. Cells grow on LB medium and other culture media used to cultivate Escherichia coli and simple culture media containing 10 μg / ml tetracycline and 50 μg / ml ampicillin. When grown on nutrient agar media at ³⁷ ° C colonies smooth cells, round, shiny, pale yellow, clear, smooth edge. When grown on the same medium, but at 30-32 ^{° C} the colonies of cells are "slimy" phenotype characteristic for colonies of cells with lon mutations, growing at lower temperatures. When growing on liquid media, cells form a uniform intense turbidity. Cells grow well at a temperature of 4-37 ^about With an optimum pH of 6.8-7.5. As a source of nitrogen, cells use both mineral salts in ammonium and nitrate forms, and organic substances in the form of peptone and amino acids. Nitrates are reduced to nitrites. Gelatin is not liquefied. Maltose is not fermented. Urease activity is not formed. Transformation of cells with plasmids with promoters of the bacteriophage λ is carried out according to standard methods. The resulting cell clones with plasmids were grown in LB medium at a temperature of 30-32 ° ^C. Preparative fermentation for production of recombinant protein is carried out at a temperature of 39-42 ^C. The productivity of the strain using plasmid expression vectors with promoters of bacteriophage λ is about 500 ug recombinant protein per 1 ml of cell suspension at a culture density of 5 x 10 ⁸ cells / ml. Protein is stable at ⁴ ° C for 3-4 months.

 Recombinant E206 polypeptide isolated and purified from the producer strain, immobilized on a solid carrier (polyvinyl chloride or polystyrene tablets, nitrocellulose, nylon, latexes, erythrocytes, etc.) binds antibodies to HIV-2 env gene products in blood serum and other biological . The strain is deposited in the collection of industrial microorganisms of the Research Institute of Genetics of Industrial Microorganisms in Moscow under N В-5872.

 PRI me R 1. Obtaining a DNA fragment HE206.

In an HIV-infected person, 10 ml of heparinized blood is taken from a vein, to which 30 ml of a lysis solution (155 mM NH ₄ Cl; 10 mM KHCO ₃ ; 0.1 mM EDTA) is added. The mixture was incubated for 15 minutes on ice. Centrifuged at 2000 G for 10 minutes at 4 ° ^C. The white cells were resuspended in 10 ml of SE (75 mM NaCl, 2 mM EDTA) was added proteinase K to a final concentration of 100 .mu.g / ml and 1 ml of 20% SDS. The mixture was incubated for 4 hours at ³⁷ ° C, add 1/2 volume (5ml) of water saturated phenol and the same amount of chloroform: isoamyl alcohol (24: 1). The resulting mixture was shaken on a rocking chair for 15 minutes and centrifuged at 2000 rpm for 10 minutes. 1/30 volume of NaOAc (pH 5.5) and an equal volume of isopropyl alcohol are added to the selected aqueous phase. DNA is precipitated by centrifugation and washed with 70% ethyl alcohol. The DNA pellet was dissolved in TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) to a final concentration of 1 μg / ml.

The Eppendorf tube of 0.5 mL of making the following components: deionized water 43.5 .mu.l, 10 .mu.l of reaction buffer 10 x (final concentration 25 mM Tris-HCl, pH 8.3 (at 25 ^C), 50 mM KCl, 2 mM MgCl ₂ , 1 mM β-mercaptoethanol, gelatin 200 μg / ml), dNTP mixture 16 μl (final concentration 200 μM), primer N1 5-CTGCACTAAAGGATCCGTCC-3 '10 μl (final concentration 1.0 μM), primer N2 5 '-CTGCAGGCTTCAGTAGTGT-3' 10 μl (final concentration 1.0 μM), DNA (amplification matrix) 10 μl (final concentration 1 ng), Taq polymerase 0.5 μl (2.5 units per sample).

 The contents of the tube are mixed in a vortex for 3-4 s and precipitated in a microcentrifuge for 5-10 s.

 50 μl of mineral oil is added to the test tube and placed in a DNA Thermal Cycler Perkin-Elmer Corporation DNA Amplification Apparatus.

The reaction mixture was incubated at 94 ^{° C} 7 minutes, and then subjected to the amplification cycle with the following parameters: 2 min at ³⁷ ° C (hybridization of primers), 5 min at 72 ^{° C} (completion primer) for 2 minutes at 94 ^{° C} (DNA denaturation ) The amplification cycle is repeated 25 times. After the final amplification cycle, the reaction mixture was incubated at 72 ^{° C} for 10 minutes.

 50 μl of chloroform are added to the tube, the material with chloroform is shaken for 5 seconds on a vortex, and then centrifuged in a microcentrifuge for 10 seconds. Select the aqueous (upper) phase (about 100 μl), which is formed in the form of a spherical drop, and transferred to a clean tube.

 10 μl of the aqueous phase is used to analyze amplification products in a 2% ethidium bromide agarose gel (430 bp fragment is visible).

 The nucleotide sequence of the HE206 DNA fragment was determined by the Sanger method.

ACGGATCCTTTAGTGCAGAGGTGGCAGAACTATACCGATTGGAATTGGGGGATTATAAAT
TAGTAGAAGTAACACCAATTGGCTTCGCACCTACAGCAGAAAAAAGATACTCCTCTGCTC
CAGGGAGACATAAGAGAGGTGTGCCTGTGCTAGGGTTCCTAGGTTTTCTCACGACAGCAG
GTGCTGCAATGGGCGCGGCGTCTCTGACGCTATCGGCTCAGTCTCGGACTTTATTGGCTG
GGATAGTGCAGCAACAGCAACAGCTGTTGGACGTGGTCAAGAGACAACAAGAAATGTTGC
GACTGACCGTCTGGGGAACTAAAAAACCTCCAGGCAAGAGTCACTGCTATCGAGAAGTACC
TAGCAGACCAGGCACGACTAAATTCATGGGGATGTGCGTTTAGACAAGTCTGCCACACTA
CTGAAGCCTGCAG
PRI me R 2. Obtaining plasmids pHE206.

Synthesized on for 14 hours at ³⁷ ° C. DNA template fragment DNA was hydrolyzed with the restriction enzymes PstI and BamHI in a buffer for restriction enzyme (10 mM Tris-HCl, 10 mM MgCl _2, 50 mM NaCl and 1 mM dithiothreitol pH 7.5) The enzymes are inactivated by heating at ⁷⁰ ° C for 15 min. DNA was precipitated with ethyl alcohol and dissolved in 50 μl of H ₂ O. 10 μl of the restriction enzyme-treated DNA fragment was placed in an Eppendorf tube containing 3 μl of ligase buffer (50 mM Tris-HCl, 10 mM MgCl ₂ , 20 mM dithiothreitol, 1.0 mM ATP , 50 μg / ml bovine serum albumin), 2 μl (0.2 μg / ml) DNA of the vector plasmid pEL5A treated with restriction enzymes PstI and BamHI, 4 μl H ₂ O. To the mixture add 1 μl (100 u) T4 DNA ligase and the mixture is incubated for 3 hours at 16 ^about C.

 The obtained ligase mixture transform cells of E. coli strain PLT90 by the usual method. Transformed cells are plated on plates with 1% LB agar containing 25 μg / ml ampicillin. The grown colonies are checked for the presence of recombinant plasmids. For this, bacterial cells lyse and secrete plasmid DNA. The isolated plasmid DNA is treated with restriction enzymes PstI and BamHI and the hydrolyzate is examined by electrophoresis in 1% agarose.

 The plasmid DNA hydrolyzate from the recombinant strain HE206 has 2 DNA bands of 6400 and 430 nucleotides on the electrophoregram, which corresponds to the size of the vector and the synthesized DNA fragment. When determining the nucleotide sequence of plasmid DNA, it was found that the DNA fragment synthesized by us in plasmid pHE206 through the BamHI site is attached to the C-terminal portion of E. coli β-galactosidase.

PRI me R 3. The strain E. coli HE206 containing the plasmid pHE206, grown in 100 ml of LB medium at 30 ^about With a density of 8 x 10 ⁸ cells / ml. Thereafter, the temperature was raised to 37 ^{° C} and cells were grown for an additional 2 hours. Cells were collected by centrifugation at 4000 rev / min for 15 min. Cells are lysed by ultrasound and proteins are isolated according to the described method.

The isolated proteins are analyzed in 10% PAG according to the standard Laemmli method. As markers of molecular masses of proteins, a Pharmacia kit containing molecular weight markers of 20-160 kD is used. As a control, a similarly obtained cell lysate of E. coli strain PLT90 containing the vector plasmid pEL5A and not containing the plasmid pHE206 obtained by us is used. A comparative analysis of the protein composition shows that the E. coli strain HE206 containing the plasmid pHE206 expresses a molar hybrid polypeptide. m. 130-135 kD. This polypeptide is named E206. Amino acid sequence of the hybrid polypeptide (β-galactosidase sequence not shown), determined on the basis of the nucleotide sequence of the cloned HIV-2 proviral DNA fragment, is presented below:
GSFAEVAELYRLELGDYKLVE VTPI
GFAPTAEKRYSSAPGRHKRGV PVLGF
LGFLTTAGAAMGAASLTLSAQ SRTLL
AGIVQQQQQLLDVVKRQQEML RLTVW
GTKNLQARVTAIEKYLADQAR LNSWG
CAFRQVCHTT
PRI me R 4. Control of antigenic activity.

Control of antigenic activity of drugs is carried out by immunoblotting. For this, the electrophoresis procedure is carried out (as described in Example 3), then the electrophoretically separated proteins are transferred to BH85 nitrocellulose membranes using a 24 V, 400 mA electroblotting apparatus for 1 h. Transfer quality is checked by staining the membranes with 0.2% solution Ponceau S in 3% TXY for 5 min at room temperature. The paint is washed twice for 30 minutes with TBS buffer (0.15 M NaCl, 20 mm Tris-HCl, pH 7.4) with 0.05% Tween-20 at room temperature. The next step is the blocking of nitrocellulose membranes with immobilized proteins with a solution of 5% skimmed milk powder prepared in 0.1 M Na-phosphate buffer, pH 7.4, for 30 min at room temperature. After blocking temperature for 1 hour at ³⁷ ° C was treated with serum containing antibodies to HIV-2 virus, diluted 1: 100. Then, TBS membranes were washed three times with 0.05% Tween-20 for 30 min at room temperature. Detection of specific antibodies is performed by incubation of the filter with the antispecies peroxidase conjugate at ³⁷ ° C for one hour. Next, repeat the procedure three times washing. The reaction is checked by adding 100 μl of 30% hydrogen peroxide and 50 ml of a solution of 4-chloro-1-naphthol (20 mg in 0.1 M Tris-HCl, pH 8.0). The analysis shows that the E206 polypeptide binds to antibodies to the human immunodeficiency virus of the second type.

 Thus, this invention allows the determination of antibodies to HIV-2 env gene products with high efficiency and specificity, and the determination process itself does not require work with highly infectious viral material.

Claims (4)

 1. The polypeptide E 206, designed to detect antibodies to the human immunodeficiency virus of the second type, obtained in the bacterial strain Escherichia coli VKPM NB-5872, transformed with recombinant plasmid pHE 206, encoding a polypeptide with the following amino acid sequence described in the description, fused to β-galatosidase E. coli and having the ability to bind to antibodies to the HIV-2 env gene product, with a mol.m. 130 135 kilodaltons when determined by polyacrylamide gel electrophoresis.  2. DNA fragment HE 206 encoding the E 206 polypeptide obtained by the polymerization chain reaction, with the nucleotide sequence described in the description, containing a stop codon at the 3 ′ end. 3. Recombinant plasmid DNA pHE 206 encoding the E 206 polypeptide, designed to detect antibodies to the human immunodeficiency virus of the second type, size 6830 BP containing Bam HI-PstI DNA fragment of the vector P EL 5A, including the gene of β-galactosidase E. coli, size 6400 bp Bam HI Pst I DNA fragment HE 206 encoding the polypeptide E 206, size 430 bp one site of restriction enzyme digestion with Bam HI, Sma I, SalGI, Pst I; lambda bacteriophage promoter croLac Z; genetic markers: Amp gene ² ampicillin resistance gene.  4. The bacterial strain Escherichia coli VKPM NB-5872 producer of the E 206 polypeptide, designed to determine antibodies to the human immunodeficiency virus of the second type.