RO121280B1 - Insectidicidal toxic proteins from photorhabdus - Google Patents

Abstract

The invention relates to a method for the control of an insect pest by feeding it with a recombinant protein obtained from the bacteria Photorhabdus with toxic activity, which encodes some amino acid sequences selected from SEQ ID No. 12 or SEQ ID No.47, said toxic protein being comprised in a transgenic plant cell and a transgenic plant accessible to the insect-pest, respectively.

Description

The present invention relates to a polynucleotide that is operatively associated with a heterologous promoter, to a transgenic plant cell comprising said polynucleotide, to a recombinant protein that has toxin activity against an insect pest, to a method of controlling an insect pest .

Many insects are largely considered harmful to homeowners, those who organize or participate in picnics, gardeners, farmers and others whose investments in agriculture are often destroyed or diminished as a result of the destruction by insects. of crops, especially in areas where the growing season is short, significant insect damage can mean losing all profits for growers and a dramatic drop in harvest.

lowering the supply of particular agricultural products invariably results in higher costs for food processors and then, finally, for consumers of food plants and products derived from these plants.

Preventing the destruction of crop plants and flowers and eliminating the nuisance of harmful insects were usually based on strong organic pesticides and insecticides, with wide toxicities. These synthetic products have become the target of general population attack, as being too annoying to the environment and to those exposed to such agents. Similarly, in non-agricultural settlements, homeowners would be happy to avoid insects in their homes when eating out, without having to kill insects.

The widespread use of chemical insecticides has given rise to environmental health concerns for farmers, insecticide-producing companies, government agencies, public interest groups and the general public. The development of less intrusive pesticide management strategies has been driven both by society's concern for the environment and by the development of biological instruments that exploit the mechanisms of insect management. Biological control agents are an alternative promise for chemical insecticides. At each level of evolutionary development, organisms are provided with the means to increase their success and survival. The use of biological molecules, as tools for defense and aggression, is known in the animal and plant kingdoms. Additionally, the relatively new tools of genetic engineering allow modifications of biological insecticides to make particular solutions for particular problems.

One such agent, Bacillus thuringiensis (Bt), is an effective insecticidal agent and is used commercially as such. In fact, the insecticidal agent of the Bt bacterium is a protein that, with limited toxicity, can be used on food crops on the day of harvest. For non-target organisms, Bt toxin is a non-toxic digestible protein.

Another known class of insect biological control agents are certain types of nematodes known as transmission vectors for bacterial symbionts that kill insects. Nematodes containing insecticidal bacteria invade insect larvae. Then the bacteria kill the larvae. Nematodes reproduce in the larval corpse. The nematode's descendants then eat the body inside. The offspring of the nematode, containing bacteria thus produced, can then invade additional larvae.

In the past, they have been used as agents for the control of nematode insects, insecticides of the genera Steinernema and Heterorhabdis. Apparently, every kind of nematode harbors a particular species of bacterium. In nematodes of the genus Heterorhabditis, the symbiotic bacterium is Photorhabdus luminescens.

Although these nematodes are effective insect control agents, it is currently difficult, expensive and inefficient to produce, maintain and distribute nematodes for insect control.

RO 121280 Β1

It is known in the art that an insecticidal toxin can be isolated from Photorhabdus 1 luminescens, which is active only when injected into the larvae of Lepidoptera and Coleoptera insects (Bowen, DJ et al., Extracellular insecticidal factor produced by 3 Xenorhabdus luminiscens, abstract from 89 ^{, h} Annual meeting of the American Society for Microbiology (ASM) 1989, Ensign, JC et al., Crystalline inclusion proteins as an 5 insecticidal toxin of Xenorhabdus luminiscens NC-19, abstract from V ¹ International Colloquium on Intervertebrate Pathology and Microbial Control (ICIPMC ), August 1990). 7

This makes impossible the effective exploitation of the insecticidal properties of the nematodes or their bacterial symbiont. It would be useful, more practical and less labor-consuming to have a method of release over an extended area of an insecticidal toxin that would retain its insecticidal properties upon release. It would be clearly desirable to discover toxins with oral activity 11 produced by the Photorhabdus genus. Isolation and use of these toxins are desired because of their efficacy. Until the discoveries of the applicants, these toxins have not been isolated or characterized.

Native toxins are complex proteins that are produced and secreted by the growing bacterial cells of the genus Photorhabdus. Of interest are the proteins produced by the species Photorhabdus luminescens. Protein complexes, with a molecular size of about 17,000 kDa, can be separated by SDS-PAGE gel analysis into numerous protein components. The toxins do not contain hemolysin, lipase, phospholipase type C or nuclease activities. 19 Toxins exhibit significant toxicity upon exposure to numerous insects. 21

The technical problem solved by the invention is to find a polynucleotide that contains the genetic information necessary for the synthesis of a protein with a toxic effect on some 23 insects, which can be easily administered, which will retain its insecticidal properties after release, and especially toxins with activity. oral, produced by the Photorhabdus genus: 25

- stabilizing modifications of the gene encoding the toxin or of the protein encoded by the gene; 27

- of toxins that initially inhibit the feeding of the larvae, maintain the activity of inhibiting the feeding, while eliminating the activity of absolute toxicity on the larva, change 29 that could allow the transformed plant to survive until harvesting, as well as

- targeting the toxin to certain parts of the insect larva, in order to improve its efficiency 31.

In a first aspect, the invention relates to a polynucleotide that is operably associated with a heterologous promoter, wherein said polynucleotide encodes a protein that has toxin activity against an insect pest, wherein said protein comprises the amino acid sequence 35 chosen from SEQ ID NO: 12 or SEQ ID NO: 47.

In a second aspect, the invention relates to a transgenic plant cell comprising said polynucleotide and expressing said polynucleotide.

In a third aspect, the invention relates to a recombinant protein having toxin activity against an insect pest, wherein said protein comprises the amino acid sequence chosen from SEQ ID NO: 12, SEQ ID NO: 47. In a fourth aspect, the invention relates to a method for controlling an insect pest, wherein the method comprises feeding on a protein comprising the amino acid sequence chosen from SEQ ID NO: 12, SEQ ID NO: 47 , said protein being produced by and being present in a transgenic plant, which is accessible to said pest. 45

The insect pest control method comprises feeding said pest with a protein from Photorhabdus, wherein said protein has oral (47-way) toxin activity and wherein said protein is produced by and is present in a transgenic plant that is accessible to the pest. mentioned. 49

RO 121280 Β1

The present invention is directed to the establishment of a unique class of insecticidal protein toxins of the genus Photorhabdus that have oral insect toxicity. A unique feature of Photorhabdus is its bioluminescence. Photorhabdus can be isolated from a variety of sources. Such a source is represented by nematodes, more precisely nematodes of the genus Heterohabditis. Another such source is represented by clinical samples from human wounds, see Farmer and collaborators, 1989, J. Clin. Microbiol, pp. 1594-1600. These saprophytic strains are stored at the American Collection of Cultures (Rockville, MD) ATCC #s 43948, 43949, 43950, 43951 and 43952 and are incorporated herein by reference. Other sources may be able to harbor Photorhabdus bacteria that produce insecticidal toxins. Such sources from the environment could be from both terrestrial and aquatic environments.

The genus Photorhabdus is taxonomically defined as a member of the family Enterobacteriaceae, although it has some atypical features of this family. For example, strains of this genus are not nitrogen-reducing, produce yellow and red pigment and are bioluminescent. The latter trait is unknown in Enterobacteriaceae, only recently has Photorhabdus been described as a genus separate from Xenorhabdus (Boemare et al., 1993, Int. J. Syst. Bacteriol. 43.249-255). This differentiation is based on DNA-DNA hybridization studies, phenotypic differences (eg, the presence (Photorhabdus) or absence (Xenorhabdus) of catalase and bioluminescence) and the host nematode family (Xenorhabdus: Steinemematide, Photorhabdus; Heter). Comparatively, cellular fatty acid assays (Janse et al., 1990, Appl. Microbiol Lett. 10.131-135; Suzuki et al., 1990, J. Gen. Appl. Microbiol., 36. 393-401) underlie the separation of Photorhabdus from Xenorhabdus.

In order to determine whether the strain collection disclosed herein contained Photorhabdus strains, the strains were characterized based on the traits that define Photorhabdus and differentiate it from other Enterobacteriaceae and Xenorhabdus species. (Farmer. 1984 Bergey's Manual of Systemic Bacteriology, Vol. 1, pp. 510-511: Akhurst and Boemare, 1988, J. Gen. Microbiol. 134, pp. 1835-1845; Boemare et al., 1993, Int. J. Bacteriol Syst. 43, pp. 249-255, which are incorporated herein by reference). The features studied were the following: gram negative colored branches, body size, colony pigmentation, inclusion bodies, presence of catalase, ability to reduce nitrogen, bioluminescence, dye absorption, gelatin hydrolysis, growth on selective media, growth temperature, survival. anaerobic conditions and mobility. Fatty acid analysis was used to confirm that all strains here belong to a single genus Photorhabdus.

Currently, the bacterial genus Photorhabdus comprises a single defined species, Photorhabdus luminescens (ATCC strain # 29999, Poinar et al., 1977, Nematology 23, 97-102). In the literature, a variety of related strains have been described (e.g., Akhurst et al., 1988, J. Gen. Microbiol., 134,1835-1845; Boemare et al., 1993, Int. J. Syst. Bacteriol. 43, pp. 249-255; Putz et al., 1990, Appl. appr. Microbiol., 56,181-186). Numerous Photorhabdus strains have been characterized here. Such strains are listed in Table 18 of the examples. Because only one species (luminescens) defined in the genus Photorhabdus exists, the features of the luminescens species have been used here to characterize the strains. As can be seen from FIG. 5, these strains are clearly diverse. It is not anticipated that in the future, there will be other Photorhabdus species that have some of the attributes of the luminescens species, as well as some different characteristics that, at present, have not been defined as a feature of Photorabdus luminescens. However, the present invention relates to any species or Photorhabdus strains that produce proteins with the functional activity of insect control agents, without taking into account other features and characteristics.

RO 121280 Β1

Furthermore, as demonstrated here, Photorhabdus bacteria produce proteins that have functional activity, as defined here. Of particular interest are the proteins produced by the species Photorhabdus luminescens. The inventions herein will in no way be limited to the strains described herein. These strains illustrate, for the first time, that proteins produced by various isolated species of Photorabdus are toxic to 5 insects upon exposure to them. Thus, the inventions described here include the strains specified herein and all their mutants, as well as any strains or species of the genus 7 Photorhabdus that have the functional activity described herein.

There are some terms used that have a particular significance, as we will see 9 in the following.

Functional activity means that the function of protein toxins, as insect control agents, is that the proteins are orally active or have a toxic effect, or are capable of destroying or damaging the food, which may or may not cause death. insect. When an insect comes in contact with an effective amount of toxin released through expression by a plant, with a protein-formulated composition (s), protein-sprayed composition (s), a bait matrix or other delivery system, the consequences usually consists in the death of the insect or insects do not feed on the source that makes the toxins accessible to insects. The protein toxins discussed here are typically referred to as insecticides. By insecticides it is meant that the protein toxins have a functional activity as further defined here 19 and are used as insect control agents.

By using the term oligonucleotides, we mean here a macromolecule 21 which consists of a short chain of nucleotides either of DNA or of RNA. Such length could be at least one nucleotide, but is usually in the range of about 10 to about 12 23 nucleotides. Determining the length of the oligonucleotide falls to a worker and there will be no limitation here. Therefore, the oligonucleotides may be smaller than 10 or greater than 12. 25

By the use of the term toxicity or toxicity, as used herein, it is understood that the toxins produced by Photorhabdus have functional activity, as defined here 27. By using the term genetic material, we refer to all genes, nucleic acid, DNA and RNA. 29

The fermentation broths from the strains selected here, reported in Table 18, were used to determine the following: the size of the insecticidal toxin production by the Photorhabdus genus 31, the insecticidal spectrum of these toxins, and to provide the material source for the purification of the toxin complexes. The strains characterized here have been shown to have oral toxicity against a diversity of order of insects. Such orders of insects include, but are not limited to Coleoptera, Homoptera, Lepidoptera, Diptera, Acarina, Hymenoptera and 35 Dictyoptera.

As with other bacterial toxins, the mutation rate of bacteria in a population produces 37 numerous related toxins, slightly different in sequence to exist. The toxins of interest here are those that produce protein complexes that are toxic to a variety of insects upon exposure, as described here. Preferably, the toxins are active against Lepidoptera, Coleoptera, Homoptera, Diptera, Hymenoptera, Dictyoptera and Acarina. In the art, it is sought to refer to protein toxins homologous to the protein toxins produced by the strains herein and any derivatives of these strains, as well as protein toxins produced by 43 Photorhabdus. These homologous proteins may differ in sequence, but do not differ according to those toxins described herein. Homologous toxins are understood to include 45 protein complexes between 300 kDa to 2,000 kDa and comprise at least 2 subunits, where one subunit is a peptide that may or may not be the same as the other subunit. 47 different protein subunits were identified and considered in the examples here. Typically, protein subunits range from about 18 kDa to about 230 kDa; between about 160 kDa to about 230 kDa, 49

100 kDa to 160 kDa; about 80 kDa to about 100 kDa and about 50 kDa to about 80 kDa.

RO 121280 Β1

By the term Photorhabdus toxin is meant any protein produced by a strain of the Photorhabdus microorganism that has functional activity against insects, where the Photorhabdus toxin could be formulated as a spray composition, expressed by a transgenic plant, formulated as a matrix bait, and released. by means of a Baculovirus or released by any other applicable host or delivery system.

As discussed above, some Photorhabdus strains can be isolated from nematodes. Some nematodes, elongated cylindrical worms, parasites of the Nematoda stream, have developed an ability to exploit insect larvae, as a favorable growth environment. Insect larvae provide a food source for nematode growth and a breeding environment. A dramatic effect following the invasion of larvae by certain nematodes is larval death. Larval death results from the presence, in certain nematodes, of bacteria that produce an insecticidal toxin that stops larval growth and inhibits feeding activity. Interestingly, each genus of nematode, which parasites an insect, hosts a particular species of bacterium, uniquely adapted for symbiotic growth with that nematode. Provisionally, since this research began, the name of the bacterial genus Xenorabdus has been reclassified into Xenorhabdus and Photorhabdus. The bacteria of the genus Photorhabdus are characterized as symbionts of the nematodes Heterorhabdtus, while the Xenorhabdus species are symbionts of the Steinemema species. This change in nomenclature is reflected in this description, but in no way will a change in nomenclature change the scope of the inventions described herein.

The peptides and genes described herein are named according to the guidelines published recently in the Journal of Bacteriology Instructions to Authors, pp. L-xii (Jan. 1996), which is incorporated herein by reference. The following peptides and genes were isolated from Photorhabdus strain W-14.

Peptide / gene nomenclature Complex toxin (Tc)

Peptide name Gene name Sequence ID ^# patent genomic region tea Tea A tcaA 12 TcaA _iH tcaA 4 TcaBj tcaB 3 (19, 20) TcaBi · tcaB 5 TCACI TCACI 2 genomic region tcb TcbA tcbA 16 TcbAj tcbA (Pro-peptide) TcbAjj tcbA 1 (21,22,23, 24) TcbA _Bj tcbA 40

RO 121280 Β1

Table (continued) 1

Peptide name Gene name Sequence ID ^# patent genomic region tcc Tcc A TCCA 8 TCCB TCCB 7 genomic region tcd TcdAi tcdA (Pro-peptide) TcdA ,, tcdA 13, (38, 39, 17, 18) TcdAjjj tcdA 41, (42, 43) TcdB tcdB 14

(The sequence in parentheses shows the internal amino acid sequence, obtained by tryptic digests).

(The sequence in parentheses shows the internal amino acid sequence, obtained by tryptic digests).

The sequences listed above are grouped by genomic region. The tcbAs gene was expressed in E. coli as two TcbAs and TcbA ^ protein fragments, as illustrated in the examples. 15 It may be beneficial to have a proteolytic shortening of some sequences, in order to obtain higher activity of toxins for commercial transgenic applications. 17

The toxins described here are clearly unique, in that the toxins have functional activity which is the key to developing an insect control strategy. In developing 19 a strategy for combating insects it is possible to delay or bypass the process of protein degradation by injecting a protein directly into an organism, avoiding its digestive tract. In such cases, the protein administered to the body will retain its function, until it is distorted, non-specifically degraded or eliminated by the immune system 23 from the higher organisms.

The insect injection of an insecticidal toxin has potential application only in the laboratory and only on large insects that are easily injected. The observation that the insecticidal protein toxins described herein exhibit toxic activity, after oral ingestion or contact with the toxins, 27 allows the development of an insect control plan, based solely on the ability to incorporate the protein toxins into the insect's food. Such a plan could result in the production of 29 baits for insects.

Photorahbdus toxins can be administered to insects in a purified form. Likewise, the toxins can be released in amounts from about 1 to about 100 mg / l of the medium. This may vary depending on the formulation condition, inoculum source conditions, toxin isolation techniques and others. Toxins can be administered as an exudate secretion or cellular protein, initially expressed in a prokaryotic or eukaryotic heterologous host. Typically, bacteria are the host where proteins are expressed. Eukaryotic hosts may include, but are not limited to plants, insects, and yeast. Alternatively, toxins can be produced in bacteria or transgenic plants, in the field or in the insect, by a baculovirus vector. Typically, toxins will be introduced into the insect by incorporating one or more toxins into the insect's food. 39

Complete lethality when feeding on insects is useful, but not necessary to achieve useful toxicity. If insects avoid toxin or stop feeding, this avoidance 41 will be useful in some applications, even if the effects are sublethal. For example, if transgenic, insect-resistant crop plants are desired, a nuisance of insects to feed 43 on plants is as useful as lethal toxicity, because the ultimate goal is rather to protect the plants, and not to kill the insect. 45

RO 121280 Β1

There are many other ways in which toxins can be incorporated into the food of an insect. As an example, it is possible to mix the feed source of the larva with the toxic protein, by spraying the feed with a protein solution, as described here. Alternatively, the purified protein could be processed by genetic engineering into a less harmful bacterium, which could then be grown in culture and applied either to the food source or left to stand in the soil, in an area within which was desired to eradicate the insect. Also, the protein could be processed by genetic engineering into an insect feed source. For example, the main food source for many insect larvae is plant material.

By incorporating the genetic material that encodes the insecticidal properties of Photorhabdus toxins into the genome of a plant consumed by the particular harmful insect, the adult or larva will die after consuming the plant food. Many members of the monocotyledonous and dicotyledonous genera have been transformed. Transgenic agricultural plants, as well as fruits and vegetables are of commercial interest. Such cultivated plants include but are not limited to corn, rice, soybean, rapeseed, sunflower, alfalfa, sorghum, wheat, cotton, peanuts, tomatoes, potatoes and others. There are several techniques for introducing foreign genetic material into plant cells and for obtaining plants that maintain and express the introduced gene. Such techniques include accelerating the genetic material coated in microparticles directly into cells (US Patent 4,954,050 for Cornels and 5 141 131 for DowElanco). Plants can be transformed using Agrobacterium technology, see US Patent 5,177,010 for the University of Toledo, 5 104 310 for Texas A&M, European Patent Application 0131624B1, European Patent Application 120516,159418B1 and 176 112 for Schilperoot, US Patent 5,149,645 , 5 469 976, 5 464 763 and 4 940 838 and 4 693 976 for Scilperoot, European patent applications 116718, 290799, 320500 all for MaxPlanck, European patent applications 604662 and 627752 for Japan Tobacco, European patent applications 0267159 and 0292435 and US patent for Ciba Geigy, US patents 5 463 174 and 4 762 785, both for Calgene, and US patents 5 004 863 and 5 159 135 both for Agracetus. Another transformation includes point-to-point contact technology, see US Patents 5,302,523 and 5,464,765 for both Zeneca. Electroporation technology was also used for plant transformation, see WO 87/06614 for Boyce Thomson Institute, 5 472 869 and 5 384 253 both for Dekalb, WO 92/09696 and WO 93/21335 both for PGS. All of these patents and publications on transformation are incorporated herein by reference. Additionally, in the many technologies for plant transformation, the type of tissue that contacts foreign genes can vary just as well. Such tissue will include, but will not be limited to, embryogenic tissue, type I and II calus tissue, hypocotyl, meristem and others. Almost all plant tissues can be transformed during differentiation, using appropriate techniques included in preparing the worker in the field.

Another variable is the choice of a markerselectable. The preference for a particular marker is at the discretion of the specialist, but any of the following selectable markers may be used in conjunction with any other gene not mentioned here, which may function as a selectable marker. Such selectable markers include but are not limited to the aminoglycoside phosphotransferase gene of the Tn5 (Aph II) transposon, which encodes antibiotic resistance kanamycin, neomycin and G418, as well as those genes encoding for resistance or tolerance to glyphosate, hygromycin, methotrex (bialophos), imidazolinones, sulfonylureas and triazolopyrimidine herbicides such as chlorosulfuron, bromoxynil, dalapon and others.

In addition to a selectable marker, it may be desirable to use a reporter gene. In some cases, a reporter gene can be used without a selectable marker. Reporter genes are genes that are usually not present or expressed in the recipient body or tissue. into the

Typically, the reporter gene encodes a protein that provides phenotypic change 1 or enzymatic property. Examples of such genes are given in K. Weising et al., Ann. Rev. Genetics. 22, 421 (1988), which is incorporated herein by reference. A preferred reporter gene 3 is the glucuronidase (GUS) gene. Regardless of the transformation technique, the gene is preferably incorporated into a gene transfer vector, adapted to express 5 Photorhabdus toxins in the plant cell by including in the vector a plant promoter. In addition to plant promoters, promoters 7 from a variety of sources for the expression of foreign genes can be efficiently used in plant cells. For example, promoters of bacterial origin, such as promoter octopin synthase, nopalin 9 synthase promoter, mannopin synthase promoter, viral origin promoters, such as the cauliflower mosaic virus (35S and 19S) and others may be used. Plant promoters include, but are not limited to 11 ribulose-1,6-bisphosphate (RUBP) carboxylase small subunit (ssu), beta-conglicinin promoter, fazeolin promoter, ADH promoter, heat shock promoters, and tissue-specific promoters. Also, promoters may contain enhancer sequence elements that may enhance transcription efficiency. Typical intensifiers include but are not limited to 15 Adh-intron 1 and Adh-intron 6. Constitutive promoters may also be used. Constitutive promoters continuously direct gene expression in all cell types and at all times (eg, 17 actin, ubiquitin, CaMV 35S). Tissue-specific promoters are responsible for gene expression in specific cell or tissue types, such as leaf or seed (eg, wedges, 19 oleosin, napine, ACP), and these promoters can also be used. Also, promoters may be active during a certain stage of plant development, as well as active 21 in plant tissues and organs. Examples of such promoters include but are not limited to pollen specific, embryo specific, maize silk specific, bumblebee fiber specific, root specific, seed endosperm specific promoters and others.

In some circumstances, it may be desirable to use an inductive promoter. An inductive promoter is responsible for the expression of genes in response to a specific signal, such as: physical stimulus (heat shock genes), light (RUBP carboxylase), hormone (Em), metabolites 27 and stress. Other desired transcription and translation elements that work in plants can be used. Numerous plant-specific gene transfer vectors are known in the art. In addition, it is known that in order to obtain the high expression of bacterial genes in plants it is preferable to engineer the bacterial genes, so that they are more efficiently expressed in the cytoplasm of plants. Maize is such a plant that it is preferred that the bacterial gene (s) be restored by engineering, before transformation to increase the level of toxin expression in the plant. One reason for engineering recovery is the very low G + C content of the native bacterial gene (s) (and consequently the correction to the high A + T content). This results in the generation of sequences that mimic or duplicate the control sequences of the plant gene, which are known to be strongly A + T rich. The presence of 37 rich A + T sequences in the DNA of the gene (s) introduced into plants (eg, TATA box regions normally found in gene promoters) may result in aberrant transcription of 39 gene (s). On the other hand, the presence of other regulatory sequences belonging to the transcribed mRNA (for example, polyadenylation signal sequences (AAUAAA), or complementary sequences to small nuclear RNAs involved in pre-mRNA sphicing) can lead to RNA instability acquis. Therefore, one purpose in modeling the bacterial gene (s) by engineering, more preferably known as optimized plant gene (s), is to generate a DNA sequence that has a higher G + C content and preferably one close to that of the genes of the plant which codes for metabolic enzymes. Another purpose in modeling the plant-optimized gene (s) is to generate a DNA sequence that not only has a higher G + C content, but changes the sequence-modifying strands so that they do not impede translation.

RO 121280 Β1

An example of a plant with a high G + C content is maize. The table below illustrates how high the G + C content is in corn. Like corn, it is believed that G + C content is also high in other plants.

Table 1

Composition of the G + C contents of the corn gene regions encoding protein

Protein class ³ G + C% domain Average G + C% ^b Metabolic enzymes (40) 44.4 - 75.3 59.8 (8.0) Storage proteins Group I (23) 46.0 to 51.9 48.1 (1.3) Group II (13) 60.4 to 74.3 67.5 (3.2) Group I + II (36) 46.0 to 74.3 55.1 (9.6) ^c Structural proteins (18) 48.6 to 70.5 63.6 (6.7) Regulatory proteins (5) 57.2 to 68.9 62.0 (4.9) Uncharacterized proteins (9) 41.5 to 70.3 64.3 (7.2) All proteins (108) 44.4 to 75.3 60.8 (5.2)

The number of genes in the class is given in parentheses.

Standard deviations are given in parentheses.

Average combined groups, ignored in the calculation of the total average.

For the data in Table 1, the coding regions of the genes were extracted from the GenBank irritations (Release 71), and the base compositions were calculated using the MacVector ^1M program (IBI. New Haven, CT). The intron sequences were ignored in the calculations. Group I and II of the storage protein gene sequences were noted for their marked difference in the base composition.

Due to the plasticity allowed by the genetic code redundancy (that is, some amino acids are specified by more than one codon), the evolution of the genomes of different organisms or classes of organisms has resulted in the differential use of redundant codons. This bias codon is reflected in the average of the basic composition of the regions encoding the protein. For example, organisms with relatively low G + C contents use codons that have A or T in the third position of redundant codons, while those that have G + C contents use codons that have G or C in the third position. It is considered that the presence of minor codons in a mRNA gene may reduce the absolute rate of translation of that mRNA, especially when the relative abundance of the loaded tRNA corresponding to the minor codon is low. An extension of this is that lowering the translation rate by individual minor codons will be at least cumulative for multiple minor codons. As a result, mRNAs that have relatively high contents of minor codons will have correspondingly low translational rates. This rate will be reflected by the synthesis of the low levels of the encoded protein.

For the purpose of engineering the bacterial gene (s), the bias codon of the plant is determined. The codon bias is the statistical distribution of the codon that the plant uses to encode its proteins. After determining the bias, the percentage of codon frequency in the gene (s) of interest is determined. The primary preferred codons of the plant, as well as the second and third preferred codons, will be determined. The amino acid sequence of the protein of interest is reversed so that the resulting nucleic acid sequence encodes for

RO 121280 Β1 the same protein as the native bacterial gene, but the resulting nucleic acid sequence corresponds to the first preferred codons of the desired plant. The new sequence is analyzed for restriction enzyme sites, which could be created by modification. The identified sites are further modified by replacing the codons with the second or third preferred codon option. Other sites in the sequence, which could affect the transcription or translation of the gene of interest, 5 are exon junctions: 5 'or 3' intron, additional polyA signals or RNA polymerase termination signals. Next, the sequence is analyzed and modified to reduce the frequency of the TA or GC doubles. In addition to dubbing, the G or C sequence blocks what has more than about 4 residues, which are the same ones that can affect the transcription of the sequence. 9 Therefore, these locks are also modified by replacing the first or second option codons, etc. with the preferred codon of choice below. It is preferable that 11 plant-optimized gene (s) contain about 63% of the codons of the first option, between about 22% to about 37% codons of the second option and between 15% and 0% codons of the third option. one, in which the total percentage is 100%. Most preferably, the plant-optimized gene (s) contains about 63% codons of the first option, at least about 22% codons of the second option, about 15 7.5% codons of the third option and about 7.5% codons of the the fourth option, where the total percentage is 100%. The method described above allows the person skilled in the art to modify 17 gene (s) that are foreign to a particular plant, so that the genes are optimally expressed in plants. The method is further explained in the US request pending resolution, 19 60/005 405, filed on October 13, 1995, which is incorporated herein by reference.

Thus, for the purpose of modeling the plant-optimized gene (s), the amino acid sequence of the 21 toxins is reverse translated into a DNA sequence, using a non-redundant genetic code established from a bias codon table prepared for the DNA sequence for the particular plant 23 to be transformed. The resulting DNA sequence, which is completely homogeneous in the use of the codon, is further modified to establish a DNA sequence which, in addition to a higher degree of diversity, also contains restriction enzyme recognition sites, strategically placed, composition. desired base and an absence of sequences that may interfere with gene transcription or translation of the mRNA product.

Theoretically, it is considered that bacterial genes can be expressed more easily in plants if 29 bacterial genes are expressed in plastids. Thus, it may be possible to express bacterial genes in plants, without optimizing the genes for plant expression and obtaining high protein expression. See, US Patents 4,762,785, 5,451,513 and 5,545,817, which are incorporated herein by reference. 33

One of the opinions taken into consideration regarding the commercial exploitation of transgenic plants is the conduct of resistance. This is a particular concern with Bacillus thunngiensis toxins. There are numerous companies that commercially exploit Bacillus thunngiensis and there is concern about whether Bt toxins become resistant. A strategy for managing insect resistance would be to combine Photorhabdus toxins with toxins such as Bt, vegetative insect proteins (Ciba Geigy) or 39 other toxins. The combinations could be formulated for spray application or they could be molecular combinations. The plants could be transformed with Photorhabdus genes, which produce 41 insect toxins and other insect toxin genes like Bt with other insect toxin genes, such as Bt. 43

European patent application 0400246A1 describes the conversion of 2 Bt into a plant, which could be any 2 genes. Another way to produce a transgenic plant, which contains more than 45 insect resistance genes, would be to produce 2 plants, each containing an insect resistance gene. These plants could be crossed using traditional selection techniques, 47 to produce a plant that contains more than one insect resistance gene. 49

RO 121280 Β1

In addition to producing a transformed plant that contains plant-optimized gene (s), there are other delivery systems where it can be reconstructed by engineering, bacterial gene (s). Following the same lines, genetic protein can be easily isolated by genetic engineering, fused together to both an insect attracting molecule and a food source, and the insecticidal activity of the toxin can be engineered and expressed in bacteria or eukaryotic cells, using well-known standard techniques. After purification in the laboratory, such a toxic agent with built-in bait could be packaged inside a standard housing insect trap.

Another release scheme is the incorporation of the genetic material of the toxins into a baculovirus vector. Baculoviruses infect particular host insects, including those targeted with Photorhabdus toxins. Infectious Baculovirus, which harbors an expression construct for Photorhabdus toxins, could be introduced into the areas of insect infestation and thus poison or infect infected insects. The transfer of insecticidal properties requires nucleic acid sequences that encode amino acid sequences for Photorhabdus toxins integrated into a protein expression vector, appropriate for the host in which the vector will be. One way to obtain a nucleic acid sequence that encodes a protein with insecticidal properties is to isolate the native genetic material, which produces the toxins from Photorhabdus, using the information derived from the amino acid sequence of the toxin, of which large portions are mentioned below. As described below, methods of purifying the proteins responsible for toxin activity are also disclosed. Using the N-terminal amino acid sequence data, as mentioned below, one can construct complementary oligonucleotides at all or at a section of the DNA bases encoding the first toxin amino acids. These oligonucleotides can be radiolabelled and used as molecular probes for isolating the genetic material from a genomic gene bank, constructed from the genetic material isolated from Photorhabdus strains. The genetic bank can be cloned into plasmid, cosmid, phage or phagemid vectors. The bank could be transformed into Escherichia coli and sought for toxin production by transformed cells, using antibodies produced against the toxin or direct assays for insect toxicity.

This approach requires the production of a set of oligonucleotides, because the degenerate genetic code allows an amino acid to be encoded into DNA by any of the few combinations of 3 nucleotides. For example, the amino acid arginine can be encoded by the nucleic acid triplets CGA, CGC, CGG, CGT, AGA, and AGG. Because it is not possible to say precisely which triplet is used at those positions in the toxin gene, one must prepare oligonucleotides with each potential triplet represented. More than one DNA molecule corresponding to a protein subunit may be needed to build a sufficient number of oligonucleotide probes to recover all of the protein subunits required for oral toxicity.

From the amino acid sequence of the purified protein one can easily isolate and donate, in whole or in part, the genetic material responsible for producing toxins in an expression vector, using any of the few techniques well known to the molecular biology specialist. A typical expression vector is a DNA plasmid, although other means of transfer include, but are not limited to, cosmids, phagemids and phages, which are also contemplated. In addition to features required or desired for plasmid replication, such as an origin of replication and antibiotic resistance or other form of a selectable marker, such as the bar gene of Streptomyces hygroscopicus or viridochromogenes, protein expression vectors additionally require, in normally, an expression box that incorporates cis-acting sequences required for transcription and translation of the gene of interest. The cis-acting sequences required for expression in prokaryotes differ from those required in eukaryotes and plants.

RO 121280 Β1

A eukaryotic expression cassette requires a transcriptional promoter upstream (5 ') 1 of the gene of interest, a transcriptional termination region, such as a poly-A addition site and a ribosome binding site upstream of the first gene codon. of interest. In bacterial 3 cells, a useful transcriptional promoter that could be included in the vector is the RNA polymerase 17 promoter. Promoters, such as those described hereinbefore, are known for efficient initiation of mRNA transcription. Also upstream of the gene of interest, the vector may include a nucleotide sequence encoding a known signal sequence 7 for directing a covalently linked protein to a particular compartment of the host cells, such as the cell surface. 9

Insect viruses or baculoviruses are known to infect and harm certain insects. The effect of viruses on insects is slow, and viruses do not stop feeding the insects. Thus, viruses are not considered to be useful as pest control agents. Combining the Photorhabdus toxin genes in a 13 Baculovirus vector could provide an efficient way of transmitting toxins, while increasing the lethality of the virus. Additionally, because different baculoviruses are specific to 15 different insects, it may be possible to use a particular toxin to selectively target certain harmful insects. A particularly useful vector for the toxin genes is the nuclear polyhedrosis virus. Transfer vectors, which use this virus, have been described and are now the vectors of the option for transferring foreign genes into insects. The recombinant virus-toxin gene can be constructed in an orally transmissible form. Usually, baculoviruses infect the insect victim through the intestinal mucosa of the middle intestine. The toxin gene 21 inserted behind a strong promoter of viral coating protein will be expressed and will rapidly kill the infected insect. 2. 3

Additionally, in an insect or baculovirus virus delivery system, or transgenic plant for the protein toxins of the present invention, the proteins can be encapsulated using Bacillus thuringiensis encapsulation technology, such as, but not limited to, US Patent 4,695,455, 4 695 462, 4 861 595, all of which are incorporated herein by reference. Another delivery system for the protein toxins of the present invention is the formulation of the protein in a bait matrix, which could then be used as baits in insect sites, 29 above the ground and below the ground. Examples of such technologies include, but are not limited to, PCT patent application WO / 93/23998, which is incorporated herein by reference. 31

As described above, it may become necessary to modify the sequence encoding the protein, when expressed in a non-native host, because the preferences of the codon 33 to other hosts may differ from those of Photorhabdus. In such a case, the translation may even be inefficient in a new host unless compensation changes are made to the coding sequence. Additionally, modifications to the amino acid sequence may be desired to avoid cross-reactivity with the proteins of the new host or to refine the insecticidal properties of the protein in the new host. A genetically modified toxin gene may encode a toxin, which exhibits, for example, increased or reduced toxicity, development of modified insect resistance, altered stability or altered specificity for the target species.

In addition, in the Photorhabdus genes that encode toxins, the contents of the present invention are intended to include nucleic acid related sequences encoding amino acid biopolymers homologous to the toxin proteins and retaining the toxic effect of Photorhabdus 43 proteins on insect species after oral ingestion.

For example, the toxins used in the present invention appear to initially inhibit larval feeding, 45 before death. By manipulating the nucleic acid sequences of Photorhabdus toxins or its control sequences, genetic engineers who place the toxin gene 47 in plants can modulate its potency or its mode of action in order to maintain,

For example, feeding inhibition activity, while eliminating the activity of absolute toxicity on the larva. This change could allow the transformed plant to survive until harvest, without having a dramatically unnecessary effect on the ecosystem, destroying all target insects. All of these modifications of the toxin-encoding gene or of the gene-encoded protein are contemplated within the scope of the present invention.

Other envisaged modifications of the nucleic acid refer to supplementing the target sequences for directing the toxin to specific parts of the insect larva, to improve its efficiency.

ATCC strains 55397,43948,43949,43950,43951.43952 were deposited at the American Cultivation Collection type 12301 Parklawn Drive, Rockville, MD 20852 USA. The amino acid and nucleotide sequence data for the native toxin W-14 (ATCC 55397) are presented below. Also, the isolation of genomic DNA for toxins from bacterial hosts is exemplified here. Additional information can be found in Sambrook J., Fritsch, E.F., and Maniatis.T. (1989), Molecular Cloning. In Laborator'Manual. Cold Spring Harbor Press, which is incorporated herein by reference.

The invention has the following advantages:

- reducing the influence on the ecosystem;

- superior efficiency.

The following are examples of embodiments of the invention in connection with FIG. 1-6 which represents:

FIG. 1 is an illustration of a pair of cloned DNA isolates, used as part of the toxin gene sequence of the present invention;

FIG. 2 is a map of 3 plasmids used in the sequencing process;

FIG. 3 is a map that illustrates the interrelationships of several partial DNA fragments;

FIG. 4 is an illustration of a homology analysis between the TcbAji and TcaB protein sequences;

FIG. 5 is a phenotype of Photorhabdus strains. Photovhabdus strain relationships were defined by rep-PCR.

The upper axis of FIG. 5 measures the percentage of strain similarity based on the appreciation of the rep-PCR products (ie 0.0 [no similarity] to 1.0 [100% similarity]). To the right of the axis, the numbers and letters indicate the various strains tested; i4 = W-14, Hm = Hm, H9 = H9, 7 = WX-7, 1 = WX-1, 2 = WX-2, 88 = HP88, NC-1 = NC-1, 4 = WX-4, 9 = WX-9, 8 = WX-8, 10 = WX-10, WIR = WIR, 3 = WX-3, 11 = WX-11, 5 = WX-5, 6 = WX-6, 12 = WX- 12, x14 = WX-14, 15 = WX-15, Hb = Hb, B2 = B2, 48 to 52 = ATCC 43948 to ATCC 43952. The vertical lines separating the horizontal lines show the degree of kinship (as read from the extrapolated intersection of of the vertical line with the upper axis) between the stems or groups of stems, at the base of the horizontal lines (for example, the W-14 strain is approximately 60% similar to the H9 and Hm strains).

FIG. 6 is an illustration of genomic maps of strain W-14.

In the examples, the following abbreviations are used: Tris = tris (hydroxymethyl) amino methane; SDS = sodium dodecyl sulfate; EDTA = ethylenediaminetetraacetic acid; IPTG = isopropylthio-Bgalactoside; X-gal - 5-bromo-4-chloro-3-indoyl-B-D-galactoside; CTAB = cetyltrimethylammonium bromide; kbp = kilobases pairs; dATP, dCTP, dGTP, dTTP, 1 = 2'-deoxynucleoside 5 * -phenosphates of adenine, cytosine, guanine, thymine and inosine respectively; ATP = adenosine 5'-triphosphate.

Example 1. Purification of P. luminescens toxin and demonstration of toxicity after oral release of purified toxin

The insecticidal protein toxin of the present invention was purified from P. luminescens strain W-14, ATCC accession number 55397. Stock cultures of P. luminescens were maintained on Petri dishes containing 2% Proteose Peptone no. 3 (ie, PP3, Difco Laboratories, Detroit

RO 121280 Β1

Ml) in 1.5% agar, incubated at 25 ° C and transferred weekly. Bacteria of the first-1 bacterial form were incubated in 200 ml of PP3 broth supplemented with 0.5% polyoxyethylene sorbitan mono-stearate (Tween 60, Sigma Chemical Company, St. Louis MO) in a 3-by-1 flask. I. The broth cultures were grown 72 h, at 30 ”C, on a rotary shaker. Toxin proteins can be recovered from cultures grown in the presence or absence of Tween; however, the absence of Tween 5 may affect the growth of the bacterium and the profile of the proteins produced by the bacteria, in the absence of Tween, is found to be a variant in that the molecular weight of at least 7 of a subunit of identified toxin changes from about 200 kDa to about 185 kDa.

The 72 h cultures were centrifuged at 10,000 xg, for 30 min, to remove 9 cells and cell debris. The fraction of the supernatant, which contained the insecticidal activity, was decanted and brought to 50 mM K ₂ HPO ₄ , adding an appropriate volume of 11 1.0 MK ₂ HPO ₄ . The pH was adjusted to 8.6 by adding potassium hydroxide. This supernatant fraction was then mixed with DEAE-Sephacel (Pharmacia LKB Biotechnology), which was equilibrated with 50 mM K ₂ HPO ₄ . The toxic activity was adsorbed on the DEAE resin. This mixture was then poured into a 2.6 X 40 cm column and washed with 50 mM K ₂ HPO ₄ at room temperature at a flow rate of 30 ml / h, until the effluent reached UV absorbance at a constant baseline at 280 nm. The column was then washed with KC1150 mM until the effluent reached a constant baseline again at 280 nm. Finally, the column was washed with 300 mM KC1 and the fractions were collected. 19

The toxin-containing fractions were collected and sterilized by filtration, using a 0.2-μm pore filtration membrane. Then, the toxin was concentrated and equilibrated at 100 mM KPO4, 21 pH 6.9, using an ultrafiltration membrane with a molecular weight separation of 100 kDa, at 4 ° C (Centriprep 100, Amicon Division-WR Grace and Company). A 3 ml sample of 3 toxin concentrate was applied to the top of a 2.6 x 95 cm Sephacryl S-400 HR gel filtration column (Pharmacia LKB Biotechnology). The effluent buffer was 25 KPO ₄ 100 mM, pH 6.9, which migrated at a flow rate of 17 ml / h at 4 ° C. The effluent was monitored at 280 nm. 27

The fractions were collected and tested for toxic activity. The toxicity of the chromatographic fractions was examined in a biological analysis, using larvae of Manduca sexta. The fractions were applied either directly to the insect food (Gypsy, grain germ-fed feed, ICN Biochemicals Division-ICN Biomedicals, Inc.), or administered by intrahemocellular injection of a 5 μΙ sample into the first protrusion. abdominal of a larva in stage 4 or 5, using a needle of size 30. The weight of each larva 33 in the treatment group was recorded at 24-hour intervals. Toxicity is assumed, if the insect has stopped feeding and died within a few days of diet consumption, or if death occurred within 24h35 after injecting a fraction.

The toxic fractions were collected and concentrated using Centriprep 100 and then analyzed by HPLC using a 7.5 mm x 60 cm permeation gel column TSK-GEL G-4000 SW with potassium phosphate 100 mM, pH 6.9 eluent buffer migrating at 0.4 ml / min. 39 This analysis showed the protein toxin to be contained in a single sharp peak that eluted from the column with a retention time of about 33.6 min. This retention time corresponded to an estimated molecular weight of 1000 kDa. The maximum of the fractions was collected for further purification, while the fractions not containing this protein were eliminated. The maximum eluted from HPLC absorbs UV light at 218 and 280 nm, but does not absorb at 405 rounds. The absorbance at 405 nm proved to be an attribute of the antibiotic compounds 45 xenorhabdin.

Electrophoresis of the maximum fractions collected in a non-denatured agarose gel 47 (Metaphor Agarose, FMC BioProducts) showed that 2 complexes are present in the maximum

RO 121280 Β1 protein. Maximum material buffered in 50 mM Tris-HCl, pH 7.0 was separated on 1.5% agarose gel buffered with Tris-HC1100 mM at pH 7.0 and 1.9% agarose separating gel was buffered with Tris - 200 mM borate at pH 8.3, under standard buffer conditions (Tris-HCl IM anode buffer, pH 8.3; 0.025 M Tris cathode buffer, 0.92 M glycine). The gels migrated at a constant current of 13 niA, at 15 ° C, until the phenol red trace dye reached the end of the gel. 2 protein bands were viewed in agarose gels, using Coomassie brilliant blue staining.

The slower migration band was called protein band 1 and the faster migration band was called protein band 2. The two protein bands were present in approximately equal amounts. Coomassie colored agarose gels were used as a guide to precisely excise the two protein bands from the colorless portions of the gels. The excised pieces containing the protein bands were macerated and a small amount of sterile water was added. For control, a portion of the gel that did not contain any protein was excised and treated in the same manner as the gel pieces containing the protein. The protein was recovered from the gel pieces by electroelection in 100 mM Tris-borate, pH 8.3, at 100 volts (constant voltage), for 2 h. Alternatively, the passive protein was eluted from the gel pieces by adding an equal volume of 50 mM Tris-HCl, pH 7.0, on gel pieces, then incubated at 30'C, 16 h. This allowed the protein to diffuse from the gel into the buffer which was then collected.

Results of insect toxicity tests using HPLC purified toxin (33.6 min, max) and agarose gel purified toxin demonstrated the toxicity of the extracts. Injection of 1.5 µg of HPLC purified protein kills in 24 hours. Both protein bands 1 and 2, recovered from the agarose gel by passive elution or electroelution, were lethal to the injection. The estimated protein concentration for these samples was less than 50 ng / larva. A comparison of weight gained and mortality between groups of larvae, injected with protein bands 1 or 2, shows that protein band 1 was more toxic upon release by injection.

When the HPLC purified toxin was applied to the larval food, at a concentration of

7.5 pg / larva, this caused a stop in the larval weight gain (24 larvae were tested). The larvae began to feed, but after consuming only a small portion of the toxin-treated food, they began to show the toxin-induced pathological symptoms and the larvae stopped feeding. The insect becomes colorless and most larvae show signs of diarrhea. Significant insect mortality resulted when several doses of 5 µg toxin were applied to the food over a period of 7-10 days.

The separate protein band 1 on agarose significantly inhibited larval weight gain at a dose of 200 ng / larva. Larvae fed with similar concentrations of the 2-band protein did not inhibit and gained weight at the same rate as the control larvae. 12 larvae were fed with eluted protein and 45 larvae were fed with the protein contained in the agarose pieces. These two datasets show that the protein in band 1 was orally toxic to Manduca sexta. In this experiment, it appears that the protein in band 2 was not toxic to Manduca sexta.

Further analysis of protein in lanes 1 and 2 by SDS-PAGE, under denaturing conditions, showed that each band was composed of several smaller protein subunits. The proteins were visualized by Coomassie brilliant blue staining, followed by silver staining, to achieve maximum sensitivity.

The protein subunits of the two bands had a very high similarity. Protein band 1 contains 8 proteins of 25,1,56,2, 60,8, 65,6,166,171,184 and 208 kDa. The protein band 2 had an identical profile, except that the proteins 25.1, 60.8 and

65.5 kDa were not present. Proteins 56,2,60,8,65,6 and 184 kDa were present in the protein band 1 complex at approximately equal concentrations and represent 80% or more of the total protein content of this complex.

RO 121280 Β1

The purified native toxin-HPLC was further characterized as follows. 1 The toxin was thermally labile, because after being heated to 60 ° C for 15 minutes, it lost its ability to kill or inhibit weight gain, when injected or - fed M.sexta larvae. The tests aimed to detect the activities of lipase, type C phospholipase, nucleases or red blood hemolysis and were performed with purified toxin. None of these activities were presented. Also, area antibiotic inhibition tests were performed and the purified toxin failed to inhibit the growth of gram-7 or gram-positive bacteria, yeasts or filamentous fungi, showing that the toxicant is not a xenorhabdin antibiotic. 9

Purified native toxin - HPLC - has been tested for the ability to kill insects other than Manduca sexta. Table 2 contains the names of the insects killed by the purified P-11 luminescens toxin-HPLC in this study.

Table 2

Insects killed by P. luminescens toxin 15

Common name Order Genres or species Path of liberation Tobacco moth Lepidoptera Sixth manduca Oral or injected Meal beetle Coleptera Tenebtio molitor Oral Pharaoh ant Hymenoptera Monomorium pharoanis Oral Cockroach Dictyoptera German Plettella Oral or injected Mosquito 1 " Diptera Aedes aegypti Oral

Example 2. The use and toxicity of Photorhabdus luminescens were further characterized. The crop broth Photorhabdus luminescens (strain W-14) was produced as follows. The production medium was 2% Bacto Proteose Peptone® no. 3 (PP3, Difco 25 Laboratories, Detroit, Michigan) in Milli-Q® deionized water. The seed culture vials consist of 175 ml medium placed in a three-sided vial with a Delong neck, covered with 27 Kaput and autoclaved for 20 min, T = 250 ° F. The production vials consist of 500 ml of 2.81 500 ml in a three-cup vial with a Delong neck, covered by a 29 Shin-etsu silicone foam. These were autoclaved for 45 min at T = 250'F. The seed culture was incubated at 28 ° C, at 150 rpm, in a stirring rotary incubator with a 2-inch displacement. 31 After 16 h of growth, 1% of the seed culture was placed in a production vial that was allowed to grow for 24 h before harvesting. Toxin production appeared to be 33 during log growth. The microbial broth was transferred to a centrifuge bottle of 11 and the cell biomass pelleted (30 min, at 2500 RPM, at 4 ° C, centrifugal [R.C.F. = -1600] 35

HG-4L Rotor RC3 Sorval, Dupont, Wilmington, Delaware). The primary broth was abruptly cooled to 4 ° C for 8-16 hours and re-centrifuged for at least 2 hours (conditions above) to further clarify the broth by removing a so-called mucopolysaccharide that precipitated at rest. (An alternative method of production combined both stages and involved the use of a clarification centrifuge for 16 hours, the same conditions above). This broth was then stored at 4 ° C before biotesting or filtering. 41

The Ptotorhabdus culture broth and the protein toxin (s) that were purified from this broth showed activity (mortality and / or growth inhibition, reduced occurrence of adult 43) against a number of insects. Especially the activity is against rootworm (larva or adult), Colorado potato beetle and grub turf, which are members of the order 45

RO 121280 Β1 of Coleoptera insect. Other members of the Coleoptera include wireworm species, pollen beetle, Haltica and Epitrix beetles, Bruchidae beetles and hawks. Also, activity was observed against the homeoptera insects Cicadellidae, which are members of the order Homoptera. Other members of the Homoptera include planthoppers, pear pyslla, apple sucker, homeoptera insects Ciccoidae, Aleyrodidae and Cercopidae, as well as numerous hosts specific to aphids. The broth and purified fractions are also active against beet armyworm, cabbage looper, Noctuidae. Pyransta nubilatis Heliotis zea and Crpocapsa pomonella, which are members of the Lepidoptera order. Other typical members of this order are Tineidae, Indian mealmoth, leaf roller, genus Pieris, cotton bollworm, bagworm, Eastern tent Caterpillar, sod webworm and fall armyworm. Also, the activity appears to be against mosquito larvae, which are members of the Diptera order. Other members of the Diptera order are Chironomidae, carrot fly, cabbage root fly, turnip root fly, onion fly, Tipulidae, Musca domestica and different species of mosquitoes. The activity appears to be against the dipteran insects of the family Camponotus and Iridemyrmex humilis, which are members of the order which also includes Lampyridae, oderous house ant and Monomorium minimum.

The broth / fraction is useful for reducing insect populations and they have been used in a method of inhibiting an insect population. The method may comprise applying, at an insect locus, an effective amount of inactivation of the described active insect. The results are presented in table 3.

The activity against corn root worm lava was tested as follows. Photorhabdus culture broth (filter sterilized, free cells) or HPLC purified fractions were applied directly to the surface (~ 1.5 cm ² ) 0.25 ml of artificial food in 30 µl aliquots, after dilution in control medium or 10 mM sodium phosphate buffer, pH 7.0, respectively. The diet plates were allowed to air-dry in a sterile envelope, and the wells were infested with a single new-onset Diabrotica undercimpunctata howardi (Southern corn rootworm, SCR) incubated from sterilized eggs, with a second larval state. SCR raised on artificial diet or with a second larval state Diabrotica virgifera virgifera (Western corn rootworm, WCR), grown on cereal seedlings in Metromix®. Larvae were weighed in the second larval state before being added to the feed. The plates were isolated, placed in a moist growth chamber and kept at 27'C, for an appropriate period (4 days for newly emerged and adult SCR, 2-5 days for WCR larvae, 7 -14 days for SCR in the second embryonic state). Weight and mortality determinations were measured, as indicated. In general, 16 insects per treatment were used in all studies. The control modalities were the following: newly emerged larvae, <5%, adult beetles, 5%.

The activity against the Colorado potato beetle was tested as follows. Photorhabdus culture broth or control medium was applied to the surface (-2.0 cm ² )

1.5 ml of the standard artificial diet considered in the wells of a 24 well tissue culture plate. Each well received 50 µl of treatment and was allowed to air dry. Then, individual Colorado potato beetle larvae, in the second larval stage (Leptinotarsa decemlineata, CPB), were placed on food and, after 4 days, mortality was recorded. The control mortality was 3.3%.

The activity against Japanese beetle grubs & beetles was tested as follows. Ground ferns with grub turf larvae (Popillia japonica, 2-3 larval stage) were collected from infested grasslands and kept in the laboratory, in soil / peat mixture with slices of carrot added as additional feed. Truffle beetles were locally caught in the pheromone trap and kept in the laboratory in plastic containers with maple leaves as food. After application of Photorhabdus undiluted culture broth or control medium to artificial diet root root worm (30 μΙ / 1.54 cm ² , beetles) or carrot slices (larvae), both stages were placed individually

EN 121280 Β1 in a dietary well and any mortality and nutrition were observed. In both cases, there was a clear reduction in the amount of food (and the production of excrement) observed.

The activity against mosquito larvae was tested as follows. The test was performed in 3 96-well microtiter plates. Each well contained 200 µl aqueous solution (Photorhabdus culture broth, control medium or H ₂ O and about 20 larvae aged 1 day 5 (Aedes aegypti). There were 6 wells per treatment. Results were read in 2 h after infestation and did not change after the three-day observation period. No control mortality occurred. 7

Activity against dipteran insects in the Trypetidae family was tested as follows. The purchased Drosophila melanogaster medium was prepared using 50% dry medium 9 and 50% liquid, either water, control medium, or Photorhabdus culture broth. This was accomplished by placing 8.0 ml of dry medium in each of 3 vials per treatment 11 and adding 8.0 ml of corresponding fluid. Then ten late-stage larvae of Drosophila melanogaster were added to each vial. The vials were kept on a table of 13 laboratories, at room temperature, under fluorescent ceiling light. Adult and pup counts were made after 3, 7 and 10 days of exposure. Incorporation of the culture broth 15 Photorhabdus into the diet environment for Trypetidae larvae produced a slight (17%) but significant reduction in the occurrence of adults, on day -10, as compared to water or control medium 17 (3% reduction).

Activity against homeopteran insects Cicadellidae was tested as follows. The ingestion test for homeoptera insects Cicadellidae (Macrosteles severini) is intended to make it possible to ingest the asset without other external contact. The tank for solution 21 active / food is made by 2 compartments in the center of the lower portion of a 35x10 mm Petri dish. A 2-inch Parafilm M® square is placed over the tip of the vessel and is provided with 23 O-rings. One 1-oz plastic cube. it was then infested with about 7 homeoptera insects Cicadellidae and the reservoir was placed at the top of the cup, under Parafilm. The test solution was then added 25 to the tank through the slots. In assays using undiluted Photorhabdus culture broth, the control broth and control medium were dialyzed against water to reduce control mortality. Mortality was reported at 2 days, when control mortality appeared to be 26.5%. In assays using purified fractions (200 mg protein / ml), a final 5% sucrose concentration was used in 29 of all treatments to improve the survival of Cicadellidae homeoptera insects. The test was carried out in an incubator at 28 ° C, 70% RH with a photoperiod of 16/8. Test 31 reached the mortality rate at 72 hours. The control mortality was 5.5%.

The activity against insect Iridomyrmex humilis was tested as follows. 33 A 1.5 ml aliquot of 100% Photorhabdus culture broth, control medium or water, was pipetted into 2.0 ml clear glass vials. The vials were poured into a piece of 35 cotton dental wick, which was moistened with the appropriate treatment. Each vial was placed in a separate Petri dish 60x16 mm with 8 to 12 adult insects Iridomyrmex humilis 37 (Linepithema humile). Three were replicated per treatment. The biotest plates were kept on a laboratory table, at room temperature, under fluorescent ceiling light. Readings for 39 mortality were made after 5 days of exposure. The control mortality was 24%.

The activity against insects of the genus Camponotus was tested as follows. 41 Unfertile insect females (Camponotus pennsylvanicus) were collected from trees on the DowElanco plantation in Indianapolis, IN. Photorhabduss culture broth tests performed 43 as follows. Each plastic biotest container (71 / 8x3) held 15 infertile females, one paper shelter and 10 ml broth or control medium in a small plastic vessel. A 45 cotton wool delivered the treatment, to a place in the small vessel lid. All treatments contained 5% sucrose. The biotest was performed in the dark, at room temperature, for 47 19 days. The control mortality was 9%. Tests that release purified fractions use

EN 121280 Β1 artificial ant diet for treatment (purified fraction or control solution) at a rate of 0.2 ml treatment / 2.0 g diet in a plastic test tube. The final protein concentration of the purified fraction was less than 10 µg / g diet. Ten insects per treatment, one source of water, shelter and the treated diet were placed in watertight plastic containers and kept in the dark at 27 ° C in a moistened incubator. Mortality was recorded on day 10. No control mortality occurred.

The activity against different lepidopteran larvae was tested as follows. Photorhabdus culture broth or purified fractions were applied directly to the surface (~ 1.5 cm ² ) of 0.25 ml standard artificial diet in 30 µl aliquots after dilution, in control medium or 10 mM sodium phosphate buffer, pH 7 , 0, respectively. The diet plates were allowed to air-dry in a sterile envelope and the wells were infested with newly hatched larvae individually. From European sources, European corn borer (Ostrinia nubilalis) and earworm (Helicoverpa zea) eggs were supplemented and incubated with their own means and internally beet armyworm (Spodoptera exigua), cabbage looper (Trichoplusia ni), tobacco budworm (Heliothis viescens), codling moth (Laspeyresia pomonella) and black cutworm (Agrotis ipsilon). After infestation with larvae, the diet plates were sealed, placed in a moist growth chamber and kept in the dark, at 27'C, for the corresponding period. Weight and mortality determinations were recorded on days 5-7 for Photorhabdus culture broth and 4-7 days for the purified fraction. In the whole study, generally, 16 insects were used per treatment. The control mortality was between 4-12.5% for the control environment and was less than 10% for the phosphate buffer.

Table 3

Effect of culture broth Photorhabdus luminescens (strain W-14) and purified toxin fraction, on mortality and growth inhibition of different orders / species of insects

Order / species of insects Broth Purified fraction Dead.% G. L.% Dead.% G. L.% COLEOPTERA Worms cereal roots Southern / newly emerged larva 100 N / A 100 N / A Southern / 2nd larval stage N / A 38.5 nt nt Southern / adult 45 nt nt nt Western / 2nd larval stage N / A 35 nt nt Potato beetle Colorado 2nd larval stage 93 nt nt nt Lawn worm 3rd larval stage N / A A. F nt nt adult N / A A. F nt nt Diptera Tripedidae (adult appearance) 17 nt nt nt Mosquito larva 100 N / A nt nt Homoptera Cicadellidae 96.5 N / A 100 N / A

RO 121280 Β1

Table 3 (continued)

Order / species of insects Broth Fraction purified Dead.% G. L.% Dead.% G. L.% Hymenoptera Iridomyrmex humilis 75 N / A nt N / A Camponotus 71 N / A 100 N / A LEPIDOPTERA Beet Armyworm 12.5 36 18.75 41.4 Black Cutworm nt nt 0 71.2 Cabbage Looper nt nt 21.9 66.8 Codling Moth nt nt 6.25 45.0 Corn Earworm 56.3 94.2 97.9 N / A European Corn Borer 96.7 98.4 100 N / A Tobworm Tobacco 13.5 52.5 19.4 85.6

Mort. = Mortality, G.l. = growth inhibition, na = not applicable, nt = untested, a.f. = anti-nurturing 17

Example 3. Usefulness of insecticide for soil application 19

Photorhabdus luminescens culture broth (strain W-14) has been shown to be active against rootworm, when applied directly to soil or to a soil mix (Metromix®). The activity against SCR and the newly emerged WCR in Metromix® was tested as follows (Table 4). The test was performed using seedlings (United Agriseeds brand CL614), 23 which germinated lightly, on wet filter paper for 6 days. When the roots were approximately 3-6 cm long, a single seed / seedling was planted in a clear plastic cup with 25 50 mg of dry Metromix®. Then, 20 newly emerged SCRs or WCRs were placed on the roots of the seedlings and covered with Metromix®. On infestation, the seedlings were then softened with 50 ml 27 total volume of diluted broth solution. After softening, the cups were sealed and left at room temperature, light, for 7 days. After that, the seedlings were washed to remove all Metromix® and the roots were excised and weighed. The activity was evaluated as the percentage of the cereal roots remaining relative to the control plants and as the destruction of the leaf 31 induced by feeding. The leaf destruction was visually recorded and evaluated as either -, +, ++, or +++, representing the lack of destruction and "+++ representing severe destruction. 33

The activity against newly emerged SCR in soil was tested as follows (Table 5).

The test was carried out using cereal seedlings (United Agriseeds brand CL614) which germinated lightly on wet filter paper for 6 days. After the roots were about 3-6 cm long, a single seed / seedling was planted in a clear plastic bucket 37 with 150 gm soil from a field in Lebanon, IN, planted a year earlier with cereals. This soil has not previously been treated with insecticides. Then, 20 newly defended SCRs were placed directly on the roots - 39 seedlings and covered with soil. After infestation, the seedlings were soaked with 50 ml total volume of a diluted broth solution. After softening, the sealed cups were incubated 41 in a room with relatively high humidity (80%) at 78 ° F. After that, the seedlings were washed to remove all soil and the roots were excised and weighed. The activity was evaluated as the percentage of the cereal roots remaining relative to the control plants and as nutrition-induced leaf destruction. The destruction of the leaf was recorded visually and evaluated as either -, +. ++, or 45 +++, with representing without destruction and +++ representing serious destruction.

RO 121280 Β1

Table 4

Effect of Photorhabdus luminescens culture broth (W-14 strain) on rootworm larvae after postinfest soaking (Metromix®)

Treatment Larva Leaf destruction Root weight % Southern corn rootworm The water - - 0.4916 ± 0.023 100 Medium (2.0% v / v) - - 0.4416 ± 0.029 100 Broth (6.25% v / v) - - 0.4641 ± 0.081 100 The water + +++ 0.1410 ± 0.006 28.7 Medium (2.0% v / v) + +++ 0.1345 ± 0.028 30.4 Broth (1.56% v / v) + - 0.4830 ± 0.031 104 Western corn rootworm The water - - 0.4446 ± 0.019 100 Broth (2.0% v / v) - - 0.4069 ± 0.026 100 The water + - 0.2202 ± 0.015 49 Broth (2.0% v / v) + - 0.3879 ± 0.013 95

Table 5

Effect of Photorhabdus luminescens culture broth (strain W-14) on

Southern corn root after softening after infestation (Soil)

Treatment Larva Leaf destruction Root weight % The water - 0.2148 ± 0.014 100 Broth (50% v / v) - - 0.2260 ± 0.016 103 The water + +++ 0.0916 ± 0.009 43 Broth (50% v / v) + - 0.2428 ± 0.032 113

Activity of the Photorhabdus luminescens culture broth (strain W-14) against larval turf grub larvae in Metromix® was observed in tests performed as follows (Table 6). About 50 gm of Metromix® was added to a clear plastic cup of 591 ml. Metromix® was then soaked with 50 ml total volume of a 50% (v / v) diluted Photorhabdus broth solution. The dilution of the crude broth was made with water, with 50% broth, being prepared by adding 25 ml crude broth to 25 ml water for a total volume of 50 ml. A 1% (w / v) solution of protease peptone # 3 (PP3), which is a 50% dilution of the concentration of normal medium, was used as a broth control. After softening, five larval turf grubs, in the second larval stage, were placed on the damp Metromix® tip. Plenty of second-stage turf grub larvae have been digging fast in Metromix®. Those larvae that did not dig in an hour, were removed and replaced with new larvae. The cups were sealed and placed in an incubator at 28 ° C, in the dark. After seven days, the larvae were removed from Metromix® and mortality was recorded. The activity was evaluated by the percentage of mortality relative to the control.

RO 121280 Β1

Table 6

Effect of Photorhabdus luminescens culture broth (W-14 strain) on 3 turfgrub larvae after post-infestation softening (Metromix®)

Treatment mortality * Mortality% The water 7/15 47 Control medium (1.0% w / v) 12/19 63 Broth (50% v / v) 17/20 85

* - expressed in the report of dead larvae on live insects * - expressed in the report of dead larvae on live insects

Example 4. Utility of insecticide for leaf application

The activity of the Photorhabdus broth against the European corn borer was observed when the broth 13 was applied directly to the surface of the corn leaves (Table 7). In these tests, Photorhabdus broth was diluted 100 times with culture medium and manually applied to the surface of the excised corn leaves at a rate of ~ 6.0 μΙ / cm ² on the leaf surface. The leaves were air-dried and the strips of approximately 2x2 inches were cut. The leaves were rolled, 17 were secured with paper clips and placed in small 1 oz plastic pots with 0.25 inch 2% agar on the top surface to prevent dampening. There were placed 20 European corn 19 new borer appeared on the rolled leaves and the cup was sealed. After incubation for 5 days, at 27'C, in the dark, samples were recorded, food destruction and larvae recovered. 21

Table 7 23

Effect of Photorabdus luminescens culture broth (strain W-14) on European corn borer larva after pre-infestation to excise corn leaves 25

Treatment Leaf injury Larvae recovered Weight (mg) The water stretched 55/120 0.42 mg Environment control stretched 40/120 0.50 mg Broth (1.0% v / v) traces 3/120 0.15 mg

The activity of the culture broth against Heliothis virescens was demonstrated using a folded leaf methodology. Fresh cotton leaves were cut from the plants and the leaf discs were cut with an 18.5 mm stopper. The discs were individually immersed in 33 control media (PP3) or Photorhabdus luminescens culture strain / strain W-14) which was concentrated approximately 10 times, using an Amicon 35 tangential filtration system (Beverly, MA), Proflux M 12 with a 10 kDa filter. The excess fluid was removed and a hardening paper clip was placed toward the center of the disc. The paper clip was then fastened to 37 in a small 1.0 oz plastic jar containing about 2.0 ml 1% agar. This serves to suspend the leaf disc above the agar. After drying the leaf disc, 39 a single newly emerged larva was placed on the disc and the cup sealed. Then, the cups were sealed in a plastic bag and placed in a dark incubator, 27 ° C, for 5 days. At 41 this period the larvae and the remaining leaf material were weighed to establish a measure of leaf destruction (Table 8). 43

RO 121280 Β1

Table 8

Effect of Photorabdus luminescens culture broth (strain W-14) on newly emerged Heliothis virescens in a bent cotton leaf test

Treatment The leaf disk Final weight of larvae (mg) Leaves control 55.7 ± 1.3 N / A* Environment control 34.0 ± 2.9 4.3 ± 0.91 Photorhabdus broth 54.3 ± 1.4 0.00

* - not applicable ** - no larvae were found alive

Example 5. Part A Characterization of the toxin peptide components in a subsequent analysis, the toxin protein subunits of the isolated bands as in example 1 were decomposed by electrophoresis on a 7% SDS polyacrylamide gel with a ratio of 30: 0.8 ( acrylamide: BIS-acrylamide). This matrix gel better promotes higher protein resolution. The gel system, used in Example 1 to estimate the molecular weights of the Banda 1 and Banda 2 subunits, was an 18% gel with a ratio 38: 0.18 (acrylamide: BIS-acrylamide), which allows a wide range of separation. by size, but lower resolution of the components with higher molecular weight.

In this analysis, 10, rather than 8, protein bands were broken down. Table 9 presents the calculated molecular weights of the 10 broken bands and directly compares the estimated molecular weights under these conditions with those of the previous example. Not surprisingly, the additional bands were detected under different separation conditions used in this example. Variations between previous and new estimates of molecular weight are also expected to give differences under analytical conditions. In the analysis of this example, it is believed that the estimated higher molecular weight is more accurate than in Example 1, as a result of the improved resolution. However, this was estimated based on SDS PAGE analysis, which typically lacks analytical accuracy and results in peptide estimates that could be further altered due to post- and cotranslational modifications.

Amino acid sequences were determined for N-terminal portions of five of the 10 decomposed peptides. Table 9 correlates the molecular weight of the identified proteins and sequences. In SEQ ID NO: 2, some analyzes suggest that praline at residue 5 may be an asparagine (asn). In SEQ ID NO: 3, some analyzes suggest that amino acid residues at positions 13 and 14 are both arginine (arg). In SEQ ID NO: 4, some analyzes suggest that the amino acid residue at position 6 may be alanine (ala, or serine (serum). In SEQ ID NO: 5, some analyzes suggest that the amino acid residue at position 3 may be aspartic acid ( asp).

Table 9

Estimated Example 1 Dear new * SEQ list 208 200.2 kDa SEQ ID NO: 1 184 175.0 kDa SEQ ID NO: 2 65.6 68.1 kDa SEQ ID NO: 3 60.8 65.1 kDa SEQ ID NO: 4 56.2 58.3 kDa SEQ ID NO: 5 25.1 23.2 kDa SEQ ID NO: 15

* New estimates are based on SDS PAGE and are not based on gene sequences. SDS PAGE has no analytical accuracy.

RO 121280 Β1

Example 5. Part B Characterization of toxin peptide components 1

The new N-terminal sequence, SEQ ID NO: 15, Ala Gin Asp Gly Asn Gin Asp Tiu Phe Phe Ser Gly Asn Thr, was obtained by further sequencing the N-terminal of peptides 3 isolated from purified native toxin-HPLC, as described In Example 5, Part A, above. This peptide comes from the tcaA gene. The peptide labeled TcaAii3 starts at position 254 5 and continues to position 491, where the peptide TcaA begins, _(i , SEQ ID NO: 4. The estimated size of the peptide based on the gene sequence is 25,240 Da. 7

Example 6. Characterization of the toxin peptide components in another assay, the toxin protein complex was isolated from the growth medium 9 Photorhabdus lumiescens (after culture without Tween), by performing a precipitation with 10-80% ammonium sulphate, followed by a chromatography step. ion exchangers (Mono Q) and 11 two-step chromatography by molecular size. These conditions were the same as in Example 1. During the first step by molecular size, a second 13 biologically active peak was found at almost 100 ± 10 kDa. Based on protein measurements, this fraction was 20-50 times less active than the highest, or initially, peak active at nearly 15,860 ± 100 kDa (native). Also, during this isolation experiment, an active peak smaller than about 325 ± 50 kDa was detected, which retained a considerable part of the initial biological activity. The peak 325 kDa is believed to be related to, or derived from, the peak 860 kDa. 19

A 56 kDa protein was broken down in this assay. The N-terminal sequence of this protein is presented in SEQ ID NO: 6. It is worth noting that this protein 21 exhibits significant identity and conservation with SEQ ID NO: 5 at the N-terminus, suggesting that the two can be encoded by separate members of the gene family and that the proteins produced by 23 to each gene are sufficiently similar to both. to be operable in the insecticidal toxin complex. 25

A second obvious 185 kDa protein was consistently present in amounts comparable to those of protein 3 in table 9, and may be the same protein or protein fragment. The N-terminal sequence of this 185 kDa protein is shown in SEQ ID NO: 7.

Further data on the 29 N-terminal amino acid sequence was obtained from isolated proteins. None of the determined N-terminal sequences seem identical to the protein identified in Table 9. Other proteins are present in isolated preparation 31. Such a protein has an estimated molecular weight of 108 kDa and the N-terminal sequence as shown in SEQ ID NO: 9. 33

When the protein material was analyzed by size in the active peak of approx

325 kDa, bands of approximately 51, 31, 28 and 22 kDa were observed. As in all 35 cases where a molecular weight was determined by electrophoretic mobility analysis, these molecular weights were subjected to error effects introduced by differences of 37 ionic strength of the buffer, differences in electrophoretic power and the like. One of skill in the art will understand that the definitive molecular weight values cannot be determined using these 39 standard methods and that each is subject to variation. It has been assumed that proteins of these sizes are produced by degradation of larger protein species (size of approximately 41 kDa), which were observed in the initially larger toxin complex.

Finally, some preparations included a protein having the N-terminal sequence shown in SEQ ID NO: 10. This sequence has strong homology to known accompanying proteins, auxiliary proteins known to function in all large protein complexes. 45

Although the applications could not attribute such an overall functioning to the protein identified in SEQ ID NO: 10, this was consistent with the existence of the protein complex 47

EN 121280 Β1 described toxin, as an accompanying protein might be involved in its assembly. Furthermore, although such proteins have not been directly suggested to have toxic activity, this protein may be important in determining the full structural nature of the protein toxin and thus may contribute to the toxic activity or durability of the complex in vivo after oral administration.

Subsequently, the stability analysis of the protein toxin complex to proteinase K was initiated. It was determined that after incubation 24 ha of the complex, in the presence of 10-fold molar excess of proteinase K, the activity was virtually eliminated (mortality at dropwise oral application at almost 5% ). These data confirm the protein nature of the toxin.

Toxic activity was also retained through a dialysis membrane, again confirming the large size of the native toxin complex.

Example 7 Isolation, characterization and partial amino acid sequencing of Photorhabdus toxins

Isolation and N-terminal amino acid sequencing: In a series of experiments conducted in parallel with Examples 5 and 6, the photorhabdus protein was precipitated with ammonium sulphate, by adjusting the Photorhabdus broth, typically 2-3 liters, to a final concentration or 10% or 20% by the slow addition of ammonium sulfate crystals. After stirring for 1 h at 4 ° C, the material was centrifuged at 12000xg for 30 min. The supernatant was adjusted to 80% ammonium sulfate, stirred at 4 ° C for 1 h and centrifuged at 12000xg for 60 min. The pellet was resuspended in one to ten volumes of Na ₂ PO ₄ 10 mM pH 7.0 and dialyzed against the same phosphate buffer overnight at 4 ° C. The dialyzed material was centrifuged at 1.2000xg for 1 h before ion exchange chromatography.

An anion exchange column HR16 / 50 Q Sepharose (Pharmacia) was equilibrated with 10 mM Na ₂ PO ₄ , pH 7.0. The dialyzed, centrifuged ammonium sulfate pellet was applied to the Q Sepharose column at a rate of 1.5 ml / min and washed extensively at 3.0 ml / min with equilibration buffer to optical density (OD 280), reaching more less than 0,100. Further, a NaCI gradient in the range 0 to 0.5 M at 3 ml / min was applied to the column, or a series of elution steps using 0.1 M, 0.4 M and finally 1.0 NaCl for 60 min each. The fractions were collected and concentrated using a Centriprep 100. Alternatively, the proteins could be eluted by a single wash 0.4 M NaCl, without previous elution with 0.1 M NaCl.

Aliquots of 2 mL Q Sepharose concentrated samples were loaded at 0.5 mL / min on a 16/50 Seperose 12 gel filtration column (Pharmacia) equilibrated with 10 mM Na ₂ PO4, pH 7.0. The column was washed with the same buffer for 240 min at 0.5 ml / min and 2 min samples were collected. The free volume material was collected and concentrated using a Centriprep 100. Aliquots of 2 ml concentrated samples of Superose 12 were applied at 0.5 ml / min in a column of filter gel HR 16/50 Sepharose 4B-CL (Pharmacia ) with 10 mM Na ₂ PO ₄ , pH 7.0. The column was washed with the same buffer for 140 min at 0.5 ml / min and in 2 min samples were collected.

The excluded protein peak was subjected to a second fractionation by applying a gel filtration column using a Sepharose CL-4B resin, which separates proteins from ~ 30 kDa to 1000 kDa. This fraction was broken down into two peaks: a minor peak at free volume (> 1000 kDa) and a major peak that eluted to an apparent molecular weight, at about 860 kDa. After a period of one week, the samples further subjected to gel filtration showed the gradual appearance of a third peak (approx. 325 kDa), which appears to occur from the major peak, probably due to limited proteolysis. Biotests performed on the third peak showed that the free peak has no activity, while the 869 kDa toxin complex fraction has high activity and the 325 kDa peak has low activity, although totally strong. SDS PAGE analysis of the Sepharose CL-4B toxin complex peaks from different fermentation products showed two distinct peptide patterns, labeled "P and" S. The

RO 121280 Β1 two models recorded differences in molecular weights and concentrations of component 1 peptide in their fractions. Model S, most commonly produced, has 4 peptides with high molecular weights (> 150 kDa), while model P has 3 peptides with high molecular weights. 3 In addition, the S-peptide fraction was found to be 2-3 times more active against European Corn Borer. This change may refer to variations in the expression of the protein due to the age of 5 inoculations and / or other factors based on the increase of the parameters of the aged cultures.

Quantities in milligrams of peak toxin complex fractions, determined to be 7-peptide P or S models, were subjected to preparative SDS PAGE and transfected with TRIS-glycine (Seprabuff ™ to PVDF membranes (ProBlott ™, Applied Biosystems) for 3-4 h. Blots 9 were sent for N-terminal amino acid and amino acid analyzes, sequencing at Harvard MicroChem and Cambridge ProChem, respectively. Three S-pattern peptides had 11 N-terminal single amino acid sequences, compared with the sequences identified in the previous example A 201 kDa peptide (TcdAJ located before SEQ ID NO: 13, in the following, 13 divides between 33% amino acid identity and 50% similarity to SEQ ID NO: 1 (TcbA,) ( Table 10 shows the vertical lines denoting amino acid identities in table 10 and columns indicate conservative amino acid substitutions.) A second 197 kDa peptide, SEQ ID NO: 14 (TcdB) had 42% identity and 58% homology with SEQ ID NO: 2 (TcaC) A third sequence In addition, a N-terminal amino acid sequence, SEQ ID NO: 16 (TcbA) of a peptide of at least 235 kDa, was denoted in homology to the amino acid sequence, SEQ ID 19, by 205 kDa. NR: 12, deduced from a cloned gene (tcbA), SEQ ID NO: 11, containing a deduced amino acid sequence corresponding to SEQ ID NO: 1 (TcbA ,,). This shows that the higher peptide 21 235+ kDa was proteolytically processed to peptide 201 kDa, (TcbA,), (SEQ ID NO: 1), during fermentation, which probably results in the activation of the molecule. In another sequence, the original sequence reported as SEQ ID NO: 5 (TcaB '), reported in Example 5 above, was found to contain an aspartic acid residue (Asp) at the third position, rather than glycine (Gly) and two additional amino acids 25 Gly and Asp at positions 8 and 9 respectively. In two other sequences, SEQ ID NO: 2 (TcaC) and SEQ ID NO: 3 (tCAB,), an additional amino acid sequence was obtained. Densitometric quantity 27 was performed using a sample that was identical to preparation S, requiring N-terminal analysis. This analysis showed that the 201 kDa and 197 kDa peptides represent 29 7.0% and 7.2%, respectively, of the total Coomassie briliant blue colored protein in model S and is present in quantities similar to other abundant peptides. It has been appreciated that these peptides 31 may represent protein homologues, analogous to those found with other bacterial toxins, such as various Cryl Bt toxins. These proteins range from 40-90% homology to their N-terminal amino acid sequence, which surrounds the toxic fragment.

Internal amino acid sequencing to facilitate cloning of the toxin peptide genes, 35 internal amino acid sequences of the selected peptides were obtained as follows. Quantities in milligrams of the peak of the 2A fractions, determined from the P or S peptide models, 37 were subjected to the preparative SDS PAGE and TRIS-glycine (Seprabuff ™ to PVDF membranes (ProBlott ™, Applied Biosystems)) was transferred for 3- 4 h. Blots were sent for amino acid analysis and N-terminal amino acid sequencing, at Harvard MicroChem and Cambridge ProChem, respectively. Three peptides mentioned as TcbA ^ (containing SEQ ID NO: 1), TcdA, 41 and TcaBj (containing SEQ ID NO: 3) were subjected to trypsin digestion by Harvard MicroChem, followed by HPLC chromatography, to separate the individual peptides. 43 N-terminal amino acid analyzes were performed on tryptically selected peptide fragments. internal peptides were sequenced for TcaBj peptides (205 kDa peptide) referred to as TcaB-PTIH (SEQ ID 45 NO: 17) and TcaB _r PT79 (SEQ ID NO: 18). Two internal peptides were sequenced for TcaBj peptide ( 68 kDa peptide referred to as TcaBj-PT158 (SEQ ID NO: 1 9) and TcaBj-PT108 (SEQ 47 ID NO: 20). Four internal peptides were sequenced for the TobA * peptide (201 kDa peptide) referred to as TCBAII-TP103 (SEQ ID NO: 21), TcbAjjPT56 (SEQ ID NO: 22), TcbA, PT81 (a) 49 (SEQ ID NO: 23) and TcbAjjPT81 (b) (SEQ ID NO: 24).

RO 121280 Β1

Table 10 N-terminal amino acid sequences

201 kDa (33% identity & 50% similarity to SEQ ID NO: 1)

LIGYNNQFSG'A SEQIDNR: 13

FIQGYSDLFGN-A SEQ ID NO: 1

197 kDa (42% identity & 58% similarity SEQ ID NO: 2)

MQNSQTFSVGEL SEQIDNR: 14

MQDSPEVSITTL SEQ ID NO.2

Example 8. Construction of a cosmid genomic DNA bank Photorhabdus luminescens W-14 and its research to isolate genes encoding peptides comprising the preparation of the toxic protein

Being a condition for the production of toxic Photorhabdus insect proteins in heterologous hosts and for other uses, it is necessary to isolate and characterize the genes encoding these peptides. This objective was pursued in parallel. One approach, described later, was based on the use of monoclonal and polyclonal antibodies against purified toxin, which were then used to isolate clones from an expression bank. Another approach, described in this example, is based on the use of N-terminal and internal amino acid sequence data to designate degenerate oligonucleotides for use in PCR amplification. Each method can be used to identify DNA clones containing peptide-encoding genes so as to enable isolation of the respective genes and to determine their base DNA sequence.

GENOMIC DNA ISOLATION: Photorhabdus luminescens strain W-14 (ATCC accession number 55397) grew agar 2% protease peptone # 3 (Difco Laboratories, Detroit, Ml) and insecticidal toxin competence was maintained by repeating biotest after transformation, using the method described in Example 1 above. A stirred 50 ml culture was produced in a 175 ml beaker in 2% protease peptone medium # 3, raised at 28 ° C and 150 rpm, for approximately 24 h. From this culture, 15 ml were pelleted and frozen in its environment at -20'0, until it thawed for DNA isolation. The thawed culture was centrifuged (700xg, 30 min) and the floating orange mucopolysaccharide material was removed. The remaining cell material was centrifuged (25000xg, 15 min) in the pellet, the bacterial cells and the medium were removed and removed.

Genomic DNA was isolated by an adaptation of the CTAB method described in section 2.4.1 of Current Protocols in Molecular Biology (Ausubel et al., Eds. John Wiley & Sons, 1994) (modified to include a shock salt and all volumes raised 10 times). Pelleted bacterial cells were resuspended in TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) to a final volume of 10 ml, then 12 ml of 5M NaCl was added; this mixture was centrifuged 20 min, at 15000xg. The pellet was resuspended in 5.7 ml TE and 300 ml 10% SDS and 60 ml proteinase K 20 mg / ml (Gibco BRL Products, Grand Island, NY; in sterile distilled water) were added to the suspension. This mixture was incubated at 37 ° C for one hour; then about 10 mg of lysozyme (Worthington Biocgemical Corp., Freehold, NJ) was added. After a further 45 min, 1 ml of 5M NaCl and 800 ml of CTAB / NaCl solution (10% w / v CTAB,

RO 121280 Β1

0.7 MnaCl). This preparation was incubated for 10 min at 65C, then gently shaken and an additional 1 incubated and stirred for approximately 20 min to support clarification of the cell material. An equal volume of chloroform / isoamyl alcohol solution (24: 1, v / v) was added, the mixture was softened and centrifuged. After two extractions with an equal volume of PCI (phenol / chloroform / isoamyl alcohol; 50: 49: 1, v / v / v; equilibrated with IM Tris-HCl, pH 8.0; Intermountain Scientific 5 Corporation, Kaysville, UT ), precipitated the DNA with 0.6 volumes of isopropanol, the precipitated DNA was gently removed with a glass rod, washed twice with 70% ethanol, dried and dissolved in 2 ml STE (10 rM Tris -HCl pH 8.0, 10 mM NaCl, 1 mM EDTA). This preparation contained 2.5 mg / ml DNA, as determined by optical density at 260 nm (for example 9, OD ₂₆₀ ).

The molecular size domain of the isolated genomic DNA was evaluated to match the bank's construction. CHSF gel analysis was performed on 1.5% agarose gels (Seakem® LE, FMC BioProducts, Rockland, ME) with 0.5xTBE buffer (44.5 mM Tris-HCl pH 8.0.44.5 mM 13 H ₃ BO ₃ , 1 mM EDTA) on a BioRad CHEF-DRii device with a Tulseware 760 Switcher (Bio-Rad Laboratories, Inc., Richmond, CA). The operating parameters are: initial time A, 15 3 s; final time A, 12 s; 200 volts; operating temperature, 4-18 ° C; operating period,

16.5 h. The staining of ethidium bronze and examination of the gel under ultraviolet light showed 17 that the DNA stretched from 30-250 kbp in size.

BANK BUILDING: A partial or partial digestion of this genomic DNA Photorhabdus 19 was made. The method was based on section 3.1.3 of Ausubel (supra). The adaptations included small-scale operating reactions, under different conditions, until 21 almost optimal results were obtained. There were some large scale reactions, with different conditions, the results were analyzed on CHEF gels and only the large scale preparation, the best one, was continued. in the optimal case, 200 pg Photorhabdus genomic DNA was incubated with 1.5 units of Sau3A 1 (New England Biolabs, NEB, Beverly, MA) for 15 min, in a total volume of 2 ml 25 buffer 1 x NEB 4 (supplemented as 10x by the manufacturer). The reaction was stopped by adding 2 ml PCZ and centrifugation at 8000xg, for 10 min. To the supernatant were added 200 µl 27 5M NaCl, plus 6 ml ice-cold ethanol. This preparation was cooled for 30 min at -20 ° C, then centrifuged at 12000xg for 15 min. The supernatant was removed and precipitate 29 was dried in a vacuum oven at 40 ° C, then resuspended in 400 μΙ STE. The spectrophotometric test indicated approximately 40% recovery of the absorbed DNA. The digested DNA was fragmented by size on a sucrose gradient, according to section 5.3.2 of the CPMB (op.cit.).

A 10% to 40% (w / v) sucrose linear gradient was prepared with a gradient made in 33 Ultra-Clear ™ tubes (Beckman Instruments, Inc., Palo Alto, CA) and the DNA sample was stratified at the peak.

After centrifugation, (26ppp rpm, 17h, Beckman rotor SW41,20'C), the fractions (about 35 759 μΙ) were pulled down from the tip of the gradient and analyzed by CHEF gel electrophoresis (as described before). The fractions containing Sau3A 37 1 fragments in the size range 20-40 kpb were selected and precipitated by a modification (amounts of all solutions approximately 6.3-fold increased) of the method described in section 5.5. of Ausubel 39 (supra.). After precipitation, overnight, the DNA was collected by centrifugation (17000xg, min), dried, re-dissolved in TE, stored in a total volume of 80 μΙ and reprocessed again. 8 μΙ 3M sodium acetate and 220 μΙ ethanol. The pellet collected by centrifugation as above was resuspended in 12 μΙ TE. DNA concentration was determined by 43 Hoechst 33258 dye fluorometry (Polysciences, Inc., Warrington, PA) in a HoeferTKOIOO fluorimeter (Hoefer Scientific Instruments, San Francisco, CA). Approximately 2.5 µg of fragmented DNA was recovered by size.

20 pg cosmid pWe 15 DNA (Stratagene, La Joi la, CA) was digested at completion with 47

100 units of BamHI restriction enzyme (NEB) in the manufacturer's buffer (final volume 200 μΙ,

RO 121280 Β1

37C, one hour). The reaction was extracted with 100 µl PCI and DNA was precipitated from the aqueous phase, by the addition of 20 µl 3M sodium acetate and 550 µl absolute -20'C ethanol. After 20 min, at -70 ° C, DNA was collected by centrifugation (17000xg, 15 min), dried under vacuum and dissolved in 180 µl 10 mM Tris-HC1, pH 8.0. To this was added 20 μΙ 10x CIP buffer (100 mM Tris-HCl, pH 8.3; 10 mM ZnCl ₂ ; 10 mM MgCl ₂ ) and 1 μΙ (0.25 units) of calf intestinal alkaline phosphatase 1: 4 (Boehringer mannheim Corporation, Indianapoli, IN). After 30 min, at 370 ° C, the following additions were made: 2 μΙ 0.5 m EDTA, pH 8.0; 10 μΙ 10% SDS; 0.5 μΙ of proteinase K 20 mg / ml (as above), followed by incubation at 55 ° C for 30 min. After sequential extraction with 100 μΙ PCI and 100 μΙ phenol (Intermountain Scientific Corporation, equilibrated with Tris-HC11 M, pH 8.0), dephosphorylated DNA was precipitated by addition of 72 μΙ ammonium acetate.

7.5 M and 550 μΙ ethanol -20 ° C, incubation on ice for 30 min and centrifugation as above. The pelleted DNA was washed once with 500 μΙ -20 ° C 70%, dried under vacuum and dissolved in 20 μΙ TE buffer.

Binding of the size-fractionated Sau3A 1 fragments to the pWE15 vector digested BamH 1 and phosphatase was performed using T4 ligase (NEB) by modifying (i.e., using a premixed 10X ligation buffer provided by the manufacturer) to the protocol in section 3.33 of Ausubel. The ligation was performed overnight, in a total volume of 20 μΙ at 15 ° C, followed by storage at -20 ° C.

μΙ of the cosmid DNA ligation reaction, containing about 1 µg of DNA, were packaged in bacteriophage lambda, using a commercial packing extract (Gigapack® III Gold Packaging Extract, Startagene), following the manufacturer's instructions. The packing preparation was stored at 4 ° C until use. The packaged cosmid preparation was used to infect Escherichia coli XLI Blue MR (Stratagene) cells according to the Gigapack® III Gold (Titerinh the Cosmid Library) protocols, as follows. Blue MR XLI cells were grown in LB medium (g / L: Bacto-tryptone, 10; Bacto-yeast extract, 5; Agar-Bacto, 15; NaCI, 5; [Difco Laboratories, Detroit, Ml]) containing 0.2% (w / v) maltose plus 10 mM MgSO ₄ at 37 ° C. After 5 h of growth, the cells were pelleted at 700xg (15 min) and resuspended in 6ml 10 mM MgSO ₄ . The culture density was adjusted with 10 mM MgSO ₄ at OD ₆₀₀ = 0; 5. The packed cosmid bank was diluted 1:10 or 1:20 with sterile MS medium (0.1 M NaCl, 10 mM MgSO ₄ , 50 mM Tris-HCl pH 7.5.0.01% w / v gelatin) and 25 μΙ diluted preparation was mixed with 25 μΙ diluted XL1 Blue MR cells. The mixture was incubated at 25 ° C for 30 min (without stirring), then 200 μΙ LB broth was added and incubation continued for approximately one hour, stirring gently, occasionally. Aliquots of this culture (20-40 μΙ) were spread on LB agar plates containing 100 mg / l ampicillin (ie, LB-Amp ₁₀₀ ) and incubated overnight at 37 ° C. To deposit the bank without amplification, the individual colonies were collected and inoculated into the individual wells of the 96-well sterile microgrid plates; each well containing 75 μΙ Terrific Broth (TB medium: 12 g / l Bacto-tryptone, 24 g / l Bacto-yeast extract, 0.4% v / v glycerol, 17 mM KH ₂ PO ₄ , 72 mM K ₂ HPO ₄ ) plus 100 mg / l ampicillin (ie, TB-Amp ₁₀₀ ) and incubated (without shaking) overnight at 37 ° C. After replication of the 96-well plate into a copy plate, 75 μΙ / well of sterilized filtration TB was added to the plate: glycerol (1: 1, v / v; with or without 100 mg / l ampicillin), shaken summary at 100 rpm and closed with Parafilm® (American National Can, Greenwich, CT) and placed at -70 ° C, in a freezer for storage. Copy plates were grown and processed in the same way as the master board. A total of 40 such master plates (and their copies) were also prepared.

RESEARCHING THE BANK WITH RADIOMMARKED DNA SAMPLES: To prepare colony filters for testing with labeled radioactive samples, ten 96-well plates of the bank were thawed at 25 ° C (peak at room temperature). A 96-point template coating tool was used to inoculate a new, 96-well copy plate containing

RO 121280 Β1 μΙ / TB-Amp _{100 well} . The copy plate was grown overnight (stationary) at 37 ° C, then shaken for 30 minutes, at 100 rpm at 37'C. A total of 800 colonies were represented in these plates, due to the non-growth of some isolates. The template instrument was used to inoculate 3 fingerprints of the 96-well matrix on naylon membranes (0.45 μ, 200x250 mm) Magna NT (MSI, Westboro, MA) that had been placed on solid LB-AmplOO (100 ml / vessel). In 5 Plastic Bio-test vessels (Nune, 243x243x18 mm; Curtin Mathison Scientific, Inc., Wood Dale, IL). Colonies were grown on membranes at 37 ° C for about 3 hours. 7

A positive control colony (a bacterial clone containing a GZ4 sequence insert, see below) was grown on a Magna NT membrane (Nune, 0.45 μ, circle 82 mm) separated 9 on LB medium supplemented with 35 mg / l chloramphenicol (ie, LB-Cam ₃₅ ) and processed along the membranes of the bank colony. The bacterial colonies on the membrane were lysed and DNA 11 was denatured and neutralized according to the protocol taken from Genius ™ System User'sGuide Version 2.0 (BoehringerMannheim, Indianapolis, IN). The membranes were plated with the colony side on top of a filter paper soaked with 0.5 N NaOH plus 1.5 M NaCl, for 15 min, to distort, and neutralized on a filter soaked with 15 IM Tris-HCl pH 8.0 1.5 M NaCl, for 15 min. After crossIinking-UV using a Stratagene UV Stratalinker set on the crosslink car, the membranes were stored at 25 ”C, up to 17 use. The membranes were smoothed into strips containing duplicate fingerprints of a single 96-well plate, then washed extensively by the method of section 6.4.1 in CPMB (op.cit.): 3 h, at 19 25 ° C, in 3x SSC, 0.1% (w / v) SDS, followed by 1 hour, at 65 ° C, in the same solution, then rinsed in 2x SSC in preparation for the hybridization step (20x SSC = 3M NaCl, 0.3 M 21 sodium citrate, pH 7.0).

Amplification of a specific genomic fragment of the tcaC gene 23

Based on the N-terminal amino acid sequence, it was determined for the peptide fraction

Purified TcaC [described herein as SEQ ID NO: 2], a degenerate oligonucleotide repository 25 (reserve S4Psh) was synthesized by standard p-cyanoethyl chemistry on an Applied BioSystem ABI394 DN A / RN A Synthesizer (Perkin Elmer, Foster City, CA ). The oligonucleotides were deprotected for 8 h at 55 ”C, dissolved in water, quantitatively determined by spectrophotometry measurements and diluted for use. This deposit corresponds to the 29 N-terminal amino acid sequence determined for the TcaC peptide.

The determined amino acid sequence and the degenerate DNA sequence are given below, 31 where A, C, G and T are standard DNA bases and I represents inosine:

Amino Acid Met Gin Asp Ser Pro Glu Val

S4Psh 5 'ATG CA (A / G) GA (T / C) (T / A) (C / G) (T / A) CCI GA (A / G) GT 3'35

Another set of degenerate oligonucleotides (repository P2.3.5R) was synthesized, which represents the complement of the coding chain for the amino acid sequence determined in SEQ ID 37 NR: 17:

Amino-39 acid Ala Phe Asp lle Asp Asp Val

Codons 5 'GCN TT (T / C) AA (T / C) AT (A / T / C) GA (T / C) GA (T / C) GT 3'41

P2.3.5R 3 'CG (A / C / G / T) AA (A / G) TT (A / G) TA (T / A / G) CT (A / G) CT (A / G) CA 5 '

These oligonucleotides were used as primers in Polymerase Chain Reactions (PCR®, 43 Roche Molecular Systems, Branchburg, NJ) to amplify the specific DNA fragment from genomic DNA prepared from the W-14 Photorhabdus strain (see above). A typical reaction (50 μΙ) 45 containing 125 pmol from each P2Psh and P2.3.5R primer repository, 255 ng genomic DNA template, 10 nmol from each of dATP, dCTP, dGTP and dTTP, GeneAmp® PCR IX buffer and 47

2.5 units of AmpliTaq® DNA polymerase (both from Roche Molecular Systems; buffer

RO 121280 Β1

10X GeneAmp® is 100 mM Tris-HCl pH 8.3,500 raM Kcl, 0.01% w / v gelatin). Amplifications were performed in a Perkin ElmerCetus DNAThermalCycler (Perkin Elmer, FosterCity, Ca), using 35 cycles of 94 "C (1.0 min), 55'C (2.0 min), 72 ° C (3, 0 min), followed by an extension period of 7.0 min, at 72 ° C. Amplification products were analyzed by 2% w / v NuSieve® 3: 1 agarose (FMC Buo Products) electrophoresis in TEA buffer (40 mM Tris-acetate, 2 mM EDTA, pH 8.0). A specific product, estimated to be 250 bp in size, has been observed in numerous other products amplified by ethidium bromide (0.5 µg / ml), gel staining, and examination under ultraviolet light.

The gel region containing a product of approximately 250 bp was excised and a small plug (0.5 mm dia.) Was removed and used to feed the template for PCR amplification (40 cycles). The reaction (50 µl) contained the same components as above, minus the genomic DNA template. After amplification, the ends of the fragments were stained and phosphorylated by incubation at 25 ° C, for 20 min, with a T4 DNA polymerase unit (NEB), 1 nmol ATP and 2.15 units of T4 kinase (Pharmacia Biotech Inc. ., Piscataway, NJ).

DNA fragments were separated from residual primers by 1% w / v GTG® (FMC) agarose electrophoresis in TEA. A gel slice containing fragments of apparent size 250 bp was excised and DNA was extracted using a Qiaex kit (Qiagen Inc., Chatsworth, CA).

The extracted DNA fragments were ligated to the pBC plasmid vector KS (+) (Stratagene) which was digested upon completion of the restriction enzyme Sma 1 and extracted in a manner similar to that described for pW15 DNA, above. A typical ligation reaction (16.3 μΙ) contained 100 ng pBC KS (+) DNA digester, 70 ng 250 bp DNA fragment, 1 nmol [Co (NH ₃ ) ₆ ] Cl ₃ and 3.9 units Weiss ANDIigase T4 (Collaborative Biomedical Products, Bedford, MA), in 1X ligation buffer (50 mM Tris-HCl), pH 7.4; 10 mM MgCl ₂ ; 10 mM dithiothreitol; 1 mM spermidine, 1 mM ATP, 100 mg / ml bovine serum albumin). After incubation overnight, at 14 ° C, the ligated products were transformed into ice, competent Escherichia coli DH5a cells (Gico BRL) according to the suppliers' recommendations and covered on LB-Cam ₃₅ plates, containing IPTG (119 pg / ml ) and X-gal (50 µg / ml). Independent white colonies were pierced and plasmid DNA was prepared by a modified Prism ™ Ready Reaction Dyedeoxy ™ Terminator Cyscle Sequencing Kit Protocols (ABI / Perkin Elmer). The nucleidic sequence of both DNA insert chains was determined using T7 primers [pBC KS (+) bases 601-623: TAAAACGACGGCCAGTGAGCGCG) and LacZ [pBCKS (+) bases792-816: ATGACCATGATTACGCCAAGCGCGC) and food safety protocols ™ (ABI / Perkin Elmer). Dideoxyribonucleotide-dye-terminatedornones incorporate removed by passage through Centri-Sep 100 columns (Princeton Separations, Inc., Adelphia, NJ), according to the manufacturer's instructions. The DNA sequence was obtained by analyzing the samples on an ABI Model 373 A DNA Sequencer (ABI / Perkin Elmer). The DNA sequences of the two isolates, GZ4 and HB14, resulted as shown in FIG. 1.

This sequence illustrates the following characteristics: 1) bases 1-20 represent one of the 64 possible sequences of S4Psh degenerate oligonucleotides, ii) the amino acid sequence 1-3 and 6-12 corresponds exactly to that determined for the N-terminus of TcaC (described as SEQID NO : 2), iii) The fourth encoded amino acid is a cysteine residue rather than serine. This difference is degenerate coded for serine codons (see above), iv) the fifth encoded amino acid is praline, corresponding to the N-terminal TcaC sequence given as SEQ ID NO: 2, v) bases 257-276 encode one of the 192 sequences possible designated in the degenerate repository, vi) the TGA termination codon introduced at bases 268-270 is the result of complementarity to the degenerate construct in the oligonucleotide repository at the corresponding position and does not indicate a reduced reading frame for the corresponding gene.

RO 121280 Β1

Marking of the gene-specific tcaC peptide sample. 1

DNA fragments corresponding to the above 276 data were amplified (35 cycles) by PCR® in a reaction volume of 100 µl, using 100 pmol each of the primers P2Psh 3 and P2.3.5T, 10 ng of plasmids GZ4 and HB14 as templates, 20 nmol each of dATP.dCTP, dGTOP and dTTP, 5 AmpliTAq® DNA polymerase units and 1X GeneAmp® buffer concentration, 5 under the same temperature regimes as described above. The amplification products were extracted from a 1% GTG® agarose gel by Qiaex kit and quantitatively determined by 7 fluorometry.

The amplification products extracted from the HB14 plasmid template (approximately 400 ng) were divided into five aliquots and labeled with ³² P-dCTP, using High Prime Labeling Mix (Boehringer Mannheim), according to the manufacturer's instructions. The unincorporated radioisotope 11 was removed by passing through NucTrap® Probe Purification Clumns (Stratagene), according to the instructions of the supplier. The specific activity of the labeled DNA product was determined, by 13 scintillation counts, to be 3.11 x 108 dpm / pg. This labeled DNA was used to sample membranes prepared from the 800 members of the genomic bank. 15

RESEARCH WITH A GENE-SPECIFIC Peptide-TCAC TEST. The radiolabelled HB14 sample was boiled for approximately 10 min, then a minimal hib solution was added. [Note: 17

The minimal hyb method is taken from a CERES protocol; Restriction Fragment Length Polymorphism Laboratory Manual version 4.0, sections 4-40 and 4.47; CERES / NPI, Salt Lake 19 City, UT. NPI, which is now out of use, with its successors operating as Linkage Gebetics], minimal hyb solution contains 10% w / v PEG (polyethylene glycol, molecular weight 21 about 8000), 7% w / v SDS; 0.6X SSC, 10 mM sodium phosphate buffer (from stock IX containing 95 g / l NaH ₂ PO ₄ «1H ₂ O and 84.5 g / l Na ₂ HPO ₄ « 7H ₂ O), 5 mM EDTA and 100 mg / ml 23 DNA denatured from salmon sperm. The membranes were wiped, dried briefly, then, without prehybridization, 5 strips of the membrane were placed in each of the two plastic boxes, 25 containing 75 ml of minimal hyb and 2.6 ng / ml of HB14 sample. radiolabeled. It was incubated overnight with gentle shaking (50 rpm), at 60'C, in minimal hyb washing solution (0.25X SSC, 27 0.2% SDS), followed by two 30 min washes, with slight shaking at 60'C in the same solution. The filters were placed on Saran Wrap® coated paper (Dow Brands, Indianapolis, IN), 29 in a dense light autoradiographic box and exposed to X-ray film (Kodak, Rochester, NY) with two amplifiers. DuPont Cronex Lightning-Plus CI (Sigma Chemical Co., 31 St. Louis, MO), for 4 h, at -70 ° C. On development (standard photographic procedures), significant signals were highlighted in both replicates, against an intense background of weak 33 more irregular signals. The filters were washed again for about 4 h at 68GC in minimal hyb washing solution and then placed again in cassettes, and the film was exposed overnight at 35-70 ° C. There were identified 12 possible positives due to the strong signals on both fingerprints 96-well duplicated colonies. No signal was seen with negative control membranes of 37 (XLI Blue MR cell colonies containing pWE 15), but a very strong signal with positive control membranes was observed (DH5a cells containing GZ4 isolated from the PCR product). ), which was currently processed with experimental evidence. The 12 putative hybridization-positive colonies were recovered from the bank's 96-well frozen plates and grew 41 overnight at 37 ° C, on solid LB-AmplOO medium. For hybridization, two sets of membranes were prepared (Magna NT nylon, 0.45 μ). The first set was prepared by placing 43 a filter directly into columns on a piece of remaining plate, then removed with adherent bacterial cells and proceeded as below. The filters of the second set were placed on plates 45 containing LB-Amp ₁₀₀ medium, then inoculated with transfer cells from the remaining plate piece to the filters. After rising overnight at 37 ° C, the filters were removed from the plates and 47 were processed.

RO 121280 Β1

The bacterial cells on the filters were used with denatured DNA by placing each filter with the colony upwards in a deposit (1.0 ml) of 0.5 N NaOH, in a plastic plate, for 3 min. The filters were wiped dry on a towel paper, then the process was repeated with fresh 0.5N NaOH, After dry wiping, the filters were neutralized by placing each on a 1.0 ml tank of Tris-HCl IM, pH 7 , 5, for 3 min, were wiped dry and re-neutralized with fresh buffer. This was followed by two similar soakings (5 min, each) on deposits with 0.5 M Tr / s-HCl, pH 7.5 plus 1.5 M NaCl. After dry removal, the DNA was crosslinked to UV on the filter (as above) and the filters were washed (25 ° C, 100 rpm) in nearly 100 ml of 3X SSC plus 0.1% (w / v). SDS (4 times, 30 min, each with fresh solution for each wash). Then, they were placed in a minimum volume of prehybridization solution [6X SSC plus 1% w / v each of Ficoll 400 (Pharmacia), polyvinylpyrrolidone (average molecular weight 360000; Sigma) and bovine serum albumin Fraction V; (Sigma)] for 2 h, at 65 ° C, 50 rpm. The prehybridization solution was removed and placed with the BH14 ³² P-labeled sample which was saved from the previous hybridization of the bank membranes and which was distorted at 95 ° C for 5 min. Hybridization was performed at 60 °, for 16 h, with shaking at 50 rpm.

After removing the labeled sample solution, the membranes were washed 2 times at 25 ° C (50 rpm, 15 min) in 3X SSC (about 150 ml each washed). They were then washed for 3 h at 68 ° C (50 rpm) in 0.25X SSC plus 0.2% SDS (minimal hyb washing solution) and exposed to X-ray film, as described above, for 1.5 to 25 ° C (research not applied). This exposure demonstrated very strong hybridization signals at cosmid isolates 22G12, 25A10, 16A5 and 16B10 and a very weak signal with cosmid isolate 8B10. No signal was seen in the negative control colonies (pWE15) and a very strong signal was seen with positive control membranes (DH5a cells containing GZ4 isolate of the PCR product), which was currently processed with experimental samples.

AMPLIFICATION OF A SPECIFIC GENOMIC FRAGMENT OF THE TCAB GENE. Based on an N-terminal amino acid sequence determined for the purified TcaBj peptide fraction (described herein as SEQ ID NO: 3), a degenerate oligonucleotide deposit (P8F deposit) was synthesized, as described for the TcaC peptide. The determined amino acid sequence and the corresponding degenerate DNA sequence are given below, where A, C, G and T are standard DNA bases and I represents inosine:

Amino acid Leu Phe Thr Gin Thr Leu Lys Glu Ala Arg

P8F 5 'TTT ACI CA (A / G) ACI (C / T) TI AAA GAA GCI (A / C) G3 * (C / T) TI

Another set of degenerate oligonucleotides were synthesized (repository P8.108.3R), representing the complement of the coding chain for the amino acid sequence of the internal peptide TcaB; PT108 (described herein as SEQ ID NO: 20):

Amino acid Met Tyr Tyr Oe Gin Ala Gin Gin

ATG codon TA (T / C) TA (T / C) AT (T / C / A) CA (A / G) GC (A / C / G / T) CA (A / G) CA (A / G) p8.108.3R 3 AT (A / G) AT (A / G) TA (A / G / T) GT (T / C) CGI GT (T / C) GT 5 '

TAC

These oligonucleotides were used as primers for PCR® using HotStart 50 Tubes ™ (Molecular Bio-products, Inc., San Diego. CA) to amplify a specific DNA fragment from genomic DNA prepared from Photorhabdus strain W-14 ( see above). A typical reaction (50 µl) contained (bottom line) 25 pmol of each P8F and P8.108.3R storage primer with 2 nmol each of dATP, dCTP, dGTP, and dTTP, in GeneAmp® PCR buffer IX and (peak line). ) 230 ng genomic template DNA, 8 nmol each of dATP, dGTP and dTTP

EN 121280 Β1 and 2.5 units of AmpliTaq® DNA polymerase in GeneAmp®PCR IX buffer. The amplification was achieved by 35 cycles, as described by the peptide TcaC peptide. The amplification products were analyzed by 0.7% w / v agarose electrophoresis SeaKem® LE (FMC) in TE buffer. A specific product of an estimated size of 1600 bp was observed.

Four such reactions were stored and the amplified DNA was extracted from a 1.0% gel 5

SeaKem® LE via Qiaex kit, as described for the TcaC peptide. The extracted DNA was used directly as a template for sequence determination (PRISM ™ Sequencing Kit), using 7 P8F and P8.108.3R primer deposits. Each reaction contained nearly 100 ng of template DNA and 25 pmol of a primer was processed according to standard protocols, as described for the TcaC peptide. An analysis of the sequence derived from the extension of the P8F primers shows that the DNA sequence is short (and the amino acid sequence coded): 11

GAT GCA TTG CTT GCT

Asp Ala Leu (Val) Ala13 corresponding to a portion of the N-terminal peptide sequence described as SEQ ID NO: 3 (TcaB,).

Marking of the tcaB peptide sample, gene specific

About 50 ng of the gel-purified TcaBj DNA fragment was labeled with ³² P-dCTP as described above and unincorporated radioisotopes were removed by passage through NICK Column® (Pharmacia). Specific activity of the DNA was marked at 6 x 109 dpm / pg. This labeled DNA 19 was used to test the colonic membranes prepared from the genomic bank membranes that hybridized to the specific TcaC-peptide sample. 21

The membranes containing 12 colonies identified in the test-TcaC bank research (see above) were removed from the radioactive TcaC-specific label, by boiling 23 twice for about 30 minutes, each time in a liter of 0, 1 X SSC plus 0.1% SDS. Radiolabelling removal was verified with 6 h film exposure. The removed membranes were then incubated with the TcaBt-specific peptide sample prepared above. The labeled DNA was boiled for 10 min and then added to the filtrates that had been incubated for 27 hours in 100 ml of minimal hyb solution at 60 ° C. After overnight hybridization, at this temperature, the sample solution was removed and the filtrates were washed as follows (all in 29 0.3X SSC plus 0.1% SDS): once for 10 min, at 25'C, once for one hour, at 60 ° C in fresh solution and once for one hour at 63'C in fresh solution. After 1.5 h of exposure to X-ray film 31, following standard procedures, 4 strongly hybridized colonies were observed. These were, as in the case of the TcaC specific sample, isolates 22G12,25A10,26A5 and 26B10. 33

The same sample solution TcaB; diluted with an equal volume (about 100 ml) of minimal hyb solution and then used to search for membranes containing 800 members of 35 genomic banks. After hybridization, washing, and exposure to X-ray film, as described above, only four cosmid clones 22G12, 25A10, 26A5, and 26b10 were found to hybridize strongly to this sample.

Isolation of sub-genes containing genes encoding TcaC and TcaB peptides, and determination of their basic DNA sequence:

They were stirred overnight (200 rpm) at 30 ° C in 100 ml TB-Amp ₁₀₀ 3 41 positively hybridized cosmids in XL1 Blue MR strain. After harvesting the cells by centrifugation, DNA was prepared using a commercially available kit (BIGprep ™, 5 Prime 3 Prime, 43 Inc., Boulder, CO), using the manufacturer's protocol. Only one cosmid, 26A5, was successfully isolated by this procedure. When digested with the restriction enzyme EcoR 1 (NEB) 45 and analyzed by gel electrophoresis, fragments of approximate sizes 14, 10.8 (vector), 5, 3.3, 2.9 and 1 were detected. 5 kbp. A second attempt to isolate cosmid DNA from the same 47 three strains (8 ml culture; TB-Amp ₁₀₀ , 30 ° C, using the boiling miniprep method (Evans G. and

RO 121280 Β1

G.Wahl., 1987, Cosmid vectors forgenomic walking and rapid restriction mapping in Guide to Molecular Cloning Techniques. Meth. Enzymology, you guys. 152, S. Berger and A. Kimmel, eds., Pp. 604-610). Only one cosmid, 25A10, was successfully isolated by this method. When digested with restriction enzyme EcoR 1 (NEB) and analyzed by gel electrophoresis, this cosmid showed a fragmentation pattern identical to that observed earlier at cosmid 26 A5.

A 0.15 µg sample of cosmid 26A5 DNA was used to transform 50 ml of DHcα E.coli cells (Gibco BRL) through the supplier's protocol. An isolated individual colony of this strain was inoculated into 4 ml of TB-Amp ₁₀₀ and grown for 8 h at 37 ° C. Chloramphenicol was added to the final concentration of 225 µg / ml, incubation continued for another 24 h, then the cells were harvested by centrifugation and frozen at -20 ° C. Isolation of cosmid DNA 26 A5 was done by -a standard alkaline minipipe (Maniatis et al., op.cit, p.382), modified by increasing all volumes by 50% and with gentle shaking or mixing, rather than by spinning, at each stage. After washing the DNA pellet in 70% ethanol, it was dissolved in TE containing 25 (ag / ml ribonuclease A (Boehringer Mannheim).

Identification of EcoR 1 fragments that hybridize to GZ4-derived and TcaB samples. Approximately 0.4 µg of 25A10 cosmid (from XL1 Blue MR cells) and approximately 0.5 µg of 26A5 cosmid (from chloramphenic amplified DH5a cells) were each digested with nearly 15 units of EcoR 1 (NEB) for 85 min, frozen overnight, then heated to 65 ° C for 5 min, and subjected to 0.7% agarose gel electrophoresis (Seakem®, 1X TEA, 80 volts, 90 min) . The DNA was stained with ethidium bromide, as described above, and photographed under ultraviolet light. Digestion with EeoR 1 of cosmid 25A10 was a complete digestion, but the sample of cosmid 26A5 was partially digested under these conditions. The agarose gel containing the DNA fragments was subjected to purification, denaturation and neutralization, followed by Southem blot on Magna NT nylon membranes, using a high salt protocol (20X SSC), all as described in section 2.9 of Ausubel et al. . (CPMB, op.cit). The transfected DNA was UV crosslinked to the nylon membrane as before.

A DNA fragment specific for the TcaC peptide that corresponds to the insert of plasmid GZ4 isolate, was amplified by PCR® in a reaction volume of 100 ml as described above earlier. The amplified products from 3 such reactions were stored and extracted from 1% GTG® agarose gel using Qiaex kit, as described above, and quantitatively determined by fluorometry. The purified DNA gel (100 ng) was labeled with ³² P-dCTP, using the High Prime Labeling Mix (Boehringer Mannheim) as described above, at a specific activity of 6.3 4x108 dpm / pg.

The ³² P labeled GZ4 sample was boiled for 10 min, then added to minimal hyb buffer (at 1 ng / ml) and the Southern blot membrane containing the digested cosmid DNA fragments was added and incubated for 4 h at 60 ° C. with gentle shaking at 50 rpm. Then, the membrane was washed 3 times at 25 ° C, almost 5 minutes each time (minimal hyb washing solution), followed by two washes for 30 minutes, each at 60 ° C. The blot was exposed to film (with amplified research) for almost 30 min, at -70 ° C. The GZ4 sample strongly hybridized to 5.0 kbp (apparent size) of the EcoR 1 fragment of both cosmids, 26A5 and 25A10.

Radioactivity was removed from the membrane by boiling for approximately 30 min in 0, IX SSC plus 0.1% SDS and the absence of radiolabelling was verified by film exposure. Then, it was hybridized at 60 ° C for 3.5 h with TcaBj sample (denatured) in minimal hyb buffer previously used for colonic membrane research (above), washed as described earlier and exposed to film time. 40 min, at -70 ° C, with two research amplifiers. ProbaTcaBj hybridized, with both cosmids, slightly with an EcoR 1 fragment of about 5.0 kbp and strong, with a fragment of about 2.9 kbp.

RO 121280 Β1

The cosmid DNA sample 26A5 described above (from DH5a cells) was used as the source of the DNA from which the bands of interest were subcloned. This DNA (2.5 µg) was digested with approximately 3 units of EcoR 1 (NEB) in a total volume of 30 µl for about 1.5 h, 3 to obtain partial digestion, as confirmed by electrophoresis on gel. 10 pg KS (+) pBC DNA (Stratagene) was digested for 1.5 h with 20 EcoR 1 units in a total volume of 20 μΙ, leading to total digestion, as confirmed by electrophoresis. Both EcoR 1 DNA preparations - cut or diluted to 50 μΙ with water, added to each 7 equal volumes of PCI, the suspension was gently mixed, spun in a microcentrifuge and the aqueous supernatant was collected. DNA was precipitated with 150 μΙ ethanol and the mixture was placed at 9 -20 ° C overnight. Following centrifugation and drying, EcoR 1 digested pBC KS (+) was dissolved in 100 μΙ TE; Partially digested 26A5 was dissolved in 20 μΙ TE. DNA recovery was verified by fluorometry.

In separate reactions, EcoR 1 digested pBC KS (+) DNA was ligated with approximately 180 ng 13 or 270 ng partially digested cosmid DNA 26A5. Ligations were performed in a volume of 20 μΙ, at 15 ° C, for 5 h, using T4 ligase and buffer from New England BioLabs. The ligation mixture 15, diluted to 100 μΙ with sterile TE, was used to transform frozen, competent DH5a cells (Gibco BRL) according to the supplier's instructions. Variable quantities 17 (25-200 μΙ) of transformed cells were deposited on freshly prepared LB-Cam ₃₅ medium with 1 mM IPTG and 50 mg / l X-gal. The plates were incubated at 37 ° C for about 20 hours, then cooled 19 in the dark for about 3 hours for color intensification to select the insert. The white colonies were collected on the rest of the plate of the same composition and incubated for 21 nights at 37 ° C.

Two protrusions of colonies, from each selected plate residue, were prepared 23 as follows. After raising the white colonies to fresh plates, round Magna NT nylon membranes were pressed onto the debris of the plates, the membrane was detached and subjected to 25 denaturation, neutralization and UV crosslinking, as described above for the bank's colony membranes. The prominence of the crosslinked colony was vigorously washed including gentle deletion of excess cellular debris with tissue. One set hybridized with the GZ4 (TcaC) sample solution described earlier and the other set hybridized with the 29 TcaB sample solution, described earlier, according to the minimal hyb protocol, following washing and exposure to the film, as described for the colony membranes. of the bank. 31

Colonies that showed hybridization signals, either with only the GZ4 sample, or with both GZ4 and TcaB samples, or only with the TcaBj sample, were selected for further processing, and the cells were streaked to isolate the individual colony on the environment. LB-Cam ₃₅ with IPTG and X-gal, as before. Approximately 35 individual colonies from 16 different isolates were separated in ₃₅ liquid LB-Cam medium and grown overnight at 37 ° C; the cells were centrifuged by centrifugation and plasmid DNA was isolated by standard alkaline minipeptide in accordance with Maniatis et al., (ap.cit.p.368). The DNA pellets were dissolved in TE + 25 µg / ml ribonuclease A and the DNA concentration was determined by fluorometry. The EcoR 1 digestion model was analyzed by gel electrophoresis. The following isolates were selected as useful. Isolate A17.2 contains only pBC KS (+) relayed and used for control (negative). Isolates D38.3 and 41 C44.1 each containing only 2.9 kpb, the TcaB fragment, which hybridizes to EcoR 1, was inserted into the KS (+) pBC. These plasmids named pDAB2000 and pDAB2001, respectively, are 43 illustrated in FIG. 2.

Isolate A35.3 contains only about 5 kbp, the GZ4- fragment hybridizing 45 EcoR 1 was inserted into KS (+) pBC. This plasmid was named pDAB2002 (also in Fig. 2). These isolates provide templates for DNA sequencing. 47 ί

RO 121280 Β1

The plasmids pDAB2000 and pDAB2001 were prepared using the BIGprep ™ kit, as above. The cultures (30 ml) were grown overnight in TB-Cam ₃₅ , at an OD ₆₀₀ of 2, then the plasmid was isolated according to the manufacturer's guidelines. The DNA pellets were each dissolved in 100 µl TE and the integrity of the sample was verified by digestion with EcoR 1 and by gel electrophoretic analysis. The sequencing reactions were performed in duplicate, with one replicate using as DNA template pDAB2000 and the other replicate using as template PDAB2001 DNA. Reactions were performed using the dideoxy dye termination cycle sequencing method, as described above for GZ4 / HB14 DNA sequencing. The initial sequencing was performed using, as primers, the LacZ and T7 primers described above, plus primers based on the determined sequence of the amplified POR TcaB product, (TH1 = ATTGCAGACTGCCAATCGCTTCGG, TH12 = GAGAGTATCCAGACGCCGGATGATCTG).

After aligning and editing each sequencing product, each was cut to 250 to 350 bases, depending on the integrity of the chromatographic data, as interpreted by the Perkin Elmer Applied Biosystem Division SeqEd 675 software. The sequencing steps that followed were: achieved by selecting the appropriate sequence for the new primers. With a few exceptions, the primers (synthesized as described above) were 24 bases long with a 50% G + C composition. Sequencing by this method was performed on both chains of the EcoR fragment 1 of approximately 2.9 kpb.

To further serve as a template for DNA sequencing, plasmid DNA from pDAB2002 isolate was prepared using the BIGperp ™ kit. Sequencing reactions were performed and analyzed as described above. Initially, a T3 primer (pBS SK (+) bases 774-796: CGCGCAATTAACCCTCACTAAAG) and a T7 primer (pBS KS (+) bases 621-643: GCGCGTAATACGACTCACTATAG) were used to initiate the sequencing reactions from the vector sequences. flanking reads into inserted DNA. Another set of primers, (GZ4F: GTATCGATTACAACGCTGTCACTTCCC; TH13: GGGAAGTGACAGCGTTGTAA TCGATAC; TH14: ATGTTGGGTGCGTCGGCTAATGGACATAAC; of PCR products TcaC peptides. From the data generated during the initial sequencing rounds, a new set of primers was designated and used to traverse the entire fragment length of ~ 5 kbp. A total of 55 oligoprimers were used, which allowed the identification of all the 8432 bp of the contiguous sequence.

When the DNA sequence of the EcoR 1 insert fragment of pDAB2002 was combined with the portion of the determined sequence of pDAB2000 and pDAB2001 isolates, a total of 6005 bp of contiguous sequence was generated (described here as SEQ ID NO: 25). When the long, open reading frames have been translated into the appropriate amino acids, the sequence clearly shows the TcaB peptide; N-terminal (described as SEQ ID NO: 3) encoded by bases 19-75, immediately following methionine residue. Upstream, there is a potential ribosome binding site (bases 1-9) and downstream, at bases 166-288, is encoded the internal peptide TcaB, -PT158 (described herein as SEQ ID NO: 19). Further down, in the same reading frame, at bases 1738-1773, there is a sequence encoding the internal peptide TcaBj-PTIOS (described herein as SEQ ID NO: 20). Also, in the same reading frame, the N-terminal TcaBn peptide (described here as SEQ ID NO: 5) is encoded at the bases of 1897-1923 and the reading frame continues uninterrupted, until the translation termination codon to nucleotides 3586-3588.

The lack of a stop codon in the frame, between the end of the sequence encoding TcaB- PT108 and the beginning of the region encoding TcaB _a , and the lack of a ribosome binding site immediately above the region encoding TcaB ,, suggest that the TcaBi and TcaB _N peptides are encoded. of

RO 121280 Β1 a single reading frame of 3567 bp, which starts at base pair 16 in SEQ ID NO: 25, and, 1 most likely, derives from an individual primary gene product of 1198 amino acids (131,586 Daltons; described herein as SEQ ID NO: 26), through a posttranslational split. If the amino acid 3 immediately preceding the TcaB ^ N-terminal peptide represents the C-terminal amino acid of the TcaBi peptide, then the predicted mass TcaB _H (627 amino acids) is 70,814 Daltons (described 5 here as SEQ ID NO: 28), slightly larger than the size observed by SDS-PAGE (68 kDa). This peptide would be encoded by a contiguous stretch of 1881 base pairs (described 7 herein as SEQ ID NO: 27). It was considered that the native C-terminus of TcaB is somewhat closer to the C-terminus of TcaB-PT108. The molecular mass of PT108 (3,438 kDa; determined in 9 during the analysis of the N-terminal amino acid sequence of this peptide) provides an amino acid size. Using the size of this peptide to designate the C-terminus of region 11 encoding TcaBi [Glu at position 604 of SEQ ID NO: 28], the derived size of TcaBi is determined to be 604 amino acids or 68,463 Daltons, according to experimental observations 13.

Translating the 1686 base pair region, which encodes the TcaB * peptide (described herein 15 as SEQ ID NO: 29), yielded a 562 amino acid protein (described herein as SEQ ID NO: 30), with the predicted mass of 60,789 Daltons, which corresponds well to that observed at 61 kDa. 17

A potential ribosome binding site (bases 3633-3638) is found 48 bp below the stop codon for the open tcaB reading frame. At bases 3645-3677, a sequence 19 encoding the N-terminus of the TcaC peptide was found (described herein as SEQ ID NO: 2). The open reading frame initiated by the N-terminal peptide continues uninterrupted to base 6005 (2361 bases on 21-strands, described here as the first 2361 base pairs of SEQ ID NO: 31). A gene (tcaC) encoding the entire TcaC peptide, (apparent size -165 kDa; -1500 amino acids) would comprise 23 approximately 4500 bp.

Another isolate containing the cloned EcoR 1 fragments of cosmid 26A5, E20.6 was also identified by homology to the aforementioned GZ4 and TcaBi samples. Agarose gel analysis of EcoR 1 digests of plasmid DNA housed in this strain (pDAB2004, fig. 2) showed inserted fragments of estimated sizes 2.9, 5 and 3.3 kbp. Analysis of the DNA sequence initiated from the designated primers from plasmid sequence 29 pDAB2002 showed that the 3.3 kbp EcoR 1 fragment of pDAB2004 is adjacent to the 5 kbp EcoR 1 fragment represented in pDAB2002. The open reading frame of 2361 base pairs found in pDAB2002 continues uninterrupted for another 2094 bases in pDAB2004 [described here as base pairs 2362 to 4458 of SEQ ID NO: 31], DNA sequence analysis 33 using primary 26A5 cosmid DNA as a mold confirmed the continuity of the open reading frame. together, the open reading frame (TcaC SEQ ID NO: 31) comprises 4455 base pairs 35 and encodes a protein (TcaC) of 1485 amino acids [described herein as SEQ ID NO: 32], the calculated molecular size of 166,214 daltons is in size estimated TcaC 37 peptide (165 kDa) and the derived amino acid sequence exactly matches that described for the N-terminal TcaC sequence [SEQ ID NO: 2]. 39

The lack of an appropriate amino acid sequence SEQ ID NO: 17, used to describe degenerate primeroligonucleotide deposition in the discovered sequence, shows that the generation of PCR® products found in GZ4 and HB14 isolates, which were used as evidence in initial bank research, were accidentally generated by priming the reverse chain by one of 43 primers in the degenerate warehouse. Further, the derived protein sequence does not include the internal fragment described herein as SEQ ID NO: 18. These sequences show that plasmid pDAB2004 contains the entire coding region for the TcaC peptide.

f

RO 121280 Β1

Example 9. Photorhabdus benchmarking for genes encoding the TcbA ^ peptide

This example describes a method used to identify DNA clones containing the genes encoding the TcbA peptide, isolating these genes and determining their partial DNA base sequence.

The polypeptide TcbA ,, active insect preparation is - 602 kDa. The amino acid sequence of the N-terminus of this peptide is described as SEQ ID NO: 1. Four deposits of degenerate oligonucleotide primers (forward primers: TH-4, TH-5, TH-6 through TH-7) were synthesized to encode a portion of this amino acid sequence, as described in Example 8, and are described and below.

Table 11

Primers and PCR reactions

Amino acid Phe Ile Gin Gly Tyr Serum Asp Lion Phe TH-4 5'-TT (T / C) ATI CA (A / G) GGI TA (T / C) TOI GA (T / C) CTI TT-3 ' TH-5 5'-TT (T / C) ATI CA (A / G) GGI TA (T / C) AG (T / C) GA (T / C) CTI TT-3 ' TH-6 5'-TT (T / C) ATI CA (A / G) GGI TA (T / C) TOI GA (T / C) TT (A / G) TT-3 ' TH-7 5'-TT (T / C) ATI CA (A / G) GGI TA (T / C) AG (T / C) CA (T / C) TT (A / G) TT-3 '

In addition, a primary (a) and a secondary (b) sequence of internal peptide preparation (TcbAjj-PT81) were determined and described herein as SEQ ID NO: 23 and SEQ ID NO: 24, respectively. Four degenerate oligonucleotide deposits (reverse primers: TH-8, TH-9, TH-10, and TH-11) were constructed and synthesized to encode the reverse complement of sequences encoding a portion of the peptide SEQ ID NO : 23, as shown below.

Table 12

Amino acid Thr Tyr Lion Thr Serum Phe Glu Gin Wave That Asn TH-8 3'TGI AT (A / G) GAI TGI AGI AA (A / G) CT (T / C) GT (T / C CAI CGI TT (G / A) -5 ' TH-9 3'TGI AT (A / G) TT (A / G) TGI AGI AA (A / G) CT (T / C) GT (T / C CAI CGI TT (G / A) -5 ' TH-10 3'TGI AT (A / G) GAI TGI TC (G / A) AA (A / G) CT (T / C) GT (T / C CAI CGI TT (G / A) -5 ' TH-11 3'TGI AT (A / G) TT (A / G) TGI TC (G / A) AA (A / G) CT (T / C) GT (T / C CAI CGI TT (G / A) -5 '

Sets of these primers were used in PCR® reactions to amplify the gene fragments encoding TcbA from the Photorhabdus luminescens W-14 genomic DNA prepared in Example 6. All PCR reactions were performed using the Hot Star technique using AmpliWax ™ buds and other Perkin Elmer reagents and protocols, usually a mixture (total volume μΙ) of MgCI ₂ , dNTP's, U10XGeneAmp® PCR buffer, and primers were added to tubes containing a single wax grain, [buffer PCR II10X GeneAmp® is composed of 10 mM Tris-HCl, pH 8.3 and 500 mM KC1J. The tubes were heated for 2 min at 80 ° C and allowed to cool. A solution containing 11AXX GeneAmp® PCR buffer, DNA template and DNA polymerase was added at the top of the wax seal. After melting the sealing plug

RO 121280 Β1 of wax and mixing the components by thermal cycling, the final reaction conditions 1 (volume of 50 µl) were: 10 mM Tris-HCl, pH 8.3; 50 mM KC1; 2.5 gM MgCl ₂ ; 200 µM each of dATP, dCTP, dGTP, dTTP; 1.25 mM in a single primer forward deposit; 3 1.25 µM in a single reverse primer storage, 1.25 AmpliTaq® DNA polymerase units and

170 ng AND mold. 5

The reactions were placed in a thermocycler (as in example 8) and were performed with the following program: 7

Table 13

Temperature Time Highlights cycle 94 ° C 2 min 1X 94 ° C 55-65 ° C 72 ° C 15s 30 s 1 min 30X 72 ° C 7 min 1X 15 ° C Constant

A series of amplifications were performed at these three normalizing temperatures (55 °, 60 °, 65 ° C), using degenerate prime deposits. Reactions normalized to 65 ° C did not have 19 visible amplification products after agarose gel electrophoresis. Reactions having a 60 ° C normalization regime containing TH-5 + TH-10 primers resulted in a 21 amplification product that had a corresponding mobility of 2.9 kbp. A product quantity of less than 2.9 kbp was produced under these conditions with TH-7 + TH-10 primers. When 23 reactions were normalized to 55 ° C, these primer pairs produced more than a 2.9 kbp product and this product also occurred with TH-5 + TH-8 25 primer pairs and TH-5 + TH-11. In addition, very pale 2.9 kbp bands were observed in passages containing amplified products from TH-7 plus TH-8, TH-10 or TH-11 primer pairs. 27

To obtain a PCR amplified product sufficient for cloning and DNA sequence determination, 10 separate PCR reactions were initiated using TH-5 + TH-10 primers and 29 were performed using the above conditions normalized to 55'C. All reactions were stored and the 2.9 kbp product was purified by Qiaex extraction from agarose gel, as 31 described above.

Additional sequences determined for the internal peptide TcbAj are described herein as 33 SEQ ID NO: 21 and SEQ ID NO: 22. As before, degenerate oligonucleotides (reverse primers TH-17 and TH-18) were made according to the reverse complement encoding a portion of the amino acid sequence of these peptides.

Table 14

From SEQ ID NO: 21 39

Amino acid Met Glu Thr Gin Asn Ile Gin Glu Pro TH-17 3-TAC CTT / C TGI GTT / C TTA / G TAI GTT / C GTT / C GG-5 '

RO 121280 Β1

Table 15

From SEQ ID NR.22

Amino acid Asn Pro Ile Asn Ile Asn Thr Gly Ile Asp TH-18 3'-TT (A / G) GGI TAI TT (A / G) TAI TT (A / G) TGI CCI TAI CT / A / G) -5 '

The degenerate oligonucleotides TH-18 and TH-17 were used in the DNA amplification experiment Photorhabdus hammescens'V \ l-14 as a template and primers TH-4, TH-5, TH-6 or TH-7 as primers 5 ' - (forward). These reactions amplified products of approximately 4 kbp and 4.5 kbp, respectively. These DNAs were transferred from agarose gel onto nylon membranes and hybridized with 32P labeled sample (as described above), prepared from the 2.9 kbp product amplified by TH-5 primer pair. + TH-10. Both the 4 kbp and 4.5 kbp amplification product hybridized strongly with the 2.9 kbp sample. These results were used to construct a map for the TcbA internal peptide sequence ", as shown in FIG. 3. The approximate distance between the primers is shown in fig. 3.

DNA sequence of the 2.9 kbp fragment encoding TcbA ^

Approximately 200 ng of the 2.9 kbp fragment (prepared above) was precipitated with ethanol and dissolved in 17 ml of water. Half of this was used as the sequencing template with 25 pmol from the TH-5 repository as the primer and the other half was used as the template for the TH-10 primer. The sequencing reactions were as shown in Example 8. No basic sequence was produced using the TH-10 primer repository; however, reactions with TH-5 primer repository produced the sequence described below:

AATCGTGTTG ATCCCTATGC CGNGCCGGGT TCGGTGGAAT CGATGTCCTC ACCGGGGGTT

TATTNGAGGG ANTNGTCCCG TGAGGCCAAA AANTGGAATG AAAGAAGTTC AAATTTNTTAC

121 CTAGATAAAC GTAGCCCGGN TTTAGAAAGN TTANTGNTCA GCCAGAAAATTTTGGTTGAG

181 GAAATTCCAC CGNTGGTTCT CTCTATTGAT TNGGGCCTGG CCGGGTTCGA ANNAAAACNA

241 GAAATNCAC AAGTTGAGGTGATGGNTTTGTNGCNANCTTNTCGTTTAGGT GGGGAGAAA

301 CCTTNTCANCACGNTTNTGAAACTGACCGGGAAATCGTCCATGANCGTGANC CAGGNTTN

361 CGCCATTGG

Based on this sequence, a sequencing primer (TH-21,5'CCGGGCGACGTTTATC TAGG-3 '.) Was designed to reverse complement bases 120-139 and initiate polymerization toward the 5' end (i.e., TH-5) of the fragment. 2.9 kbp purified-gel PCR encoding TobA ^.

The determined sequence is presented below and is compared with the biochemically determined N-terminal peptide sequence of TcbAfi SEQ ID NO: 1.

Confirmation of the sequence of the PCR fragment 2.9 kbp TcbA "[Underlined amino acids = encoded by degenerate oligonucleotides].

SEQ FIQ GYS D L F G - - A

IDNR: 1 | li llllll I I

GCATG CAG GGG TATAGTGAC CTGTTT GGT AATCGTGCT

M Q GY SDLFGNRA

RO 121280 Β1

From the homology of the amino acid sequence, derived from the biochemically determined one, it was clear that the 2.9 kbp PCR fragment represents the region encoding TcbA. This 2.9 kbp fragment was then used as a hybridization assay for genomic bank 3 PhotorhabdusW-W research prepared in Example 8, for cosmids containing the gene encoding TcbA. 5

Research of the cosmid bank Pphotorhabdus

The 2.9 kbp purified gel-PCR fragment was labeled with ³² P using the 7-labeled kit

Boehringer Mannheim High Prime, as described in Example 8. Filters containing remnants of approximately 800 colonies from the cosmid bank were searched as described above (example 8) and positive clones were employed for isolation. colonies and were researched. 3 clones (8A11,25G8 and 26D1) gave positive results during several 11 stages of research and characterization. The hybridization of the specific TcbA sample was not observed, with any of the 4 cosmids identified in example 8 and containing the tcaB and tcaC genes. DNA 13 from Cosmetics 8A11.25G8 and 26D1 were digested with restriction enzymes Bgl 2, EcoR 1 or Hind 3 (each alone or in combination with another) and the fragments separated on an agarose gel 15 and transferred onto a nylon membrane, as described in Example 8. The membrane was hybridized with the ³² P labeled sample prepared from the 4.5 kbp fragment 17 (generated by amplifying genomic DNA from Photorhabdus with TH-5 + TH- primers. 17). The patterns generated from cosmid DNAs 8A11 and 26D1 were identical to those generated with genomic-cut DNA 19 similar on the same membrane. It was concluded that the respective cosmids 8A11 and 26D1 are precise representations of the TebA "genome encoding locus. However, cosmid 25G8 has 21 an individual Bg 1 fragment that is slightly larger than genomic DNA. This may result from the positioning of the insert in the vector. 2. 3

DNA sequence of the gene encoding tcBa

26D1 membrane hybridization assay analysis revealed that the 4.5 kbp sample hybridized to a single large EcoR 1 fragment (greater than 9 kbp). This fragment was gel-purified and ligated to the EcoR 1 site of pBC KS (+), as described in Example 8, 27 to generate the pBC-SI / RI plasmid. The partial DNA sequence of the DNA insert of this plasmid was determined by walking the primer from the flanking vector sequence, using the 29 procedure described in Example 8. Next, the sequence was generated by extending the new oligonucleotides designed from the previously determined sequence. When comparing 31 with the DNA sequence determined for the tcbA gene identified by other methods (described herein as SEQ ID NO: 11, as described in Example 12 below), complete homology 33 was found at nucleotides 1-272, 319-862 , 2578-3036 and 3068-3540 (total base = 1712). It has been concluded that both approaches can be used to identify DNA fragments encoding peptide 35 TcbAiAnalysis of the amino acid sequence derived from the tcbA gene 37

The DNA fragment sequence identified as SEQ ID NO: 11 encodes a protein whose derived amino acid sequence is described herein as SEQ ID NO: 12. Several features verify the identity of the gene with the one encoding the TcbAi protein · N-terminal peptide TcbA, j (SEQ ID NO: 1; Phe lle Gin Gly Tyr Ser Asp Leu Phe Gly Asn Arg Ala) is encoded by amino acids 41 88-100. TcbArPT81 (a) internal peptide TcbAi (SEQ ID NO: 23) is encoded by amino acids 1065-1077 and TcbA _tt -PT81 (b) (SEQ ID NO: 24) is encoded as amino acids 1571-1592. Further 43, the internal peptide TcbAjj-PTSG (SEQ ID NO: 22) is encoded as amino acids 1474-1488 and the internal peptide TcbAi-PT103 (SEQ ID NO: 24) is encoded as amino acids 45 1614-1639. It is evident that this gene is an authentic clone encoding the TcbA ^ peptide as isolated from the preparation of the insecticidal protein of Photorhabdus luminescens strain 47

W-14.

RO 121280 Β1

The protein isolated as the TcbA _a peptide is derived from the cleavage of a longer peptide. Evidence for this is provided by the fact that the nucleotides encoding the TcbA peptide, N-terminal SEQ ID NO: 1 are preceded by 261 bases (encoding 87 N-terminal-proximal amino acids) of a longer open reading frame (SEQ). ID NO: 11). This reading frame begins with the oligonucleotides encoding the Met Gin Asn Serum amino acid sequence, which corresponds to the N-terminal sequence of the larger TcbA peptide and described herein as SEQ ED NO: 16. TcbA was considered to be the precursor protein for TcbA, _r

Relationships of tcbA, tcaB and tcaC genes

The tcaB and tcaC genes are closely linked and can be transcribed as a single mRNA (example 8). The tcbA gene appears on the cosmid, which apparently does not envelop those that harbor the tcaB and tcaC cluster, since the research of the respective genomic bank has identified different cosmids. However, the comparison of the amino sequences encoded by the tcaB and tcaC genes with the tcbA gene revealed a substantial degree of homology. The amino acid preservation (Protein Alignment Mode of MacVector ™ Sequence Analysis Software, which marks the pam250 matrix, cut-off value = 2; Kodak Scientific Imaging Systems, Rochester, NY) is shown in FIG. 4. On the marking line of each painting in fig. 4, signs ^semn indicate homology or conservation of amino acid changes and signs v indicate nonomology.

This analysis shows that the amino acid sequence of TcbA peptide from residues 1739 to 1894 is highly homologous with amino acids 441 to 603 of the TcaBi peptide (162 out of a total of 627 amino acids of P8; SEQ ID NO: 28). In addition, the amino acid sequence TcbA 1932 at 2459 is highly homologous with amino acids 12 to 531 of the TcaB _u peptide (520 of the total 562 amino acids; SEQ ID NO: 30). Considering that the TcbA peptide (SEQ ID NO: 12) comprises 2595 amino acids, a total of 684 amino acids (27%), at its C-proximal end, is homologous to the TcaBj and TcaB peptides, and the homologues are arranged colinously on the preprotein arrangement. putative TcaB (SEQ ID NO; 26). A measurable gap in TcaB homology _a ; coincides with the junction between the TcaBi and TcaBa portions θΐθ of the TcaB preprotein. Obviously, the TcbA and TcaB gene products are evolutionarily linked and it has been proposed that they have a common function (s) in Photorhabdus.

Example 10. Characterization of zinc-metalloproteases in Photorhabdus broth: protease inhibition, classification and purification

Protease Inhibition and Classification Assays: Protease assays were performed using casein-FITC dissolved in water as a substrate (final test concentration 0.08%). The proteolysis reactions were carried out at 25 ”C for one hour in the appropriate buffer with Photorhabdus broth (total reaction volume 150 µl). The samples were also tested in the presence and absence of dithiothreitol. After incubation an equal volume of 12% trichloroacetic acid was added to precipitate the undigested protein. After precipitation for 0.5 h and subsequent centrifugation, 100 µg of the supernatant was placed in a 96-well microtiter plate and the pH of the solution adjusted by adding an equal volume of 4N NaOH. Proteolysis was then quantified using a Fluoroskan II fluorometric plate reader at excitation and emission at wavelengths of 485 and 538 nm, respectively. Protease activity was tested in a range from pH 5.0-10.0 in 5 units. The following buffers were used at the final concentration of 50 mM: sodium acetate (pH 5.0-6.5); Tris-HCl (pH 7.0-8.0) and bis-Tris propane (pH 8.5-10.0). To identify the class of protease (s) observed, the crude broth was treated with a variety of protease inhibitors (final concentration 0.5 µg / µg) and then examined for protease activity pH 8.0, using the substrate described above. Protease inhibitors used include E-64 (L-trans-expoxisaccinilleucylamino [4 -, - guamdino] -butane), 3,4-dichloroisocoumarin, Leupeptin, pepstatin, amastatin, ethylenediaminetetraacetia (EDTA) and 1.10 phenanthroline. The protease assays performed over the pH range reveal that the protease (s) were indeed those with the highest activity at -pH 8.0 (Table 16). The addition of DTT had no effect on it

RO 121280 Β1 protease activity. The crude broth was then treated with a variety of protease inhibitors (Table 17). Treatment of the raw broth with the inhibitors described above shows that 1,10 phenanthroiin caused complete inhibition of the entire activity of the protease, when it was added to a final concentration of 50 µg with IC ₅₀ = 5 µg in 100 µl to a broth solution 2 mg / ml. These data show that the most abundant protease (s) found in Photorhabdus broth is of the zinc-metalloprotease class of enzymes.

Table 16

The effect of pH on day 1 activity of Photorhabdus

pH Activity® unit.flu? Percent 5.0 3013 ± 78 17 5.5 7994 ± 448 45 6.0 12965 ± 483 74 6.5 14390 ± 1291 82 7.0 14386 ± 1287 82 7.5 14135 ± 198 80 8.0 17582 ± 831 100 8.5 16183 ± 953 92 9.0 16795 ± 760 96 9.5 16279 ± 1022 93 10.0 15225 ± 210 87

a. Activity = percentage activity relative to maximum pH 8.0.

b. Unit. flu = fluorescent units (maximum = -28,000; background = -2200).

Table 17

Effect of different protease inhibitors on protease activity at pH 8 found in day 1 production of Photorhabdus luminescens (strain W-14)

Inhibitive United. Son. corrected ³ Percentage of inhibition Control 13053 0 E-64 14259 0 1-10 Fenantrolin® 15 99 3.4 Dichlorizocoumarin ^d 7956 39 leupeptin 13074 0 Pepstatin® 13441 0 Amastatin 12474 4 DMSO control 12005 8 Control Methanol 12125 7

a. Unit. son. corrected = fluorescent units - background (2200 son units).

b. Percentage of inhibition relative to protease activity at pH 8.0.

c. The inhibitors were dissolved in methanol.

d. The inhibitors were dissolved in DMSO.

RO 121280 Β1

Zinc-metalprotease isolation was performed by applying 10-80% ammonium sulphate pellet dialyzed to a Sepharose Q column equilibrated to 50 mM Na ₂ PO ₄ , pH 7.0, as described in Example 5 for the Photorhabdus toxin. After intensive washing, a gradient 0 to 0.5 M NaCl was used to elute the toxin protein. Most of the biological activity and protein were eluted from 0.15-0.45 M NaCl. However, it was observed that most of the proteolytic activity was present in the fraction 0.25-0.35 M NaCI with some activity in the fraction 0.15-0.25 M NaCI. SDS PAGE analysis of the 0.25-0.35 M NaCl fraction showed an important peptide band of approximately 69 kDa. The 0.15-0.25 M NaCl fraction contained a similar band of 60 kDa, but a lower relative protein concentration. Subsequent gel filtration of these fractions using a Superose 12 HR 16/50 column resulted in a major peak migrating to 57.5 kDa, which contained the predominant 58.5 kDa band (> 90% of total colored protein). by SDS PAGE analysis. Further analysis of this fragment, using different protease inhibitors, as described above, determined that the protease was a zinc-metal protease. Almost all the activity of the protease present in Photorhabdus broth on day 1 of fermentation corresponds to ~ 58 kDa zinc-metalloprotease.

In another secondary isolation of zinc-metalloprotease (s), the Photorhabdus broth grown three days was collected, and the activity of the protease was visualized with gelatin-bound dodecyl sulfate-polyacrylamide (SDS-PAGE) electrophoresis, as described. in Schmidt, TM, Bleakley, B. and Nealson, KM 1988. SDS (5.5x8 cm) migration gels were made with 12.5% polyacrylamide (40% acrylamide / bis-acrylamide stock solution; Sigma Chemical Co., St. Louis, MO), at which final concentration 0.1% gelatin (Biorad EIA reagent; Richmond CA) was incorporated on dissolution in water. Stacking SDS gels (1.0x8 cm) were constructed with 5% polyacrylamide, they were also bound with 0.1% gelatin. Typically, 2.5 µg of the test protein was diluted in 0.03 ml dithiothreitol-free SDS-PAGE loading buffer (DTT) and loaded onto the gel. Proteins underwent electrophoresis in SDS migration buffer (Laernmli, U.K. 1970, Nature 227,680) at 0 ° C and 8 mA. After electrophoresis was complete, the gel was washed 2 h in 2.5% (v / v) Triton X-100. The gels were then incubated for one hour, at 37 ° C, in 0.1 M glycine (pH 8.0). After incubation, the gels were fixed and stained overnight with 0.1% amido black in methanol-acetic acid-water (30:10:60, vol./vol./vol .; Sigma Chemical Co.). The activity of the protease was visualized as bright areas on black, amido black colored the background, due to the proteolysis and subsequent diffusion of the embedded gelatin. At least 3 distinct bands produced by the proteolytic activity were observed at 58-. 41 and 38 kDa.

Activity tests of the different proteases in the W-14 culture broth, day 3, were performed using FITC casein dissolved in water as a substrate (final test concentration 0.02%). The proteolysis experiments were performed at 37 ° C for 0-0.5 h in 0.1 M Tris-HCl (pH 8.0) with different protein fractions in a total volume of 0.4-5 ml. The reactions were terminated by adding an equal volume of 12% trichloroacetic acid (TCA) dissolved in water. After incubation at room temperature for 0.25 h, the samples were centrifuged at 10,000 xg 0.25 h and 10 ml aliquots were removed and placed on 96-well microtiter plates. The solution was then neutralized by adding an equal volume of 2N sodium hydroxide, followed by quantification using a Fluoroskan II fluorometric plate reader with excitation and emission at wavelengths of 485 and 538 nm, respectively. Activity measurement was performed using casein FITC with different protease concentrations at 37 ° C, 0-10 min. One unit of activity was defined arbitrarily, such as the amount of enzyme required to produce 1000 fluorescent units / min, and the specific activity was defined as units / mg of protease.

Inhibition studies were performed using 2 zinc-metalloprotease inhibitors; 1,10 phenanthroline and N- (α-Ramnopyranosyloxyhydroxyphosphinyl) -Leu-Trp (phosphoramidone) with stock solutions of

EN 121280 Β1 inhibitors dissolved in 100% ethanol and water, respectively. Stock concentrations were typically 1 10 mg / ml and 5 mg / ml for 1.10 phenanthroline and phosphoramidone, respectively, the final inhibitor concentration of 0.5-1.0 mg / ml per reaction. The 3-day treatment of the W-14 broth with 3 1.10 phenanthroline, an inhibitor of all zinc-metalloproteases, resulted in the complete elimination of all protease activity, while treatment with phosphoraminodin, a protease inhibitor such as thermolysine. (Waver, LH, Kester, WR, & Matthews, BW, 1977, J. Mol. Biol, 114,119-132) resulted in a -56% reduction in protease activity. The residual proteolytic activity 7 could not be further reduced with additional phosphoramidone.

Photorhabdus W-14 broth protease for 3 days was purified as follows: 9

4.0 1 broth were concentrated using an Amicon SI Y100 spiral ultrafiltration cartridge, attached to an Amicon M-12 filtration device. The flowing material, having 11 native proteins smaller in length than 100 kDa (3.8 L), was concentrated to 0.375 L using an Amicon S1 Y10 spiral ultrafiltration cartridge, attached to an Amicon M-12 filter device. The retained material contained proteins ranging in size from 10-100 kDa. This material was loaded onto a Pharmacia HR 16/10 column which was packaged with PerSeptive Biosystem 15 (Framington, MA) Poros®50 HQ, strongly anion exchange packing, which was equilibrated in 10 mM sodium phosphate buffer (pH 7 , 0). Proteins were loaded onto column 17 at a flow rate of 5 ml / min, followed by washing of unbound proteins with buffer, until A ₂₈₀ = 0.00. Thereafter, the proteins were eluted using NaCl gradient at 0-1.0 M NaCl, 19 in 40 min, at a flow rate of 7.5 ml / min. The fractions were tested for protease activity, supra, and the active fractions were deposited. The proteolytic active fractions were diluted with 21 50% (v / v) 10 mM sodium phosphate buffer (pH 7.0) and loaded onto a Pharmacia HR 10/10 Mono Q column, equilibrated in 10 mM phosphate buffer. sodium. After washing the column with buffer, 23 until A ₂₈₀ = 0.00, the proteins were eluted using a NaCl gradient of 0-0.5 M NaCl, one hour, at a flow rate of 2.0 ml / min. The fractions were tested for protease activity. Those 25 fractions that had the highest amount of phosphoramidon-sensitive protease activity, phosphoramidon-sensitive activity being due to the 41/38 kDa protease, infra, were 27 deposited. These fractions were found to elute to a range of 0.15-0.25 M NaCl. Fractions containing the predominant phosphoramidone-insensitive protease activity, 58 kDa protease, 29 were also deposited. These fractions were found to elute to a range of 0.25-0.35M NaCl. Phosphoramidon-sensitive protease fractions were then concentrated to the final volume of 31 0.75 ml, using a Millipore Ultrafree®-15 Biomax-5K NMWL membrane centrifugal filtration device. This material was applied at a flow rate of 0.5 ml / min on a 33 Pharmacia HR 10/30 column, which had been packed with Pharmacia Sephadex G-50 equilibrated in 10 mM sodium sulfate buffer (pH 7, 0) / 0.1 M NaCl. Fractions that had maximal phosphoramidon-sensitive protease activity were then stored and centrifuged on a Millipore Ultrafree®-15 Biomax-5K NMWL membrane centrifugal filtration device. The analysis of proteolytic activity, supra, indicates that this material has only phosphoramidone-sensitive protease activity. Deposition of the phosphoramidone-insensitive protease, 58 kDa 39 protein was followed by concentration in a Millipore Ultrafree®-15 Biomax-5K NMWL membrane centrifugal filtration device and further separation on a Pharmacia 41 Supredex-75 column. The fractions containing the protease were deposited.

Analysis of 58- and 41/38 kDa purified proteases revealed that, while both 43 protease types were completely inhibited with phenanthroline 1.10, only 41/38 kDa protease was inhibited with phosphoramidone. Further analysis of the crude broth showed that the activity of protease 45 of the W-14 broth on day 1 was 23% of the total protease activity due to the 41/38 kDa protease, which increased to 44% on day 3 of the W-14 broth. . 47

RO 121280 Β1

Standard SDS-PAGE analysis for examining protein purity and obtaining the amino terminal sequence were performed using 4-20% gradient MiniPlus SepraGels purchased from Integrated Separation Systems (Natick, MA). Amino-terminal sequencing proteins were blotted on PVDF membranes, followed by purification, infra (ProBlott ™ Membranes; Applied Biosystems, Foster City, CA), visualized with 0.1 amido black, excised and sent to Cambridge Prochem., Cambridge, MA, for sequencing.

The deduced amino terminal sequences of the 58- (SEQID NO: 45) and 41/38 kDa (SEQ ID NO: 44) proteases of the 3-day-old W-14 broth were DV-GSEKANEKLK (SEQ ID NO: 45) and , respectively, DSGDDDKVTNTDIHR (SEQ ID NO: 44).

The 41/38 kDa protease sequencing revealed several amino terminals, each having an additional amino acid removed by proteolysis. Examination of the primary, secondary, tertiary and quaternary sequences for the 38 and 41 kDa polypeptides allowed deduction of the sequence shown above and revealed that these two proteases are homologous.

Example 11. Part A. Research of the Photorhabdus genome bank using antibodies to genes encoding the TcbA peptide in parallel with the sequencing described above, a corresponding experiment and sequencing were also performed based on the TcbA ^ peptide (SEQ ID NO: 1). This sequencing was accomplished by preparing the bacterial culture broth and purifying the toxin, as described in Examples 1 and 2, above.

The genomic DNA of the lei was isolated. Photorhabdus luminescens strain W-14 grown in Grace's insect tissue culture medium. The bacterium was grown in 5 ml culture medium in an Erlenmeyer beaker at 28 ° C and 250 rpm for approximately 24 h. Bacterial cells from 100 ml of culture medium were pelleted at 5000xg for 10 min. The supernatant was removed and the cell pellets were then used to isolate genomic DNA.

Genomic DNA was isolated using a modification of the CTAB method described in Section 2.4.3. of Ausubel (supra.), a section entitled Large Scale CsCI prep of bacterial genomic DNA, was followed by step 6. At this point, additional chloroform / isoamyl alcohol extraction was performed (24: 1), followed by an extraction step. phenol / chloroform / isoamyl (25: 24: 1) and a final extraction chloroform / isoamyl alcohol (24: 1). The DNA was precipitated by adding a volume of 0.6 isopropanol. The precipitated DNA was suspended and reached the tip of a stretched glass wand, briefly immersed in 70% ethanol as a final wash and dissolved in 3 ml TE buffer.

The DNA concentration, expressed by optical density at 280/260 nm, was approximately 2 mg / ml.

Using this genomic DNA a bank was prepared. About 50 µg of genomic DNA was partially digested with Sau3 A. Then, NaCl density gradient centrifugation was used to measure partially fragmented digested DNA fragments. Fractions containing DNA fragments, with an average size of 12 kb or greater, as determined by agarose gel electrophoresis, were ligated into BluScript, Stratagene, La Jolla, California plasmid and transformed into DH5a or DHB10 E.coli.

Separately, purified aliquots of the protein were sent to the Hybridoma Biotechnology Center of the University of Wisconsin, Madison, for the production of monoclonal antibodies to the protein. The material that was sent was HPLC purified, and the fractions containing the native bands 1 and 2, which had been denatured at 65 ° C and from which 20 µg were injected into each of the 4 mice. Hybridoma cell lines, which produce stable monoclonal antibodies, were recovered from spleen cells from immunized mice, melted with a stable myeloma cell line. Monoclonal antibodies were recovered from hybridomas.

RO 121280 Β1

Separately, polyclonal antibodies were created by taking native band 1, purified on agarose gel 1 (see example 1) protein, which was then used to immunize a white New Zealand rabbit. The protein was prepared by excising the band from the native agarose gels, 3 by heating the gel pieces to 65 ° C, to melt the agarose and immediate emulsifying it with the adjuvant. The complete Freund adjuvant was used for primary immunization, and the incomplete Freund 5 was used for 3 additional injections at 1-month intervals. For each injection, approximately 7.0 ml of emulsified band 1 containing 50 to 100 µg of protein was administered subcutaneously, through multiple injections behind the rabbit. Serum was obtained 10 days after the last injection and additional bleeding was performed at intervals of 1 week, 9 for 3 weeks. The serum complement was inactivated by heating at 56 ° C for 15 minutes and stored at -20 ° C. 11

Monoclonal and polyclonal antibodies were then used to search the genomic bank for the expression of antigens that could be detected by epitopes. Positive clones 13 were detected on the protrusions of the colony on the nitrocellulose filter. Immunoblot analysis of positive clones was performed. 15

A clone analysis defined by immunoblot and Southern analysis resulted in the attempt to identify five classes of clones. 17 in the first class of clones was a gene encoding the peptide designated herein as TcbA;

The entire DNA sequence of this gene (TcbA) was obtained. This was presented as SEQ 19 ID NO: 11. Confirmation that this sequence encodes the internal sequence of SEQ ID NO: 1 was demonstrated by the presence of SEQ ID NO: 1 at amino acid number 88 in the deduced amino acid sequence 21, created by the open reading frame. of SEQ ID NO: 11. This can be confirmed by reference to SEQ ID NO: 12, which is the deduced amino acid sequence created by SEQ ID 23 NO: 11.

The second class of toxin peptides contains the segments referred to above 25 as TcaB ;, TcaB ;; and TcaC. Following the bank's research with polyclonal antisera, this second class of toxin gene was identified by several clones that produced proteins of different sizes, 27 of which all reacted cross-linked with the polyclonal antibody on an immunoblot and were also found. that they have DNA homology on a Southern blot. Comparison of their sequences reveals that they belong to the same gene complex designated TcaB and TcaC, above.

Three other classes of antibody toxin clones were also isolated in polyclonal research. These classes produced cross-reacting proteins with a polyclonal antibody and also had DNA homology to the classes, as determined by Southern 33 Blot. The classes were designated Class III, Class IV and Class V. It was also possible to identify monoclonal ones that cross-react with Classes I, II, III and IV. This 35 suggests that all have regions of high protein homology. Thus, it seems that P. luminescens extracellular protein genes do not have a family of evolutionarily related genes. 37 In order to further the concept that there may be evolutionarily related variations in the toxin peptides contained in this organism, two approaches have been undertaken to examine 39 other P. luminesces strains for the presence of related proteins. This was accomplished both by PCR amplification of genomic DNA and by immunoblot analysis using monoclonal antibodies 41 and polyclonal.

The results show that the related proteins are produced by P. luminescens 43 WX-2, WX-3, WX-4, WX-5, WX-6, WX-7, WX-8, WX-11, WX-12, WX strains. -15 and W-14.

Example 11. Part B. Sequence and analysis of Class III toxin clones - tcc 45

Subsequent DNA sequencing was performed on plasmids isolated from E.coli Class III clones, described in Example 11, Part A. The nucleotide sequence was shown to be three-fold linked, 47 almost open reading frame at this genomic locus. This locus was called teak with three

RO 121280 Β1 open reading frames named tccA SEQ ID NO: 56, tccB SEQ ID NO: 58 and tccC SEQ ID NO: 60 (Fig. 6B).

The amino acid deduced from the open reading frame tccA shows that the gene encodes a protein of 105,459 Yes. This protein was called TccA. The first 12 amino acids of this protein matched to the N-terminal sequence were obtained from a 108 kDa protein, SEQ ID NO: 7, identified earlier as part of the toxin complex.

The amino acid deduced from the open TccB reading frame shows that the gene encodes a protein of 157,716 Da. This protein corresponding to the N-terminal sequence was obtained from a protein with an estimated molecular weight of 185 kDa, SEQ ID NO: 8.

The amino acid sequence deduced from tccC shows that this open reading frame encodes a protein of 111.694 Yes and the protein product was called TccC.

Example 12. Characterization of Photorhabdus strains

To determine whether the collection described herein was comprised of Photorhabdus strains, the respective strains were evaluated for the recognition of the microbiological features that are characteristic of Photordabdus and which differentiate it from other Enterobacteriacee and Xenorhabdus spp. (Farmerge, JY Manual, 1984, Ber. of Systemic Bacteriology, vol. 1, pp. 510-511. (Ed. Kreig NR and Hoit, JG.) Wiffiams & Wilkins, Baltimore; Akhurstand Boemare, 1988, Boemare et al., 1993). These characteristic features are as follows: Gram's negative colored rods, body size 0.5-2 pm in width and 2-10 pm in length, pigmentation of red / yellow colony, presence of crystalline inclusion bodies, presence of catalase, inability to reduce nitrates, presence of bioluminescence, ability to resume dye from culture medium, positive for protease production, growth temperature range below 37 ° C, survival under anaerobic conditions and positive movement ability, (Table 18). Reference strains Escherichia coli, Xenorhabdus and Photorhabdus were included in all tests for comparison. The surface results are consistent for all strains that are part of the Enterobacteriaceae family and the Photorhabdus genus.

A luminometer was used to determine the bioluminescence of each strain and to provide a quantitative and relative measurement of light production. For the measurement of the relative light emission units, broths from each strain (cells and medium) were measured at three time intervals, after inoculation in culture fluid (6.12 and 24 h) and compared with the background brightness. (non-inoculated medium and water). Before measuring light emission from different broths, cell density was determined by measuring light absorbance (560 nM) in a Gilford Systems spectrometer (Oberlin, OH), using a suction cell. Appropriate dilutions were then performed (to normalize the optical density to 1.0 units) before measuring the brightness. Aliquots of the diluted broth were then placed in vats (300 µl each) and read in Bio Orbit 1251 Luminometer (Bio-Orbit Oy, Twiku, Finland). The integration period for each sample was 45 s. The samples were mixed continuously (spun into vats with thresholds), while read to ensure oxygen availability. A positive test was determined to be> 5 times the background luminescence (-5-10 units). In addition, the brightness of the colony was detected with photographic and visual coverage film, after adaptation to the darkroom. Gram staining characteristics of each strain were established with a commercial Gram staining kit (BBL, Cockeysville, MD) used with Gram staining slides (Fisher Scientific, Pittsburgh, PA). Microscopic evaluation was then performed using a Zeiss microscope (Cari Zeiss, Germany), 100X immersion lenses (with 10X ocular magnification and 2X body). Microscopic examination of individual strains for body size, cell description and inclusion bodies (later after logarithmic growth) was performed using wet mount slides (10X ocular magnification, 2X body magnification

RO 121280 Β1 and 40X objective) with oil immersion and phase contrast microscopy with a micrometer (Akhurst, 1 RJ and Boemare, NE 1990, Entomopathogenic Nematodes in Biological Control (ed. Gaugler, R. and Kaya, H.), pp. 75 -90, ORC Press, Boca Raton, USA; Baghdiguian S., 3

Boyer-Giglio Μ. H., Thaler, JO, Bonnot G., Boemare N., 1993, Biol. What // 79.177-185.). Colony pigmentation was observed after inoculation on Bacto nutrient agar (Difco 5 Laboratories, Detroit, Ml), prepared as instructed on the label. Incubation occurred at 28 ° C and characterization occurred after 5-7 days. To test for the presence of enzyme catalase, 7 a colony of the test organism was removed on the small buffer from the agar nutrient plate and placed on the bottom of the test glass tube. Gently add 1 ml 9 of ordinary hydrogen peroxide solution to the edge of the tube. There was a positive reaction when gas bubbles (presumably oxygen) appeared immediately or within 5 minutes. The controls of non-inoculated nutrient agar and oxygenated water solution were also examined. To test nitrate reduction, each culture was inoculated with 10 ml Bacto Nitrate Broth (Difco Laboratories, 13 Detroit, Ml). After 24 h of incubation at 28 ° C, nitrite production was tested by adding two drops of sulphanilic acid reagent and 2 drops of α / fa-naphthylamine reagent (see Difco 15 Manual, IO ** ¹ edition, Difco Laboratories, Detroit , Ml, 1984). Generation of a distinct pink or red color indicates the formation of nitrite from nitrate. The ability of each strain to absorb colorant from the culture medium was tested with Bacto MacConkey agar, which contains natural red dye; Bacto Tergitol-7 agar containing blue bromtimol dye and Bacto EMB 19 agar containing eosin-y dye (agar from Difco Laboratories, Detroit, Ml, all prepared according to label directions). After incubation on these media, the dye 21 absorbed was recorded after incubation at 28 ° C for 5 days. Growth on the latter media is characteristic for members of the Enterobacteriaceae family. The mobility of each strain 23 was tested using a Bacto Motility Test Medium solution (Difco Laboratories, Detroit, Ml) prepared as instructed on the label. A junction-breakpoint inoculation was performed with each strain and the mobility was macroscopically assessed through the diffuse area of the growth spread from the inoculation line. In many cases, the mobility was observed microscopically from the culture liquid under wet mount slides. Biochemical nutrient evaluation for each strain was performed using BBL Enterotube II (Benton, Dickinson, Germany). There were 29 followed the instructions of the product, except that the incubation was done at 28'C, for 5 days. The results were similar to the aforementioned report on Photorhabdus. The protease production was tested by observing gelatin hydrolysis, using Bacto gelatin plates (Difco Laboratories, Detroit, Ml), prepared as in the label instructions. Cultures 33 were inoculated and plates were incubated at 28'C for 5 days. To assess growth at different temperatures, agar plates [2% Peptone # 3 with 2% Bacto-Agar (Difco, Detroit, 35 Ml) in deionized water] were striated from the common source of inoculation. The plates were sealed with Nesco® film and incubated at 20, 28 and 37 ° C for 3 weeks. Plates that did not show growth at 37 ° C did not demonstrate cell viability after transfer to an incubator at 28 ° C for one week. Oxygen requirement of Photorhabdus strains was tested in the following 39 ways. A junction-breakpoint inoculation was performed in a fluid thioglycolate broth medium (Difco, Detroit, Ml). The tubes were incubated at room temperature for one week 41 and the cultures were examined for growth type and extent. The resazurin indicator demonstrates the average oxidation level of aerobic areas (Difco Manual, 10 ^{, h} edition, Difco Laboratories, 43

Detroit, Ml). The results of the growth zones obtained for the Photorhabdus strains tested were similar to those of the optional anaerobic microorganisms. 45

RO 121280 Β1

Table 18

Taxonomic features of Photorhabdus strains - Trait evaluation *

Stem A B C D E F G H I J K IT M N 0 P Q W-14 - ± ± rd Ș ± - ± ± ± 0 ± ± ± ± ± ± = WX-1 ± ± rd Ș ± ± ± ± a ± ± ± ± ± ± = WX-2 = ± ± fd AND ± ± ± ± 0 ± ± ± ± ± ± = WX-3 = ± ± rd Ș ± = ± ± ± him ± ± ± ± ± ± = WX-4 = ± ± rd AND ± = ± ± ± YT ± ± ± ± ± ± = WX-5 = ± ± rd Ș ± = ± ± ± LO ± ± ± ± ± ± = WX-6 = ± ± rd AND ± = ± ± ± LY ± ± ± + ± ± = WX-7 = ± + rd AND ± = ± ± ± R ± ± ± ± ± ± = WX-8 = ± ± rd Ș ± = ± ± ± A ± ± ± ± ± ± = WX-9 - ± ± rd AND ± = ± ± + him + + ± ± ± ± = WX-10 = ± ± rd Ș ± = + + + RQ ± ± + ± + ± = WX-12 = ± ± rd Ș ± = + ± + EN ± ± ± ± + ± = WX-13 = ± ± rd Ș ± = ± + ± A ± ± ± ± ± ± = WX-14 = ± ± rd AND ± = + ± ± LR + ± ± ± ± ± = WX-15 - + + rd AND + - + + + LR + + + + + ± = H9 = + ± rd AND + = + + + LY + + ± ± ± ± = Hb = ± ± rd AND ± = ± ± ± THEM ± ± ± ± ± ±

RO 121280 Β1

A = Gram dye, B = inclusion crystalline bodies, C = bioluminescence, D = cell shape, E = mobility, F = nitrate reduction, G = presence of catalase, H = gelatin hydrolysis, 1 = dye absorption, J = pigmentation, K = growth on EMB agar, L = growth on MacConkey agar, M = growth on Tergitol-7 agar, N = optional anaerobes, 0 = growth at 28'C, Q = growth at 37'C, t - +/- = for positive or negative trait, rd = rod, S = measured with Genus descriptors, RO = red-orange, LR = light red, R = red, O = orange, Y = yellow, T = brown, LY = light yellow, YT = yellowish brown and LO = light orange.

Table 18 (continued)

Stem A B C D E F G H I J K IT M N A P Q ahem = ± ± rd AND ± = ± ± ± IX ± ± ± ± ± ± = HP88 ± ± rd AND ± = ± ± ± LX ± ± ± ± ± ± = NC-1 = ± ± rd AND ± = ± ± ± A ± ± ± ± ± ± = W30 = ± ± rd Ș ± = ± ± ± XI ± ± ± ± ± ± = WIR = ± ± rd Ș ± = ± ± ± EN ± ± ± ± ± ± = B2 = ± ± rd Ș ± = ± ± ± R ± ± ± ± ± ± = 43 948 = ± ± rd AND ± = ± ± ± A ± ± ± ± ± ± = 43 949 = ± ± rd Ș ± = ± ± ± A ± ± ± ± ± ± = 43950 = ± ± rd Ș ± = ± ± ± A ± ± + ± ± ± = 43 851 = ± ± rd AND ± = ± ± ± A ± ± ± ± ± ± = 42 952 = ± ± rd Ș ± = ± ± ± A ± ± ± ± ± ± =

Cellular fatty acid analysis is recognized as a tool for bacterial characterization at the genus and species level (Tornabene, T.G., 1985, Lipid Analysis and the 33 Relationship to Chemotaxonomy in Methods in Microbiology, vol. 18, 209-234; Goodfellow,

M. and O'Donnell, A.G., 1993, Roots of Bacteria! Systematics in Handbook of New Bacterial 35 Systematics. Goodfellow, M. & O'Donnell, AG), pp. 3-54, London: Academic Press Ltd), these references are incorporated herein by reference and were used to confirm that our collection was related to gender level The cultures were transported to an external contract laboratory for fatty methyl esteracid analysis (FAME), using a Microbial ID (Midi, Newark, 39 DE, USA) Microbial Identification System (MIS). The MIS system consists of a Hewlett Packard HP5890A gas chromatograph with a capillary column of 5% methylphenyl silicon melted silica of 41 25 mm x 0.2 mm. It uses hydrogen, as a carrier gas, and a flame ionization detector, it works together with an automatic sampling device, an integrator and a 43

RO 121280 Β1 computer. The computer compares the samples of fatty acid methyl ester with a bank of microbial fatty acids and with a calibration mixture of known fatty acids. As selected by the contracting laboratory, the strains were grown 24 h, at 28 "C, on a soy trypticase agar, before analysis. The sampling was performed by the contracting laboratory in accordance with the standard FAME methodology. No strains from another luminescent bacterial group were identified directly, other than Photorhabdus. When the analysis was performed on groups comparing the fatty acid profiles of a group of isolates, the fatty acid profiles of the strain were related at the genus level.

The evolutionary diversity of Photorhabdus strains from our collection was measured by PCR (Polymerase Chain Reaction) analysis of genomic fingerprints mediated using genomic DNA from each strain. This technique is based on families of repetitive DNA sequences, present throughout the genomes of various bacterial species (reviewed by Versalovic, J., Schneider, N., DE Bruijn, F.J. and Lupski, J.R. 1994, Methods Mol. Cell. Biol. 5,25-40.). Three of these repetitive extragenic palindrome sequences (REPs), enterobacterial repetitive intergenic consensus (ERIC) and BOX element are considered to play an important role in the organization of the bacterial genome. The genomic organization is considered to be formed by the differential selection and dispersion of these elements in the genome of closely related bacterial strains, can be used to differentiate these strains (e.g. Louws, FJ, Fulbright, DW, Stephens, CT and DE Bruijn, FJ , 1994, Appl. Environ. Micro. 60, 2286-2295). REP-PCR uses oligonucleotide primers complementary to these repetitive sequences to amplify variable-size DNA fragments that are found between them. The resulting products are separated by electrophoresis to determine the DNA imprint for each strain.

To isolate genomic DNA for our strains, cell pellets were resuspended in TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) to a final volume of 10 ml, and 10 ml NaCl was added. 5 M. This mixture was centrifuged 20 min, at 15000xg. The resulting pellet was resuspended in 5.7 ml TE and 300 µl SDS and 60 µl 20 mg / ml proteinase K were added (Gibco BRL Products, Grand Island, NY). This mixture was incubated at 37 ° C for one hour, then about 10 mg of lysozyme was added and the mixture was incubated for a further 45 min. Then 1 ml of 5M NaCl and 800 µl CTAB / NaCl solution (10% w / v CTAB, 0.7 M NaCl) was added and the mixture was incubated for 10 min at 65 ° C, shaking gently, then incubated and stirred for another 20 minutes to help clear the cell material. An equal volume of chloroform / isoamyl alcohol solution (24: 1, v / v) was added, mixed gently and then centrifuged. Two extractions were then made with an equal volume of phenyl / chloroform / isoamyl allyl (50: 49: 1). Genomic DNA was precipitated with 0.6 volumes of isopropanol. The precipitated DNA was removed with a glass rod, washed twice with 70% ethanol, dried and dissolved in 2 ml STE (10 mM Tris-HCl pH 8.0, 10 mM NaCl, 1 mM EDTA). The DNA was then quantified by optical density 260 Jun. To perform the rep-PCR analysis of the Photorhabdus genomic DNA, the following primers were used: REP1R-I; S'-IIIICGICGICATCIGGC-S 'and REP2-I; 5'-ICGICTTATCIGGCCTAC-3 '. PCR was performed using the following 25 µl of reaction: 7.75 µl water, 2.5 µl 10X LA buffer (PanVera Corp., Madison, Wl), 16 µl dNTP mixture (2.5 mM each), 1 µl of each primer at 50 pM / pl, 1 pl DMSO, 1.5 pl genomic DNA (concentration range 0.075-0.480 pg / pl) and 0.25 pl TaKaRa EX Taq (PanVera Corp., Madison, Wl). PCR amplification was performed in a Perkin Elmer DNA Thermal Cycler (Norwalk, CT), which used the following conditions: 97'C / 7 min, then 35 cycles at 94'C / 1 min, 44'C / 1 min, 65 ° C / 8 min; followed by 15 min, at 65'C. After cycling, the 25 µl reaction was added to 6x gel loading buffer (0.25% bromphenol blue, 40% w / v sucrose in water). A 1% 15x20 cm agarose gel was then passed into TBE buffer (0.09 M Tris-borate, 0.02 M EDTA),

EN 121280 Β1 using 8 μΙ of each reaction. The gel was passed for approximately 16 h, at 45 v. The gels 1 were then stained in 20 µg / ml ethidium bromide for one hour, and bleached in TBE buffer for about 3 h. they then took Polaroid® photographs under UV light of the gels. 3 The presence and absence of bands at specific size for each strain were measured from the photographs and introduced as a similarity matrix in a software program of numerical taxonomy, NTSYS-pc (Exeter Software, Setauket, NY). HB 101 strain controls

E.coli and Xanthomonas oryzae pv. Oryzae were tested at the same time as the 7 PCR fingerprints produced, which correspond to published reports (Versalovic, J., Koeuth, T. and Lupsky, J.R.,

1991, Nucleic Acids Res. 19.6823 to 6831; Vera Cruz, CM. Halda-Alija, L. Louws, F., Skinner, 9 D.Z., George, M.L., Nelson, R.J., DE Bruijn, F.J., Rice, C and Leach, J.E., 1995, Int. Rice Res.

Notes, 20, 23-24; Vera Cruz, CM., Ardales, E.Y., Skinner, D.Z., Talag, J., Nelson, R.J., 11

Louws, F.J., Leung, H., Mew, T.W. and Leach, J.E., 1996, Phytopathology (respectively, in press).

Then, data from Photorhabdus strains were analyzed with a number of programs in NTSYS-pc; 13 SIMQUAL (Similarity for Qualitative data) to generate a matrix of similarity coefficients (using the Jaccard coefficient) and SAHN (Sequential, Agglomerative, heirarchical and 15 Nested) to make groups using the [UPGMA (Unweighted Pair-Group Method with Arithmetic) method Averages)] that group related strains and can be expressed as a phenogram 17 (fig. 5). The COPH (cofenetic values) and MXCOMP (comparison matrix) programs were used to generate a cogenetic value matrix and compare the correlation between it and the original matrix 19 on which the grouping was based. A result of the standardized mantle (r) statistics was generated, which is a measure of the harmonization value for a group analysis (4 = 0.8-0.9 represents a very good value 21). in our case, r = 0.919. That is why our collection is made up of a different group of the easy-to-spot strains of the Photorhabdus genus. 2. 3

Example 13. Insecticidal utility of toxins produced by different strains

Photorhabdus 25

Initial seed cultures of the different Photorhabdus strains were produced by inoculating 175 ml of 2% Proteose Peptone # 3 (PP3) (Difco Laboratories, Detroit, Ml) on average 27 liquids with a primary primary subclone into a 500 ml vial with three bibs with a Delong neck, covered with a Kaput. The inoculum for each seed culture was derived from 29 inclined agar coating-oil or plate cultures. After inoculation, these vials were incubated for 16 h at 28 ° C for rotary shaker at 150 rpm. These seed crops 31 were then used as sources of uniform inoculum, to give fermentation to each strain. In addition, the post-log seed culture was coated with sterile mineral oil, adding a sterile 33 magnetic stirrer for subsequent resuspension and storing the culture in the dark, at room temperature, and ensuring long-term storage of the inoculum in a competent toxin state. . The broths 35 produced were inoculated by adding 1% of the culture of active growth of seeds to the medium 2% fresh PP3 (for example, 1.75 ml per 175 ml fresh medium). The production of 37 broths was carried out either in 500 ml vials with three cups (see above) or in 2800 ml vials with convex bottom (500 ml volumes) covered with a silicone foam. 39 The production vials were incubated for 24-48 hours, under the conditions mentioned above. After incubation, the broths were distributed in 11 sterile polyethylene bottles, spun at 2600xg for 41 hours at 1 ° C, and decanted into cells and pellet residues. Then, the liquid broth was vacuum-filtered through Whatman GF / D (2.7 µM retention) and GF / B (1.0 µM retention) glass filters, to remove debris. Further clarification of the broth was performed with a tangential flow microfiltration device (Pali Fiitron, Northborough, MA), using a 0.5-channel open filter of 0.5 μΜ. When necessary, further clarification can be obtained by cooling the broth (at 4 ° C) and centrifuging for several hours at 2600xg. Following these 47 procedures, the broth was sterilized by filtration using a nitrocellulose membrane filter.

RO 121280 Β1

0.2 μΜ. The sterile broths were then used directly for biological testing, biochemical analysis or concentrated (up to 15-fold) using a 10,000 MW disconnect, MI2 ultra-filtration device (Amicon, Beverly, MA) or centrifugal concentrators ( Millipore, Bedford, MA and Pali Fltron, Northborough, MA) with a pore size of 10,000 MW. In the case of centrifugal concentrators, the broth was spun at 2000xg for about 2 h. The 10,000 MW quench was added to the appropriate retention to obtain the desired concentration of components greater than 10,000 MW. The heat inactivation of the processed broth samples was achieved by heating the samples at 100 ° C, in a heating block filled with sand, for 10 min.

The broth (s) and toxin complex (s) from different strains of Photorhabdus are used to reduce insect populations and have been used in a method of inhibiting an insect population, which includes applying to an insect site, an effective amount of insect inactivation from the described asset. A demonstration of the extent of insecticidal activity observed from the broth of a selected group of fermented Photorhabdus strains, as described above, is shown in Table 19. It is possible that additional insecticidal activity could be detected with these strains, by increased broth concentration or by using different fermentation methods. Compatible with the activity associated with a protein, the insecticidal activity of all the tested strains was thermally labile (see above).

The culture broth (s) of different Photorhabdus strains show differential insecticidal activity (mortality and / or growth inhibition reduced adult emergence) against a number of insects. More specifically, the activity is observed against the rootworm larvae and weevil diseases, which are members of the Coleoptera order. Other Coleoptera members include wireworm, pollen beetles, flea beetles and the Colorado potato beetle. The activity was also observed against the homeoptera insects of the Cicadellidae family and horn plant hopper, which are members of the Homoptera family. Other members of the Homoptera include planthopper, pear psylla, apple sucker, scale insects, whitefly, spittle bug, as well as numerous hosts characteristic of aphids. Broths and purified toxin complexes are also active against tobacco budworm, tobacco hornworm and European corn borer, which are members of the Lepidoptera order. Other typical members of this order are beet armyworm, cabbage looper, black cutworm, corn earworm, codling moth, clothes moth, Indian mealmoth, leaf roller, cabbage worm, cotton bollworm, bagworm, Eastern tent caterpillar, sod webworm and fall armyworm. The activity was also observed against fruitfly larvae and mosquitoes that are members of the Diptera order. Other members of the Diptera order are: pea midge, carrot fly, cabbage root fly, turnip root fly, onion fly, crane fly and housefly and different species of mosquitoes. Activity with broth (s) and toxin complex (s) is also observed against two-spotted spider bites, which is a member of the Acarina order, which includes strawberry spider bites, broad bites, citrus red bites, European red bites, pear rust bribes and tomato russet bribes.

Activity against rootworm corn larvae was tested as follows: Photorhabdus culture broth (s) (0-15 times concentrated, filter sterilized), 2% Peptone Protein # 3, purified toxin complex (s) [0.23 mg / ml ] or 10 mM sodium phosphate buffer, pH 7.0 were applied directly to the surface (nearly 1.5 cm ² ) of the artificial diet (Rose, Rl McCabe, JM (1973), J. Econ. Entomol. 66, (398-400) in 40 µl aliquots. The toxin complex was diluted in 10 mM sodium phosphate buffer, pH 7.0. The diet plates were allowed to air-dry in a sterile niche and the wells were infested with newly emerged individual Diabrotica undecimpunctata howardi (Southern corn rootworm, SCR) crested from the surface of sterilized eggs. The plates were sealed, placed in a moist growth chamber and kept at 27 ° C for the period appropriate (3-5 days) .Then, there were mortality rates and larval weight determinations. In general, all studies were performed olosit 16 insects per treatment Control mortality was generally less than 5%.

RO 121280 Β1

The activity against weevil diseases (Anthomonas grandis) was tested as follows. 1 Photorhabdus broths concentrated (1-10 times), control medium (2% Peptone Protein # 3), purified toxin complex (s) [0.23 mg / ml] or 10 mM sodium phosphate buffer, pH 7.0 s They applied 3 in 60 pl aliquots on the surface of 0.35 g artificial diet (Stoneville Yellow Lepidoptera diet) and allowed to dry. A single weevil larvae of 12-24 hr were placed on the diet and the wells were sealed and kept at 25 ° C, 50% RH, for 5 days. Then mortality and larval weights were evaluated. The control mortality was between 0-13%. 7

The activity against mosquito larvae was tested as follows. The test was conducted in a 96-well microtiter plate. Each well contained 200 µl aqueous solution 9 (concentrated 10 times) Photorhabdus culture broth (s), control medium (2% Peptone Protein # 3), 10 mM sodium phosphate buffer, 0.23 toxin complex (s) mg (ml or water) and 11 approximately 20 day-old larvae (Aedes aegypti). There were 6 wells per treatment. The results were read 3-4 days after the infestation. The control mortality was between 0-20%. 13

Activity against fruitflies was tested as follows. Drosophila melanogaster medium purchased was prepared using 50% dry medium and 50% liquid or water, 15 control medium (2% Peptone Protein # 3), 10-fold concentrated Photorhabdus culture broth (s), purified toxin complex (s) [ 0.23 mg / ml] or 10 mM sodium phosphate buffer, pH 7.0. This 17 was covered by placing 4.0 ml of dry medium in each of 3 growth vials per treatment and adding 4.0 ml of corresponding liquid. 10 Drosophila melanogaster larvae in late 19 larval stages were added to each 25 ml vial. The vials were kept on a laboratory table, at room temperature, under a ceiling with fluorescent light. After 15 days of exposure, 21 adults and pups were counted. The occurrence of adults was compared with the control and aqueous environment (0-16% reduction). 2. 3

The activity against adult aster leafhopper (Macrosteles severini) and horn planthoppre nymphs (Peregrimis maidis) was tested with an ingestion test designed to allow ingestion of 25 assets without other external contact. The tank for the active solution / ^, 'food' ^, is built by making two holes in the center of the bottom portion of a 35x10 mm Petri dish. A 2-inch Parafilm M® square was placed on the tip of the vessel and secured with a Ό ring. Then a 1 oz plastic mug was infested with about 7 individuals and the tank was placed above the vessel 29

Parafilm M®, down. The test solution was then added to the tank through holes. In assays using 10-fold concentrated Photorhabdus culture broth (s), broth and control medium 31 (2% peptonic protease # 3) were dialyzed on 10 mM sodium phosphate buffer, pH 7.0, and to the resulting solution was added sucrose (to 5%), to reduce the control mortality. The purified toxin complex (s) [0.23 mg / ml] or 10 mM sodium phosphate buffer, pH 7.0 were also tested. Mortality was reported on day 3. The tests were held in an incubator at 35 ° C, 70% RH with a 16/8 photoperiod. The tests were graded for mortality at 72 h. The control mortality was less than 6%. 37

The activity against lepidoteran larvae was tested as follows. Photorhabdus culture broth (s) (10 times), control medium (2% peptone protease # 3), 39 purified toxin complex (s) [0.23 mg / ml] or 10 mM sodium phosphate buffer , pH 7.0 were applied directly on the surface (-1.5 cm ² ) to the standard artificial lepidoteran regimen (41 Stoneville Yellow regime) in 40 µl aliquots. The food plates were allowed to air dry, in a sterile covered course, and each well was infested with a single new-born larva. European eggs 43 corn borer (Ostrinia nubilalis) and tobacco hornworm (Manduca sexta) were obtained from commercial sources and incubated locally, while larvae of tobacco budworm (Heliothis virescens) 45 were supplied internally. After infestation with larvae, the food plates were sealed, placed in a moist growth chamber and kept in the dark at 27 ° C for an adequate period. 47 Determinations of mortality and weight were made on day 5. Overall, 16 insects were used per treatment in all studies. Control mortality was generally in the range of 49 4-12.5% for the control medium and less than 10% for the phosphate buffer.

Activity against two-spotted spider bites (Tetranychus urticae) was determined as follows. Young pumpkin plants were cut into a single cotyledon and sprayed

RO 121280 Β1 for emptying with concentrated broth (s), control medium (2% peptonic protease # 3), purified toxin complex (s) [0.23 mg / ml] or 10 mM sodium phosphate buffer, pH 7.0 . After drying, the plants were infested with a mixed population of spider bites and kept at room temperature and humidity for 72 hours. Live insects were counted to determine the level of control.

Table 19

The insecticidal spectrum observed in broths from different Photorhabdus strains

Photorhabdus strain Sensitive insect species' WX-1 3 ”, 4, 5, 6, 7, 8 WX-2 2.4 WX-3 1.4 WX-4 1.4 WX-5 4 WX-6 4 WX-7 3, 4, 5, 6, 7, 8 WX-8 1,2,4 WX-9 1,2,4 WX-10 4 WX-11 1,2,4 WX-12 2, 4, 5, 6, 7, 8 WX-14 1,2,4 WX-15 1,2,4 W30 3,4, 5, 8 NC-1 1,2, 3, 4, 5, 6, 7, 8.9 WIR 2, 3, 4, 5, 6, 7, 8 HP88 1.3, 4, 5.7,8 Hb 3,4, 5, 7,8 ahem 1,2, 3, 4, 5, 7.8 H9 1,2, 3, 4, 5,6, 7,8 W-14 1,2, 3, 4, 5, 6, 7, 8, 9, 10 ATCC 43948 4 ATCC 43949 4 ATCC 43950 4 ATCC 43951 4 ATCC 43952 4

* = 25% mortality and / or growth inhibition vs. control “= 1; tobacco budworm, 2; European corn borer, 3; tobacco hornworm, 4; Southern corn rootworm, 5; bolL weevil, 6; mosquito, 7; fruit fly, 8; aster leafhopper, 9; horn planthopper, 10; two-spotted spider mite.

RO 121280 Β1

Example 14. Non-W-14 Photordabdus strains: purification, characterization and spectrum of activity. Purification.

The protocol, as follows, is similar to that developed for W-143 purification and was established based on the purification of those fractions that have the most activity against Southern corn root worm (SCR), as determined in biotests (see example 13) .5

Usually, 4-20 L broth was received and concentrated which was filtered, as described in example 13, using an Amicon S1 Y100 type spiral ultrafiltration cartridge, attached to an 7 Amicon M filter device. -12. The retainer contained native proteins having a molecular weight greater than 100 kDa, while the flow material contained native proteins 9 smaller than 100 kDa in size. Most of the activity against SCR was contained in the 100kDa retainer. The retainer was then diafiltered continuously with sodium phosphate 10 MM 11 (pH 7.0), until the filtrate reached an A ₂₈₀ <0.100. If this were not the case, then all procedures were performed in buffer defined by 10 mM sodium phosphate 13 (pH 7.0). The retainer was then concentrated to a final volume of about 0.20 I and filtered using a sterile 0.45 mm Nalgene ™ Filterware. The filtered material was charged at 7.5 ml / min. on a Pharmacia HR16 / 10 column that had been packaged with PerSeptive Biosystem Poros® 50 HQ strong anion exchange matrix balanced in buffer, using a PerSeptive Biosystem Sprint® HPLC system. After loading, the column was washed with buffer until A _{28 O} 0.100 was reached. Proteins were then eluted from the column at 19 2.5 ml / min for 20 min until a volume of 50 ml was reached using 0.4 M NaCL buffer. The column was then washed using 1.0 M NaCl buffer at the same flow rate, 21 for an additional 20 min (final volume = 50 ml). Proteins eluted with 0.4 M and 1.0 M NaCl were then placed in separate dialysis kits (Spectra / Por® MWCO Membranes: 2,000) and allowed to dialysate 23 overnight, at 4'C, in 12 L buffer. Most activity against SCR was contained in the 0.4 M fraction. The 0.4 M fraction was further purified by applying a 25 column Pharmacia XK 26/100 which had been pre-packed with Sepharose CL4B (Pharmacia), using a flow rate of 0. , 75 ml / min. The fractions were deposited on the basis of peak profile A ₂₈₀ and concentrated to a final volume of 0.75 ml, using a Millipore Ultrafree® -15 Biomax-50 KNMWL membrane centrifugal filtration device. The 29 protein concentration was determined using a Biorad Protein Assay kit with bovine standard globulin.

Characterization 31

The native molecular weight of the SCR toxin complex was determined using a Pharmacia HR16 / 50 which had been pre-packaged with a Sepharose CL4B buffer. Column 33 was then calibrated using proteins of known molecular weight, thus allowing calculation of the approximate native molecular size of the toxin. As shown in Table 20, the molecular size of the toxin complex was in the range from 777 kDa with the Hb strain to 1,900 kDa with the WX-14 strain. The yield of the toxin complex also varied, from the WX-12 strain producing 0.8 mg / L to the Hb strain producing 7.0 mg / L.

The proteins found in the toxin complex were examined for individual polypeptide size, using SDS-PAGE analysis. Typically, 20 mg protein of the toxin complex from each strain was loaded onto a 2-15% polyacrylamide gel (Integrated Separation Systems) and subjected to electrophoresis at 20 mA in Biorad SDS-PAGE buffer. After electrophoresis was completed, the gels were stained overnight in blue Biorad Coomassie R-250 (0.2% in methanocacid 43 acetic acid: water; 40:10:40 v / v / v). The gels were further discolored in acetic methanocacid: water; 40:10:40 (v / v / v). The gels were then clarified with water for 15 minutes and scanned using a 45 Molecular Dynamucs Personal Laser Densitometer®. The bands were quantified and the molecular size was calculated as compared to the high molecular weight standards 47 Biorad, which ranged from 200-45 kDa.

RO 121280 Β1

The sizes of the individual polypeptides containing the SCR toxin complex in each strain are listed in Table 21. The sizes of the individual polypeptides ranged from 230 kDa with the WX-1 strain to 16 kDa, as observed in the WX-7 strain. Each strain, except for the Hb strain, had polypeptides comprising the toxin complex that are in the range 160-230 kDa, the range 100-160 kDa and the range 50-80 kDa. These data show that said toxin complex may vary in peptide composition and strain-to-strain components, however, in all cases, the toxin attributes appear to consist of an oligameric protein complex.

Table 20

Characterization of the toxin complex from Photorhabdhus non W-14 strains

Stem Mol. native approx. ^of Production of active fraction (mg / L) ^b Hb 972.000 1.8 Hb 777.000 7.0 ahem 1,400,000 1.1 HP88 813,000 2.5 NCI 1.092 million 3.3 WIR 979.000 1.0 WX-1 973.000 0.8 WX-2 951.000 2.2 WX-7 1,000,000 1.5 WX-12 898.000 0.4 WX-14 1,900,000 1.9 W-14 860,000 7.5

³ Native molecular weight determined using a Pharmacia HR 16/50 column packed with Sepharose CL4B;

^{b The} amount of toxin complex recovered from the culture broth.

Spectrum of activity

As shown in Table 21, the toxin complexes purified from the Hm and H9 strains were tested for activity against a variety of insects, for comparison with the toxin complex from the W-14 strain. The tests were performed as described in Example 13. The toxin complex from all three strains showed activity against tobacco budworm, European corn borer, Southern corn rootworm and aster leafhopper. In addition, the toxin complex from Hm and W-14 strains also showed activity against two-spotted spider bites. Furthermore, the W-14 toxin complex showed activity against mosquito larvae. These data show that, as they have similarities in activities between different orders of insects, the toxin complex may also show different activities against other orders of insects.

RO 121280 Β1

Table 21

Approximate sizes (kDa) of peptides in a non-W-14 purified toxin complex Photorhabdus

H9 Hb ahem HP NC-1 WIR WX-1 WX-2 WX-7 WX-12 WX-14 W-14 88 180 150 170 170 180 170 230 two hundred two hundred 180 210 190 170 140 140 160 170 160 190 170 180 160 180 180 160 139 100 140 140 120 170 150 110 140 160 170 140 130 81 130 110 110 160 120 87 139 120 160 120 120 72 129 44 89 110 110 75 130 110 150 98 100 68 110 16 79 98 82 43 110 100 130 87 98 49 100 74 76 64 33 92 95 120 84 88 46 86 62 58 37 28 87 80 110 79 81 30 81 51 53 30 26 80 69 93 72 75 22 77 40 41 2. 3 73 49 90 68 69 20 73 39 35 22 59 41 77 60 60 19 60 37 31 21 56 33 69 57 57 58 33 28 19 51 65 52 54 45 30 24 18 37 63 46 49 39 28 22 16 33 60 40 44 35 27 32 51 37 39 25 26 46 37 2. 3 40 35 39 29

Table 22

The insecticidal spectrum observed in a purified toxin complex from Photorhabdus strains

Photorhabdus strain Sensitive insect species * Hm toxin complex 1 ", 2,3,5,6,7,8 H9 toxin complex 1,2,3, 6, 7,8 W-14 toxin complex 1,2, 3, 4, 5, 6,7,8

'=> 25% mortality or growth inhibition;

** = 1; Tobacco bud worm, 2; European corn borer, 3; Southern corn root worm, 4) Mosquito, 5; Two-spotted spider mite, 6; Aster leafhopper, 7; fruit Fly, 8; Weevil disease.

RO 121280 Β1

Example 15. Subfractionation of the protein toxin complex Photorhabdus

The Photorhabdus toxin protein complex was isolated as described in Example 14. Next, approximately 10 mg of toxin was applied to a 5/5 MonoQ 5/5 column equilibrated with 20 mM Tris-HCl, pH 7.0 at a flow rate of 1 ml / min. The column was washed with 20 mM Tris-HCl, pH 7.0, until the optical density at 280 nm returned to baseline absorbance. Column-bound proteins were eluted with a linear gradient of 0 to 1.0 M NaCl in 20 mM Tris-HCl, pH 7.0 at 1 ml / min for 30 min. Fractions of 1 ml were collected and subjected to Southern corn rootworm (SCR) biotest (see Example 13). Activity peaks were determined by a series of dilutions of each fraction in SCR biotests. Two peaks of activity against SCR were observed and were called A (eluted to about 0.2-0.3 M NaCl) and B (eluted to 0.3-0.4 M NaCl). Activity peaks A and B were stored separately and both peaks were further purified using a 3-step procedure, described below.

(NH ₄ ) ₂ SO ₄ solid was added to the above protein fraction at a final concentration of 1.7 M. Then the proteins were applied to a phenyl-Superose 5/5 column equilibrated with 1.7 M (NH ₄ ) ₂ SO ₄ in 5 mM potassium phosphate buffer, pH 7 at 1 ml / min. Column-bound proteins were eluted with a linear gradient of 1.7 M (NH ₄ ) ₂ SO ₄ , 0% ethylene glycol, 50 mM potassium phosphate, pH 7.0, 25% ethylene glycol, 25 mM phosphate of potassium, pH 7.0 (not (NH ₄ ) ₂ SO ₄ at 0.5 ml / min. Fractions were dialyzed overnight over 10 mM sodium phosphate buffer, pH 7.0. Activities in each fraction against SCR were determined by biotest.

The higher activity fractions were stored and applied to a MonoQ 5/5 column, which was equilibrated with 20 mM Tris-HCl, pH 7.0 at 1 ml / min. Column bound proteins were eluted at 1 ml / min through a linear gradient from 0 to 1 M NaCl in 20 mM Tris-HCl, pH 7.0.

For the final purification step, the above active fractions (determined by SCR biotest) were stored and subjected to a second phenyl-Superose 5/5 column. (NH ₄ ) ₂ SO ₄ solid was added to a final concentration of 1.7 M. Then the solution was loaded to the column equilibrated with 1.7 M (NH ₄ ) ₂ SO ₄ in 50 mM potassium phosphate buffer, pH 7 at 1 ml / min. Column bound proteins were eluted with a linear gradient of 1.7 M (NH ₄ ) ₂ SO ₄ mM potassium phosphate, pH 7.0, at 10 mM potassium phosphate, pH 7.0 at 0.5 ml / min. The fractions were dialyzed overnight against 10 mM sodium phosphate buffer, pH 7.0. The activities in each fraction against SCR were determined by biomass.

The final protein purified by the procedure in 3 steps above, from peak A, was called toxin A, and the final protein purified from peak B was called toxin B.

Characterization and amino acid sequencing of toxin A and toxin B in SDS-PAGE Both toxins A and B contained two major peptides (> 90% of total Commassie colored protein): 192 kDa (named Al and Bl respectively) and 58 kDa (respectively called A2 and B2, respectively). Both toxins A and B reveal only a major band in native PAGE, indicating that Al and A2 are subunits of a protein complex, and Bl and B2 are subunits of a protein complex. Additionally, the native molecular weight of both toxins A and B was determined by gel filtration chromatography to be 860 kDa. The relative molar concentrations of Al and A2 were estimated to be 1 to 1 equivalence, as determined by densitometric analysis of SDS-PAGE gels. Similarly, the peptides Bl and B2 had the same molar concentration.

Toxin A and toxin B were electrophoresed in 10% SDS-PAGE and transferred to PVDF membranes. The blots were transmitted for amino acid analysis and N-terminal amino acid sequencing at Harvard MicroChem, and Cambridge ProChem, respectively. Amino N-terminal sequence of Bl was determined to be identical to SEQ ID NO: 1, the TcbA ^ region of the tcbA gene (SEQ ID NO: 12, position 87 to 99). A single N-terminal sequence was obtained for peptide B2 (SEQ ID NO: 40). The N-terminal amino acid sequence of peptide B2 was

RO 121280 Β1 identical to the TcbA ^ region of the amino acid sequence derived from the tcbA gene (SEQ ID NO: 12, 1 position 1935 to 1945). Therefore, toxin B contained predominantly 2 peptides, TcbA ;, and TcbA ,,,, which were observed to be derived from the same gene product, TcbA. 3

The N-terminal sequence of A2 (SEQ ID NO: 41) was unique compared to the TcbAjji peptide and other peptides. Peptide A2 was designated TcdA ^ (see Example 17). SEQ ID NO: 6 was determined to be a mixture of the amino acid sequences SEQ ID NO: 40 and 41.

Peptides A1 and A2 were further subjected to internal amino acid sequencing. For 7 internal amino acid sequencing, 10 µg of toxin A was electrophoresed in 10% SDS-PAGE and transferred to a PVDF membrane. After the blot was stained with amido 9 black, peptides A1 and A2, called TcdAj; and TcdA ^ respectively, were excised from the blot and sent to Harvard MicroChem and Cambridge ProChem. The peptides were subjected to trypsin digestion, followed by HPLC chromatography, to separate the individual peptides. N-terminal amino acid analysis was performed on selected tryptic peptide fragments. Two 13 internal amino acid sequences of peptide A (TcdA _ji -PK71, SEQ ID NO: 38 and TcdAj | -PK44, SEQ ID NO: 39) were found to have significant homologies with the deduced amino acid sequences of the 15 Tcb ^ region of the gene. tcbA (SEQ ID NO: 12) Similarly, the N-terminal sequence (SEQ ID NO: 41) and two internal sequences of peptides A2 _(IIJ -PK57 TcdA SEQ ID NO: 42 and TcdA -PK20 _IJJ, SEQ ID NO: 17: 43) also showed significant homology with the deduced amino acid sequences of the TcbA ^ region of the tcbA gene (SEQ ID NR.-12). 19 in the summary of the above results, the toxin complex has at least 2 protein toxin complexes active against SCR: toxin A and toxin B. Toxin A and toxin B are similar in their native molecular weights and in their subunits, however, their compositions. of peptides are different. Toxin A contains the peptides TcdAj, and TcdA ,,, as majority peptides and toxin B contains TcbA ;; 23 and TcbA ,,, as majority peptides.

Example 16. Cleavage and activation of TcbA 25 peptides in the toxin B complex, TcbA, and TobA ^ peptides create from a single gene product

TcbA (Example 15). Processing of the TcbA peptide at TcbAj, and TcbA ,,; is presumed by the action of the Photorhabdus protease (s) and, most likely, the metalloproteases described in Example 10. In some cases, it was noted that, when the W-14 Photorhabdus broth was processed, 29 TcbA peptide appeared in the complex. B toxin, as a major component, in addition to the peptides TcbAjj and TcbAjj Identical procedures, described for the purification of the toxin B 31 complex (example 15), have been used to enrich the TcbA peptide from the toxin complex fraction of the W-14 broth. The final purified material was analyzed in a 4-20% SDS-PAGE 33 gradient and the major peptides were quantified by densitometry. It was determined that TcbA, TcbAjj and TcbAjjj comprised 58%, 36% and 6% of the total protein respectively. The identities of these peptides 35 were confirmed by their molecular sizes in SDS-PAGE and Western Blot analyzes, using specific antibodies. The native molecular weight of this fraction was determined to be 37,860 kDa.

TcbA cleavage was evaluated by treating the above purified material with 38 kDa and 39 58 kDa metalloprotecting W-14 Photorhabdus (example 10) and Tripsin as control enzyme (Sigma, MO). The standard reaction consisted of 17.5 µg of the above purified fraction, 1.5 41 units protease and 0.1 M Tris buffer, pH 8.0, in a total volume of 100 µl. For the control reaction, the protease was omitted. The reaction mixture was incubated at 37 ° C for 90 min. At the end of the reaction, 20 μΙ were taken and boiled with SDS-PAGE sample buffer for electrophoretic analysis in 4-20% gradient SDS-PAGE. From SDS-PAGE it was determined that, both in treatment 45 with protease 38 kDa and in protease 58 kDa, the amount of peptides tcbA ,, and TcbA ,,; increased 3-fold, while the amount of TcbA peptide decreased proportionally (Table 23). 47

The relative reduction and growth of the selected peptides were confirmed by Western blot analysis.

RO 121280 Β1

Furthermore, gel filtration of the cleaved material revealed that the native molecular size of the complex remained the same. By trypsin treatment, the peptides TcbA ^ and TcbA ,,, were nonspecifically digested into small peptides. This shows that Photorhabdus proteases 38 kDa and 58 kDa can specifically process the TcbA peptide, in the TcbA, and TcbA, peptides. The treated and untreated protease control of the remaining 80 µl of the reaction mixture was serially diluted with 10 mM sodium phosphate buffer, pH 7.0 and analyzed by SCR biotest. By comparing the activity at different dilutions, it was determined that the 38 kDa protease treatment increased SCR insecticidal activity by about 3 to 4 times. The inhibition of growth of insects remaining in the prostate treatment is also more serious than that of the control (Table 23).

Table 23

Conversion and activation of the TcbA peptide in TcbA peptides; and TcbA ,,,, by protease treatment

Control Treatment protects 38 kDa S0 (% of total protein) 58 18 S1 (% of total protein) 36 64 S9 (% of total protein) 6 18 LD 50 (pg protein) 2.1 0.52 Weight SCR (mg / insect) * 0.2 0.1

* - an indicator of growth inhibition by measuring the average weight of live insects, after 5 days of diet in test.

Example 17. Bank research for genes encoding the TcdA peptide "

Cloning and characterization of the gene encoding the TcdA peptide ", described as SEQ ID NO: 17 (sequence of the internal TcdA peptide" -PT111 N-terminal) and SEQ ID NO: 18 (sequence of the internal peptide TcdA _r PT79 N-terminal) were completed . Synthesized as described in Example 8, 2 degenerate oligonucleotide deposits designed to encode the amino acid sequences of SEQ ID NO: 17 (Table 24) and SEQ ID NO: 18 (Table 25) and their reverse complement two. The DNA sequence of the oligonucleotides is given below:

CO io CD T ~ CO LO N CD T CO IO T r CM CM CM CM

'ΜCXl

RO 121280 Β1

co I Ser ? ·% f- 5 g 5 Pi δ Fn 8 < 8 £ 10 £ ! S g δ 5 and 5 $ V. A 3 | complicated g I E £ • TF · S I £ and < g ξ £ - ί g s £ <ϋ. R y < 2 and ί I £ and g a - «c z 8 5N I σ O w * l a δ <; 8 ol A-. sheep a 5 A. f T> Ί5 § ** yes You are «* î Si oi Ό ♦ · »if g r * Î <1 CQ V ed 2

Ο

Degenerated oligonucleotide for SEQ ID NO: 18 m * 42 rn > R * P * r ~ k et p> K 2 * <7> O a < 2* 3 < > - and $ P 5 - and w CL · § g S s A < 2 i? > z / i or <5 n 7 " a > < £ "λ > g § y & GC "*a »· Ϋ s 8 > - 8 y 5 would i- ' => s? o i f-T i o <with, 3 * 0 £ OC £ sheep <> · A 3 Ό 5 g > y 8 c V » js H § δ < s 3 3 Μ ^- £ £ < «- <s o 3 1 8 <s * i o s E I <p c · § o E-1 TI> and g g § 8> «» E ZE t: < - c " £ sheep £ Οι £ «Λ t < sheep <Hi 1 H 8 ί 6 7g 0i £ m ε if 2 0k £ 8 her ε and

co

RO 121280 Β1

Polymerase chain reactions (PCR) were performed mainly as described in Example 8, using as forward primers P2.3.6.CB or P2.3.5 and as reverse primers P2.79.R.1. or P2.79R.CB, in all forward / reverse combinations, using Photohabdus W-14 genomic DNA as a template. In another set of reactions, primers P2.79.2 or P2.79.3 were used as forward primers and P.2.3.5R, P2.3.5RJ and P2.3R.CB were used as reverse primers in all combinations before / inverse. Only in reactions containing P2.3.6.CB as primers before combined with P2.79.R. 1. or P2.79R.CB as reverse primers, we observed a non-artefactual amplified product with estimated size (mobility on agarose gels) of 2500 base pairs. The order of primers used to obtain this amplification product shows that the peptide fragment TcdA ^ PTIH is located amino-proximal to the peptide fragment TcdA _jj -PT79.

The 2500 bp PCR products were ligated to the pCM ™ ll plasmid vector (Invitrogen, San Diego, CA), according to the instructions of the suppliers, and the DNA sequences along the ends of the insert fragments of the two isolates (HS24 and HS27) were determined using the primers recommended by the providers and the sequencing methods described above. The sequence of both isolates was the same. New primers were synthesized based on the determined sequence and used for additional primer sequencing reactions, to obtain a total of 2557 bases of the insert [SEQID NO; 36]. The translation of the partial peptide encoded by SEQID NO: 36 gave the amino acid sequence 845 described as SEQ ID NR.37. Protein homology analysis of this portion of the TcdA ^A peptide fragment shows substantial amino acid homology (68% similarity; 53% identity) at residues 542 to 1390 of TcbA protein [SEQ ID NO: 12], however, it appears that the gene represented in part by SEQ ID NO: 36 produces a protein of the similar but not identical amino acid sequence, such as the TcbA protein and whose similar activity had similar activity but not identical with the TcbA protein.

In another embodiment, a gene encoding TcdA _ij -PK44 peptides and 58 kDa TcdAjjj N-terminal peptide, described as SEQ ID NO: 9 (internal peptide TcdA ^ PK44 sequence), was isolated SEQ ID NO: 41 (sequence N-terminal peptide TcdA ^ of 58 kDa). Two degenerate oligonucleotide repositories, designated to encode amino acid sequences, described as SEQ ID NO: 39 (Table 27) and SEQ ID NO: 41 (Table 26) and reverse complement to these sequences, were synthesized in Example 8 and their sequences. AND.

<Ό m b- σ> τ- CO ιη b- σ> τ- CO m b- X ^- χ ^- ν- CXI CXI CXJ CM

RO 121280 Β1

xt Gin <O and CA 3 ' ? η Ο Ο ai 1CC 3 ' m s Q_ tti 8 8 δ od < CM £ > 8 fe - £ E B Ε οί ο 5 ο s ξ c £ £ £ ac fe σ ' 1· i <o > <o α: < > Η cd • ο £ > <J < ΰ < ι ο <ω ο- J g > % < < < ο u 12 δ < ω < θ '<> ο <ο W c -2 t $ μ · < < 8 .s < ΰ o ΰ ο % > g 0-, m & · Λ > - 8 > <Ν ε · < > the CJ Cn - 5 But * 4fc 32 Μ m 5 a < O4 < CM 3 α £ »η 3 A2.4.R

CM φ ο

, Ο) δ σ>

Οί

Q

Ο UJ

C0

<£ ch U <- **> < 1 CC 3 · ι ΑΤ3 · ί CC3 ' . · ** »W» © φ "the < Ξ ο αζ ο ο Ο ο ο ο μγ r £ 8 < > ο < ο < ο < (BUT) \ © 1 t— << > << g CM 4 * Ί ξ & < δ < (II) -2 Ο $ ο g <ο ο <*> J and 1 = ο £ ο S * 04 e Egg αί 8 8 ο 8 ο ο OQ * - -2> Ο > 8 BC F < ICJ ο ο · ** F < wn> «I ο C e < ϊ * at ο 3 3 ί < X τ — 1 < Tell you X ΰ α 3 OC 04 χτ χ » 5

b <0

RO 121280 Β1

Polymerase Chain Reactions (PCR) were essentially performed, as described in Example 8, using as forward primers Al.44.1 or Al.44.2 and as reverse primers A2.3R or A2.4R in all forward / reverse combinations, using Photorhabdus W-14 genomic DNA as a template. In another set of reactions, primers A2.1 or A2.2 were used as forward primers and A1.44.1R and AI.44.2R were used as reverse primers in all forward / reverse combinations. Only in reactions that contained Al.44.1 or Al.44.2 as primers before combined with A2.3R as the reverse primer, an amplified non-artefactual product of estimated size (mobility on agarose gels) of 1400 base pairs was observed. The order of the primers used to obtain this amplification product shows that the peptide fragment TcdA ^ TK44 is located amino-proximal to the 58 kDa peptide fragment of TcdA ,,,.

The 1400 bp PCR products were ligated to the pCR ™ II plasmid vector according to the supplier's instructions. The DNA sequences along the ends of the four isolate insert fragments were determined using similar primers in sequence to the primers recommended by the supplier and using previously described sequencing methods. The nucleic acid sequence of all isolates differs, as expected, in regions that correspond to the degenerate primer sequences, but the amino acid sequences deduced from these data were the same as the current amino acid sequences for the previously determined peptides (SEQ ID NOs: 41 and 39).

Research into the W-1.4 genomic cosmid bank, as described in Example 8 with a radiolabeled sample, comprised the DNA prepared above (SEQ ID NO: 36), identified five isolated cosmids that hybridize to 19D9,20B10,21D2.27B10 and 26D1. These compounds were different from those previously identified with samples corresponding to the genes described as SEQ ID NO: 11 or SEQ ID NO: 25. Restriction enzyme analyzes and DNA blot hybridizations identified EcoR I fragments, approximately 3.7, 3.7 and 1.1 kbp in size, comprising the region with DNA SEQ ID NO: 36. Research of the W-14 genomic cosmid bank, using the 1.4 kbp radiolabeled DNA fragment prepared in this sample, identified the same five cosmids (17D9, 20B10,21D2,27B10 and 26D1). DNA blot hybridization to EcoR l-digested cosmid DNAs also showed hybridization to the same subset of EcoR I fragments, as observed with the 2.5 kbp TcdAj gene sample, which shows that both fragments are encoded by DNA. genomic.

Determining the DNA sequence of cloned EcoR I fragments showed an uninterrupted read frame of 7551 base pairs (SEQ ID NO: 46), which encodes a 282.9 kDa protein of 2516 amino acids (SEQ ID NO: 47). Analysis of the amino acid sequence of this protein revealed all the internal fragments of the TcdA ^ SEQ ID NOs: 17, 18, 37, 38 and 39 and the N-terminus of the TcdA ^ peptide (SEQ ID NO: 41) and all of the internal TcdA ^ peptides (SEQ ID NO: 42 and 43) expected. The peptides isolated and identified as TcdA ^ and TcdA ^ are each product of the open reading frame, designated tcdA, described as SEQ ID NO: 46. Further, SEQ ID NO: 47 shows, from position 89, the sequence described as SEQ ID NO: 13 which is the N-terminal sequence of a peptide of approximately 201 kDa size, showing that the initial protein produced from SEQ ID NO : 46 is processed in a manner similar to that described earlier for SEQ ID NO: 12. In addition, the protein is further cleaved to generate a product of size 209.2 kDa, encoded by SEQ ID NO: 48 and described as SEQ ID NO: 49 (peptide TcdA ;;) and a product of size 63.6 kDa encoded by SEQ ID NO: 50 and described as SEQ ID NO.51 (TcdAJ peptide. Thus, it is considered that the insecticidal activity identified as toxin A (example 15) derived from SEQ ID NR.46 products exemplified by full-length protein. of 282.9 kDa, described as SEQ ID NR.47, is processed to produce the peptides described as SEQ ID NO: 49 and 51. The insecticidal activity identified as toxin B (example 15) is considered to derive from SEQ ID NO : 11, as exemplified by the 280.6 kDa protein described as SEQ ID NO: 12. This protein is proteolytically processed to obtain a 207.6 kDa peptide described as SEQ ID NO: 53, which is encoded by SEQ ID NR: 52 and 62.9 kDa peptide having the sequence

RO 121280 Β1

N-terminal described as SEQ ID NO: 40 and further described as SEQ ID NO: 55, which is 1 encoded by SEQ ID NO: 54.

Comparisons of the amino acid sequence, between the proteins described as SEQ ID NO: 12 and 3 SEQ ID NO: 47, showed that they have 69% similarity and 54% identity. This high degree of evolving relationships is not uniform throughout the entire amino acid sequence of these peptides, but is higher towards the carboxy-terminal end of the proteins, as the peptides described as SEQ ID NO: 51 (derived from SEQ ID NO: 47) and SEQ ID NO: 55 (derived from 7 SEQ ID NO: 12) have 76% similarity and 64% identity.

Example 18. Combating maize destruction 9

The ability of Photorhabdus toxin (s) to reduce plant damage caused by insect larvae has been demonstrated by measuring leaf damage caused by European 11 comborer (Ostrinia nubilalis) infested with Photorhabdus broth treated corn. The broth fermentation from Photorhabdus strain W-14 was produced and concentrated 13 approximately 10 times by ultrafiltration (10,000 MW pore size), as described in example 13. The resulting concentrated broth was then sterilized by filtration, using as membrane filters. 0.2% nitrocellulose. A similarly prepared sample of 2% non-inoculated protease peptone # 3 was used for control purposes. Maize plants (a cross line owned by DowElanco) 17 grew from seed at vegetative stage 7 or 8, in pots containing an earthless mixture, in a greenhouse (27 ° C day; 22 ° C at night, almost 50 % RH, 14 h day-light, watered / fertilized 19 as needed). The test plants were arranged in a completely randomized block diagram (3 repetitions / treatment, 6 plants / treatment), in a greenhouse with a temperature of almost 22 ° C during the day; 21 18 ° C at night, without artificial light and with partial shading, almost 50% RH and watered / fertilized as needed. Treatments (non-inoculated medium and concentrated broth 23 Photorhabdus) were applied with a spray syringe, 2.0 ml applied directly (nearly 6 inches) above the whorl and another 2.0 ml applied in a circular motion from about one foot above. whorl. 25 In addition, one group of plants did not receive treatment. After the treatments were dried (about 30 minutes), 12 newly emerged larvae, European corn borer (obtained from commercial sources and 27 hatches by their own means), were applied directly to the vedic. After 1 week, the plants were investigated for leaf destruction, using a modified Guthrie scale (Koziel, MG, Belnad, 29 GL, Bowman, C, Carozzi, NB, Crenshaw, R., Crossland L., Dawson, 1, Desai , N., Hill, M "Kadwell, S., Launis, K., Lewis, K-, Maddox, D., McPherson, K., Meghji, MZ, Merlin. E., 31

Rhodes, R., Warren, G. W., Wright, M. and Evola, S.V., 1993, Bio / Technology, 11, 194-195) and measurements were statistically compared [T-test (LSD) p <0.05 and Tukey's Studentized Range 33 (HDS) Test p <0.1]. The results are presented in table 28. As a reference, 1 means no destruction, 2 represents fine window destruction on the unopened leaf without penetration 35 pores and 5 represents leaf penetration with elongated lesions and / or eaten middle rib, evident at more than 3 leaves (lesions <1 inch). These data show that the broth or other proteins containing the fractions may confer protection against certain parasitic insects, when administered in the spray formula, or when the gene or derivatives thereof encoding the protein, or part thereof is administered via a transgenic plant or a microbe.

Table 28

Effect of Photorhabdus culture broth on induced leaf destruction43

Average Guthrie Measurement Treatment

Without treatment 5.02 ^of 45

Non-inoculated medium5,15

Photorhabdus Bulion 2.24 ^b 47

The means with different letters are different statically (p <0.05 or p <0.1).

RO 121280 Β1

Example 19. Genetic engineering of genes for expression in E.coli

Summary of constructions

A series of plasmids have been constructed to express the Photorhabdus W-14 gene in Escherichia coli. A list of plasmids is presented in Table 29. Data were obtained for a brief description of each construct as a result of the expression E.coli.

Table 29

Expression plasmids for the tcbA gene

plasmid Gene Vector / Selection Behavior pDAB634 tcbA pBC / Chl intracellular pAcGP67 / tcbA tcbA pAcG67B / Amp Secreted Baculovirus PDAB635 tcbA pET27b / Kan periplasm pET 15-tcbA tcbA pET15-tcbA intracellular

Abbreviations: Kan = kanamycin, Chl = chloramphenicol, Amp = ampicillin

The pDAB634 construct in Example 9 describes a large EcoR I fragment that hybridizes to the TcbA _a sample. This fragment was subcloned into pBC (Stratagene, La Jolla CA). Sequence analysis showed that this fragment consists of 8816 base pairs. The fragment encodes the tcbA gene with ATG starting at position 571 and TAA ending at position 8086. Therefore, the fragment carries 570 Photorhabdus DNA base pairs upstream of ATG and 730 base pairs downstream of TAA.

Construction of plasmid pAcGP67BftcbA

The tcbA gene was PCR amplified using the following primers: 5 'primer (S1Ac51) 5' TTT AAA CCA TGG GAA ACT CAT TAT CAA GCA CTA TC 3 'primer (S1 Ac31) 5' TTT AAA GCG GCC GCT TAA CGG ATG GTA-TAA CGA TAT TG 3 '. PCR was performed using a TaKaRa LA PCR kit from PanVera (Madison, Wisconsin) in the following reaction: 57.5 ml water, 10 ml 10X LA buffer, 16 ml dNTPs (2m5 mM each stock solution), 20 ml each primer at 10 pmoli / ml, 300 ng plasmid pDAB634 containing the tcbA gene and 1 ml TaKaRa LA Taq polymerase. The cycling conditions were 98 ° C / 20 s, 68 ° C / 5 min, 72 ° C / 10 min for 30 cycles. An expected PCR product of about 7526 bp was isolated in a 0.8% agarose gel in TBE buffer (100 mM Tris, 90 mM boric acid, 1 mM EDTA) and purified using a Qiaex II kit from Qiagen (Chatsworth (California). The purified tcbA gene was digested with Nco I and Not I and ligated into the baculovirus transfer vector pAcGP67B (PharMingen (San Diego, California)) and transformed into E. coli DH5a. The tcbA gene was then cut from pAcGP67B and transferred to pET27b to create plasmid pDAB635. Fixed a mutation in pDAB635 in the tcbA gene.

The repaired tcbA gene contains 2 modifications from the sequence shown in SEQID NO: 11; an A> G at change 212, an aspargin 71 laser 71 and a G> Al change 229, an alanine 77 at threonine 77. These changes are both above the proposed N-terminus TcbA ^.

Construction of pET 15-tcbA

The tcbA encoding region of pDAB635 was transfected into pET vector 15b. This was done using shotgun ligands, the DNAs were cut with the restriction enzymes Nco I and Xho I. The resulting recombinant was named pET15-tcbA.

Expression of TcbA in E.coli from plasmid pET15-tcbA

RO 121280 Β1

The expression of tcbA in E.coli was obtained by modifying the previous methods described by Studieret al. (Studier, F. W., Rosenberg, A., Dunn, J. and Dubendorff, J., (1990) Use of T7 RNA polymerase to direct expression of cloned genes. Methods Enzymol., 185, 60-89). Corresponding cells 2s.co//tulpine BL21 (DE3) were transformed with pET 15-tcbA plasmid and deposited on LB agar containing 100 µg ampicillin and 40 mM glucose. The transformed cells were deposited at a density of several hundred isolated colonies / plate. After incubation overnight, at 37 ° C, the cells were cleaned from the plates and suspended in LB broth containing 100 µg ampicillin. Typical culture volumes were 200-500 ml. At time zero, the culture densities (OD6GO) were from 0.15-0.5, depending on the experiment. The cultures were shaken at one of three temperatures (22 ° C, 30 ° C or 37 ° C), until the density of 0.15-0.5 was obtained when they were induced with 1 mM isopropylthio -8-galactoside (IPTG). Cultures were incubated at the designated temperature for 4-5 h, and then transfected at 4 * C until processing (12-72 h).

Purification and characterization of TcbA expressed in E.coli from plasmid pET15-tcbA

E.coli cultures expressing TcbA peptides were processed as follows. The cells were harvested by centrifugation at 17,000 x G and the medium was decanted and stored in a separate container.

The medium was concentrated to about 8x using the M12 filtration system (Amicon, Beverly MA) and a 100 kDa molecular weight separation filter. The concentrated medium was loaded onto an anion exchange column and the bound proteins eluted with 1.0 M NaCl. The elution peak of 1.0 M NaCI was found to cause mortality of Southern corn rootworm (SCR) larvae (Table 30). The 1.0 M NaCl fraction was dialyzed on 10 mM sodium phosphate buffer pH 7.0, concentrated and subjected to gel filtration on Sepharose CL-4B (Pharmacia, Piscataway, New Jersey). The region of the CL-4B elution profile corresponding to the calculated molecular mass (nearly 900 kDa), such as the native W-14 toxin complex, was collected, concentrated and biotested against larvae. The fraction collected of 900 kDa was found to have insecticidal activity (see table 30 below) with symptoms similar to that caused by the native W-14 toxin complex. This fraction was subjected to Proteinase K and heat treatment, the activity in both cases being reduced or eliminated, providing evidence that the activity is protein in nature. In addition, the active fraction was tested immunologically positive for TcbA and TcbA peptides, in immunoblot analysis, when an anti-TcbAII monoclonal antibody was tested (Table 30).

Table 30

Immunoblot and SCR biotest results

faction SCR activity immunoblot Native size death rate % Growth inhibition% Peptides detected Estimated size CL-4B Medium Tcb 1.0 M +++ +++ TcbA Ion exchange Medium TcbA CL-4B +++ +++ Tcb, TcbA ,,, -900 kDa Medium TcbA CL-4B + K protein ++ +++ NT TcbA medium CL-4B + heat treatment - - NT TcbA cells Sup CI-4B - +++ NT -900 kD

PK = K Proteinase Treatment, 2 h; Heat treatment = 100 * C, for 10 minutes; ND = undetected; NT = untested. Measurement system for mortality and growth inhibition, as compared to control samples; 5-24% = +, 25-49% = ++, 50-100% = +++.

RO 121280 Β1

The cell pellet was resuspended in 10 mM sodium phosphate buffer, pH 7.0, and passed through a Bio-Neb ™ cell spray device (Glas-Col Inc., Terra Haute, IN). The pellets were treated with DNase to remove the DNA and centrifuged at 17,000xg, to separate the pellet cells from the cell supernatant. The supernatant fraction was decanted and filtered through a 0.2μ filter to remove large particles and subjected to anion exchange chromatography. The bound proteins were eluted with 1.0 M NaCl, dialyzed and concentrated using Biomax ™ concentrators (Millipore Corp, Bedford, MA) with a molecular weight of 50,000 Daltons. The concentrated fraction was subjected to gel filtration chromatography, using Sepharose CL-4B granular matrix. The biotest data for the material prepared in this way are shown in table 30 and are referred to as TcbA sup cells.

In another method, to handle large amounts of material, the cell pellets were resuspended in 10 mM sodium phosphate buffer, pH 7.0 and completely homogenized, using a 40 mL Kontes Glass tissue polishing mechanism. Company (Vineland, NJ). The remaining cell pellet was pelleted by centrifugation at 25000xg and the cell supernatant was decanted, passed through a 0.2 μ filter and subjected to anion exchange chromatography, using a Pharmacia 10/10 column packed with Poros HQ 50 granules. eluted by achieving a NaCl gradient of 0.0 to 1.0 M. The fractions containing the TcbA protein were combined and concentrated using a 50 kDa concentrator and subjected to gel filtration chromatography, using a matrix. granulated Pharmacia CL-4B. Fractions containing oligomerTcbA, about 900 kDa molecular weight, were collected and subjected to anion exchange chromatography using a Pharmacia Mono Q10 / 10 column equilibrated with 20 mM Tris buffer, pH 7.3. A gradient of 0.0 to 1.0 M NaCl was used to elute the recombinant TcbA protein. Recombinant TcbA was eluted from the column at a saline concentration of about 0.3-0.4 M NaCl, the same molarity at which the TcbA oligomer was eluted from the Mono Q 10/10 column. The recombinant TcbA fraction was found to cause SCR mortality in biotest experiments, similar to those presented in Table 30.

Claims (7)

claims 1. A polynucleotide that is operably associated with a heterologous promoter, wherein said polynucleotide encodes a protein that has toxin activity against an insect pest, wherein said protein comprises the amino acid sequence selected from SEQ ID NO: 12 and SEQ ID NO: 47 . A transgenic plant cell, comprising a polynucleotide according to claim 1. A transgenic plant cell expressing a polynucleotide according to claim 1. 4. A recombinant protein that has toxin activity against an insect pest, wherein said protein comprises the amino acid sequence selected from SEQ ID NO: 12 or SEQ ID NO: 47. The method of controlling an insect pest, wherein said method comprises feeding on a protein according to claim 4, of said pest. The method of claim 5, wherein said protein is produced by a polynucleotide and is present in a transgenic plant, which is accessible to said pest. 7. Method of controlling an insect pest, wherein said method comprises feeding said pest with a protein of Photorhabdus, wherein said protein has toxin activity, orally, and wherein said protein is produced by and is present in a transgenic plant, which is accessible to said pest.