JP3482214B2 - Insecticidal protein toxin from Hotorhabdasu - Google Patents

Description

FIELD OF THE INVENTION The present invention relates to toxins isolated from bacteria and their use as insecticides.

BACKGROUND OF THE INVENTION Many insects are widespread as pests for homeowners, picnicers, gardeners, farmers and others who often result in the destruction or reduction of investment in their crops as a result of insect damage to the crop. Be regarded. Significant insect damage to growers means a loss of all benefits and a dramatic reduction in crop yield, especially in areas of short growing season. Lack of supply of certain agricultural products always results in high costs for food processors, followed by edible plants and end consumers of products derived from these plants.

Prevention of insect damage to crops and flowers and elimination of pests that pests typically rely on potent organic pesticides and insecticides with a wide range of toxicity. These synthetic products have been attacked by the public by being too harsh to the environment and even to those exposed to such agents. Similarly in non-agricultural situations,
Homeowners will be content with keeping insects away from their homes and not having to kill them for an outdoor meal.

The widespread use of chemical pesticides has caused environmental and health concerns to farmers, companies that manufacture the pesticides, government agencies, interested public bodies and the general public. Less invasive pest control methods were driven by both concern over social environment and advances in biological tools to elucidate insect control mechanisms. Biological control agents offer a promising option for chemical pesticides.

At each stage of evolution and development, organisms acquire various means to enhance their own survival and survival. The use of biological molecules as a means of defense and attack is known throughout the animal and plant kingdoms. Furthermore, relatively new means of genetic engineering allow modification of biological pesticides, resulting in specific solutions to specific problems.

One such drug, Bacillus thuringiensis (B
t) is an effective insecticide and is widely used industrially. In fact, Bt bacterial insecticides are proteins with limited toxicity and can be used as human food crops on the day of harvest. For non-targeted organisms, this Bt toxin is a digestible, non-toxic protein.

Another class of already known biological insect control agents is the class of nematodes known as vectors of insecticidal bacterial symbionts. Nematodes containing insecticidal bacteria invade insect larvae. The bacteria then kill the larvae and the nematodes grow on the larval carcasses. The nematode child then eats the corpse from the body. The bacterium-containing nematode pup thus produced can subsequently invade another new larva.

So far, insecticidal nematodes of the Steinernema and Heterorhabditis genera have been used as insect control agents. Clearly, each genus of nematode hosts a specific bacterium. Heterorhabditis
In the genus Nematode, the symbiotic bacterium is Photorhabdus luminescens.

Although these nematodes are effective insect control agents, they are currently expensive and difficult to manufacture, maintain, and disperse nematodes for insect control.

In this technical field, there is a hot rub das luminescence (Ph
It is known that an insecticidal toxin can be isolated from otorhabdus luminescens). This toxin is only active when injected into the larvae of Lepidoptera and Coleoptera insects. This precludes the effective development of the insecticidal properties of nematodes or their commensal bacteria. What is important is that the insecticidal toxins that retain their biological properties after spraying are more practical,
It would be a non-labor intensive drug delivery method. It is highly desirable to find toxins produced by the genus Photorhabdus that are orally active. Separation and use of these toxins is desirable because they are effective. These toxins have never been isolated or characterized until Applicants' discovery.

SUMMARY OF THE INVENTION Natural toxins are protein complexes produced and secreted by growing bacterial cells of the genus Photorhabdus, of particular interest are Ph
It is a protein produced by otorhabdus luminescens species. A protein complex with a molecular weight size of approximately 1000 kDa can be separated into a large number of component proteins by SDS-PAGE gel analysis. This toxin contains no hemolysin, lipase, C-type phospholipase or nuclease activity. This toxin exhibits significant toxicity when exposed to a large number of insects.

The present invention provides for the expression of toxins in a heterologous system with an easy-to-administer insecticidal protein.

The present invention also provides a more effective method of delivering insecticidal toxins with activity that is functional against many insect orders.

Objects, advantages and features of the invention will be apparent from the following specification.

Brief Description of the Drawings Figure 1 shows the pairing of cloned DNA isolates used as part of the sequence gene of the toxins of the invention.

FIG. 2 is a map of the three plasmids used in the sequencing step.

FIG. 3 is a map showing the relationship between several partial DNA fragments.

Figure 4 shows the homology analysis between the protein sequences of TcbA _ii and TCAB _ii protein.

FIG. 5 is a dendrogram of the Photorhabdus strain. Photorhabd
The relationship between us strains was defined by rep-PCR. The upper axis of FIG. 5 shows% similarity between strains based on rep-PCR scores (ie 0.0 (no similarity) to 1.0 (100% similarity)). The numbers and letters on the right axis indicate the various strains examined. That is, 14 = W-14, Hm = Hm, H9 = H9, 7 = WX-7, 1
= WX-1, 2 = WX-2, 88 = HP88, NC-1 = NC-1,4
= WX-4, 9 = WX-9, 8 = WX-8, 10 = WX-10, WIR
= WIR, 3 = WX-3, 11 = WX-11, 5 = WX-5, 6 = WX
-6, 12 = WX-12, x14 = WX-14, 15 = WX-15, Hb = H
b, B2 = B2, 48 to 52 = ATCC43948 to ATCC43952. The vertical lines that separate the horizontal lines indicate the degree of relationship between the stocks or stock groups on the horizontal line (eg, stock W-14 is stock H9 and stock H9
Hm is approximately 60% similar) (this is read from the extrapolated intersection of the upper axis and the vertical line).

  FIG. 6 is a genome map of the W-14 strain.

DETAILED DESCRIPTION OF THE INVENTION The present invention provides Photorhabd with oral toxicity to insects.
The purpose is to discover extremely rare insecticidal toxins from the genus us. A unique property of Photorhabdus is its bioluminescence.
Photorhabdus can be isolated from various sources.
One such source is nematodes, more specifically Heterorh
It is a nematode of the genus abditis. Another source is from clinical samples obtained from human wounds (Farmer et al., J. Cli.
n. Microbiol. 27: 1594-1600 (1998).
These dead parasite strains were found at the American Culture Collection (Rockville, MD) in ATCC # 43948, 43949, 43950, 4
Deposited as 3952, which is incorporated herein by reference. Others also produce insecticidal toxins Phot
It may contain orhabdus bacteria. Such sources in the environment could be of terrestrial or aquatic origin.

The genus Photorhabdus is taxonomically defined as a member of the family Enterobacteriaceae, but has certain atypical characteristics with respect to this family. For example, strains of this genus are nitrate reduction negative, yellow and red pigment producing, and bioluminescent. This latter feature is unknown in the Enterobacteriaceae family. Photorhabd
us was recently described as a separate genus from Xenorhabdus (Boemare et al., Int. J. Syst. Bacteriol. 43: 249-25.
5 (1993)). This difference may be due to DNA-DNA hybridization experiments, phenotypic differences (eg, presence or absence of catalase and bioluminescence (Yes (Photorhabdus) No (Xenorhabdus)
s)), the species of nematode host (Xenorhabdus; (Steinernemati
dae), Photorhabdus; (Heterorhabditidae)). Comparative analysis of cellular fatty acids (Janse et al., Lett. App
L. Microbiol. 10: 131-135 (1990); Suzuki et al., J. Gen. Ap.
pl.Microbiol.36: 393-401 (1990)) is Photorhabdus
Favors isolation from Xenorhabdus.

To confirm that the strain collections disclosed herein contain Photorhabdus, these strains were identified based on Photorhabdus and based on recognized characteristics to distinguish them from other Enterobacteriaceae and Xenorhabdus species. (Farmer, Bergy's Manual of Systemic Bacteriology, 1
Volume, 510-511; Akhurst & Boemare, J. Gen. Microbiol.13.
4: 1835-1845 (1988); Boemare et al., Int. J. Syst. Bacteri.
43: 249-255 (1993), which are incorporated herein by reference). The characteristics examined were: Gram-staining negative bacilli, microbial size, colony pigmentation, inclusion bodies, the presence of catalase, nitrate reduction, biological luminescence, pigment uptake, gelatin hydrolysis, growth in selective media. , Growth temperature, survival and motility under anaerobic conditions. Fatty acid analysis showed that all strains herein were single Photorha
It was used to confirm that it belongs to the genus bdus.

At present, Photorhabdus bacterium is a single limited species, Photorhabdus luminescence (ATCC standard strain # 2999).
9, Poinar et al., Nematologica 23: 97-102 (1977)). Various related strains have been described in the literature (Akhurst et al., JG
En. Microbiol. 134: 1835-1845 (1988); Boemare et al., In
tJSys.Bacteriol.43: 249-255 (1993); Putz et al., App
L. Environ. Microbiol. 56: 181-186 (1990)). A number of strains were characterized herein. Such strains are listed in Table 18 of the examples. At present, only one species (luminescence) is defined in the genus Photorhabdus, so the characteristics of the luminescence species were used as characteristics of the strains in this specification. As can be seen in Figure 5, these strains are extremely diverse. Other Phs that have some of the characteristics of the luminescence species and yet have some different attributes that are not currently recognized as the characteristics of Photorhabdus luminescence.
The future emergence of otorhabdus species is not unexpected. However, the scope of the present invention includes any Photorhabdus species or strain that, despite their characteristics and properties, produces proteins with functional activity as insect control agents.

Furthermore, as embodied herein, Photorhabd
Bacteria of the genus us produce proteins with functional activity as defined herein. Of particular interest are
A protein produced by Photorhabdus luminescence species. The invention herein should in no way be limited to the strains disclosed herein. These strains are Photorhabd
It demonstrates for the first time that the proteins produced by various isolates of us are toxic when exposed to insects.
Therefore, included in the present invention are Photorhabd having the functional activity disclosed herein, as well as strains having all the characteristics disclosed herein and all mutants thereof.
Any strain or species of us.

There are several terms that have particular meanings and are used herein, as follows:

As used herein, "functional activity" means that the protein toxin is orally active, has a toxic effect, or interferes with or arrests feeding (insect death Whether it causes or not), it means to act as an insect control agent. Insect expression of transgenic plants, formulated protein composition, sprayable protein composition,
When contacted with an effective amount of toxin brought about by a poison bait matrix or other drug delivery system, the result is typically the death of the insect, or the insect is given the bait from which the toxin is available to the insect. I can't eat.

When using the term "Photorhabdus toxin", the term refers to any protein produced by a Photorhabdus microbial strain that has functional activity against insects, in which case the Photorhabdus toxin is a sprayable composition. Formulated, expressed by transgenic plants, formulated as a bait matrix, distributed via baculovirus, or using any other available host or drug delivery system. Distributed.

The protein toxins discussed herein are typically referred to as "insecticides." As used herein, "insecticide" means that the protein has "functional activity" and is used as an insect control agent, as further defined herein.

The term "oligonucleotide" refers to RNA or DNA
Means a macromolecule consisting of a short chain of any of The length of such chains is at least one nucleotide, but typically ranges from about 10 to 12 nucleotides.
Determination of oligonucleotide length is well known in the art and should not be limiting here. Therefore,
Oligonucleotides may be less than 10 and may be greater than 12.

As used herein, the term "toxic" or "toxic" means that the toxin produced by Photorhabdus has "functional activity" as defined herein.

As used herein, "genetic material" is meant to include all genes, nucleic acids, DNA and RNA.

Using selected strains of fermentation broth reported in Table 18, Photor
The breadth of insecticidal toxin production by Habdus, the insecticidal spectrum of these toxins, was determined, and the starting material for purification of the toxin complex is provided. The strains characterized herein were shown to be orally toxic to various insect orders. For such insect orders, Coleoptera, Homoptera, L
epidoptera, Diptera, Acarina, Hymenoptera and Dic
tyoptera, but is not limited to.

For other bacterial toxins, the mutation rate within this bacterial population results in many related toxins that differ slightly from existing sequences. Toxins of interest herein are those that upon exposure produce protein complexes that are toxic to a variety of insects as disclosed herein. Preferably the toxin is
Coleoptera, Homoptera, Lepidoptera, Diptera, Acari
It has activity against na, Hymenoptera and Dictyoptera. The present invention provides Photorhabdus with protein toxins produced by the strains herein and any derivatives thereof.
It is intended to include all protein toxins produced by the same protein toxin. Although these cognate proteins may differ in sequence, they do not differ in function from these toxins described herein. Allogeneic toxin
It is intended to include protein complexes between 300 kDa and 2000 kDa, and also to include at least two subunits. In this case, one subunit is a peptide and may be the same as or different from the other subunits. Various protein subunits have been identified and disclosed in the examples herein. Typically, the protein subunit is approximately 18
kDa to about 230 kDa, about 160 kDa to about 230 kDa, about 100 kDa to 160 kDa, about 80 kDa to about 100 kDa, and about 50 kDa to about
It is 80kDa.

As discussed above, several Photorhabdus strains were isolated from nematodes. Some nematodes, elongated tubular parasites of the phylum Nematoda, have evolved their ability to utilize insect larvae as their preferred growth environment. Insect larvae provide a feeding source for growing nematodes and an environment for propagation.
One of the dramatic effects following larval invasion by certain nematodes is larval death. Larval death occurs in some nematodes due to the presence of bacteria that produce insecticidal toxins. This toxin restrains larval growth and suppresses feeding capacity.

Interestingly, insect parasitic nematodes appear to be hosts for certain bacterial species that show unique adaptations for symbiotic growth with the nematodes. For a while after starting this study, the bacterial Xeno
The rhabdus designation has been reclassified to Xenorhabdus and Photorhabdus. Photorhabdus bacteria have the property that they are symbiotic bacteria of Heterorhabditus nematodes, while Xenorhab
dus is a symbiotic bacterium of the Steinernema species. Although this change in nomenclature is also reflected herein, this change in nomenclature does not affect the scope of the invention disclosed herein at all.

The peptides and genes disclosed herein are J. Bact
eriology “Instructions to Author
s) ”(pages i-xii, January 1996), which has been named according to a recently published guideline. The following peptides and genes are Photorhabdus strain W. Separated from -14.

The sequences listed above are grouped by genomic region. The tcbA gene was expressed in E. coli as two protein fragments TcbA and TcbA _iii as described in the examples. It would be beneficial to proteolytically cleave off some sequences to obtain toxins with higher activity for commercial gene transfer.

The toxins disclosed herein are highly specific in that they have functional activity, which is key to the development of insect control strategies. In the development of insect control strategies, it is possible to avoid the gastrointestinal tract of an organism and inject the protein directly into the organism to delay or interfere with the proteolytic process. In such cases, the protein administered to the organism will retain its function until denaturation, non-specific degradation or elimination by the immune system of higher organisms. Injection of insecticidal toxins into insects can only be applied in the laboratory, even for large insects that can be easily injected. The observation that the insecticidal protein toxins disclosed herein exhibit their toxic activity after oral digestion or contact with the toxin suggests that the insect control exclusively relies on the possibility of incorporating the protein toxin into insect baits. Allows the development of plans. The result of such a plan would be insect bait.

The Photorhabdus toxin may be administered to the insect in purified form. The toxin may also be drug distributed in an amount of about 1 to about 100 mg / liter broth. This will vary according to formulation conditions, inoculum conditions, toxin isolation technology, etc. The toxin may be administered as an exudate or cellular protein originally expressed in a heterologous prokaryotic or eukaryotic host. Bacteria are typically hosts in which the protein of interest is expressed. Eukaryotic hosts include, but are not limited to, plants, insects and yeast. Alternatively, the toxin may be produced in insects by bacteria, or by transgenic plants in the field, or by baculovirus vectors. Typically the toxin will be introduced into the insect by mixing the insect bait with one or more toxins.

Complete lethality against feeding insects is useful, but not required to achieve significant toxicity. If the insect avoids the toxin or ceases to feed, this avoidance behavior may be useful in some applications, even if the effect of the toxin is sublethal. For example, if an insect-tolerant transgenic plant is desired, reluctant contact of the insect with the plant is as useful as lethal toxicity to the insect. Because the ultimate purpose is to protect the plant, not to kill the insect.

There are many other ways to mix toxins with insect baits. As an example, the protein solution can be nebulized as described herein to incorporate the toxin protein into the larval feeding source. Alternatively, the purified protein can be genetically engineered into innocuous bacteria, which can then be grown in culture and used as a food source or settled in the soil of the area in which the insect is being eradicated. Also,
The protein can also be directly introduced into an insect feeding source by genetic engineering. For example, the major source of feeding for many insect larvae is plant constituents.

By incorporating a genetic component that encodes the insecticidal properties of Photorhabdus toxin into the genome of a plant that feeds on a particular pest, adults or larvae will die after eating the feeding plant. Many plants belonging to monocots and dicots were transformed. Transgenic crops are commercially important along with fruits and vegetables. Such crops include, but are not limited to, corn, rice, soybean, canola, sunflower, alfalfa, sorghum, wheat, cotton, peanuts, tomatoes, potatoes and the like. There are several techniques for introducing a foreign genetic component into plant cells and for stably maintaining and expressing the transgene. Such techniques include facilitating direct cell transfer of genetic material coated on microparticles (US Pat. Nos. 4,945,050 (Cornell) and 514113).
No. 1 (DowElanco)). Plants can be transformed using Agrobacterium-related technology (US Pat. No. 5,177,010).
rsity of Tpledo), 5104310 (Texas A & M), European Patent Application Publication No. 0131624B1, European Patent Application Publication Nos. 120516, 159418B1 and 176112 (Schi).
lperoot), US Patent Nos. 5149645, 5469976, and 54647.
63 and 4940838 and 4693976 (Schilper
oot), European Patent Publication No. 116718, 290799, 3
20500 (all MaxPlanck), European Patent Application Publication No. 60
4662 and 627752 (Jaapan Tobacco), European Patent Application Publication Nos. 0267159 and 0292435, and US patents.
See 5231019 (all Ciba Geigy), US Pat. Nos. 5463174 and 4762785 (both Caigene), US Pat. Nos. 5004863 and 5159135 (both Agracetus)). Other transformation techniques include the technique of Whiskers (see US Pat. Nos. 5,302,523 and 5,464,765 (both to Zeneca)). Electroporation
technology) was also used for plant transformation (WO87
/ 06614 (Boyce Thompson Institute), 5472869 and 5384253 (both Dekalb), WO9209695 and
See WO9321335 (both PGS)). Patents and publications relating to these transformations are included herein by reference. Not only many techniques for transforming plants, but also the type of tissue in contact with the foreign gene can be altered. Such tissues include fetal tissue,
Callus tissue types I and II, hypocotyl, meristem, etc. are included, but are not limited thereto. Almost all plant tissues can be transformed during differentiation using appropriate techniques in the art.

Yet another variable is the selection of selectable markers. What is selected as a specific marker is at the discretion of one of ordinary skill in the art, however, any of the following selection markers can be used, and further other selection markers not listed herein can be used. Either gene can be used. Such selectable markers include transposons
The aminoglycoside phosphotransferase gene of Tn5 (Aph II), which encodes resistance to antibiotics (kanamycin, neomycin and G418), along with glyphosate; hygromycin; methotrexate; phosphinothricin (bialophos); Triazolopyrimidine herbicides (eg, chlorosulfuron); including, but not limited to, genes encoding resistance or resistance to bromoxynil, darapone, and the like.

It is desirable to use a reporter gene in addition to the selection marker. In some cases, a reporter gene can be used without the selection marker. Reporter genes are genes that are not typically present or expressed in the recipient organism or tissue. Reporter genes typically encode proteins that provide some phenotypic change or enzymatic property. Examples of such genes have been described in the literature (K. Weising et al., Ann.R.
ev.Genetics 22: 421 (1988), which is incorporated herein by reference). A preferred reporter gene is the glucuronidase (GUS) gene.

Regardless of the transformation technique, the gene is preferably incorporated into a gene transfer vector adapted to express Photorhabdus toxin in plant cells by including a plant promoter in the vector. In addition to plant promoters, promoters of various origins are effectively used in plant cells to express foreign genes. For example, promoters derived from bacteria (eg, octopine synthetase promoter, nopaline synthetase promoter, mannopine synthetase promoter), virus-derived promoters (eg cauliflower mosaic virus (35S and 19S)) and the like can be used. Plant promoters include ribulose-1,6-bisphosphate (RUBP) carboxylase small subunit (ssu),
Examples include, but are not limited to, the beta-conglycinin promoter, phaseolin promoter, ADH promoter, heat shock promoter and tissue-specific promoter. The promoter can also include certain enhancer sequence components that can improve the efficiency of transcription. Adh for a typical enhancer
-Intron 1 and Adh-Intron 6 but are not limited to these. A constitutive promoter can also be used. A constitutive promoter induces always continuous gene expression in all cell types (eg actin, ubiquitin, CaMV35S). Tissue-specific promoters also direct gene expression in particular cells or tissue types, eg leaves or seeds (eg zein, oleosin, napine, ACP), these promoters can also be used. Promoters are active in plant tissues and organs as well as at certain stages of plant development. Examples of such promoters are pollen-specific, fetal-specific, maize ear hair-specific, cotton fiber-specific, root-specific, seed endosperm (endosperm).
m) Specific promoters and the like, but not limited thereto.

In some circumstances it may be desirable to use an inducible promoter. Inducible promoters drive the expression of genes in response to specific signals (eg physiological signals (heat shock genes), light (RUBP carboxylase), hormones (Em), metabolites and stress). Other desirable transcription and translation components that function in plants can also be used. Many plant-specific gene transfer vectors are known in the art.

Furthermore, in order to obtain high expression of bacterial genes in plants, it is known to be preferable to reengineer the bacterial genes so that they are more effectively expressed in the cytoplasm of the plant. Maize is one of the plants in which it is preferable to re-engineer bacterial genes to increase toxin expression levels in plants prior to transformation. One of the reasons for re-engineering is that the natural bacterial genes have a very low G + C content (resulting in a high A + T content). The result would be the creation of sequences that mimic or replicate plant gene regulatory sequences known to be extremely rich in A + T. A + T in the DNA of the gene introduced into the plant
The presence of some sequences that are rich in HLA, such as the TATA box region normally found in gene promoters, can result in aberrant transcription of the gene. On the other hand, the presence of other regulatory sequences present in transcribed mRNAs, such as the polyadenylation signal sequence (AAUAAA) or small nuclear RNAs required for splicing of precursor mRNAs, may lead to RNA instability. Thus, one of the goals of reengineered bacterial gene design (more preferably referred to as plant-optimized genes) is that of DNA sequences with higher G + C content, and preferably that of plant genes encoding metabolic enzymes. It is to make something close. Another goal of plant-optimized gene design is to produce DNA sequences that not only have a high G + C content, but also modify (alter) their sequence changes to prevent translation.

An example of a plant with a high G + C content is corn. The table below shows how the G + C content is high in corn. The G + C content of other plants is also considered high, as is the case for corn.

For the data in Table 1, the coding region of the gene is GenB
Extracted from the registration of ank (Release 71), the base composition is the MacVector® program (MacVector ^™ , IBI,
Calculated using New Haven, Connecticut). The intron sequence was ignored in the calculation. Group I and II storage protein gene sequences were distinguished by marked differences in their base composition.

Redundancy of the genetic code (ie some amino acids have 1
Due to the flexibility allowed by (specified by more than one codon), the evolution of different organisms or different types of genomes has led to different uses of redundant codons. This "codon bias" appears in the average base composition of the protein coding region. For example, organisms with relatively low G + C content utilize codons with A or T at the third position of the surplus codon, while those with high G + C content have codons with G or C at the third position. To use. The presence of a "minor" codon in the mRNA of a gene is thought to reduce the absolute translation rate of that mRNA, especially if the relative clearance of the working tRNA corresponding to that minor codon is low. Expanding this, the reduction in translation rate by individual minor codons is at least cumulative for many minor codons. Therefore, mRNAs with a relatively high content of minor codons will have a correspondingly low translation rate. This translation rate is embodied by low level synthesis of the encoded protein of interest.

Determine plant codon bias for bacterial genetic reengineering. Codon bias is the statistical codon distribution that plants use to encode that protein. After obtaining this bias, the% frequency of codons of the target gene is obtained. The major codon preferred by plants should be sought along with the second and third preferred codons. The amino acid sequence of the protein of interest is reversely translated so that the resulting nucleic acid sequence encodes the same protein as the natural bacterial gene, but the resulting nucleic acid sequence corresponds to the first preferred codon of the desired plant. did. The new sequence is analyzed for restriction enzyme sites created by the changes.
This specified site is altered by further substituting the codon with a second or third preferred codon of choice. Other sites within the sequence that affect transcription or translation of the gene of interest are exon: intron 5'or 3'junctions, poly A addition signals, or RNA polymerase termination signals. Further analysis of this sequence, TA or
Modify to reduce the frequency of GC pairs. In addition to these pairs, G or C sequence blocks with about 4 or more identical residues also influence transcription of the sequence. Thus, these blocks are also modified by replacing the first or second selection codon, etc. with the next preferred selection codon. Preferably, the plant optimization gene has about
It contains 63% of the first selected codon, about 22% to about 37% of the second selected codon, and 15% to 0% of the third selected codon, where the total percentage is 100%. . Most preferably, the plant optimization gene comprises about 63% of the first selection codon, at least about 22% of the selection codon, about 7.5% of the third selection codon, and further about 7.5% of the fourth selection codon. Including codons, where the total percentage is 100%. The methods described above allow the person skilled in the art to modify a gene that is foreign to a particular plant, so that it is optimally expressed in the plant. This method is further detailed in Conditional US Patent Application 60/005405, filed October 13, 1995, which is hereby incorporated by reference, which is currently under examination.

Therefore, to design a plant-optimized gene, the amino acid sequence of the toxin was DNA-translated using the non-surplus genetic code established from the codon bias table edited for the gene DNA sequence for the particular plant to be transformed. To translate back to. The resulting DNA sequence, which is completely homogenous in codon usage, is further modified to have higher codon diversity, as well as planned placement of restriction enzyme sites, desired bases. Eliminate sequences that may interfere with composition and transcription of genes or translation of produced mRNAs.

There is a theory that if a bacterial gene is expressed in a plasmid, it will be more easily expressed in plants. Therefore, it may be possible to express bacterial genes in plants without optimizing the genes for plant expression and to obtain high expression of the protein (see, for example, US Pat. Are incorporated herein by reference).

One of the challenges for developing transgenic plants as products
One is managing tolerance. This is Bacillus thuringiensis
This is especially true for toxins. Commercially Bacillus thuringie
Many companies are developing nsis, and there has been much concern about resistant Bt toxins. Previous strategies for controlling resistance to insects have included the toxins produced by Photorhabdus, such as herbivorous insect protein toxins (Ci) such as Bt.
ba Geigy) or other toxins. This combination could be formulated so that it could be nebulized or it could be combined as a molecule. The plant
The Photorhabdus gene and other insect toxin genes that produce insect toxin (eg Bt) could be transformed.

EP-A-0400246A1 discloses the transformation of one plant with two Bt's (the two genes may be any). Another method for producing transgenic plants containing one or more insect resistance genes is to produce one plant, each plant containing one insect resistance gene. These plants are backcrossed using conventional crossing techniques to produce plants containing more than one insect resistance gene.

In addition to producing transformed plants containing plant-optimized genes, there are other drug delivery systems that may be desirable for reengineering of bacterial genes. Similarly, a genetically engineered, easily separable protein toxin, which fuses an insect-inducing molecule with the insecticidal activity of the toxin as a feeding source, is prepared using standard and well-known techniques. Can be expressed in bacteria or eukaryotic cells. After laboratory purification, such toxin agents, including "built-in" bait, can be packaged in standard insect supplement housings.

Another drug delivery system is the incorporation of toxin genetic material into baculovirus vectors. Baculovirus infects specific insect hosts, including insects, which are preferred targets for Photorhabdus toxin. Infectious baculovirus containing an expression construct of Photorhabdus toxin is introduced into the insect-damaged area, thereby poisoning the infected insect.

Transmission of insecticidal properties requires a nucleic acid sequence encoding the amino acid sequence of Photorhabdus toxin incorporated into a protein expression vector. The vector must be appropriate to the host in which it lives. Method 1 for obtaining a nucleic acid sequence encoding a protein having insecticidal properties
One is to use information deduced from the amino acid sequence of the toxin, most of which is detailed below, to isolate the natural genetic material that produces the toxin from Photorhabdus.
Also disclosed are methods of purifying proteins that provide toxin activity, as described below.

Using the N-terminal amino acid information as described below,
Oligonucleotides complementary to all (or a portion) of the DNA bases encoding the first amino acid of the toxin can be constructed. These oligonucleotides can be radiolabeled and used as molecular probes to isolate the genetic material from a genomic gene library constructed from the genetic material isolated from Photorhabdus strains. This gene library can be cloned in a plasmid, cosmid, phage or phagemid vector. This library could be transformed into E. coli and screened for toxin production by transformed cells using antibodies raised against the toxin or direct assays for insect toxins.

This approach requires the production of a set of oligonucleotides. Because of the degenerate genetic code, one amino acid can be encoded by a combination of several 3-nucleotides. For example, the amino acid arginine can be encoded by the nucleic acid triplets CGA, CGC, CGG, CGT, AGA and GG. Since it is not possible to predict which triplet will be used at that position in the toxin gene, it is necessary to prepare the oligonucleotide with each of the potential triplets. To recover all of the protein subunits required to complete the oral toxin, one or more DNA molecules corresponding to one protein subunit are needed to construct a sufficient number of oligonucleotide probes Will.

The genetic material required for toxin production can be easily separated from the amino acid sequence of the purified protein, and an expression vector using any of several techniques well known to those skilled in the field of molecular biology. Can be cloned in whole or in part. Typical expression vectors are DNA plasmids, including, but not limited to, cosmids, phagemids and phages
Other communication means can also be used. Properties required or desirable for plasmid replication (eg, origin of replication and antibiotic resistance or other forms of selection markers (eg, Steptomyces hygroscopicus or viridochrom).
In addition to the ogenes bar gene)), protein expression vectors usually require an expression cassette. It contains the cis-acting sequences required for transcription and translation of the gene of interest. The cis-acting sequences required for prokaryotic expression are different from those required for eukaryotic cells and plants.

Eukaryotic expression cassettes require a transcription promoter upstream (5 ') to the gene of interest, a transcription termination region (eg, poly A addition site), and a ribosome binding site upstream of the first codon of the gene of interest. . A useful transcription promoter that can be included in the vector in the case of bacterial cells is the T7 RNA polymerase binding promoter. As mentioned earlier herein, promoters are known to effectively promote transcription of mRNA. Also upstream from the gene of interest, the vector may include a nucleotide sequence encoding a signal sequence, which induces a protein covalently linked to a specific portion of the host cell (eg, cell surface). I know that.

Insect viruses or baculoviruses are known to infect or adversely affect certain insects.
This effect of the virus on insects is slow and the virus does not stop insect feeding. Therefore, the virus does not appear to be useful as a pest control agent. Photorhabdus
Coupling the toxin gene to the baculovirus vector provides an effective method of delivering the toxin while increasing lethality of the virus. Moreover, because different baculoviruses have specificities for different insects, it is possible to target specific pests selectively with specific toxins. A particularly useful vector for the toxin gene is the nuclear polyhedrosis virus. Transfer vectors using this virus have been previously described and have become the vector of choice for transferring foreign genes to insects. The virus-toxin gene recombinant can be constructed as an orally transmissible form. Baculoviruses commonly infect insects via the intestinal mucus of the midgut. A toxin gene inserted behind the strong viral coat protein promoter will be expressed and rapidly kill the infected insect.

In addition to transgenic plant-based drug delivery systems for insect viruses or baculoviruses or protein toxins of the invention, this protein is described, for example, in US Pat. No. 4,695,455.
No. 4694562, 4861595, but not limited thereto (these references are incorporated herein by reference).
It can be encapsulated using the Bacillus thuringiensis encapsulation technique. Another drug delivery system for the protein toxins of the present invention is the formulation of the protein into a bait matrix. This formulation can then be used at aboveground or underground insect bait stations. Examples of such techniques include, but are not limited to, PCT patent application WO93 / 23989, which is hereby incorporated by reference.

As mentioned above, when the protein is expressed in a host other than the original host, it may be necessary to change the sequence encoding the protein. Photor is the preferred codon used in other hosts.
This may be different from the case of habdus. In such cases, translation in the new host would be very inefficient unless compensatory changes were made to the coding sequence. Furthermore, changes to the amino acid sequence may be desirable to avoid inhibitory cross-reactivity with proteins in the new host, or to enhance the insecticidal properties of the protein in the new host. The genetically modified toxin gene may encode, for example, a toxin that exhibits enhanced or reduced toxicity, altered insect resistance development, altered stability or altered target species specificity.

In addition to the Photorhabdus gene that encodes the toxin, the present invention encodes an amino acid biopolymer homologous to the toxin protein, and further after oral digestion, Ph.
It is intended to include related nucleic acid sequences that retain the toxic effects of the otorhabdus protein.

For example, the toxins used in the present invention appear to first suppress larval feeding before resulting in death. By manipulating the nucleic acid sequence of Photorhabdus toxin or its regulatory sequence, the genetic engineer who placed the toxin gene in the plant, for example, in order to maintain antifeedant activity while eliminating absolute toxicity to larvae It would be possible to modulate the capacity of the protein or its mode of action. This change will allow the transformed plants to survive the harvest without the unwanted and dramatic impact on the environmental system of eradicating all target insects. All such alterations in the gene encoding the toxin, or all such alterations in the protein encoded by the gene, are included within the scope of the present invention.

Other nucleic acid modifications included include the addition of aiming sequences to direct the toxin to specific parts of insect larvae to improve the efficacy of the toxin.

ATCC55397, 43948, 43949, 43950, 43951, 43952 strains are American fungus culture collection (12301, Parklawn Drive, Rockvil
le, MD 20852 USA). W-14 natural toxin (ATC
C55397) amino acid and nucleic acid sequence data is presented below. Isolation of the toxin genomic DNA from the bacterial host is exemplified herein.

Standard techniques and molecular biology techniques are used and are further disclosed herein. For more information, see Molecular Cloning: Laboratory Manual (Cold Spring Harbor Laboratory Publishing (J. Sambrook, EFFritsch & T. Maniat
is (1989)), which is incorporated herein by reference.

The following abbreviations are used throughout the examples: Tris = tris (hydroxymethyl) aminomethane; SDS = sodium dodecyl sulfate; EDTA = ethylenediaminetetraacetic acid; IPTG
= Isopropylthio-β-galactoside; X-gal = 5-
Bromo-4-chloro-3-indoyl-β-D-galactoside; CTAB = cetyltrimethylammonium bromide; kbp
= Kilobase pairs; dATP, dCTP, dGTP, dTTP, I = 2'-deoxynucleoside 5'-triphosphates of adenine, cytosine, guanine, thymine and inosine respectively; ATP = adenosine 5'triphosphate.

Example 1 Purification of P. luminescens-derived toxin and toxic expression of the purified toxin after oral drug delivery The insecticidal protein toxin of the present invention is P. luminescens W-14.
Purified from the strain (ATCC Access # 55397). P.lumines
Stock cultures of cens were kept in 1.5% agar in Petri dishes containing 2% proteose peptone # 3 (ie PP3, Difco Laboratories, Detroit, MI) at 25 ° C and maintained weekly for passage. Bacterial primary morphology colonies were transferred to 0.5% polyoxyethylene sorbitan monostearate (Tween 60, Sigma Chemical Compa
ny, St. Louis, MO) ingested 200 ml of supplemented PP3 broth. Broth cultures were grown for 72 hours at 30 ° C on a rotary shaker. Toxin proteins can be recovered from cultures grown in the absence or presence of tween. However, in the absence of tween, the morphology of growing bacteria and the protein profile produced by them are affected. In the absence of tween, various shifts occur, from about 200 kDa to about 185 kDa, as far as the molecular weight of at least one toxin subunit identified.
Shift to.

The 72-hour culture was centrifuged at 10,000 × g for 30 minutes to remove cells and debris. It poured by tilting the supernatant fraction containing insecticidal activity, and 50mMK ₂ HPO ₄ was added to K ₂ HPO ₄ appropriate volume of 1.0 M. The pH was adjusted to 8.6 by adding potassium hydroxide.
Subsequently, this supernatant fraction was subjected to DEAE- equilibration with 50 mM K ₂ HPO _4.
Mixed with Sephacel (Pharmacia LKB Biotechnology). This toxic activity was adsorbed on DEAE resin. The mixture was then loaded onto a 2.6 x 40 cm column and washed with 50 mM K ₂ HPO ₄ at room temperature at a flow rate of 30 ml / hr and the eluate was stabilized at 280 nm UV.
The absorption reference line was reached. The column was then washed with 150 mM KCl until the eluate again reached the stable 280 nm baseline. Finally the column was washed with 300 mM KCl and the fractions were collected.

Fractions containing toxin were collected and filter sterilized using a 0.2 micron pore membrane filter. Subsequently, the toxin was concentrated, and the ultrafiltration membrane (Centriprep 1
00, Amicon Division-WR Grace and Company) and equilibrated to 100 mM KPO ₄ (pH 6.9) at 4 ° C. 3 ml of the toxin concentrate was loaded on top of a 2.6 x 95 cm Sephacil S-400HR gel filtration column (Pharmacia LKB Biotechnology). The eluent was 100 mM KPO ₄ (pH 6.9), which was run at a flow rate of 17 ml / hour at 4 ° C. The eluate was monitored at 280 nm.

Fractions were collected and examined for toxin activity. The toxicity of the chromatographic fractions was investigated in a biological assay using Manduca sexta larvae. Fractions are directly fed to insect diet (wheat malt diet for gypsy moth, ICN Biochemicals Division-ICN
Biomedicals, Inc.) or 5 μl samples from the first forelimbs of 4th or 5th instar larvae were administered by intracavitary injection using a 30 gauge needle. The body weight of each larva in the treatment group was recorded at 24-hour intervals. It was estimated that the insects were toxic if they stopped feeding and consumed the treated insect food and died within a few days or died within 24 hours of injecting the fraction.

The toxic fractions were collected and concentrated using Centriprep-100,
Subsequently, it was analyzed by HPLC using a 7.5 mm × 60 cm TSK-GELG-4000SW gel permeation column while flowing an eluent of 100 mM potassium phosphate (pH 6.9) at 0.4 ml / min. This analysis revealed that the toxin protein was contained in a single sharp peak eluting from the column with a retention time of approximately 33.6 minutes. This retention time corresponds to an approximate molecular weight of 1000 kDa. The peak fraction was collected for further purification, while the protein-free fraction was discarded. The peaks eluted from the HPLC absorbed UV light at 218 and 280 nm but not at 405 nm. The absorption at 405 nm is measured by xenorhabdi (xenorhabdi
n) It was shown to be an attribute of an antibiotic compound.

Non-denaturing agarose gel (Metaphor of the collected peak fractions)
2 by electrophoresis on Agarose, FMC BioProducts)
It was shown that two protein complexes were present at this peak. This peak material (buffered with 50 mM Tris-HCl (pH 7.0)) was loaded on a 1.5% agarose loading gel (100 mM Tris-HCl).
HCl (pH 7.0)) and 1.9% agarose analytical gel (200 mM Tris-borate (pH 8.3)) in standard buffer conditions (anodic buffer 1 M Tris-HCl (pH 8.3)). ); Cathodic buffer 0.025M Tris, 0.192M glycine). The gel was subjected to a constant current of 13 mA at 15 ° C until the phenol red tracing dye reached the end of the gel. The two protein bands were visualized on an agarose gel using Coomassie Brilliant Blue staining.

The slower migrating band was called "protein band 1" and the faster migrating band was called "protein band 2". The two protein bands were present in approximately equal amounts. The Coomassie-stained agarose gel is 2 from the unstained part of the gel.
It was used as a guide to accurately cut out the protein band of the book. The excised strip containing the protein band was softened and a small amount of sterile water was added. As a control, a portion of the gel without protein was also cut out and processed in the same manner as the gel with protein. Proteins were recovered from the gel pieces by electrophoresis in 100 mM Tris-borate (pH 8.3) at 100 volts (constant voltage) for 2 hours. Separately, the protein is an equal volume of 50 mM Tris-HCl (pH 7.0).
Was added to the gel pieces, followed by a 16 hour incubation at 30 ° C. to passively elute from the gel pieces. This allowed the protein to diffuse into the buffer and subsequently collect the protein.

Results of insect toxin tests using HPLC purified toxin (33.6 min peak) and agarose gel purified toxin demonstrated toxicity of the extract. 24 injections of 1.5 μg of HPLC purified protein
Caused death within hours. Both protein bands 1 and 2 recovered from agarose by passive or electrophoretic elution were lethal by injection. The estimated protein concentration for these samples was less than 50 ng / larva. Comparison of weight gain and mortality between larva groups injected with protein band 1 or 2 showed that protein band 1 was more toxic for delivery by injection.

When the HPLC-purified toxin was applied to the larval diet at a concentration of 7.5 μg / larva, it resulted in the termination of larval weight gain.
With 24 larvae). The larvae began feeding, but after consuming a very small portion of the toxin-treated diet, the larvae began to show pathological signs induced by the toxin and stopped feeding. Insect feces were discolored and most larvae showed diarrhea. 7-
Significant mortality was obtained when 5 μg of each toxin was applied to the diet over 10 days.

Agarose separated protein band 1 remarkably suppressed larval body weight gain at a dose of 200 ng / larva. Larvae that received similar concentrations of protein band 2 were not suppressed, and body weight increased at the same rate as control larvae. Twelve larvae received the eluted protein and 45 larvae received the protein-containing agarose pieces. These two sets of data showed that protein band 1 was orally toxic to Manduca sexta. In this experiment, protein band 2
Did not appear to be toxic to Manduca sexta.

Further analysis of protein bands 1 and 2 by SDS-PAGE under denaturing conditions showed that each band contained several smaller protein subunits.
Proteins were visualized with Coomassie Brilliant Blue stain followed by silver stain to achieve maximum sensitivity.

The protein subunits of the two bands were very similar. Protein band 1 consists of eight protein subunits (25.1, 56.2, 60.8, 65.6, 166, 171, 184 and 208).
Kd)). Protein band 2 is 25.1, 60.8 and 6
It had the same profile except that the 5.6 kDa protein was not present. 56.2, 60.8, 65.6 and 18
The 4 kDa protein was present in the protein band 1 complex at approximately equal concentrations, and the total protein content of the complex was
It accounted for 80% or more.

The natural HPLC purified toxin was further characterized as follows. The toxin is heat-labile and after heating at 60 ° C for 15 minutes, M. sexta
Larvae when killed or lost their ability to suppress weight gain when injected or fed. Lipase, C
Assays were designed to detect type phospholipase, nuclease, or red blood cell hemolytic activity and performed with purified toxin. None of these activities were present. An antibiotic zone inhibition assay was also performed.
The purified toxin was unable to suppress the growth of Gram negative or positive bacteria, yeast or filamentous fungi. This suggests that this toxicity is not a xenorabudine antibiotic.

Native HPLC-purified toxins were tested for their ability to kill insects other than M. sexta. Table 2 shows that in this experiment HPLC purified P.lu was used.
The insects killed by the minescens toxin are listed.

Example 2 Insecticidal Utility The utility and toxicity of Photorhabdus luminescens was further characterized. Photorhabdus luminescens (strain W-14) culture broth was prepared according to the following. The production medium was 2% Bacto Proteose Peptone® # 3 (PP3, Diff Collaboration, Detroit, MI) in Milli-Q® deionized water as solvent. Seed culture flask is 175 ml of medium in a 500 ml tribaffie flask with a Delong neck.
And covered with Kaput, temperature 121 ° C (250
Autoclaved for 20 minutes. The production flask consisted of 50 ml in 2.8 liters in a 500 ml three-part divider flask with a Delong neck and was covered with a Shinetsu silicone foam closure. These have a temperature of 121
Sterilized by autoclaving at 250 ° F for 45 minutes. The seed culture was incubated at 28 ° C. and 150 rpm in an incubator with orbital shaking at an amplitude of 5.08 cm (2 inches). 16
After growing for 1 hour, 1% of this seeding medium was placed in the production flask and grown for 24 hours before harvesting. Toxin production is
It was obvious in the logarithmic growth phase. The broth of this microorganism
Transfer to a 1 liter centrifuge tube and pellet cell biomass (4 ° C, 2500 rpm for 30 minutes [RCF = ~ 160
0], HG-4L rotor PC3, Sorval centrifuge,
Dupont, Wilmington, Delaware). Additional broth was obtained by cooling the first broth at 4 ° C for 8-16 hours, centrifuging again for at least 2 hours (previous conditions) to remove the putative mucopolysaccharides that had precipitated on standing. Made it transparent. (An alternative method used a combination of both steps and the same conditions as above, but a 16 hour clarification centrifugation). The broth was then stored at 4 ° C before bioassay or filtration.

Photorhabdus culture broth purified from this broth and the protein toxin (s) showed activity (mortality and / or growth inhibition, reduced emergence) against many insects.
More specifically, Coleopte
ra) members, larvae and adults, Colorado potato beetle, and turf grubs.
Activity was observed. Other members of the order Coleoptera included click beetles, pollen beetle, leaf beetle, seed beetle, and weevil. Similarly, the activity against Aster leafhopper, which is a member of the order Homoptera, was also observed. Other members of the order Homoptera, in addition to many host-specific aphid species, include planthoppers, European white lice, and apple sucke.
r), scale insects, whiteflies, and armpits. The above-mentioned broth and the purified fraction were also active against white-spotted bollworm, nettle buckwheat, black corn beetle, tobacco budworm, European armyworm, Helicoverpa armigera, and Himehamaki. Other typical members of this eye were moths, Indian mealmoths, leaf beetles, bollworms, cottonweed bugs, rotifers, eastern bedbugs, sod webworms, and Shironagaya. The activity was also observed against larvae of fruit flies and mosquitoes, which are members of the order Diptera. Other members of the order Diptera are the chironomid pea, the carrot fly, the cabbage root fly, the chrysanthemum beetle, the onion fly, the crab fly, the house fly and various mosquito species. Also Fusari,
Activity was also observed against giant ants (Argentine ant), which are members of the eye including Oderous house ant and little black ant.

The aforementioned broth / fractionation was useful for reducing insect populations and was used in a method of inhibiting insect populations. The method can include applying the actives described above to the insect locus in an amount sufficient to inactivate the insect. The results are shown in Table 3.

The activity against leaf beetle larvae was tested by the following method. Photorhabdus culture broth (filter sterilized, cell-free) or purified HPLC fractions were diluted with control medium or 10 mM sodium phosphate buffer, pH 7.0, 30 μl aliquots of 0.25 ml artificial feed, respectively. the surface (~1.5cm ^2), was applied directly. This feed plate
Air-dried in a sterile flow hood, and these wells contained one neonatal Diabrotica undecym Punctata whirdy hatched from sterile eggs.
ecimpun howardi) (Southern Hambill, SCR), 2nd instar SCR grown on artificial diet, or 2nd india Diabrotica virginifera bildifera (Di) fed on corn seedlings grown in Metromix®.
abrotica virgifera virugifera) (Western Hammond, WCR). Second instar larvae were weighed before feed administration. The plates were sealed, placed in a moistened growth chamber and kept at 27 ° C for an appropriate period (SCR
4 days for neonates and adults, 2-5 days for WCR larvae, 7-14 days for second instar SCR). Mortality and measured body weights were scored as indicated.
In general, 16 worms were used per treatment in all trials. Control mortality is as follows: <5% for newborn larvae, 5% for adult beetles.

The activity against Colorado potato beetle was tested by the following method. The Photorhabdus culture broth or control medium was held in a 24-well tissue culture plates well was applied to the surface (~2.0cm ²⁾ Standard artificial diet 1.5 ml. Each well was treated with 50 μl and air dried.
Then, each second-instar Colorado potato beetle (Leptinotarsa decelimea)
Ta), CPB) larvae were placed on this diet and mortality scored after 4 days. For all tests, 10 larvae were used per treatment. The control mortality rate was 33%.

The activity of Japanese beetle against Japanese beetle grub and beetle was tested by the following method. Lawn grub (Popillia japonica), 2-3
(Age) were harvested from the colonized grass and cultivated in the laboratory in the soil / peat mixture, with slices of carrot as an additional diet. Turf beetles were pheromone-trapped by topical pheromones and were fed in the laboratory in plastic containers with maple leaves as diet. Undiluted Photorhabdus culture broth or control medium
After application to artificial feed of Hammondoki (30 μl / 1.54 cm ² , beetles) or slices of carrots (larvae), both stages were placed alone in the feed wells and observed for mortality and feeding. In both cases, a clear decrease in food intake (and fecal excretion) was observed.

The activity against mosquito larvae was tested by the following method. The assay was performed in 96 well microtiter plates. Each well contained 200 μl of an aqueous solution (Photorhabdus culture broth, control medium or water) and about 20 1-day-old larvae (Aedes aegypti). Six wells were performed per treatment. The results were examined 2 hours after the colony and did not change over the 3 day observation period. Control mortality was not examined.

The activity against fruit fly was examined by the following method. Purchased Drosophia meganoga
ster) medium with 50% dry medium and water, control medium or Ph
Prepared with 50% of either liquid of otorhabdus culture broth. This is done by placing 8.0 ml of dry medium in each of 3 breeding vials per treatment and adding 8.0 ml of appropriate liquid.
Achieved by adding. Then, in the latter half of 10 days (la
Te) old Drosophila melanogaster maggots were added to each vial. These vials were placed at room temperature in a laboratory bench with a fluorescent light on the ceiling. The number of pupae or adults was measured 3, 7 and 10 days after exposure. The mixture of Photorhabdus culture broth in the fruit fly pupa diet showed a slight (17%) but significant reduction in emergence on day 10 compared to water or control medium (3% reduction).

The activity against Aster leafhopper was tested by the following method. The uptake assay for the aster leafhopper (Macrosteles severini)
It was designed so that this active substance could be ingested without contacting the outside. A container of this active / "food" solution was prepared with two holes in the center of the bottom of a 35 x 10 mm Petri dish. A 5 cm (2 inch) square Parafilm M® was placed over the surface of the dish and tightened with a “0” type ring. Next, 28.3g (1o
About 7 leafhoppers were grouped in a plastic cup (z.), the above-mentioned container was placed on the top of the cup, and the parafilm was removed. The test solution was then placed in this container through the hole. In tests using undiluted Photorhabdus culture broth, the broth and control medium were dialyzed against water to reduce control mortality. Mortality is
Reported on day 2 when the control mortality was 26.5%.
In tests using purified fractions (200 mg protein / ml), a final concentration of 5% of sucrose was used in all treatments to increase the viability of Aster leafhopper. This assay is performed at 28 ° C and 70% relative humidity with 16/8 irradiation intervals.
% Hatcher. This assay was graded for mortality after 72 hours. The control mortality rate is 5.5
%Met.

The activity against Argentine ants was tested by the following method. A 1.5 ml aliquot of 100% Photorhabdus culture broth, control medium or water was pipetted into a 2.0 ml clear glass vial. The vials were capped with a dental cotton core that had been dampened with the appropriate procedure. 8-12 for each vial
Argentine ants (Lunepithema fumille)
ema humile)) adults were placed in individual 60 x 16 mm Petri dishes. Three were tested per treatment. The bioassay plate was placed on a laboratory bench with a fluorescent lamp on the ceiling at room temperature. Mortality was read 5 days after exposure. The control mortality rate was 24%.

The activity against termites was tested by the following method. Black ant worker ants (Camponotus pennsylvanicus) were collected from trees on the DowElanco farm in Indianapolis (IN). The test with Photorhabdus culture broth was performed by the following method. Each plastic bioassay container (18.1 cm x 7.6 cm (7 1/8 "x 3") contains 15 worker ants, a paper hide, and 10 ml of broth or control in a plastic bite glass. placed. The ant was allowed to reach the treatment through the cotton core through the hole made in the lid of the bite glass. All treatments included 5% sucrose. Bioassays were performed in the dark at room temperature and graded on day 19. Control mortality was 9%. The purified fractions delivered for the assay utilized in the ant artificial feed were prepared according to the procedure described above (purified fraction or control solution),
In a plastic test tube, mix 0.2 ml of treatment / 2.0 g of feed. The final protein concentration of the purified fraction was less than 10 μg / g feed. 10 ants per treatment
Animals, water, shelter and treated feed in a sealed plastic container and in a humidified hatch, in the dark,
Nourished at 27 ° C. Mortality was scored on day 10. Control mortality was not examined.

The activity of various lepidopteran larvae was tested by the following method. Photorhabdus culture broth or purified fractions
0.25 ml standard artificial diet was applied directly to the surface (~ 1.5 cm ² ) in 30 μl aliquots after dilution in either control medium or 10 mM sodium phosphate buffer pH 7.0, respectively. The feed plates were air dried in a sterile flow hood and the wells were infested with one newborn larva. European Awanomeiga (ostrinia
Eggs of Nutrialis (Ostrinia nubilalis) and Tobacco moth (Helicoverpa zea)
Acquired from a commercial source and hatched in-house,
odoptera exigua), nettle buckwheat (Trichoplusia ni), tobacco budworm (Heliothis virescen)
s)), Himehamaki (Laspeirecia pomonella)
yresia pomonella)) and black beetle (Agrotis ipsilo n) larvae were procured in-house. After the larvae have been swarmed, they are sealed in a feed plate and placed in a humidified growth chamber in the dark at 27 ° C.
So I cultivated for a suitable period. Photor for mortality and weight measurements
The habdus culture broth was scored on days 5-7 and the purified fractions on days 4-7. In general, 16 insects were used per treatment in all experiments. Control mortality for control media ranged from 4 to 12.5% and less than 10% for Photorhabdus buffer.

Example 3 Efficacy of Insecticides for Soil Application Photorhabdus luminescens (strain W-14) culture broth was shown to have activity against hamstrings when applied directly to soil or a soil mixture (Metromix®). New SCR in Metromix®
And the activity against WCR were tested by the following method (Table 4). The test was carried out for 6 days using corn saplings (United Agricide brand CL614) which had been germinated on a lighted, moist filter paper. After the roots had grown to about 3-6 cm, one grain / sapling was planted in a 591 ml clear plastic cup containing 50 g of dry Metromix®. After that, 20 newborns
The SCR or WCR was placed directly on the roots of this seedling and covered with Metromix®. During planting, the seedlings were drenched with a total of 50 ml of diluted broth solution. After spraying, the cup was sealed and left for 7 days in the light at room temperature. Then, the seedlings were washed, Metromix (registered trademark) was completely removed, and the roots were cut and weighed. Activity was graded for corn root survival relative to control roots and leaf damage caused by feeding. Leaf damage was visually scored and graded as either-, +, ++, or +++, undamaged-and severe damage ++.
Expressed as

The activity against nascent SCR in soil was tested by the following method (Table 5). The test was carried out using corn seedlings (United Agricide brand CL614) which had been germinated on a light, moist filter paper for 6 days. After the roots had grown to about 3-6 cm, one grain / sapling was planted in a 591 ml clear plastic cup containing 150 g of soil taken from a previous year's maize field in Lebanon (IN). . This soil has not been treated with pesticides until then. Twenty newborn SCRs were placed directly on the roots of this seedling and covered with soil. After planting, the seedlings were sprayed with 50 ml of the diluted broth solution in total length. After spraying, the unsealed cups were incubated at 25 ° C (78 ° F) in a high relative humidity (80%) chamber. The seedlings were then washed, the soil completely removed, the roots cut and weighed. Activity was graded for corn root survival relative to control roots and leaf damage caused by feeding. Leaf damage was visually scored and graded as-, +, ++, or +++, with no damage as-, and severe damage as +++.

The activity of Photorhabdus luminescens (strain W-14) culture broth against the second-instar lawn grub in Metromix® was observed in a test performed by the following method (Table 6). Approximately 50 g of dry Metromix® was placed in a 591 ml clear plastic cup. Thereafter, this Metromix (registered trademark) was diluted by 50% by volume.
A total of 50 ml of Photorhabdus broth solution was sprayed. Dilute the crude broth with water, and add 50% broth to 25 ml of crude broth.
25 ml of water was added to make a total volume of 50 ml. Normal medium concentration 50
% Proteose Peptone # 3 (PP
A 1 wt / vol% solution of 3) was used as a broth control. After spraying, 5 second-instar lawn worms were placed on the surface of the moistened Metromix®. The vigorous larvae of lawn worms immediately dug into the Metromix® by digging holes. Larvae that did not burrow within 1 hour were excluded and replaced with new larvae. The cup was sealed and placed in the dark in a 28 ° C. hatcher.
After 7 days, larvae were removed from Metromix® and scored for mortality. The activity was shown as the ratio of mortality to the control.

Example 4 Efficacy of Insecticides for Leaf Application The activity of Photorhabdus broth against the European corn borer was investigated when the broth was applied directly to the surface of corn leaves (Table 7). In this assay, Photorhabdus broth was diluted 100-fold with culture medium,
And on the surface of the cut corn leaves,
It was applied by hand at a rate of 6.0 μl / cm ² . The leaves were air dried and cut into equal size strips (about 2 x 2 inches). The leaves were rolled, fixed with a paper clip, placed in 28 g (1 oz) bite plastic glass with 0.63 cm (0.25 in) of 2% agar on the bottom and moistened. Then, the new Europe Awanomeiga 12
The pups were placed on the rounded leaves described above and sealed in cups.
After incubation for 5 days in the dark at 27 ° C., these samples were tested for feeding damage and larvae recovered.
Scored.

New tobacco budworm (Heliotis virescens (Heli
The activity of the above-mentioned culture broth against othis virescens)) was clarified using the leaf dipping method. Fresh cotton leaves were cut from the plants and leaf discs were cut with a 18.5 mm cork punch. This disc was concentrated approximately 10-fold with control medium (PP3) or with an Amicon (Beverly, MA) Proflux M12 tangential filtration system equipped with a 10 kDa filter. Photorhabdus lum
They were individually immersed in inescens (strain W-14) culture broth. Excess liquid was removed and a straightened paper clip was passed through the center of the disc. Then, add 28 g (1o of paper clip) containing 2.0 ml of 1% agar.
z) I put it in a bite of plastic glass.
This left the leaves hanging above the agar.
After the leaf discs were dried, a single larva of the newborn tobacco leaf moth was placed on top of the disc and the cup was capped. The cup was then placed in a plastic bag, sealed, and left in a dark place at 27 ° C. for 5 days. at this point,
The remaining larvae and leaf material were weighed and leaf damage was measured (Table 8).

Example 5, Part A Characterization of Toxin Peptide Components Subsequent toxin protein subunits of the band isolated in Example 1 were analyzed in a subsequent analysis to 7% of the 30: 0.8 ratio (acrylamide: BIS-acrylamide). SDS
It was resolved on a polyacrylamide gel. This gel matrix facilitates the degradation of larger proteins. In Example 1, the gel system used to estimate the molecular weights of the Band 1 and Band 2 subunits was a 38: 0.18 ratio (acrylamide: BIS-acrylamide) 18% gel, which has a broad range. Areas can be separated by size, but for high molecular weight components,
The resolution is low.

In this analysis, 10 protein bands were resolved instead of 8. Table 9 shows the calculated molecular weights of the 10 resolved bands and compares the estimated molecular weights under these conditions directly with the molecular weights of the previous examples. It is not surprising that additional bands were detected under the different separation conditions used in this example. The variability between the above molecular weight estimates and the new estimate is also expected to be caused by the difference in the degradation conditions. In the analysis of this example, the relatively large molecular weight estimates are believed to be more accurate than in Example 1 as a result of the improved resolution. However, these are estimated based on SDS-PAGE analysis, which is typically not as analytically accurate and yields peptide estimates and this is due to post-translational or co-translational modifications. Can be further substituted.

The amino acid sequence was determined for 5 N-termini in 10 degraded peptides. Table 9 correlates the molecular weights of these proteins and the identified sequences. In SEQ ID NO: 2, one analysis showed that the proline residue at position 5 could be asparagine (asn). In SEQ ID NO: 3, one analysis showed that the amino acid residues at positions 13 and 14 were both arginine (arg). In SEQ ID NO: 4, one analysis showed that the amino acid residue at position 6 was either alanine (ala) or serine (ser). In SEQ ID NO: 5, one analysis shows that the amino acid residue at position 3 is aspartic acid (as
p).

Example 5, Part B Characterization of Toxin Peptide Component A new N-terminal sequence SEQ ID NO: 15, Ala Gln Asp
Gly Asn Gln Asp Thr Phe Phe Ser Gly Asn Thr was obtained by further N-terminal sequencing of a peptide isolated from the native HPLC purified toxin described in Example 5 Part A above. . TCAA _ii termed this peptide begins in position 254, and reaches the 491 position, wherein TCAA _ii peptide starts SEQ ID NO: 4. The size of this peptide estimated from the gene sequence was 25,2
It is 40 Da.

Example 6 Characterization of Toxin Peptide Components In yet another analysis, the toxin protein complex was precipitated from Photorhabdus luminescens growth medium (after culturing without Tween) with 10-80% ammonium sulphate, followed by It was isolated again by an ion exchange chromatography step (Mono Q) and two molecular sizing chromatography steps. These conditions were similar to those used in Example 1. In the first molecular sizing step, a second peak of biological activity was found at approximately 100 ± 10 kDa. Based on protein measurements, this fraction was 20-50 times less active than the larger, or first activity peak of approximately 860 ± 100 kDa (native). During this isolation experiment, a smaller activity peak of approximately 325 ± 50 kDa, which retained a significant portion of the starting biological activity, was also resolved. This 325 kDa peak is the above-mentioned 86
It was considered to be related to or derived from the peak of 0 kDa.

In this analysis the 56 kDa protein was degraded. The N-terminal sequence of this protein is shown in SEQ ID NO: 6. Of note is that this protein shares significant identity and conservation with the N-terminus of SEQ ID NO: 5, which may be encoded by distinct members of a gene family. And that the proteins produced by each gene are sufficiently similar to be able to engineer both in this insecticidal toxin complex.

This would be the same protein or protein fragment as the second most prominent 185 kDa protein is consistently present in comparable amounts to protein 3 in Table 9. The N-terminus of this 185 kDa protein is shown in SEQ ID NO: 7.

Additional N-terminal amino acid sequence data was also obtained from the isolated protein. None of the determined N-terminal sequences matched the proteins identified in Table 9. Other proteins were present in the isolated preparation. One of these proteins has an estimated molecular weight
It was 108 kDa and had the N-terminal sequence shown in SEQ ID NO: 8. The second such protein had a predicted molecular weight of 80 kDa and had the N-terminal sequence shown in SEQ ID NO: 9.

Analysis of the size of this protein material with an activity peak at approximately 325 kDa showed bands at approximately 51, 31, 28 and 22 kDa. Since the molecular weight was determined by the mobility of electrophoresis in all cases, these molecular weights were subject to an error effect due to the difference in ionic strength of the buffer, the potential difference in electrophoresis, and the like. One of ordinary skill in the art will appreciate that a well-defined molecular weight value cannot be determined using these standard methods and that each is subject to variability. It was hypothesized that proteins of this size were the degradation products of the larger protein species (approximately 200 kDa in size) found in the larger initial toxin complex.

Finally, some preparations contained a protein with the N-terminal sequence shown in SEQ ID NO: 10. This sequence was highly homologous to a known chaperonin protein, which is an accessory protein whose function of forming structures of giant protein complexes is known. Applicants do not attribute such a structure-forming function to the protein identified in SEQ ID NO: 10, but it does explain that the explained toxin is associated with chaperone proteins in its structure formation. Consistent with the existence of protein complexes. Furthermore, although such proteins are not directly suggested to be toxic, it is important for this protein to determine the structural properties of the overall protein toxin and, as a result, after oral delivery. in vivo
Would contribute to the toxicity or tolerability of the complex.

The stability of the protein-toxin complex against proteinase K was subsequently analyzed. It was concluded that after incubating the complex for 24 hours in the presence of a 10-fold molar excess of proteinase K, the activity was almost inactivated (oral mortality was reduced to about 5%). It was These data support that the toxins described above are proteinaceous.

This toxicity was also retained by the dialysis membrane, again confirming the large size of the natural toxin complex.

Example 7 Photorhabdus Toxin Isolation, Characterization and Partial Amino Acid Sequencing Isolation and N-Terminal Amino Acid Sequencing: In a set of experiments performed in parallel with Examples 5 and 6, typically 2 to
Add 3 liters of Photorhabdus broth to a final concentration of 10 or
Ammonium sulfate precipitation of Photorhabdus proteins was performed by slowly adding and adjusting crystalline ammonium sulfate to either 20%. After stirring for 1 hour at 4 ° C., the material was centrifuged at 12,000 × g for 30 minutes. Adjust the supernatant with 80% ammonium sulphate and
It was stirred for an hour and centrifuged at 12,000 xg for 60 minutes.
This pellet was mixed with 1/10 its volume of 10 mM Na ₂ PO ₄ , pH.
Resuspended in 7.0 and dialyzed against the same phosphate buffer at 4 ° C overnight. The dialyzed material was centrifuged at 12,000 xg for 1 hour and subjected to ion exchange chromatography.

An HR 16/50 Q Sepharose (Pharmacia) anion exchange column was equilibrated with 10 mM Na ₂ PO ₄ , pH 7.0. Centrifuge and dialyzed ammonium sulfate pellets
It was added to the Sepharose column at a rate of 1.5 ml / min and the equilibration buffer was washed in large volumes at 3.0 ml / min until the optical density (OD280) reached below 0.100. Then 60
Gradient from 0 to 0.5 M NaCl over 3 min at 3 ml / min or over 60 min with 0.1 M, 0.4 M and finally 1.0 M Na.
Any one of a series of elution steps with Cl was run on the column respectively. Fractions are collected and sent to Centriprep (Centripr
ep) 100 and concentrated. Alternatively, the protein
It is possible to elute with a single 0.4M NaCl wash solution without eluting with 0.1M NaCl.

Concentrate 2 ml aliquots of Q Sepharose into 10m
HR 16/50 Superose 12 equilibrated with M Na ₂ PO ₄ , pH 7.0
On a (Pharmacia) gel filtration column, 0.5 ml / min was applied. The column was placed in the same buffer for 240 minutes at 0.5
Washed at ml / min and collected samples every 2 minutes. A void volume of material was collected and concentrated using Centriprep 100. A 2 ml aliquot of the concentrated sample of Superose 12 was loaded at 0.5 ml / min on a HR 16/50 Sepharose 4B-CL (Pharmacia) gel filtration column equilibrated with 10 mM Na ₂ PO ₄ , pH 7.0. . The column was washed with the same buffer at 0.5 ml / min for 240 minutes and samples were collected every 2 minutes.

The peak of the eluted protein was analyzed by Sepharose CL-
A second fractionation was performed by applying to a gel filtration column using 4B resin to separate proteins in the range -30 kDa to 1000 kDa. This fraction was resolved for two peaks; the smaller peak was the void volume (> 1000 kDa).
, And a large peak eluted at an apparent molecular weight of about 860 kDa. When samples were continuously subjected to gel filtration for more than 1 week, a gradual appearance of a third peak (approx. 325 kDa) was observed, which appeared to originate from the large peak mentioned above, probably due to limited proteolysis. Was given. Bioassays performed on these three peaks showed that this gap peak was inactive, but the 860 kDa toxin complex was highly active, and the 325 kDa peak was more likely, but less active. It was shown to be few. SDS-PAGE analysis of the peaks of the toxin complex of Sepharose CL-4B from different fermentation products revealed two distinct peptide patterns, designated "P" and "S". The difference between the molecular weights and the concentration of peptide components in their fractions was remarkable in these two patterns. The "S" pattern was produced most frequently and had 4 high molecular weight peptides (> 150 kDa), while the "P" pattern had 3 high molecular weight peptides. In addition to this, the "S" peptide fraction was found to be 2-3 times more active against the European corn borer. This bias may be associated with other variations in expression due to growth factor-based protein factors of the aged culture over the age and / or age of inoculation.

Milligram quantities of the peak toxin complex fractions defined as "P" and "S" peptide patterns were subjected to preparative SDS-PAGE and Tris-glycine (Seplabaf ®)
The blots were transferred to a PVDF membrane (Problot®, Applied Biosystems) over 3-4 hours. Blots were sent to Harvard Microchem and Cambridge Prochem for amino acid analysis and N-terminal amino acid sequencing, respectively. The three peptides in the "S" pattern had a unique N-terminal amino acid sequence as compared to the sequences identified in the previous example. The 201 kDa (TcdA _ii ) peptide described in SEQ ID NO: 13 below shared 33% amino acid identity and 50% similarity with SEQ ID NO: 1 (TcbA _ii ) (vertical lines in Table 10 and Table 10). Indicates amino acid identity, and the dotted line means conservative substitution of amino acids). The 197 kDa second peptide of SEQ ID NO: 14 (TcdB) had 42% identity and 58% homology with SEQ ID NO: 2 (TcaC). Furthermore, the third peptide
205kDa was meaning the TcdA _ii. In addition, the limited N-terminal amino acid sequence SEQ ID NO: 16 (TcbA) is a peptide of at least 235 kDa which was deduced from the cloned gene of SEQ ID NO: 11 (tcbA). the amino acid sequence of ID NO: 12, homology is the same, had a deduced amino acid sequence corresponding to SEQ ID NO: 1 (TcbA _ii). This is greater than 235 + kDa peptide, during fermentation, proteolytically, 201KDa peptide (TcbA _ii)
(SEQ ID NO: 1), which probably results in activation of the molecule. In yet another sequence, the sequence first reported as SEQ ID NO: 5 (TcaB _ii ) reported in Example 5 above has an aspartic acid residue (Asp) at position 3 instead of glycine (Gly), And 8 and 9
Positions were found to contain two additional amino acids, Gly and Asp, respectively. Two other sequences, SEQ ID NO: 2
Additional amino acid sequences were obtained in (TcaC) and SEQ ID NO: 3 (TcaB _i ). "S" sent for N-terminal analysis
A densitometer quantification was performed using a sample identical to the preparation. This analysis shows that the 201 kDa and 197 kDa peptides represent 7.0% and 70% of the total protein stained with Coomassie Brilliant Blue in the "S" pattern, respectively.
7.2%, and was shown to be present in amounts comparable to other abundant peptides. It was speculated that these peptides represent protein homologues, analogs to the situation found with other bacterial toxins, such as various Cry I Bt toxins. These proteins vary in their N-terminal amino acid sequence by 40-90% homology, which includes toxic fragments.

Internal amino acid sequencing: To facilitate cloning of the toxin peptide gene, the internal amino acid sequences of selected peptides were obtained by the following method. Preparative SDS-PAGE was applied to the milligram amount of the peak 2A fraction determined to have the "P" or "S" peptide pattern, and Tris-glycine (Seplabaf (registered trademark)) was used to prepare a PVDF membrane (problot). (Registered trademark), Applied Biosystems Inc.
Blots were copied over 4 hours. Blots were sent to Harvard Microchem and Cambridge Prochem for amino acid analysis and N-terminal amino acid sequencing, respectively. TcbA _ii (including SEQ ID NO: 1), TcdA
Three peptides, designated _ii and TcaB _i (including SEQ ID NO: 3), were trypsin digested at Harvard Microchem, then individual peptides were separated by HPCL chromatography. N-terminal amino acid analysis was performed on selected tryptic peptide fragments. Peptide TcaB
_The two internal peptides sequenced for _i (205 kDa peptide) were TcaB _i -PT111 (SEQ ID NO: 17) and TcaB.
_It is called _i- PT79 (SEQ ID NO: 18). Peptide TcaB _i (68
The two internal peptides sequenced with respect to the KdA peptide) are TcaB _i -PT158 (SEQ ID NO: 19) and TcaB _i -PT1.
It is called 08 (SEQ ID NO: 20). Peptide TcbA _ii (201kDa
Peptide) was sequenced for four types of internal peptides, TcbA _ii -PT103 (SEQ ID NO: 21), TcbA _ii -PT56
(SEQ ID NO: _{22), TcbA ii -PT81 (a} ) ( SEQ ID NO: 23),
And referred TcbA _ii -PT81 and (b) (SEQ ID NO: 24).

Example 8 Construction of a Photorhabdus luminescens W-14 Genomic DNA Cosmid Library and Screening to Isolate Genes Encoding Peptides Containing Toxic Protein Preparations Production of Photorhabdus insect toxic proteins in a heterologous host, and As a prerequisite for other uses, it is necessary to isolate and characterize the genes encoding these peptides. This purpose is investigated in parallel in detail. One way is to
It is based on the use of monoclonal and polyclonal antibodies raised against the purified toxin, as used subsequently for the isolation of clones from expression libraries.
Another method is based on the use of N-terminal and internal amino acid sequence data to design degenerate oligonucleotides for use in PCR amplification, as described in this example. Either method can be used for the isolation of each gene and the identification of the DNA clone containing the gene encoding the peptide in order to enable the determination of their DNA base sequences.

Isolation of genomic DNA: Photorhabdus luminescens strain W-
14 (ATCC Deposit No. 55397) with 2% Proteose Peptone # 3 Agar (Diff Collaborator, Detroit, M
I) that grows on and is capable of receiving insecticidal toxins (competenc
e) was maintained by repeated bioassays after passage using the method of Example 1 above. Shake culture 50 ml
175 ml containing 2% proteose peptone # 3 medium
Made in a flask with a partition of, at 28 ℃ and 150 rpm,
Proliferated for about 24 hours. Fifteen ml of this culture was pelleted and -20% in the medium until thawed for DNA isolation.
Frozen at ℃. The thawed culture was centrifuged (70
(0 × g, 30 minutes), and the floating orange mucopolysaccharide substance was removed. The remaining cellular material was centrifuged (25,000 xg, 15 minutes) to pellet the bacterial cells and the medium was removed.

Genomic DNA was isolated by applying the CTAB method described in Section 2.4.1 of a recent protocol in molecular biology (edited by Ausbel et al., John Willie Son (1994)). shock) and all capacity
The point that the dose was increased 10 times was changed. ). The pelleted bacterial cells were treated with TF buffer (10 mM Tris-HCl, 1 mM EDTA, p
Resuspend in H8.0) to a final volume of 10 ml, then 5M N
12 ml of aCl was added; the mixture was centrifuged at 15,000 xg for 20 minutes. The resulting pellet was resuspended in 5.7 ml TE and to this suspension was added 300 ml 10% SDS and 20 mg / ml.
Proteinase K 60 ml (Gibco BRT Products, Grand Island, NY; sterile distilled water as solvent) was added. This mixture was incubated for 1 hour at 37 ° C .; then 10 mg of lysozyme (Worthington Biochemical, Freehold, NJ) was added. 45 minutes after addition, 1 ml of 5M NaCl and 800 ml of CTAB / NaCl solution (10 ml
Weight / volume% CATB and 0.7M NaCl) was added. The preparation was incubated at 65 ° C for 10 minutes, then gently agitated, further incubated, and agitated for about 20 minutes,
Helped the cell material clear. An equal volume of chloroform / isoamyl alcohol solution (24: 1, v / v) was added, mixed gently and centrifuged. Equivalent PCI
(Phenol / chloroform / isoamyl alcohol,
50: 49: 1, volume / volume / volume, equilibrated with 1M Tris-HCl, pH 8.0; this DNA was extracted twice with Intermounting Scientific, Caisville, UT).
Was precipitated with 0.6 volume of isopropanol. The DNA precipitate was slowly removed with a glass rod, washed twice with 70% ethanol, dried and 2 ml STE (10 mM Tris-HCl,
pH 8.0, 10 mM NaCl, 1 mM EDTA). This preparation was measured for optical density at 260 nm (ie O 2
D ₂₆₀ ), containing 2.5 mg / ml of DNA.

The molecular size range of this isolated genomic DNA is
It was evaluated to be suitable for preparing a library. CHEF gel analysis is performed on a Birad CHEF-D equipped with a pulse wave 760 converter.
R II device (Bio-Rad Laboratory, Richmond,
CA) in 0.5 × TBE buffer (44.5 mM Tris-HCl, p.
_{H8.0,44.5mM H 3 BO 3, 1mM EDTA} ) with 1.5% agarose (C-Chem (R) LE, FMC BioProducts, Inc., Rockland, ME) was performed in the gel. The operating parameters are: Initial A time, 3 seconds; Final A time, 12 seconds; 200
Volts; operating temperature, 4-18 ° C; operating time, 16.5 hours. Staining with ethidium bromide and examining the gel under UV light showed that the DNA size ranged from 30 to 250 kbp.

Library Generation: This Photorhabdus genomic DNA preparation was partially digested with Sau3A1. This way, Ausbel
Based on Section 3.1.3 (supra). The reaction was adapted to run on a smaller scale under various conditions until almost optimal results were obtained. Several large scale reactions were scaled up under various conditions, the results were analyzed on a CHEF gel and only the best large scale preparation was proceeded. Optimally, 200 μl of Photorhabdus genomic DNA,
Sau3A 1 (MU England Biolabs, “NE
B ", Beverly, MA) with 1.5 units, total volume 2 ml 1X N
37 in EB 4 buffer (supplied by the manufacturer at 10 ×)
Incubated at 15 ° C for 15 minutes. This reaction is PCI
Stop by adding 2 ml and 10 at 8000 xg.
Centrifuge for minutes. 200 μl of 5M NaCl and 6 ml of ice-cooled ethanol were added to the supernatant. This preparation was
It was cooled at 0 ° C. for 30 minutes and then centrifuged at 12,000 × g for 15 minutes. The supernatant was removed, and the pellet was dried in a vacuum oven at 40 ° C and then resuspended in 400 µl STE. A spectrophotometric assay showed that about 40% of the input DNA was recovered. The digested DNA follows the CPMB Section 5.3.2 (supra)
Size fractionation on a sucrose density gradient. 10% to 40%
A (weight / volume) linear sucrose density gradient was prepared in an Ultra-Clear® tube (Beckman Instruments, Inc., Palo Alto, Calif.) Using a gradient maker and the DNA sample was I put it on the top. Centrifuge (26,000 rpm, 17 hours, Beckman SW41 rotor, 20
After (° C.), a fraction (about 750 μl) was collected from the top of this gradient and analyzed by CHEF gel electrophoresis (described above). Fractions containing the Sau3A 1 fragment of size 20-40 kbp were selected and the method of Section 5.3.3 of Ausbel (supra) was modified (total solution volume increased approximately 6.3-fold). The DNA was precipitated. After overnight precipitation, the DNA was centrifuged (17,000 xg, 1
5 min), dried, redissolved in TE to a final volume of 80 μl and reprecipitated by adding 8 μl of 3M sodium acetate and 220 μl of ethanol. The pellet collected by centrifugation as described above was resuspended in 12 μl TE. The DNA concentration was measured by Hoechst 33258 dye (Polyscience, Warrington, PA) fluorimetric assay using a Hofer TKO100 fluorometer (Hofer Scientific Instruments, San Francisco, CA). About 2.5 μl of the size-fractionated DNA was recovered.

Cosmid pWE15 DNA (Stratagene, La Jolla, C
A) 30 μg with 100 units of BamH 1 (NEB) restriction enzyme
Manufacturer's buffer (final volume 200 μl, 37 ° C, 1
Time) as a solvent and completely digested. This reaction product
It was extracted with 100 μl PCI and the DNA was precipitated from the aqueous phase by adding 3 M sodium acetate and 550 μl absolute ethanol at -20 ° C. After leaving at -70 ° C for 20 minutes,
The DNA was collected by centrifugation (17,000 xg, 15 minutes), dried in vacuo, and 10 mM Tris-HCl, pH 8.0, 18
It was dissolved in 0 μl. Add 10x CIP buffer (100 mM
1 μl (0.25 units) of calf intestinal alkaline phosphatase (Boehringer Mannheim, Indianapolis, IN) diluted with Tris-HCl, pH 8.3; 10 mM ZnCl ₂ ; 10 mM MgCl ₂ ) 20 μl and diluted 1: 4 Was added. 37 ° C
After 30 minutes at room temperature, add the following: 2 μl of 0.5 M EDTA pH 8.0;
10 μl 10% SDS; 20 mg / ml proteinase K (previously described).
5 μl, followed by incubation at 55 ° C. for 30 minutes. PCI 100 μl and phenol (Intermounting Scientific, equilibrated with 1 M Tris-HCl, p
H8.0) Dephosphorylated DNA after continuous extraction with 100 μl
Was precipitated by the addition of 72 μl 7.5M ammonium acetate and 550 μl ethanol at -20 ° C., incubated on ice for 30 minutes and centrifuged as before. Precipitated DNA
Was washed once with 500 μl of 70% ethanol at −20 ° C., dried in vacuo and dissolved in 20 μl of TE buffer.

Ligation of the size-fractionated Sau3A1 fragment into the BamH1-digested and phosphorylated pWE15 vector
The protocol in section 3.3 of usbel was modified (ie using the pre-mixed 10 × ligation buffer supplied by the manufacturer) and was achieved with T4 ligase (NEB). Ligation was carried out for a total volume of 20 μl.
It was carried out at 15 ° C overnight and subsequently stored at -20 ° C.

4 μl of the cosmid DNA ligation reaction containing about 1 μg of DNA was subjected to λ bacterio using a commercial packaging extract (Gigapack® III Gold packaging extract, Stratagene) according to the manufacturer's instructions. Packaged in phage. The packaged preparation was stored at 4 ° C until use. The following Gigapack® III Gold Protocol (Cosmid Library Titering (ti
This packaged cosmid preparation was used for transfection into Escherichia coli XL1 blue MR cells (Stratagene) according to XL1 blue MR cells,
L containing 0.2 wt / vol% maltose and 10 mM MgSO ₄ ,
It was grown at 37 ° C. in B medium (g / L: 10 bacto-tryptone; 5 bacto yeast extract; 15 bacto agar; 5 NaCl (Difco Laboratories, Detroit, MI)). After 5 hours of growth, cells were pelleted at 700 xg (15 minutes) and resuspended in ₆ ml of 10 mM MgSO4. The concentration of the culture was adjusted to OD ₆₀₀ = 0.5 with 10 mM MgSO ₄ . The packaged cosmid library was sterilized with SM medium (0.1 MN
aCl, 10 mM MgSO ₄ , 50 mM Tris-HCl, pH 7.5, 0.01 wt / vol% gelatin) 1:10 or 1:20 and 25 μl of diluted preparation 25 μl of diluted XL1 blue MR cells
Mixed with. This mixture was incubated for 30 minutes at 25 ° C. (without shaking), after which 200 μl of LB broth was added,
And the incubation was continued for about 1 hour with occasional gentle agitation. An aliquot of this culture (20-40 μ
l) was plated on LB agar plates (ie LB-Amp ₁₀₀ ) containing 100 mg / l ampicillin and incubated overnight at 37 ° C. To preserve this library without amplification, single clones were picked and inoculated into individual wells of sterile 96-well microwell plates;
75 μl of terific broth (TB medium: 12 g / l bactotryptone, 24 g / l bacto yeast extract, 0.4 vol% glycerol, 17 mM H ₂ PO ₄ , 72 mM K ₂ HPO ₄ ) in each well.
Ampicillin 100 mg / l (ie TB-Amp ₁₀₀ ) was added and incubated overnight at 37 ° C. (without shaking). After copying the 96-well plate to the copy plate, filter-sterilized TB: glycerol (1: 1, volume /
Volume, ampicillin 100 mg / l with or without) 75 μl / well, added to this plate briefly 100 rpm,
Shake at 37 ° C., then seal with Parafilm® (American National, Greenwich, CT), -70
Stored in a freezer at 0 ° C. The copy plate was processed in the same manner as the master plate. A total of 40 such master plates (and their copies)
Was prepared.

Library screening with radiolabeled DNA probes: To prepare colony filters for probing with radiolabeled probes, 10 96-well plates of the above library were thawed at 25 ° C (bench surface at room temperature). . Using a replica plating instrument with 96 pointed parts, TB-Amp ₁₀₀ 75 μm
A new 96-well copy plate containing l / well was inoculated. The copy plates were grown overnight at 37 ° C. (standing) and then shaken at 100 rpm at 37 ° C. for about 30 minutes. A total of 800 colonies were revealed on this copy plate to isolate those that did not grow. Solid LB- in a bioassay plastic dish (Nunc, 243 × 243 × 18 mm; Curtin Matison Scientific, Wood Dale IL) using the replica device.
Magna NT placed on Amp ₁₀₀ (100 ml / dish)
(MSI, Westborough, MA) Nylon film (0.45μm, 2
20x250 mm) were inoculated with duplicate impressions of this 96-well array. These colonies were grown on the aforementioned membrane at 37 ° C. for about 3 hours.

Positive control colonies (bacterial clones containing GZ4 sequence inserts, see below) were separated on LB medium supplemented with 35 mg / l chloramphenicol (ie LB-Cam ₃₅ ) with a separate Magna NT membrane (Nunc., 0.45 μm, 82mm circle)
Grows on and processed along this library colony membrane. The bacterial colonies on the membrane were lysed and the DNA denatured and neutralized according to the protocol of the Genius® System User Guide Version 2.0 (Boehringer Mannheim, Indianapolis, IN). With 0.5N NaOH
On a filter paper dipped in 1.5M NaCl for 15 minutes,
Place the membrane, colony side up, to denature, and
Neutralization was performed on filter paper immersed in 1 M Tris-HCl, pH 8.0, 1.5 M NaCl for 15 minutes. Stratagene's
After UV crosslinking using UV Stratalinker set to auto crosslink, the membrane is dried at 25 ° C.
So I saved it until I used it. Membranes were trimmed into strips containing duplicate traces in a single 96-well plate and then extensively washed as described in CPMB (supra) Section 6.4.1: 3 x SS.
C, 0.1 wt / vol% SDS, washed for 3 hours at 25 ° C, then with the same solution for 1 hour at 65 ° C, followed by a hybridization step (20 x SSC = 3M NaCl, 0.3M sodium citrate). , PH 7.0) and rinsed with 2 × SSC.

Amplification of a specific genomic fragment of the tcaC gene: A pool of degenerate oligonucleotides (pool S4Psh) based on the N-terminal amino acid sequence determined here for the purified TacC peptide fraction (shown here as SEQ ID NO: 2), Applied Biosystem ABI394 DNA / RNA Synthesizer (PerkinElmer, Foster City, CA) with standard β
Synthesized by cyanoethyl chemistry. These nucleotides were deprotected for 8 hours at 55 ° C., dissolved in water, quantified by spectrophotometry and diluted for use.
This pool matched the N-terminal determined amino acid sequence of the TacC peptide. The determined amino acid sequence and the corresponding degenerate DNA sequence are shown below, where A,
C, G and T are standard DNA bases and I represents inosine: Another set of degenerate oligonucleotides was synthesized (pool P2.3.5R), showing the integrity of the coding strand for the determined amino acid sequence of SEQ ID NO: 17: These oligonucleotides are available from Photorhabdus strain-
Specific D from genomic DNA prepared from 14 (see above)
Polymerase chain reaction (PCR) to amplify NA fragments
(Registered trademark), Roche Molecular Systems, Inc., Brunchuberg, NJ). A typical reaction (50 μl) was 125 pmol of each primer pool P2Psh and P2.3.5R, 253 ng of genomic template DNA, dATP, dC.
TP, dGTP and dTTP were each 10 nmol 1x Geneamp (R) PCR buffer, and 2.5 units AmpliTac (R) DNA polymerase (both obtained from Roche Molecular Systems; 10X Geneamp (R) buffer was 100 mM. Tris-HCl, pH 8.3, 500 mM
KCl, 0.01% w / v gelatin). Amplification was performed at 94 ° C (1.0 min), 55 ° C (2.0 min), 72 ° C (3.0 min), and 7.0 min 72 ° C extension period for 35 cycles, using a Perkin Elmer Cetus DNA thermal cycler (Perkin Elmer, Foster, Inc.). City, CA). The amplification product was TEA buffer (40 mM Tris-
It was analyzed by electrophoresis in 2% w / v% Nucive® 3: 1 agarose (FMC Bioproducts) in acetic acid, 2 mM EDTA, pH 8.0). By staining this gel with ethidium bromide (0.5 μg / ml) and detecting it under UV light, a specific product with an estimated size of 250 bp was found in many other amplification products.

The portion of the gel containing the approximately 250 bp product was cut and a small plug (0.5 mm diameter) was removed and used to supply template for PCR amplification (40 cycles). This reaction (50 μl) contained the same contents as above, except for the genomic template DNA. After amplification, blunt the ends of this fragment,
And 1 unit of T4 DNA polymerase (NEB), 1nmol AT
Phosphorylated by incubation with P and 2.15 units of T4 kinase (Pharmacia Biotech, Piskate Way, NJ) for 20 minutes at 25 ° C.

The DNA fragments were separated from the remaining primers by electrophoresis through 1% w / v% GTG® Agarose (FMC) in TEA. Apparent size 250bp
Cut the gel slice with the fragment of
Kia Ex Kit (Qiagen, Chast Worth,
CA).

This extracted DNA fragment was ligated to the plasmid vector pBC KS (+) (Stratagene) which had been completely digested with the restriction enzyme Sma 1 and extracted in the same manner as described for the pWE15 DNA probe above. . A typical ligation reaction (16.3 μl) was 1 × ligation buffer (50 mM Tris-HCl, pH 7.4; 10 mM MgCl 2.
₂ ; 10 mM dithiothreitol; 1 mM spermidine; 1 mM ATP; 1
(00mg / ml bovine serum albumin) as a solvent, 100ng of digested pBC KS (+) DNA, 70ng of 250bp DNA fragment, 1nm
ol [Co (NH ₃ ) ₆ ] Cl and T4 DNA ligase with 3.9 Weiss
Unit (Collaborative Biomedical Products, Bedford, MA). After overnight incubation at 14 ° C, the ligated product was transformed into frozen competent Escherichia coli DH5α (Gibco BRL) according to the supplier's instructions and IPTS (119 μg
/ ml) and X-gal (50 μg / ml), LB-Cam ₃₅
Placed on the plate. Independent white colonies were picked and plasmid DNA was modified with modified alkaline lysis / PE
It was prepared by the G precipitation method (PRISM (registered trademark) simple reaction dideoxy (registered trademark) terminator cycle sequencing kit protocol; ABI / Perkin Elmer). The nucleotide sequences of both strands of this insert DNA were taken from the T7 primer [pBC KC (+) bases 601-623: TAAAACG.
ACGGCCAGTGAGCGCG] and LacZ primer [pBC KS (+)
Base 792-816: ATGACCATGATTACGCCAAGCGCGC], and PRIS
It was determined using the protocol of the M® sequencing kit (ABI / Perkin Elmer). The unincorporated stained terminator dideoxyribonucleotides were removed by passing through a Sentry Sep 100 column (Princeton Separation, Inc., Adelphia, NJ) according to the manufacturer's instructions. This DNA
Sequences were obtained by analyzing these samples using an ABI model 373A DNA sequencer (ABI / Perkinermer). The DNA sequences of the two isolates GZ4 and HB14 were found to be detailed in FIG.

This sequence has the following characteristics: i) bases 1-20 are S4
Ii) The sequence of amino acids 1-3 and 6-12, representing one of the 64 possible sequences of the Psh degenerate oligonucleotide, is exactly the one determined for the N-terminus of TacC (SEQ ID NO: 2). A match, iii) the fourth amino acid encoded is a cysteine residue rather than a serine residue, and this difference is encoded within the degeneracy of the serine codon (see above), iv) encoded The 5th amino acid is proline and corresponds to the TcaC N-terminal sequence shown in SEQ ID NO: 2, v) bases 257-276 are 192 possible sequences designed into a degenerate pool. Vi) a TGA stop codon introduced at bases 268-270, which is the result of complementarity to the degeneracy incorporated into the oligonucleotide pool at the corresponding position, and of the corresponding gene. To show a short reading frame No.

Labeling of the TcaC peptide gene-specific probe   100 pmol of P2Psh primer and P2.3.5R primer respectively
-, Plasmid GZ4 or HE14 10ng as template, respectively
20 nmoles dATP, dCTP, dGTP, and dTTP, AmpliTAq DNA
5 units of polymerase, 1X concentration of GeneAmp Buffer above
Used under the same temperature regime as
PCR the corresponding DNA fragment in 100 μl reaction volume To
More amplified (35 cycles). Amplification products in Qiaex kit
By 1% GTG Extract from agarose gel and
It was quantified by measurement.

  Amplification product extracted from plasmid HB14 template (approximately 400n
g) in 5 aliquots and follow the manufacturer's instructions
High Prime Labeling Mix (Boehringa
Mannheim)³²Labeled with P-dCTP. When
Follow the supplier's instructions for radioactive isotopes not incorporated.
NucTrap In probe purification column (Stratagen)
Was removed by passage through. The specific activity of the labeled DNA product
3.11 as measured by scintillation counting
 x 10⁸It was dpm / μg. Using this labeled DNA
Membranes prepared from 800 members of the genomic library
I checked.

Screening by TcaC peptide gene-specific probe
Gu   Boil the radiolabeled HB14 probe for about 10 minutes,
Then added to the "minimum hyb" solution [Note: "minimum hyb" method
CERES protocol; "Restriction fragment length polymorphism research manual
Alversion 4.0 ", Sections 4-40 and 4-47; CERES / NPI, Sa
Adopted from lt Lake City, UT. NPI does not exist
However, its successor operates as Linkage Genetics
]]. The “minimum hyb” solution is 10% w / v PEG
Recall, M.W. about 8000), 7% w / v SDS, 0.6X SSC, 1
0 mM sodium phosphate buffer (95 g / l NaH₂PO_Four・ 1 H₂O
And 84.5 g / l Na₂HPO_Four・ 7 H₂From 1M stock solution containing O), 5
Includes mM EDTA and 100 mg / ml denatured salmon sperm DNA. film
Rapidly dry blot and then pre-hybridize
5 strips of membrane, without minimum
b "75 ml and 2.6 ng / ml radiolabeled HB14 probe
Put in each of the two plastic boxes that contain. this
Incubate overnight at 60 ° C with gentle shaking
It was “Minimize filters at 25 ° C for approximately 10 minutes each
Wash 3 times in "hyb wash" (0.25X SSC, 0.2% SDS)
And then twice in the same solution with gentle shaking at 60 ° C.
Was washed for 30 minutes. Light-tight filter
・ Saran wrap in autoradiography cassette
Of paper covered with (Dow Brand, Indianapolis, IN)
Place it on top of two DuPonts at -70 ° C for 4 hours.
Kronex Lightning Enhancer + C1 Enha
Using a sensor (Sigma Chemical Co., St.Lois, MO)
-Exposed to Omat X-ray film (Kodak, Rochester, NY)
It was After development (normal photo manipulation), a significant signal was detected.
High background with weak and even irregular signal
Was apparent in both replicates between. Again, fill
In "minimum hyb wash" at 68 ° C for about 4 hours
Rinse, then re-insert in cassette and load film at -70
Exposed overnight at ° C. Duplicate 96-well with 12 possible positives
Identify both colony depressions with strong signals
It was Signal is negative control membrane (XL1 blue MR containing pWE15
Cell colony) and a very strong signal
Positive control membranes (PCR products) treated simultaneously with experimental samples
DH5α cells containing GZ4 isolates).

Twelve putative hybridization-positive colonies were harvested from frozen 96-well library plates and grown overnight at 37 ° C in solid LB-Amp ₁₀₀ medium. They were then patched into solid LB-Amp ₁₀₀ (3 / plate, +3 negative controls: XL1 blue MR cells with pWE15 vector).
Two sets of membranes (Magna NT Nylon, 0.45 micron) were prepared for hybridization. The first set was prepared by placing the filter directly on the colonies of the patch plate, then removing it with attached bacterial cells and treating as follows. A second set of filters was seeded by placing the plates in LB-Amp ₁₀₀ medium and then transferring the cells from the patch plate to the filter. After overnight growth at 37 ° C, the filters were removed from the plates and processed.

The DNA was denatured by lysing the bacterial cells on the filters and placing each filter in a pool of 0.5 N NaOH (1.0 ml) in a plastic plate, colony side up, for 3 minutes. Dry blot the filters with paper towels and then repeat the process with a fresh 0.
Repeat with 5N NaOH. After dry blotting, the filters were neutralized by placing them in 1.0 ml pools of 1M Tris-HCl, pH 7.5 for 3 minutes each, dry blotted and re-neutralized with fresh buffer. This was followed by two similar soaks (5 min each) with a pool of 0.5 M Tris-HCl, pH 7.5 + 1.5 M NaCl. After dry blotting, the DNA was UV cross-linked to filters (as above) and the filters were washed in 100 ml 3X SSC + 0.1% (w / v) SDS (25 ° C, 100 rpm) (4 times each). For cleaning, use fresh solution for 30 minutes each). They were then allowed to react for 2 hours at 65 ° C. and 50 rpm in a minimum volume of prehybridization solution [6X SSC + 1% w / v Ficoll 400 each.
(Pharmacia), Polyvinylpyrrolidone (Average MW36
0,000; Sigma) and bovine serum albumin fraction V;
(Sigma)]. The prehybridization solution was removed and the HB14 stored from the previous hybridization of the library membrane and denatured at 95 ° C for 5 minutes.
^It was replaced with a ³² P-labeled probe. Hybridization was carried out at 60 ° C. for 16 hours with shaking at 50 rpm.

After removing the labeled probe solution, the membrane was placed at 25 ° C (50 rpm, 15 rpm).
Min) for 3 times in 3X SSC (about 150 ml of wash solution each). Then add them to 0.25X SSC + 0.2% SDS (minimum hyb
It was washed in a washing solution) at 68 ° C. for 3 hours (50 rpm) and exposed to the above X-ray film at 25 ° C. for 1.5 hours (no enhancer screen). This exposure is a cosmid isolate 22G1
Very strong hybridization signals were revealed for 2, 25A10, 26A5, and 26B10, and very weak signals for cosmid isolate 8B10. No signal was seen in the negative control (pWE15) colonies, a very strong signal was seen in the positive control membranes (DH5α cells containing the PCR product GZ4 isolate) co-treated with the experimental samples.

Amplification of a Specific Genomic Fragment of the tcaB Gene Based on the N-terminal amino acid sequence determined for the purified TcaB _i peptide fraction (disclosed herein as SEQ ID NO: 3), a pool of degenerate oligonucleotides (Pool P8F). Was synthesized as described for the peptide TcaC. The determined amino acid sequence and the corresponding degenerate DNA sequence are shown below, where A, C, G and T are normal DNA bases and I represents inosine.

Another set of degenerate oligonucleotides was synthesized (Pool P
8.108.3R), the determined amino acid sequence of the TcaB _i -PT108 internal peptide (disclosed herein as SEQ ID NO: 20).
Corresponding to the complement of the cord strand.

  Hot start 50 tubes^TM(Molecular Pio
-Products, SanDiego, CA)
Using oligonucleotides as primers for PCR,
Photorhabdus strain W-14 (see above)
Specific DNA fragments from genomic DNA prepared from
Amplified. Typical reaction solution (50 μl) is 1X GeneAmp
2 nmol each of dATP, dCTP, dGTP, and d in PCR buffer
25 pmoles of primer pools P8F and P8 respectively with TTP.
108.3R (lower layer) and 1X GeneAmp In the PCR buffer,
Nome template DNA 230 ng, 8 nmole each of dATP, dCTP, dGTP, and
And dTTP, and 2.5 units of AmpliTaq DNA polymerase (top
Layers). Amplification is described for the TcaC peptide
35 cycles as described above. Amplification product is TE
0.7% w / v Schem in A buffer LE agarose (FMC)
Was analyzed by electrophoresis. Estimated size 1600bp
The fixed product was observed.

  Amplified DNA by pooling four such reactions
Qiaex key as described for the TcaC peptide.
1.0% seachem depending on Extracted from LE gel. P8F
Use the primer pool and P8.108.3R primer pool.
Sequencing the extracted DNA using (PRISM^TMSequencing key
Was used directly as a mold. Each reaction solution is a template
Includes approximately 100 ng of DNA and one primer pool of 25 pmol.
, As described for the TcaC peptide.
Processed according to protocol. Is it an extension of the P8F primer?
Analysis of the sequences derived from
Amino acid sequence).

This corresponds to a portion of the N-terminal peptide sequence disclosed as SEQ ID NO: 3 (TcaB _i ).

TcaB_iLabeling of peptide gene-specific probes   Gel-purified TcaB_i About 50ng of DNA fragment
Like³²Labeled with P-dCTP and not incorporated
Radioactive isotope for NICK column (Pharmacia)
It was removed by filtration. The specific activity of labeled DNA was measured
By the way, 6 x 10⁹It was dpm / μg. This labeled DNA
To hybridize to the TcaC-peptide specific probe.
Code prepared from members of the genomic library
The Ronnie membrane was probed.

The membrane containing the 12 colonies identified on the TcaC-probe library screen (see above) was approximately 30
Stripped from the radioactive TcaC-specific label by boiling twice in 1 liter of 0.1X SSC + 0.1% SDS per minute. Radiolabel removal was checked with a 6 hour film exposure. The stripped membrane was then incubated with the previously prepared TcaB _i peptide specific probe. Labeled DNA was denatured by boiling for 10 minutes and then added to filters that had been incubated for 1 hour in 100 ml of "minimal hyb" solution at 60 ° C. After overnight hybridization at this temperature, the probe solution was removed and the filters were washed as follows (all 0.3X SSC
+ 0.1% in SDS). Once at 25 ° C for 5 minutes, once in fresh solution at 60 ° C for 1 hour, and in fresh solution once at 63 ° C for 1 hour. Four strong hybridizing colonies were observed after 1.5 hours of exposure to X-ray film by routine manipulation. They are,
According to the TcaC-specific probe, isolates 22G12, 25A10,
26A5 and 26B10.

The same TcaB _i probe solution with an equal volume (about 100 ml)
It was diluted with a b "solution and then used to screen a membrane containing 800 members of the genomic library. After hybridization, washing, and exposure to X-ray film as described above, four cosmid clones 22G12 were used. , 25A1
Only 0, 26A5, and 26B10 were found to hybridize strongly to this probe.

Isolation of subclones containing the gene encoding the TcaC peptide and TCAB _i peptides, and vibration overnight in TB-Amp ₁₀₀ Three positively hybridizing cosmids at 30 ° C. Determination strain XL1 in Blue MR of the DNA base sequence Tou (200rp
m) while growing. After harvesting the cells by centrifugation, follow the manufacturer's protocol to
Cosmid DNA was prepared using Gprep ^™ , 5 Prime 3 Prime, Boulder, CO). Only one cosmid, 26A5, was successfully isolated by this procedure. Restriction enzyme EcoR 1
When digested with (NEB) and analyzed by gel electrophoresis, sizes of approximately 14, 10, 8 (vector), 5, 3.3, 2.9,
And a 1.5 kbp fragment was detected. The second attempt (8 ml culture; TB-Amp ₁₀₀ , 30 ° C.) to isolate cosmid DNA from the same three strains was a boiling miniprep method (Evans G.
And G. Wahl., 1987, “Cosmid vectors for genomic walk.
ing and rapid restri−ction mapping ", Guide to Mole
cular Cloning Techniques.Meth.Enzymology, Volume 152, SB
Erger and A. Kimmel, pp. 604-610). Only one cosmid, 25A10, was successfully isolated by this method. When digested with the restriction enzyme EcoR 1 (NEB) and analyzed by gel electrophoresis, this cosmid showed the same fragmentation pattern as previously seen with cosmid 26A5.

A sample of 0.15 μg of 26A5 cosmid DNA was used to transform 50 ml of E. coli DH5α cells (Gibco BRL) according to the supplier's protocol. A single colony isolate of that strain was inoculated into 4 ml of TB-Amp ₁₀₀ and grown at 37 ° C for 8 hours. Chloramphenicol was added at a final concentration of 225 μg / ml, the incubation was continued for another 24 hours, then the cells were harvested by centrifugation and frozen at −20 ° C. Isolation of the 26A5 cosmid DNA increased all volumes by 50% and improved conventional alkaline lysis minipreps by using agitation or light mixing rather than vortexing in each step (Maniatis et al., Supra, p. 382). It was due to. After washing the DNA pellet in 70% ethanol, it was dissolved in TE containing 25 μg / ml Ribonuclease A (Boehringer Mannheim).

GZ4 induction probe and TcaB_iForm a hybrid on the probe
Of the resulting EcoR 1 fragment   Cosmid 25A10 (from XL1 blue MR cells) About 0.4 μg
And cosmid 26A5 (chloramphenicol amplified DH5
Approximately 0.5 μg (from α cells) with approximately 15 units of EcoR 1 (NEB) 85
Digest each for minutes, freeze overnight, then at 65 ° C
Heat for 5 minutes and electrophorese in a 0.7% agarose gel.
Hung (Chem LE, 1X TEA, 80 volts, 90 minutes).
Staining the DNA with ethidium bromide as described above,
Photographed under UV light. Cosmid 25A10 EcoR 1
The digested product was completely digested, but the cosmid 26A5 sample
The le was only partially digested under these conditions.
Depurinase an agarose gel containing DNA fragments
Depurination, denaturation and neutralization, followed by total
See Section 2.9 of Ausubel et al. (CPMB, cited above).
Using the high salt (20X SSC) protocol.
Southern blotting was performed on a Guna NT nylon membrane. Then
UV-crosslink the transferred DNA to the nylon membrane as described above.
did.

  The TcaC plasmid corresponding to the insert of the plasmid isolate GZ4.
100 ml of peptide-specific DNA fragment as above
It was amplified by PCR in a reaction volume of. Three kinds of such anti
Amplification products from Oia are pooled and processed as described above for Qiaex.
1% GTG depending on the kit Extracted from agarose gel,
It was quantified by fluorometry. As described above
Lee Prime Labeling Mix (Boehringer
Gel-purified DNA (100 ng) using Mannheim)
To 6.34 x 10⁸For specific activity of dpm / μg³²Labeled with P-dCTP
It was

^{The 32} P-labeled GZ4 probe was boiled for 10 minutes, then added to "minimal hyb" buffer (at 1 ng / ml), Southern blot membrane containing digested cosmid DNA fragment was added, and gently shaken at 50 rpm. The mixture was incubated at 60 ° C for 4 hours with stirring. The membrane was then washed 3 times at 25 ° C for about 5 minutes each (minimum hyb wash), followed by 2 washes at 60 ° C for 30 minutes each. The blot was exposed to film (using an enhancer screen) at -70 ° C for approximately 30 minutes. The GZ4 probe uses these two cosmids, 26A
It hybridized strongly to 5.0 kbp (apparent size) EcoR 1 fragments of both 5 and 25A10.

The radioactivity was stripped by boiling the membrane in 0.1X SSC + 0.1% SDS for about 30 minutes and the absence of radiolabel was checked by exposure to the film. It was then hybridized with the (denatured) TcaB _i probe for 3.5 hours at 60 ° C in the "minimal hyb" buffer previously used to screen colony membranes (above) and washed as above. And exposed to the film for 40 minutes at -70 ° C using two enhancer screens. In both cosmids, the TcaB _i probe had an E of approximately 5.0 kbp.
Lightly hybridizes with the coR 1 fragment and is approximately 2.9
It hybridized strongly with the kbp fragment.

A sample of the above cosmid 26A5 DNA (from DH5α cells) was used as the source of DNA from which the relevant band will be subcloned. 30μ of this DNA (2.5μg)
Approximately 3 units of EcoR I 1 over 1.5 hours in a total volume of 1
It was digested with (NEB) and confirmed by gel electrophoresis to obtain a partial digestion product. pBC KS (+) DNA (Stratagen) 10
20 μl of E in 20 μl total volume over 1.5 hours
Digestion with coR I 1 resulted in complete digestion as confirmed by electrophoresis. 50 μl of both EcoR I 1-cleaved DNA preparations in water
It was diluted to 1 and an equal volume of PCI was added to each, the suspension was gently mixed and spun in a small centrifuge and the aqueous supernatant was collected. The DNA was precipitated with 150 μl of ethanol and the mixture was left at −20 ° C. overnight. After centrifugation and drying, EcoR1 digested pBC KS (+) was dissolved in 100 μl of TE. Partially digested 26A5 was dissolved in 20 μl TE. DN
A recovery was checked by fluorometry.

PBC KS (+) DN digested with EcoR 1 in separate reactions
About 60 ng of A was ligated with about 180 ng or 270 ng of partially digested cosmid 26A5 DNA. Twenty ties were bound using T4 ligase and buffer from New England Biolabs.
Performed for 5 hours at 15 ° C. in a volume of μl. The ligation mixture diluted to 100 μl with sterile TE was used to transform frozen competent DH5α cells (Gibco BRL) according to the supplier's instructions. Different amounts (25-200 μl) of transformed cells were plated on freshly prepared solid LB-Cam ₃₅ medium containing 1 mM IPTG and 50 mg / l X-gal. Plate 3
Incubate at 7 ° C for about 20 hours, then cool in the dark for about 3 hours to enhance staining for insert selection.
Pick a white colony on a patch plate of the same composition, 37 ℃
Incubated overnight.

Two colony lifts of each of the selected patch plates were prepared as follows. After picking white colonies on a new plate, a circular Magna NT nylon membrane was pressed onto the patch plate, the membrane was lifted and subjected to denaturation, neutralization and UV crosslinking as described above for the library colony membrane. The cross-linked colony lift was washed vigorously, including gently wiping off excess cell debris with tissue. According to the "Min hyb" protocol, one set to form the GZ4 (tCAC) probe solution and hybrids, the other set to form the TCAB _i probe solution and hybrids followed as described for the library colony membranes And washed and exposed to film. GZ4
Probe only, both GZ4 probe and TcaB _i probe,
Alternatively, colonies showing hybridization signals with the TcaB _i probe alone were selected for further study and cells were streaked for single colony isolation in LB-Cam ₃₅ medium containing IPTG and X-gal as described above. Approximately 35 single colonies from 16 different isolates were picked into liquid LB-Cam ₃₅ medium and grown overnight at 37 ° C. Cells were harvested by centrifugation and plasmid DNA was isolated by standard alkaline lysis minipreps according to Maniatis et al. (Cited above, p. 368). The DNA pellet was dissolved in TE + 25 μg / ml ribonuclease A and the DNA concentration was measured by fluorometry. The EcoR 1 digestion pattern was analyzed by gel electrophoresis. The following isolates were collected as useful.
Isolate A17.2 contained only the religated pBC KS (+) and was used as the (negative) control. Isolates D38.3 and C44.1 each contain only the EcoR 1 fragment which hybridizes with 2.9 kbp TcaB _i inserted in pBC KS (+) respectively. pDAB
These plasmids, designated 2000 and pDAB2001, are shown in Figure 2, respectively.

Isolate A35.3 is approximately 5 kbp GZ4 inserted into pBC KS (+)
Contains only the EcoR 1 fragment that hybridizes with. This plasmid was called pDAB2002 (also shown in Figure 2). These isolates provided the template for DNA sequencing.

Plasmid pDAB200 using the BIGprep ^™ kit
0 and pDAB2001 were prepared. Culture (30 ml) with TB-Cam ₃₅
It was grown overnight to an OD ₆₀₀ of 2 and then the plasmid was isolated according to the manufacturer's instructions. 100 DNA pellets each
Redissolved in μl of TE and sample integrity checked by EcoR 1 digestion and gel electrophoresis analysis.

Sequencing reactions were run in duplicate, one repeat using pDAB2000 DNA as template and the other repeat using pDAB2001 DNA as template. Reactions were performed using the dideoxy dye terminator cycle sequencing method, as described above for GZ4 / HB14 DNA sequencing. In the initial sequencing experiment, the above-mentioned LacZ primer and T7 primer were used as primers, and the primer based on the determined sequence of + TcaB _i PCR amplification product (TH1 = ATTGCAG
ACTGCCAATCGCTTCGG, TH12 = GAGAGTATCCAGACCGCGGATGATC
TG) was used.

After alignment and compilation of each sequencing output, each was truncated to 250-350 bases depending on the integration of the chromatographic data as read by Perkin Elmer Applied Biosystems SeqEd 675 software. Subsequent sequencing "steps" were performed by selecting the appropriate sequence for the new primer. With a few exceptions, the primer (synthesized as above) had a 50% G + C composition and was 24 bases in length. Sequencing by this method was performed on both strands of the EcoR 1 fragment of approximately 2.9 kbp.

Plasmid DNA from isolate pDAB2002 was prepared with the BIGprep ^™ kit for further use as a template for DNA sequencing. Sequencing reactions were performed and analyzed as described above. Initially, T3 primer (pBS SK (+) base 774
−796: CGCGCAATTAACCCTCACTAAAG) and T7 primer (p
BS SK (+) base 621-643: GCGCGTAATACGACTCACTATAG)
Was used to initiate a sequencing reaction that reads from the flanking vector sequence to the insert DNA. Another set of primers (GZ4F: GTATCGATTACAACGCTGTCACTTCCC; TH13: GGGAAGTGAC
AGCGTTGTAATCGATAC; TH14: ATGTTGGGTGCGTCGGCTAATGGACAT
AAC; and LW-1-204: GGGAAGTGACAGCGTTGTAATCGATAC)
Were generated starting with internal sequences, which were previously determined by degenerate oligonucleotide-mediated sequencing of subcloned TcaC-peptide PCR products. From the data generated during the initial round of sequencing, a new set of primers was designed to walk through the full length of the approximately 5 kbp fragment (wa
lk). A total of 55 oligo primers were used to allow the identification of a total of 4832 bp of contiguous sequence.

When the DNA sequence of the EcoR 1 fragment insert of pDAB2002 was combined with a portion of the determined sequence of pDAB2000 / pDAB2001 isolates, a total of 6005 bp of contiguous sequence was generated (disclosed herein as SEQ ID NO: 25). When the long open reading frame was translated into the corresponding amino acid, the sequence revealed a TcaB _i N-terminal peptide (disclosed as SEQ ID NO: 3) encoded by bases 19-75 immediately after the methionine residue (start of translation). Shown in. There is a potential ribosome binding site (bases 1-9) upstream and TcaB _i -PT158 downstream.
An internal peptide (disclosed herein as SEQ ID NO: 19) is encoded by bases 166-128. Further downstream is in the same reading frame, at bases 1738-1773, a sequence encoding the TcaB _i -PT108 internal peptide (disclosed herein as SEQ ID NO: 20). Also, in the same reading frame,
At bases 1897-1923, the TcaB _ii N-terminal peptide (disclosed herein as SEQ ID NO: 5) is encoded and remains uninterrupted until the translation stop codon in open reading frame at nucleotides 3586-3588.

In between the start terminal and TCAB _ii coding region of the sequence encoding TcaB _i -PT108 - Frame lack of (in-frame) stop codon and the lack of ribosomal binding site which can be recognized immediately upstream of TCAB _ii coding region , The peptide TcaB _ii and
TcaB _i is encoded by a single open reading frame of 3567 bp beginning at base pair 16 in SEQ ID NO: 25, probably due to post-translational cleavage, resulting in a single 1189 amino acid (131,586 dalton; disclosed herein as SEQ ID NO: 26). It is shown to be derived from one primary gene product. If the amino acid immediately preceding the TcaB _ii N-terminal peptide corresponds to the C-terminal amino acid of the peptide TcaB _i , the predicted mass of TcaB _ii (627 amino acids) is S
Slightly higher than the size observed by DS-PAGE (68 kDa), 70,814 Daltons (disclosed herein as SEQ ID NO: 28). This peptide is a continuous stretch of 1881 base pairs (disclosed herein as SEQ ID NO: 27).
Will be coded by. The natural C-terminus of TcaB _i is Tca
It is considered to be slightly close to the C terminus of B _i -PT108. P
The molecular weight of T108 [3.438 kDa; measured during N-terminal amino acid sequence analysis of this peptide] predicts a size of 30 amino acids. Using the size of this peptide to direct the C-terminus of the TcaB _i coding region [Glu at position 604 of SEQ ID NO: 28], the induced size of TcaB _i was further consistent with experimental observations: 604 Measured to be amino acids or 68,463 Daltons.

Translation of the 1686 base pair TcaB _ii peptide coding region (disclosed herein as SEQ ID NO: 29) is of 562 amino acids (disclosed herein as SEQ ID NO: 30) with a predicted mass of 60,789 daltons. A protein was produced, which is in good agreement with the observed 61 kDa.

The potential ribosome binding site (bases 3633-3638) is tcaB
It is found 48 bp downstream of the stop codon in the open reading frame. Base 36
At 45-3677, the sequence encoding the N-terminus of the peptide TcaC (disclosed as SEQ ID NO: 2) is found. The open reading frame initiated by this N-terminal peptide continues uninterrupted up to base 6005 (2361 base pairs, disclosed herein as the first 2361 base pairs of SEQ ID NO: 31). Perfect
The gene (tcaC) encoding the TcaC peptide (apparent size about 165 kDa; about 1500 amino acids) will contain about 4500 bp.

Also, another isolate containing the cloned EcoR 1 fragment of cosmid 26A5, E20.6, was used to transform the GZ4 probe and TcaB _i
It was identified by its homology to the probe. Eco of DNA of plasmid (pDAB2004, Fig. 2) harbored by this strain
Agarose gel analysis of R 1 digests gives an estimated size of 2.9,
An insert fragment of 5 and 3.3 kbp was revealed. DNA sequence analysis, starting with primers directed from the sequence of plasmid pDAB2002, showed that the 3.3 kbp E of pDAB2004
5 kbp EcoR whose coR 1 fragment was represented by pDAB2002
It was revealed that it exists adjacent to one fragment. The 2361 base pair open reading frame found in pDAB2002 is pD.
It survives uninterrupted for another 2094 bases in AB2004 [disclosed herein as base pair 2362-4458 of SEQ ID NO: 31]. DNA sequence analysis using the parental cosmid 26A5 DNA as a template confirmed the open reading frame continuity.
In short, the open reading frame (TcaC SEQ ID NO: 31) contains 4455 base pairs and has 1485 amino acids [in the present specification, SEQ ID NO: 31].
Disclosed as 32] protein (TcaC). The calculated molecular size of 166,214 daltons is consistent with the predicted size of the TcaC peptide (165 kDa) and the derived amino acid sequence is
It exactly matches that disclosed for the TcaC N-terminal sequence [SEQ ID NO: 2].

The lack of the amino acid sequence corresponding to SEQ ID NO: 17, which was used to design the degenerate oligonucleotide primer pool in the discovered sequence, was due to isolates GZ4 and HB14 (these were used as probes in the initial library screen). Shows that the generation of the PCR product seen in Fig. 3) was accidentally caused by reverse strand priming with one of the primers in its degenerate pool. Furthermore, the derived protein sequence does not include the internal fragment disclosed herein as SEQ ID NO: 18. These sequences reveal that plasmid pDAB2004 contains the complete coding region for the TcaC peptide.

Example 9 Photolabdas of gene encoding TcbA _ii peptide
Screening the genomic library This example describes the method used to identify a DNA clone containing the gene encoding the TcbA _ii peptide, the isolation of that gene, and the determination of its partial DNA sequence.

TcbA _ii polypeptides of primers and PCR reaction insects active formulation is about 206KDa. The N-terminal amino acid sequence of this peptide is SEQ ID NO: 1.
Disclosed as. To encode a part of this amino acid sequence, four pools of degenerate oligonucleotide primers (“Forward primer”: TH-
4, TH-5, TH-6, and TH-7) were synthesized as described in Example 8 and are shown below.

In addition, to determine the primary sequence of the internal peptide preparation _{(TcbA ii -PT81) ( "a} ") and the secondary sequence ( "b"), respectively, herein disclosed as SEQ ID NO: 23 and SEQ ID NO: 24 . As shown below, four pools of degenerate oligonucleotides (“Re-vers (Re-vers)” were encoded to encode the reverse complement of the sequence encoding a portion of the peptide of SEQ ID NO: 23.
e) Primer ": TH-8, TH-9, TH-10 and TH-11)
Was similarly designed and synthesized.

  Performed using these primer sets in a PCR reaction
Genome Photorhabdus luminesen prepared in Example 6
W-14 DNA to TcbA_iiGene Fragmen that encodes
Amplified. AmpliWax^TMGems and other
Using the Perkin-Elmer reagent and protocol,
Perform all PCR reactions using "hot start" technology
It was Typically MgCl₂, DNTP, 10X GeneAmp PCR buffer
Mix solution II and primer mixture (total volume 11 μl)
Add to tube containing one wax bead [10X GeneA-mp
PCR Buffer II is 100 mM Tris-HCl, pH 8.3, and 500 mM
Including M KCl]. Heat the tube to 80 ° C for 2 minutes,
Cooled. 10X GeneA-mp on the wax seal PCR
Buffer II, DNA template, and AmpliTAq^* DNA polymerase
Was added. Melt and heat the wax seal
After mixing the components with ukule, the final reaction conditions (50 μl
Volume) is 10 mM Tris-HCl, pH 8.3, 50 mM KCl, 2.5
mM MgCl₂, 200 μM dATP, dCTP, dGTP, dTTP, 1.
25 mM single forward primer pool, 1.25 μM single forward primer pool
One reverse primer pool, 1.25 units AmpliTAq^* D
NA polymerase and 170 ng of template DNA.

The reaction solution was put in a thermocycler (the same as in Example 8), and an experiment was conducted according to the following program.

A series of amplifications was performed at three different annealing temperatures (55 ° C, 60 ° C, 65 ° C) using the degenerate primer pool. The reaction by annealing at 65 ° C had no visible amplification product after agarose electrophoresis.
Has an annealing regime of 60 ° C and has a primer TH-5 +
The reaction containing TH-10 yielded an amplification product with a mobility corresponding to 2.9 kbp. An even smaller amount of the 2.9 kbp product was produced under these conditions using the primers TH-7 + TH-10. When the reaction was annealed at 55 ° C., these primer pairs produced more product of 2.9 kbp and this product was produced by the primer pairs TH-5 + TH-8 and TH-5 + TH-11. An additional, very obscure 2.9 kbp band is the primer pair TH-7 + TH-8, TH-9, TH-10, or TH-
It was found in the lane containing the amplification product from 11.

To obtain sufficient PCR amplification products for cloning and DNA sequencing, 10 separate PCR reactions were set up using primers TH-5 + TH-10 and performed using the above conditions at an annealing temperature of 55 ° C. . Pool all reactions, 2.
The 9 kbp product was Qiae from an agarose gel as described above.
x Purified by extraction.

Additional sequences determined for the TcbA _ii internal peptide are disclosed herein as SEQ ID NO: 21 and SEQ ID NO: 22. Degenerate oligonucleotides (reverse primers TH-17 and TH-18) corresponding to the reverse complement of the sequences encoding part of the amino acid sequence of these peptides were prepared as described above.

Degenerate oligonucleotides TH-18 and TH-17 were used as template for Photolabdus luminescence W-14 DNA and 5 '
-TH-4, TH-5 as a (forward) primer,
It was used for amplification experiments using TH-6 or TH-7. These reactions amplified products of approximately 4 kbp and 4.5 kbp, respectively.
Transfer these DNAs from agarose gel to nylon membrane and
Hybridized with a ³² P-labeled probe (as described above) prepared from a 2.9 kbp product amplified with the H-5 + TH-10 primer pair. Both the 4 kbp and 4.5 kbp amplification products hybridized strongly to the 2.9 kbp probe. Using these results, as shown in FIG.
I made a map for regulating the TcbA _ii internal peptide sequence. The approximate distance between the primers is shown in Figure 3 in nucleotide numbers.

DNA sequence of the 2.9 kbp TcbA _ii- encoding fragment Purified 2.9 kbp fragment (prepared above) Approx. 20
0 ng was precipitated with ethanol and dissolved in 17 ml water. 25 pmol of TH-5 pool was used as a primer, half of which was used as a sequencing template and the other half was used as a template for TH-10 priming. The sequencing reaction is described in Example 8.
Was as shown in. The TH-10 primer pool was used to yield no reliable sequence. However, reaction with the TH-5 primer pool yielded the sequences disclosed below.

Based on this sequence, the sequencing primer (TH-21, 5 '
-CCGGGCGACGTTTATCTAGG-3 ') and designed complement base 120
Inverting the -139, 5 'end of the PCR fragment encoding TcbA _ii of 2.9kbp which was gel purified (i.e., TH-5 end) and polymerization was initiated towards. The determined sequence is shown below, compared with N-terminal peptide sequence determined biochemically of TcbA _ii SEQ ID NO: 1.

TcbA _ii 2.9kbp PCR fragment sequence confirmation [underlined amino acids = encoded by degenerate oligonucleotides] Due to the homology of the derived amino acid sequence to the biochemically determined amino acid sequence, the 2.9 kbp PCR fragment was identified as TcbA.
It is clear that this corresponds to the coding region. Then this
Photo Love prepared in Example 8 for cosmids containing the gene encoding TcbA _ii using 2.9kbp fragment as a hybridization probe Das W-14
The genomic library was screened.

Screening the Photorhabdus cosmid library The 2.9 kbp gel purified PCR fragment was labeled with ³² P using the Boehringer Mannheim high prime labeling kit as described in Example 8. Remnants (rem) of approximately 800 colonies from the cosmid library
nant) containing filters were screened as described above (Example 8) and positive clones were streaked for isolated colonies and rescreened. Three clones (8A11, 25G8, and 26D1) produced positive results with several screening and binding steps. Tc
Hybridization of bA _ii specific probe is four cosmids (these including tcaB gene and tcaC genes) identified in Example 8 was not observed in any of.
Restriction enzyme Bgl for DNA from cosmids 8A11, 25G8, and 26D1
2, digested with EcoR 1 or Hind 3 (alone or in combination with each other), fragments were separated on an agarose gel and transferred to nylon membranes as described in Example 8. The membrane was divided into 4.5 kbp fragments (primer TH-5 + TH-
Hybridized with a ³² P-labeled probe prepared from (generated by amplification of Photorhabdus genomic DNA by 17). The pattern generated from cosmid DNA 8A11 and 26D1 was identical to that generated with similarly cleaved genomic DNA for the same membrane. Cosmids 8A11 and 26D1 It is concluded is an accurate representative of the loci encoding genomic TcbA _ii. However, cosmid 25G8 is a genomic DN
It has a single Bgl 2 fragment slightly larger than A.
This may be due to the positioning of the insert within the vector.

DNA sequence of the gene encoding tcbA Membrane hybridization analysis of cosmid 26D1 showed 4.
A single large EcoR 1 fragment (9 kbp
Greater than) to form a hybrid. This fragment was gel purified and ligated into the EcoR 1 site of pBC KS (+) as described in Example 8 to generate plasmid pBC / S1 / R1. Using the procedure described in Example 8, the partial DNA sequence of the insert DNA of this plasmid was determined by "primer walking" from the flanking vector sequences. A further sequence was generated by extension from a novel oligonucleotide designed from the previously determined sequence. DNA sequence determined for the alternative identified tcbA gene (disclosed herein as SEQ ID NO: 11 as described in Example 12 below)
The complete homology was compared to nucleotides 1-272,3 when compared to
19-826, 2578-3036, and 3068-3540 (total base = 171
2) was seen. It was concluded that both approaches could be used to identify a DNA fragment encoding the TcbA _ii peptide.

Analysis of the Derived Amino Acid Sequence of the tcbA Gene The sequence of the DNA fragment identified as SEQ ID NO: 11 encodes the protein whose deduced amino acid sequence is disclosed herein as SEQ ID NO: 12. Some features are TcbA
_Demonstrate the identity of the gene as a sequence encoding the _ii protein. TcbA _ii N-terminal peptide (SEQ ID NO: 1: Phe I
le Gln Gly Tyr Ser Asp Leu Phe Gly Asn Arg Ala) is encoded as amino acids 88-100. TcbA _ii internal peptide TcbA _ii -PT81 (a) (SEQ ID NO: 23) has amino acid 1065
Encoded as _{-1077, TcbA ii -PT81 (b)} ( SEQ ID NO: 24) is encoded as amino acids 1571-1592. Furthermore, internal peptide TcbA _ii -PT 56 (SEQ ID NO: 22) is encoded as amino acids 1474-1488, internal peptide TcbA _ii
-PT103 (SEQ ID NO: 24) is encoded as amino acids 1614-1639. This gene is Photorhabdus luminescens
As isolated from an insecticide protein preparation of strain W-14
It is obvious that the authenticity of clones encoding TcbA _ii peptides.

The protein isolated as peptide TcbA _ii is derived from the cleavage of longer peptides. This evidence is TcbA
_ii Given by the fact that the nucleotide encoding the N-terminal peptide SEQ ID NO: 1 is preceded by a longer open reading frame of 261 bases (SEQ ID NO: 11), which encodes the 87 N-terminal proximal amino acid. This open reading frame corresponds to the N-terminal sequence of the large peptide TcbA and is referred to herein as SEQ ID NO:
The amino acid sequence disclosed as 16 Met Gln Asn Ser Leu
Start with a nucleotide encoding TcbA is thought to be the precursor protein for TcbA _ii .

Relationship between tcbA gene, tcaB gene, and tcaC gene tcaB gene and tcaC gene are closely related, and single mRNA
(Example 8). The tcbA gene is produced in a cosmid that clearly does not overlap with the cosmids harboring the tcaB and tcaC clusters. What if
This is because each genomic library screen identified different cosmids. However, with the tcbA gene
Comparison of the amino acid sequences encoded by the tcaB and tcaC genes reveals a substantial degree of homology. Amino acid conservation (protein alignment mode of MacVector ^™ sequence analysis software, scoring matrix pam250, hash value = 2; Kodak Scientific Imaging Systems, R-ochester, N
Y) is shown in FIG. Regarding the score line of each panel in FIG. 4, the upper carat (^) shows homology or conserved amino acid changes, and the lower carat (v) shows non-homology.

This analysis, amino acid sequence of the TcbA peptide from residues 1739 to 1894 is TCAB _i peptide 441-603 (P8
Of 627 amino acids of 162; SEQ ID NO: 28). In addition, the sequence of TcbA amino acids 1932-2459 amino acids of the peptide TcaB _ii 12-531 (of the total 562 amino acids
520; highly homologous to SEQ ID NO: 30). Considering that the TcbA peptide (SEQ ID NO: 12) contains 2505 amino acids, a total of 684 amino acids (27%) at its C-proximal end.
Is homologous to TcaB _i peptide or TcaB _ii peptide,
Its homology is co-linearly aligned with that of the putative TcaB preprotein (SEQ ID NO: 26). The sizeable gap in TcbA homology is the TcaB preprotein TcaB _i
It is consistent with the bond between the parts and TCAB _ii portions. Apparently, Tc
The bA and TcaB gene products are evolutionarily related, and it is proposed that they share some common functions in Photorhabdus.

Example 10 Characterization of Zinc-Metalloprotease in Photorhabdus Broth: Protease Inhibition, Classification, and Purification Protease Inhibition Assay and Classification Assay: Using FITC-casein (0.08% final assay concentration) dissolved in water as substrate, Protease assay was performed. Proteolytic reaction was carried out for 1 hour at 25 ° C. in an appropriate buffer containing 25 μl of Photorhabdus broth (total reaction volume 150
μl). Samples were also analyzed in the presence and absence of dithiothreitol. After incubation, an equal volume of 12% trichloroacetic acid was added to precipitate undigested protein. After 0.5 h of precipitation and subsequent centrifugation, 100 μl of the supernatant was placed in a 96-well microtiter plate and the pH of the solution was adjusted by addition of an equal volume of 4N NaOH. Proteolysis was then quantified using a Fluoroscan II fluorometric plate reader at excitation and emission wavelengths of 485 nm and 538 nm, respectively. Protease activity was tested in 0.5 unit increments over a pH range of 5.0-10.0. The following buffers were used at a final concentration of 50 mM: sodium acetate (pH 5.0-6.5); Tris-HCl (pH 7.0-8.
0); and bis-tris propane (pH 8.5-10.0). To identify one or more classes of proteases observed, crude broth was treated with various protease inhibitors (final concentration 0.5 μg / μl) and then tested for protease activity at pH 8.0 using the above substrates. . The protease inhibitors used were E-64 (L-trans-epoxysuccinylleucylamino [4-,-guanidino] -butane), 3,4-dichloroisocoumarin, leupeptin, pepstatin, amatatin, ethylenediaminetetraacetic acid (EDTA) and It contained 1,10 phenanthroline.

The protease assay performed over the pH range is
In fact, it was revealed that there is one or more proteases that show maximum activity at a pH of about 8.0 (Table 16). Addition of DTT did not affect protease activity. The crude broth was then treated with various protease inhibitors (Table
17). Treatment of crude broth with the above inhibitors is 1,10
It was shown that phenanthroline resulted in complete inhibition of total protease activity when added at a final concentration of 50 μg. IC ₅₀ is 5μ in 100μl of 2mg / ml crude broth solution
It was g. These data indicate that the most prevalent one or more proteases found in Photorhabdus broth are from the zinc-metalloprotease class of enzymes.

50-80 mM of 10-80% ammonium sulfate dialyzed as described in Example 5 for Photorhabdus toxin.
Zinc-metalloprotease isolation was performed by applying to Q sepharose crows equilibrated with Na ₂ PO ₄ , pH 7.0. After extensive washing, the toxin protein was eluted using a 0-0.5M NaCl gradient. Most of the biological activity and proteins were eluted with 0.15-0.45M NaCl. However, most of the proteolytic activity was 0.25-0.35M NaCl.
Present in the fraction with some activity of 0.15-0.35M N
It was observed to be present in the aCl fraction. 0.25
SDS PAGE analysis of the -0.35M NaCl fraction showed a major peptide band at approximately 60 kDa. The 0.15-0.25M NaCl fraction contained a similar 60 kDa band, but at a lower relative protein concentration. Subsequent gel filtration of this fraction using a Superose 12HR 16/50 column
By SDS PAGE analysis mainly (of total stained proteins
Greater than 90%) gave rise to a major peak migrating at 57.5 kDa, which included the 58.5 kDa band. Additional analysis of this fraction using the various protease inhibitors described above determined that the protease was a zinc-metalloprotease. Almost all of the protease activity present in Photorhabdus broth on the first day of fermentation corresponded to a zinc-metalloprotease of approximately 58 kDa.

W-14 Photorhabd grown for 3 days in a second isolation of one or more zinc-metalloproteases
Collect us broth, Schmidt, TM, Bleakley, B. and Ne
Protease activity was visualized using sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) combined with gelatin as described in alson, KM1988. SDS run gel (5.5 x 8cm), 0.1
Final Gelatin Concentration (% BioRad EIA Brand Reagent; Richmo
12.5% polyacrylamide (40% of acrylamide / bis-acrylamide) mixed with water after dissolving nd CA)
Stock solution; Sigma Chemical Co., St. Louis, MO).
SDS-stacking gels (1.0 x 8 cm) were made with 5% polyacrylamide also combined with 0.1% gelatin. Typically, 2.5 μg of the protein to be tested was diluted in 0.03 ml of SDS-PAGE loading buffer without dithiothreitol (DTT) and loaded on the gel. Protein
Electrophoresis was carried out in SDS running buffer (Laemmli, UK 1970, Nature 227, 680) at 0 ° C. and 8 mA. After electrophoresis is complete, the gel is allowed to react for 2.5 hours with 2.5% (v / v) Triton X.
Washed in -100. The gel is then allowed to stand for 1 hour 37
Incubated in 0.1 M glycine pH 8.0 at ° C. After incubation, the gel was fixed and stained with 0.1% Amido Black in methanol-acetic acid-water (30:10:60, vol./vol./vol .; Sigma Chemical Co.) overnight. Protease activity was visualized as a light area against a dark Amido Black stained background due to proteolysis and subsequent diffusion of the incorporated gelatin. At least three different bands were observed, generated by the proteolytic activity of 58kDa, 41kDa, and 38kDa.

Activity assays of different proteases in 3-day W-14 broth were performed using FITC-casein (0.02% final assay concentration) dissolved in water as substrate. Proteolysis experiments were performed at 37 ° C. for 0-0.5 h with different protein fractions in 0.1 M Tris-HCl (pH 8.0) in a total volume of 0.15 ml. The reaction was stopped by the addition of an equal volume of 12% trichloroacetic acid (TCA) dissolved in water. After 0.25 hour incubation at room temperature, the samples were centrifuged at 10,000 xg for 0.25 hour, removing 0.10 ml aliquots and placing in 96 well microtiter plates. Then add the solution to an equal volume of 2N
Neutralized by the addition of sodium hydroxide, followed by 48
Quantification was performed using a Fluoroscan II fluorometric plate reader at excitation and emission wavelengths of 5 nm and 538 nm. FITC-casein at different protease concentrations at 37 ° C
The activity measurement was carried out at 0-10 min. The unit of activity was arbitrarily defined as the amount of enzyme required to produce 1000 fluorescence units / min and the specific activity was defined as units per mg of protease.

Two zinc-metalloprotease inhibitors; 1,10
Inhibition studies were carried out using phenanthroline and N- (a-rhamnopyranosyloxyhydroxyphosphinyl) -Leu-Trp (phosphoramidone) to obtain a stock solution of the inhibitor dissolved in 100% ethanol and water, respectively. used.
Stock solution concentrations are typically 10 mg / ml and 5 mg / ml for 1,10 phenanthroline and phosphoramide, respectively,
The final concentration of inhibitor was 0.5-1.0 mg / ml per reaction. Treatment of W-14 crude broth on day 3 with 1,10 phenanthroline, an inhibitor of all zinc metalloproteases, resulted in the complete elimination of all protease activity, while the thermolysin-like protease (Weave
r, LH, Kester, WR, and Matthews, BW1977.J.Mol.Bio
l.114,119-132) treatment with the phosphoramidone inhibitor resulted in about a 56% reduction in protease activity. The residual proteolytic activity could not be further reduced with additional phosphoramide.

  Protease from W-14 Photorhabdus broth on day 3
Was purified as follows. Amicon M-12 Filtration Device
Amicon Helical Ultrafiltration Cartridge attached to
Using di-type S1Y100, concentrate 4.0 liters of broth
It was Amicon attached to Amicon M-12 filtration device
Using the spiral type ultrafiltration cartridge type S1Y100,
Flow-through with native protein less than 100 kDa
Material (3.8 L) was concentrated to 0.375 L. Retenate (rete
ntate) substances are proteins in the size range of 10-100 kDa
Was included. This material was washed with 10 mM sodium phosphate buffer.
Perceptive Bio equilibrated in buffer solution (pH 7.0)
System (Framington, MA) Poros 50HQ strong anion exchange
Pharmacia HR16 / 10 color packed with replacement packing
I loaded it into the mu. Load protein onto the column at a flow rate of 5 ml / min.
Fill, then A₂₈₀Wash unbound protein to = 0.00
It was Then use a NaCl gradient of 0-1.0M NaCl in 40 minutes.
The protein was eluted at a flow rate of 7.5 ml / min. Fraxio
Assayed for protease activity as above
The active fractions were pooled. Proteolytic activity
50% (v / v) of 10 mM sodium phosphate sodium phosphate
10 mM sodium phosphate diluted with sodium chloride buffer (pH 7.0)
Mounted on a Pharmacia HR10 / 10 Mono Q column equilibrated with
I filled it. Column A₂₈₀= 0.00 after washing with buffer,
Using a NaCl gradient of 0-0.5M NaCl over 1 hour
The protein was eluted at a flow rate of 2.0 ml / min. Fraction
Was analyzed for protease activity. Maximum amount of phospho
Fraction with luamiden-sensitive protease activity
(Phosphoramidon sensitive activity is
As for the 41 / 38kDa protease). these
Fractions elute in the range 0.15-0.25M NaCl
I understood it. It is also non-sensitive to the dominant phosphoramide
Fraction containing a sex protease activity, 58kDa pro
Thease was pooled. These fractions are 0.25−
It was found to elute in the range 0.35M NaCl. Then
The phosphoramide sensitive protease fraction,
Millipore Ultra Free −15 Centrifuge filter device
Place the final 0.75 ml using Biomax-5K NMWL membrane.
Concentrated to volume. This substance was added to 10 mM sodium phosphate.
Pharma equilibrated in buffer (pH 7.0) /0.1M NaCl
Pharma packed with Shea Sephadex G-50
A HR10 / 30 column was applied at a flow rate of 0.5 ml / min. Then
Has the highest phosphoramide sensitive protease activity
Pooled fractions, Millipore Ultra Free
-15 Centrifuge filter device Biomax -50K NM
It was centrifuged on a WL membrane. Proteolytic activity assay above
Indicates that this substance is a phosphoramide sensitive protease activity.
It was shown to have only sex. Phosphoramidon insensitive
A sex protease, a 58 kDa protein, was pooled, followed by
Te Millipore Ultra Free -15 Centrifuge filter
Equipment Biomax-50K NMWL Concentrate in membrane and
Further separation was carried out on a Shea Superdex-75 column. The
Fractions containing Rotase were pooled.

Analysis of the purified 58 and 41/38 kDa purified proteases showed that both types of proteases were completely inhibited by 1,10 phenanthroline, but only the 41/38 kDa protease was inhibited by phosphoramidon. Revealed. Further analysis of crude broth showed that the protease activity of W-14 broth on day 1 was 23% of the total protease activity due to the 41/38 kDa protease and W-14 on day 3
It was shown to increase to 44% with broth.

Routine SDS-PAGE analysis to test protein purity and obtain amino terminal sequences was purchased from Integrated Separation Systems (Natick, MA) 4.
Performed using a -20% gradient Milliplus Sepragels. Amino-terminal proteins to be sequenced were blotted onto PVDF membranes after purification (Problot ^™ membrane; Applied Biosystems, Foster City, CA), visualized with 0.1% amide black, excised and sequenced for sequencing. I sent it to Cambridge Prochem (Cambridge, MA).

58 kDa from W-14 broth after 3 days (SEQ ID NO: 4
The deduced amino-terminal sequences of the 5) and 41/38 kDa (SEQ ID NO: 44) proteases were DV-GSEKANEKLK (SEQ ID NO: 45) and DSGDDDKVTNTDIHR (SEQ ID NO: 44), respectively.

Sequencing of the 41/38 kDa protease reveals several amino termini, each with an additional amino acid that is proteolytically removed. 38kDa and 41kDa
Examination of the primary, secondary, tertiary and quaternary sequences for the polypeptide of Escherichia coli has allowed the deduction of the sequences shown above, revealing that these two proteases are homologous.

Example 11, Part A Screening of a Photorhabdus Genomic Library by Using Antibodies for the Gene Encoding the TcbA Peptide In parallel with the sequencing described above, suitable exploration and sequencing was performed.
TcbA and went based on _ii peptide (SEQ ID NO: 1). This sequencing was performed by preparing a bacterial culture broth as described in Examples 1 and 2 above and purifying the toxin.

Pho grown with genomic DNA in Grace's insect tissue medium
It was isolated from torhabdus luminescens strain W-14. Bacteria were grown in 250 ml Erlenmeyer flasks at 28 ° C. and 250 rpm in 5 ml medium for about 24 hours. Bacterial cells from 100 ml of medium were pelleted at 5000 xg for 10 minutes. Discard the supernatant and then remove the cell pellet from the genomic DNA.
Used for isolation.

Genomic DNA was isolated using a modification of the CTAB method described in Section 2.4.3 of Ausubel (supra). The section entitled "Large-scale CsCl prep of bacterial genomic DNA" was followed during step 6. At this point, an additional chloroform / isoamyl alcohol (24: 1) extraction was performed, followed by a phenol / chloroform / isoamyl (25: 24: 1) extraction step and a final chloroform / isoamyl alcohol (24: 1) extraction. went. DNA was precipitated by the addition of 0.6 volume of isopropanol. Hook the precipitated DNA, wrap it around the end of a bent glass rod, and use it as the final washing solution.
It was rapidly immersed in 70% ethanol and dissolved in 3 ml of TE buffer.

The DNA concentration estimated by optical density at 280/260 nm was about 2 mg / ml.

A library was prepared using this genomic DNA.

About 50 μg of genomic DNA was partially digested with Sau3A1. Then N
The partially digested DNA fragments were size fractionated using aCl density gradient centrifugation. Fractions containing DNA fragments with an average size of 12 kb or more as determined by agarose gel electrophoresis were ligated to the plasmid BluScript (Stratagen, La Jolla, california) and E. coli D
It was transformed into H5α or DHB10 strain.

Separately, a purified aliquot of the protein was sent to the Biotechnology Hybridoma Center at the University of Wisconsin (Madison) for production of monoclonal antibodies to the protein. The material delivered was an HLPC purified fraction containing natural bands 1 and 2 denatured at 65 ° C., 20 μg of which was injected into each of 4 mice.
Stable monoclonal antibody-producing hybridoma cell lines were harvested after fusing spleen cells from unimmunized mice with stable myeloma cell lines. Monoclonal antibody was recovered from the hybridoma.

Alternatively, native agarose gel purified Band 1 (see Example 1) was harvested to raise polyclonal antibodies, which protein was then used to immunize New Zealand white rabbits. The protein was prepared by excising the band from a native agarose gel, rapidly heating the gel pieces to 65 ° C to melt the agarose and immediately emulsifying with an adjuvant. Freund's complete adjuvant was used for the primary immunization, and Freund's incomplete adjuvant was used at 1-month intervals.
Used for one additional injection. About 0.2 for each injection, emulsified band 1 containing 50-100 micrograms of protein
ml was delivered to the back of the rabbit by multiple subcutaneous injections. Serum was obtained 10 days after the first injection and additional blood draws were performed weekly for 3 weeks. Serum complement was inactivated by heating at 56 ° C for 15 minutes and then stored at -20 ° C.

The monoclonal and polyclonal antibodies were then used to screen a genomic library for expression of epitope-detectable antigens. Positive clones were detected by nitrocellulose filter colony lift. An immunoblot analysis of positive clones was tried.

Analysis of clones identified by both immunoblot and Southern analysis led to a preliminary analysis of the five classes of clones.

In the first class of clones, there is a gene encoding a peptide referred to herein as TcbA _ii. The complete DNA sequence (TcbA) of this gene was obtained. It is shown as SEQ ID NO: 11. Confirmation that the sequence encodes the internal sequence of SEQ ID NO: 1 is demonstrated by the presence of SEQ ID NO: 1 at amino acid number 88 from the deduced amino acid sequence generated by the open reading frame of SEQ ID NO: 11. This can be confirmed by reference to SEQ ID NO: 12, which is the deduced amino acid sequence generated by SEQ ID NO: 11.

The second class of toxin peptides is TcaB _i , TcaB _ii and TcaC.
And the segments mentioned above. After screening the library with a polyclonal antiserum, this second class of toxin genes was identified by several clones producing proteins of different sizes, all of which cross-reacted with the polyclonal antibody on the immunoblot and also on the Southern blot. Were found to share DNA homology.
Sequence comparison revealed that they belonged to a gene complex called TcaB and TcaC above.

Also, three other classes of antibody toxin clones were isolated with a polyclonal screen. These classes produced proteins that cross-react with polyclonal antibodies and also shared DNA homology with these uras as determined by Southern blotting. These classes have been designated as Class III, Class IV and Class V. It was also possible to identify monoclonals that cross-reacted with classes I, II, III and IV. This suggests that all have regions of high protein homology. Thus, the P. luminescens extracellular protein genes represent a family of evolutionarily related genes.

To further advance the concept that there may be evolutionarily relevant changes in the toxin peptides contained in this organism,
Two approaches were tried to test other strains of P. luminescens for the presence of related proteins. This was done both by PCR amplification of genomic DNA and immunoblot analysis using polyclonal and monoclonal antibodies.

The results show that the related proteins are P. luminescens strain WX-2, W
X-3, WX-4, WX-5, WX-6, WX-7, WX-8, WX
It is shown to be produced by -11, WX-12, WX-15 and W-14.

Example 11, Part B Sequence and Analysis of Class III Toxin Clones-tcc Further DNA sequencing was performed on plasmids isolated from the Class III E. coli clones described in Example 11, Part A. The nucleotide sequence was shown to be an open reading frame with three near junctions at this genomic locus. This locus is called tcc, and the three open reading frames are tccA SEQ ID NO: 56, tccB SEQ ID NO: 58 and tccC SEQ ID NO: 60.
(FIG. 6B).

The deduced amino acid from the tccA open reading frame has its gene
It shows that it encodes a protein of 105,459 Da. This protein was designated as TccA. The first 12 of this protein
Amino acids were previously identified as part of the toxin complex,
It is compatible with the N-terminal sequence obtained from the 108 kDa protein, SEQ ID NO: 7.

This gene is the deduced amino acid from the tccB open reading frame.
It shows that it encodes a protein of 175,716 Da. This protein was designated as TccB. The first 11 of this protein
Amino acids are proteins with an estimated molecular weight of 185 kDa,
Compatible with the N-terminal sequence obtained from SEQ ID NO: 8.

The deduced amino acid sequence of tccC has 111,69
It was shown to encode a 4DA protein and the protein product was designated TccC.

Example 12 Characterization of Photorhabdus Strains To verify that the collections described herein contain Photorhabdus strains, these strains were Photorhabdus strains.
It is a characteristic of us, and it is used in other Enterobacteriaceae and Xenorhabudas spp. (Farmer, JJ1984.Bergey's Manual
of Systemic Bacte-riology, Vol. 1, pp. 510-511 (Kreig
Edited by NR, Holt, and JG.) Williams & Wilkins, Baltimor
e .; Akhurst and Boemare, 1988, Boemare et al., 1993) for recognition of recognized microbiological traits. These characteristic traits are as follows. Gram stain negative rod, 0.5-2 μm wide and 2-10 μm long organism size, red / yellow colony staining, presence of crystalline inclusion bodies, presence of catalase, inability to reduce nitrate, presence of bioluminescence, growth medium The ability to absorb dyes from, positive for protease production, growth temperature range below 37 ° C, survival under anaerobic conditions and aggressive motility (Table 18). Standard Escherichia coli strain, Xenoravdas strain and Phot
The orhabdus strain was included in all trials for comparison. The overall results are consistent with all strains being part of the Enterobacteriaceae and Photorhabdus genera.

  Prove the bioluminescence of each strain using a luminometer
And a quantitative and relative measurement of color development was obtained. Relative luminescence
For unit measurement, broth (cell and
And the culture medium) in the culture solution at three time intervals (6, 1).
2 and 24 hours) and background brightness (not
(Inoculation medium and water). From various broths
Use a sipper cell before measuring luminescence.
Ruford Systems (Ob-erlin, OH) Spectrometry
Cells by measuring the absorbance (560 nM) in a filter
Confirmed the density. Then dilute appropriately before measuring lightness
Was performed (to normalize the optical density to 1.0 unit). Next
Aliquots of broth diluted with cuvettes (each
Bio-Orbit 1251 Luminome
Read in the data (Bio-Orbit Oy, Twiku, Finland)
It was The integration time for each sample was 45 seconds.
It was Mix samples continuously (cuvette with baffle
It was spun in), and in the meanwhile read the enzyme utilization
Obtained. Positive test 5 times background luminescence
The above is decided (about 5-10 units). In addition,
-Detect the brightness with a photographic film overlay and
It was detected visually after fitting. Gram stain characteristics of each strain
Gram stain control slide (Fischer
Used with Scientific, Pitts-burgh, PA)
Commercial Gram stain kit (BBL, Cockeysville, MD)
I confirmed with. Then Zeiss microscope (Carl Zeiss, German
y) 100X oil immersion objective lens (10X eyepiece magnification and 2X body)
Microscopic evaluation was performed using (magnification). Organism size, fine
Cell description and inclusion bodies (inclusion bodies after logarithmic growth)
Microscopic examination of individual strains, wet mounting by oil immersion
Slide (10X eyepiece magnification, 2X body magnification and 40X objective magnification)
And phase contrast microscope (Akhurst, R.
J. and Boemare, N.E. 1990.Entomopathogenic Nematodes
in Biological Control (edited by Gaugler, R. and Kaya, H.)
Vol. 75-90. CRC Press, Boca Raton, USA .; Baghdi-gu
ian S., Boyer-Giglio M.H., Thaler, J.O., Bonnot G., Boe
mare, N.1993.Biol.Cell 79,177-185).
It was Bactos prepared by labeling the colony stain
Contact with nutrient agar (Difco Laboratories, Detroit, MI)
Observed after seeding. Incubation occurs at 28 ° C,
The description occurred after 5-7 days. The existence of the enzyme catalase
Colonies of the test organisms for nutrient agar plating.
Remove from rate with a small plug, bottom of glass test tube
I put it in. 1 ml of household hydrogen peroxide solution with the side of the tube down
Added gently. Air bubbles (presumably oxygen)
Scored a positive reaction when they appeared within 5 seconds. In addition,
Controls of inoculated nutrient agar and hydrogen peroxide solution were tested. Glass
Back each culture to test for acid reduction.
Tonitrate Broth [Zifco Laboratories, Detro
It, MI] 10 ml was inoculated. Incubation for 24 hours at 28 ℃
Nitrite formation after treatment with 2 drops of sulfanilic acid reagent
And by adding 2 drops of α-naphthylamine reagent.
(Jifco Manual, 10th edition, Zifco Laboratory
, Detroit, MI, 1984). Clear pink
The occurrence of red or red indicates the production of nitrite from nitrate.
The ability of each strain to absorb the dye from the growth medium is determined by the dye
Bactor MacConkey agar, including Toral Red; colors
Bacto Tajtor containing elemental bromothymol blue
-7 Bacto EMB agar containing agar and pigment Eosin-Y
(Zifco Laboratories, Detroit, MI agar, all
Prepared according to label instructions). these
Dye inoculation at 28 ° C for 5 days.
Recorded after bastion. In these latter media
Growth is characteristic of members of the family Enterobacteriaceae. Movement of each stock
Bacter mobility test prepared according to label instructions
A solution of culture medium (Difco Laboratories, Detroit, MI)
Tested using. Butt-stab inoculation
With each strain and motility from the inoculum line
It was judged macroscopically by the diffusion zone of spreading growth. Many
In case of motility, also culture under wet mounting slides
The liquid was observed with a microscope. Biochemical prosperity of each strain
The nutritional evaluation is based on BBL Enterotube II (Benton,
Nson, Germany). Incubation
Followed the product instructions except for 5 days at 28 ° C. Conclusion
The result is consistent with the earlier cited paper on Photorhabdus. The
The production of lotease was performed according to the label instructions.
Gelatin (Difco Laboratories, Detroit, MI)
Observing gelatin hydrolysis using plates
Tested by. Inoculate culture and plate at 5 ° C for 5
Incubated for days. Evaluation of growth at different temperatures
To value, agar plate [2% tap in deionized water
2% proteo containing agar (Difco, Detroit, MI)
Strepkin from a common source of inoculum
I'm sorry Nesco the plate Seal with film, 3 weeks
Incubate at 20 ° C, 28 ° C, and 37 ° C for up to
did. Plates that show no growth at 37 ° C are incubated at 28 ° C.
No cell viability after 1 week transfer to beta
It was The enzyme requirements for Photorhabdus strains were tested using the following method.
I tried Liquid thioglycollate broth medium (Difco,
Detroit, MI) was vaccinated with vat-stub. Tube
Incubate at room temperature for 1 week, then culture the growth type
And the degree. Indicator resazurin is a medium acid
Indicates the level of aging or the aerobic zone (Zifco Mani
Manual, Vol. 10, Zifco Laboratories, Detroit, M
I). Growth strains obtained for the tested Photorhabdus strains
The lane results are consistent with those of the conditionally anaerobic microorganisms.

Cellular fatty acid analysis is an accepted tool for bacterial characterization at the genus and species level (Tornabene, T. et al.
G.1985.Lipid Analysis and the Relationship to Chem
otaxonomy in Methods in Microbiolgy, Volume 18, 209-21
4 .; Goodfellow, M. and O'Donnell, AG1993.Roots of Ba
cterial Systematics in Handbook of New Bacterial S
ystematics (edited by Goodfellow, M. and O'Donnell, AG)
Page 3-54 London: Academic Press Ltd. (these references are hereby incorporated by reference), and were used to confirm that our collection is genus-level relevant. Microbial culture ID (MIDI, Newark, DE, USA)
Shipped to an external contract laboratory for fatty acid methyl ester analysis (FAME) using the Microbial Identification System (MIS). MI
The S system consists of a Hewlett Packard HP5890A Gas Chromatograph equipped with a 25 mm x 0.2 mm 5% methylphenyl silicone quartz silica capillary column. Using hydrogen as the carrier gas, the flame ionization detector works in cooperation with the autosampler, integrator and computer. The computer compares the sample fatty acid methyl ester to a microbial fatty acid library and a calibrated mixture of known fatty acids. Strains were assayed at 28 ° C in trypticase soy agar prior to analysis as selected by contract laboratories.
It grew for 24 hours. Sample extraction was performed by contract laboratories according to conventional FAME methods. Lu other than Photorhabdus
There was no direct strain identification for the minescens bacterial group. When performing cluster analysis, which compares the fatty acid profiles of groups of isolates, strain fatty acid profiles were related at the genus level.

The evolutionary diversity of Photorhabdus strains in our collection was tested by PCR using genomic DNA from each strain.
(Polymerase chain reaction) Determined by analysis of mediated genomic fingerprinting. This technology is based on a family of repetitive DNA sequences present in the genomes of various bacterial species (Versalovic, J., Schneider, M., DE Brui
jn, FJ and Lupski, JR1994.Methods Mol.Cell.Biol.,
5,25-40). It is considered that these three elements, the repetitive extra-palindrome sequence (REP), the intestinal bacterial repetitive intra-gene consensus (ERIC) and the BOX element play important roles in the organization of the bacterial genome. Genomic organization is thought to be shaped by selection, and the differential distribution of these elements within the genome of closely related bacterial strains can be used to distinguish these strains (eg, Louws, FJ, Fulbright, DW, Stephens, CT and DE
Bruijn, FJ1994.Appl.Environ.Micro.60,2286-229
Five.). Rep-PCR uses oligonucleotide primers complementary to these repetitive sequences to amplify variable size DNA fragments between them. The resulting products are separated by electrophoresis to establish a DNA "fingerprint" for each strain.

  To isolate genomic DNA from our strain,
Cell pellets in TE buffer (10 mM Tris-HCl, 1 mM EDT
A, pH 8.0) resuspended in a final volume of 10 ml, then 5M
12 ml of NaCl was added. This mixture at 15,000 x g for 20 minutes
And then centrifuged. The resulting pellet is re-prepared in 5.7 ml TE.
Suspend, 300 μl 10% SDS and 20 mg / ml proteinase
Use K (Gibco BRL Products, Grand Island, NY) 60μ
1 was added. Incubate the mixture at 37 ° C for 1 hour.
And then add about 10 mg of lysozyme and mix the mixture.
Incubated for an additional 45 minutes. Then 1 ml of 5M NaCl
And CTAB / NaCl solution (10% w / v CTAB, 0.7M NaCl) 800
μl was added and the mixture was gently stirred at 65 ° C. for 10 minutes.
Incubate with gentle agitation, then for another 20 minutes
Incubate and stir to clear cell material
Helped. Equal volume of chloroform / isoamyl alcohol
Solution (24: 1, v / v), mix gently and then
It was centrifuged at. Then two extractions of equal volume of pheno
L / chloroform / isoamyl alcohol (50: 49: 1)
Was performed using. 0.6 volume of genomic DNA isopropano
It was precipitated with Remove the precipitated DNA with a glass rod and
% Ethanol, washed twice, dried, STE (10 mM
Tris-HCl, pH 8.0, 10 mM NaCl, 1 mM EDTA) 2 ml
I understand. Then quantify the DNA by optical density at 260 nm.
did. Perform rep-PCR analysis of Photorhabdus genomic DNA
For this purpose, the following primers were used. REP1R-I; 5'-III
ICGICGICATCIGGC-3 'and REP2-I; 5'-ICGICTTATCIGGCC
TAC-3 '. Perform PCR using the following 25 μl reaction mixture
It was 7.75 μl H₂O, 2.5 μl of 10X LA buffer (Pan Bera
・ Corporation, Madison, WI), 16μl dNTP mix
(Each 2.5 mM), 1 μl of each primer (50 pM / μ
l) 1 μl of DMSO, 1.5 μl of genomic DNA (0.075-0.4
80 μg / μl range) and 0.25 μl Takara EX Taq
(Pan Bella Corporation, Madison, WI). Below
PCR amplification using the conditions Perkin-Elmer DNA Therma
It was performed in Le Cycler (Norwalk, CT). 95 ℃ / 7 minutes,
Then 94 ° C / 1 min, 44 ° C / 1 min, 65 ° C / 8 min, followed by 65 ° C for 15 min
35 cycles per minute. After cycling, 25 μl of reaction mixture was applied to 6X gel.
Loading buffer (H₂0.25% bromophenol blue in O, 4
5% of 0% w / v sucrose) was added. Then 1 of 15x20cm
% Agarose gel with 8 μl of each reaction
In E buffer (0.09M Tris-borate, 0.002M EDTA)
I experimented with. The gel was run at 45v for about 16 hours. Then get
Dyed in 20 μg / ml ethidium bromide for 1 hour.
Color and destain in TBE buffer for approximately 3 hours. Next
Ide Gel Polaroid The photos were taken under UV irradiation.

The presence or absence of a band of a specific size for each strain is scored from the photographs, and a numerical taxonomy software program, NTSYS-pc (Exeter Software, Set
auket, NY) as a similarity matrix. Controls of E. coli strain HB101 and Xanthomonas oryzae pv.oryzae evaluated simultaneously were published papers (Versalovic, J., Koeuth.T. And Lup.
ski, JR1991.Nucleic Acids Res. 19,6823-6831; Vera
Cruz, CM, Halda-Alija, L., Louws, F., Skinner, DZ, Ge
orge, ML, Nelson, RJ, DE Bruijn, FJ, Rice, C. and Le
ach, JE1995.Int.Rice Res.Notes, 20,23-24; Vera Cru
z, CM, Ardales, EY, Skinner, DZ, Talag, J., Nelson,
RJ, Louws, FJ, Leung, H., Mew, TW and Leach, JE199
6. A PCR "fingerprint" was generated that matched the Phytopathology (each in printing). Then the data from Photorhabdus strain is a series of programs in NTSYS-ps; SIMQUAL
The similarity coefficient (using the Jacquard coefficient) and the SAHN (continuous cohesive Heirarchical and nesting)
d)) gave a matrix of clustering [using UPGMA (unweighted pair-group method by arithmetic mean) method], which groups related strains and can be represented as a phenogram (Fig. 5). The COPH (cophenetic value) program and the MXCOMP (matrix comparison) program were used to generate a cophenetic value matrix and compare the correlation between this and the initial matrix on which the clustering is based. The resulting standardized Mantel statistic (r) is produced, which is a measure of the goodness of fit of the cluster analysis (r = 0.8-0.9 represents a very good fit). In our case, r is 0.919.
Therefore, our collection contains a diverse group of easily distinguishable strains representative of the genus Photorhabdus.

Example 13 Insecticidal Utility of One or More Toxins Produced by Different Photorhabdus Strains Initial "seed" cultures of different Photorhabdus strains were prepared from 2
% Proteose Peptone # 3 (PPS) (Difco Laboratories, Detroit, MI)
It was generated by inoculating the primary mutant subclone in 500 ml of three baffled flasks with a Delong mouth covered with ut). The inoculum of each seed culture was derived from oil-overlay agar slant cultures or plate cultures. After inoculation, these flasks were placed on a rotary shaker for 16 hours at 28 ° C for 150 r.
Incubated at pm. These seed cultures were then used as a uniform inoculum for a given fermentation of each strain. In addition, post-log phase seed cultures were overlayed with sterile mineral oil, sterile magnetic stir bars were added for future resuspension, and the cultures were stored in the dark at room temperature to inoculate the toxin-responsive state. Got a long-term storage of. The production broth was inoculated by adding 1% actively growing seed culture (eg 1.75 ml per 175 ml fresh medium) to 2% fresh PP3 medium. Broth production occurred in three 500 ml baffled flasks (see above) or in a 2800 ml baffled convex bottom flask (500 ml volume) covered with a silicone foam closure. The production flask was incubated under the above conditions for 24-48 hours. After incubation the broth should be sterile
Dispense into 1 L polyethylene bottles, at 10 ℃ for 1 hour
Spin at 2600 xg and decant from cell and debris pellets. Then add liquid broth to Waman GF / D (2.7μ
M retention) and GF / B (1.0 μM retention) glass filters were vacuum filtered to remove debris. Further broth clarification was obtained on a tangential flow microfiltration unit (Paul Filtron, Northborough, MA) using a 0.5 μM open-channel filter. If required, additional clarification could be obtained by cooling the broth (to 4 ° C) and centrifuging at 2600 xg for several hours. After these manipulations, the broth was filter sterilized using a 0.2 μM nitrocellulose membrane filter. The sterile broth is then used directly in biological assays, biochemical analysis, or with M12 at 10,000 MW cut-off.
Ultrafiltration device (Amicon, Beverly MA) or 10,000MW
Centrifugal concentrator with pore size (Millipore, Bedfor
d, MA and Paul Filtron, Northborough, MA). In the case of a centrifuge concentrator, the broth was spun at 2000 xg for about 2 hours. 10,000 MW of permeate was added to the corresponding retentate to obtain the desired concentration of components greater than 10,000 MW. Heat inactivation of the treated broth sample was obtained by heating the sample at 100 ° C. in a sand-filled heating block for 10 minutes.

One or more broths and one or more toxin complexes from different Photorhabdus strains are beneficial in reducing insect populations and apply an effective insect-inactivating amount of the active listed substances to insect loci It was used in a method of controlling insect populations, including: Photorha fermented as above
A demonstration of the range of insecticidal activity observed from broths of selected groups of bdus strains is shown in Table 19. It is possible that additional insecticidal activity can be detected in these strains by increasing concentrations of broth or by using different fermentation methods. Consistent with the activity associated with the protein, the insecticidal activity of all strains tested was thermolabile (see above).

One or more culture broths from different Photorhabdus strains show different insecticidal activity (mortality and / or growth inhibition, reduced adult development) against several insects. More specifically, its activity is corn rootwor
m) larvae and boll weevil larvae, which are members of the order Coleoptera. Other members of Coleoptera include click beetle larvae, pollen beetles, flea beetles,
Seed beetles and Colorado potato beetles are mentioned. Also, activity was observed against aster leafhoppers and corn plant hoppers, which are members of the order Homoptera. Other members of Homoptera include planthopper, pear psylla and apple football (app
le sucker), scale insect, whitefly, spit
Bags (spittle bugs) as well as a number of host-specific aphid species are mentioned. Also, broth and one or more purified toxin complexes are tobacco budworm, tobacco hornworm and European corn borer (these are members of the Lepidoptera). ) Is active against. Other typical members of this eye are the beet armyworm, cabbage loop.
ooper), black cutworm,
Corn earworm, codling moth, squid, Indian mealmoth, leaf beetle, aphid, cotton bollworm, bollworm, Eastern tent caterer
pillar), sod webworm and fall armyworm.
Also, activity is found against fruit fly and mosquito larvae, which are members of the order Diptera. Other members of the Gyptera are pea midge, carrot fly, cabbage root fly, turn root.
ipr-oot fly), onion fly, crayfish and housefly and various mosquito species. In addition, activity by one or more broths and one or more toxin complexes was seen against two-spot spider mites, which were
arina), a member of the order Strawberry spider mite, broad mites, Citrus red mite, European red mite, Pier last.
Includes pear rust mite and tomato russet mite.

The activity against corn rootworm larvae was tested as follows. One or more Photorhabdus culture broth (0-15 times concentrated, filter sterilized), 2% proteose peptone # 3, one or more purified toxin complex [0.23mg
/ ml] or 10 mM sodium phosphate buffer, pH 7.0 40
Artificial diet in aliquots of μl (Rose, RI and McCabe, J.
M. (1973). J. Econ. Entomol. 66, (398-400)) was applied directly to the surface (about 1.5 cm ² ). The toxin complex was diluted in 10 mM sodium phosphate buffer, pH 7.0. Meal plates were air-dried in a sterile flow-hood and wells were incubated with a single neonatal diablotica
Undecim Puncuta Tawaraj (Diabrotica undecim
punctata howardi) (Southern corn rootworm (SCR)). The plates were sealed, placed in a moisturizing growth chamber and kept at 27 ° C for an appropriate period (3-5 days). Mortality and larval weight measurements were then scored. Generally, 16 insects per treatment were used for all studies. Control mortality was generally less than 5%.

Ball Weeville (Anthomonas Granges (An
thomonas grandis) was tested as follows. Concentrated (1 to 10 times) Photorhabdus broth, control medium (2% proteose peptone # 3), one or more purified toxin complex [0.23 mg / ml] or 10 mM sodium phosphate buffer, pH 7.0 60 μl In an aliquot of an artificial diet (Stoneville Yellow Lepidopteran (Stonevil
le Yellow lepidopteran) food) applied on the surface of 0.35g,
Dried. A single 12-24 hour Ball Weeville larva was placed in the diet, the wells were sealed, and 5% at 25 ° C and 50% RH.
I kept it for days. Mortality and larval weight were then assessed. Control mortality ranged from 0 to 13%.

The activity against mosquito larvae was tested as follows. The assay was performed in 96 well microtiter plates. Each well contained 200 μl of aqueous solution (one or more 10-fold concentrated Photorhabdus culture broth, control medium (2% proteose peptone # 3), 10 mM sodium phosphate buffer, one or more toxin complex 0.23 mg / ml. Or H ₂ O) and about 20 postnatal larvae (Aedes aegypti (Ae
des aegypti)) was included. There were 6 wells per treatment. Results were read 3-4 days after occurrence. Control mortality was 0-20%.

The activity against fruit fly was tested as follows. 50
% Dry medium and 50% water, control medium (2% proteose peptone # 3), one or more 10-fold concentrated Photor
habdus culture broth, one or more purified toxin complex [0.23
mg / ml] or 10 mM sodium phosphate buffer, pH 7.0, purchased Drosophila melanogaster (Dr
osophila melanogaster) medium was prepared. Dry medium 4.0
This was done by placing ml in each of three growth vials per treatment and adding 4.0 ml of the appropriate liquid. Then 10 late-instar Drosophila melanogaster maggots were added to each 25 ml vial. The vials were kept on a laboratory bench at room temperature under fluorescent ceiling lights. Puppies or adult counts were made 15 days after exposure. Adult development was compared to water and control medium (0-16% reduction).

  Adult Aster Leaf Hopper (Macro Stealth
Bellini (Macrosteles severini) and corn plan
Tohopper larvae (Peregrinus peregrinus)
 maidis)) activity without any other external contact
Ingestion assets designed to allow the intake of active substances
Tested in b. 35X10mm pool of active substance / "food" solution
By making two holes in the center of the bottom of the Petri dish
to make. 2 inch Parafilm M Square on top of dish
Across and secure with the "Q" ring. Then 1 on
About 7 hoppers in a plastic cup
And place the reservoir on top of the cup with Parafilm down. Next
Then add the test liquid through the holes to the reservoir. 10 times concentrated one
For tests using more than one Photorhabdus culture broth
Broth and control medium (2% proteose pep
Ton # 3) in 10 mM sodium phosphate buffer, pH 7.0
Dialyze against and add sucrose (up to 5%) to the resulting solution
The control mortality rate was reduced. Also, one or more purified toxins
Complex [0.23 mg / ml] or 10 mM sodium phosphate buffer
The buffer, pH 7.0, was tested. Mortality is reported on day 3.
Assay incubator at 28 ° C, 70% RH with 16/8 light period
-Keep it inside. Assay 72 hours for mortality
I attached it. Control mortality was less than 6%.

The activity against lepidoplatin larvae was tested as follows. One or more concentrated (10x) Photorhabdus culture broth, control medium (2% proteose peptone #
3), one or more purified toxin complex [0.23mg / ml] or 1
Ordinary artificial lepidopteran diet (Stoneville.RTM.
It was applied directly to the surface of the (yellow food) (about 1.5 cm ² ). Food plates were air dried in a sterile flow-hood to generate single neonatal larvae. European Corn Borer (Ostrinia nubilali
s)) and tobacco hornworms (Manduca sexta) obtained from commercial sources and hatched in the house, while tobacco budworms (Heliogis
Heliothis virescens larvae were supplied internally. After the larvae have developed, the food plate is sealed and placed in a moisturizing growth chamber for a suitable period of time.
Keep in the dark at 27 ° C. Mortality and weight measurements were scored on day 5. Generally, 16 insects per treatment were used for all studies. Control mortality generally ranged from 4 to 12.5% for control media and less than 10% for phosphate buffer.

2 Spotted spider mites (Tetranikas urticae (Tetran
ychus urticae)) was tested as follows. Trim young pumpkin plants into single cotyledons,
One or more 10-fold concentrated broth, control medium (2% proteose peptone # 3), one or more purified toxin complex [0.
23 mg / ml] or 10 mM sodium phosphate buffer, pH 7.0
It was made to spray and was made to flow down. After drying, the plants were allowed to develop a mixed population of spider mites and were kept at experimental temperature and humidity for 72 hours. Viable mites were then counted to determine the level of control.

Example 14 Non-W-14 Photorhabdus strain: Purification, characterization and activity spectra Refining   The following protocol was developed for purification of W-14
Bioassay (see Example 13).
Southern Call Rootworm (SC)
R) is the most active fraction.
Was established on the basis of. Typically described in Example 13.
Receive 4-20L of filtered broth
Amicon attached to Amicon M-12 filtration device
Concentrate using spiral type ultrafiltration cartridge type S1Y100
did. The retentate is a heaven with a molecular size greater than 100 kDa.
Naturally contains protein, while the flow-through material is 100 kDa
Contained less than the size of the native protein. Against SCR
Most of the activity that was carried out was contained in the 100 kDa retentate. Next
And the filtrate is A₂₈₀<10mM until reaching 0.100
It was continuously diafiltered with sodium phosphate (pH = 7.0).
Unless otherwise noted, perform all operations from this point onwards.
Slow as specified with mM sodium phosphate (pH 7.0)
It was carried out in an impact liquid. The retentate is then brought to a final volume of about 0.20 L.
Concentrated with 0.45mm Nalgene^TMFilmware aseptic filtration
Filtered using unit. Parse the filtered material
Petite Biosystem Sprint Using an HPLC system
Biosystems equilibrated in buffer solution
Mu Poros Packed with 50HQ strong anion exchange matrix
Loaded Pharmacia HR16 / 10 column at 7.5 ml / min.
It was After loading, A₂₈₀Buffer the column until <0.100 is reached.
Washed with. Protein for a total volume of 50 ml
Using a buffer containing 0.4 M NaCl for 20 minutes 2.
The column was eluted at 5 ml / min. Buffer containing 1.0M NaCl
Wash the column with the same flow rate for an additional 20 minutes
(Final volume = 50 ml). Elute with 0.4 M and 1.0 M NaCl
Protein in separate dialysis bags (Spectra / Po
Membrane MWCO: 2,000) and permeate overnight at 4 ° C in 12 L of buffer solution.
Was analyzed. Fraction with 0.4M most of the activity against SCR
It was included inside. 0.4M fraction, 0.75 ml / min
With Sepharose CL4B (Pharmacia) using a flow rate of
20m into a pre-packed Pharmacia XK 26/100 column
Further purification by application of l. Fraction A₂₈₀Pee
Pooled based on profile, Millipore Ultra
free 15 Centrifuge filter device Biomax-50
Concentrated using a K NMWL membrane to a final volume of 0.75 ml. Standard
Bio-Rad ta using bovine gamma globulin as a quasi substance
Protein concentration using a protein assay kit
Decided

Characterization The native molecular weight of the SCR toxin complex was measured using Pharmacia HR 16/50 pre-packed with Sepharose CL4B in buffer. The column was then calibrated using proteins of known molecular size, which allowed calculation of the approximate natural molecular size of the toxin. As shown in Table 20, the molecular size of the toxin complex ranges from 777 kDa for strain Hb to strain WX-.
The range was 14 up to 1,900 kDa. Also, the yield of toxin complex varied from strain WX-12 producing 0.8 mg / L to strain Hb producing 7.0 mg / L.

  SDS-PAGE analysis of proteins found in the toxin complex
To test for individual polypeptide size using
It was Typically, the proteins of the toxin complex from each strain
2 to 15% polyacrylamide gel (Integr.
Loaded Separation Systems),
Electrophoresed at 20 mA in Bio-Rad SDS-PAGE buffer
It was After the electrophoresis is complete, the gel is placed in BioRad Coomassie.
-Blue R-250 (methanol: acetic acid: water; 40: 10: 40v / v /
v) 0.2%) overnight staining. Then, the gel
Color: acetic acid: water; 40:10:40 (v / v / v). Next
Rinse the gel with water for 15 minutes, then
Dynamics Personal Laser Densitometer
- Scanned using. Lanes are quantified and molecular
Iz is calculated by comparing with Bio-Rad high molecular weight standard,
This was in the range of 200-45 kDa.

The sizes of the individual polypeptides containing the SCR toxin complex from each strain are listed in Table 21. The size of individual polypeptides ranged from 230 kDa in strain WX-1 to the size of 16 kDa as found in strain WX-7. Each strain except strain Hb has a range of 160-230kDa, 100-160kDa, and 50-
It had a polypeptide containing a toxin complex that was in the 80 kDa range. These data indicate that the toxin complex may vary in peptide composition and composition from strain to strain, but in all cases it is clear that it consists of an oligomeric protein complex with high toxin properties.

Activity spectrum As shown in Table 21, toxin conjugates purified from strains Hm and H9 were tested for activity against various insects, the toxin conjugate from strain W-14 was for comparison. The assay was performed as described in Example 13. All 3
Toxin conjugates from strains of the species showed activity against tobacco badworms, European corn borers, southern corn rootworms, and aster leafhoppers. In addition, toxin conjugates from strains Hm and W-14 were also active against two-spot spider mites. In addition, the toxin complex from W-14 was active against mosquito larvae. These data indicate that the toxin complex has activity similarities between certain eyes of insects and may exhibit different activities against other eyes of insects.

Example 15 Photorhabdus Protein Toxin Complex Sub-Fraction The Photorhabdus protein toxin complex was isolated as described in Example 14. Next, about 10 mg of toxin was equilibrated with 20 mM Tris-HCl, pH 7.0 at a flow rate of 1 ml / min.
Applied to Q5 / 5 column. The column was loaded with 20 mM Tris-HCl, pH until the optical density at 280 nm returned to baseline absorbance.
Washed with 7.0. The protein bound to the column was 0-1 in 20 mM Tris-HCl, pH 7.0 at 1 ml / min for 30 minutes.
Elution with a linear gradient of 0M NaCl. Fractions of 1 ml were collected and subjected to Southern Coal Rootworm (SCR) bioassay (see Example 13). The peak of activity was determined by SCR bioassay with serial dilutions of each fraction. Two activity peaks for SCR were observed, A (eluted with about 0.2-0.3M NaCl) and B
(Eluted with 0.3-0.4 M NaCl). Activity peaks A and B were pooled separately and both peaks were further purified using the following 3-step procedure.

Solid (NH ₄ ) ₂ SO ₄ was added to the above protein fraction by 1.7
Added to final concentration of M. The protein is then added at 1 ml / min to 1.7 M (NH ₄ ) ₂ S in 50 mM potassium phosphate buffer, pH 7.
Applied to a Phenyl-Spellose 5/5 column equilibrated with O ₄ . 1.7 M of bound protein at 0.5 ml / min
(NH ₄ ) ₂ SO ₄ , 0% ethylene glycol, 50 mM potassium phosphate, pH 7.0-25% ethylene glycol, 25 m
Potassium phosphate M, and eluted with a linear gradient of pH7.0 ((NH ₄₎ None ₂ SO _4). Fractions were dialyzed overnight against 10 mM sodium phosphate buffer, pH 7.0. The activity in each fraction against SCR was measured by bioassay.

Fractions with the highest activity were pooled and applied to a Mono Q5 / 5 column equilibrated with 20 mM Tris-HCl, pH 7.0 at 1 ml / min. The protein bound to the column was run 1 m with a linear gradient of 0-1 M NaCl in 20 mM Tris-HCl, pH 7.0.
Elute at 1 / min.

For the final step of purification, the most active fractions above (determined by SCR bioassay) were pooled and loaded onto a second phenyl-superose 5/5 column.
Solid (NH ₄ ) ₂ SO ₄ was added to a final concentration of 1.7M. The solution is then added at 1 ml / min to 50 mM potassium phosphate buffer, pH.
The column was equilibrated with 1.7 M (NH ₄ ) ₂ SO ₄ in 7. The protein bound to the column was loaded with 1.7 M (NH ₄ ) ₂ SO
₄ , eluted with a linear gradient of 50 mM potassium phosphate, pH 7.0-10 mM potassium phosphate, pH 7.0 at 0.5 ml / min. Fractions were dialyzed overnight against 10 mM sodium phosphate buffer, pH 7.0. The activity in each fraction against SCR was measured by bioassay.

The final purified protein from peak A by the above three-step procedure was called toxin A, and the final purified protein from peak B was called toxin B.

Characterization and Amino Acid Sequencing of Toxin A and Toxin B During SDS-PAGE, both Toxin A and Toxin B contained two major (greater than 90% of total Coomassie staining proteins) peptides: 192 kDa (A1 and B1, respectively). 58kDa (A2 respectively)
And B2). Both toxin A and toxin B reveal a unique major band in native PAGE, A1 and A2 are subunits of a protein complex,
It was also shown that B1 and B2 are subunits of a protein complex. Furthermore, the native molecular weights of both toxin A and toxin B were 860 kDa by gel filtration chromatography.
Was measured. Relative molarity of A1 to A2 is SDS
1: 1 equivalent determined as determined by densitometric analysis of the PAGE gel. Similarly, the B1 peptide and
The B2 peptide was present at the same molarity.

Toxin A and toxin B were electrophoresed in 10% SDS-PAGE and transblotted onto PVDF membranes. Blots were sent to Harvard Microchem and Cambridge Prochem respectively for amino acid analysis and N-terminal amino acid sequencing. B1 N-terminal amino acid sequence is SEQ ID NO: 1, TcbA gene TcbA _ii region (SEQ ID NO: 12, positions 87-99) that was determined to be identical to. A unique N-terminal sequence was obtained for peptide B2 (SEQ ID NO: 40). The N-terminal amino acid sequence of peptide B2 was identical to the TcbA _iii region (SEQ ID NO: 12, positions 1935-1945) of the derived amino acid sequence of the tcbA gene. Therefore, B toxin is mainly composed of two peptides, TcbA _ii and TcbA.
It was observed that these were derived from the same gene product, TcbA, including _iii .

The N-terminal sequence of A2 (SEQ ID NO: 41) was unique compared to the TcbA _iii peptide and other peptides. The A2 peptide was designated TcdA _iii (see Example 17). SEQ ID NO: 6 was determined to be a mixture of amino acid sequences SEQ ID NO: 40 and SEQ ID NO: 41.

In addition, peptides A1 and A2 were subjected to internal amino acid sequencing. For internal amino acid sequencing, 1 to 10 μg of toxin A
It was electrophoresed in 0% SDS-PAGE and transblotted onto PVDF membrane. After staining the blot with amido black, peptides A1 and called respectively TcdA _ii and TczdA _iii
A2 was excised from the blot and sent to Harvard Microchem and Cambridge Prochem. The peptides were tryptic digested, followed by HPLC chromatography to separate individual peptides. N-terminal amino acid analysis was performed on selected tryptic peptide fragments. Two internal amino acid sequence of the peptide A1 (TcdA _ii -PK71, SEQ ID NO: 38 and TcdA _ii -PK44, SEQ ID NO: 39) of the tcbA gene
It was found to have significant homology with the deduced amino acid sequence of the TcbA _ii region (SEQ ID NO: 12). Similarly, the N-terminal sequence of peptide A2 (SEQ ID NO: 41) and two internal sequences (TcdA
_iii- PK57, SEQ ID NO: 42 and TcdA _iii- PK20, SEQ ID NO: 4
3) also showed significant homology with the deduced amino acid sequence of the TcbA _iii region of the tcbA gene (SEQ ID NO: 12).

To summarize the above results, the toxin complex has at least two active protein toxin complexes for SCR, toxin A and toxin B. Toxin A and toxin B are similar in their natural and subunit molecular weights, but differ in their peptide composition. Toxin A is TcdA _ii as the main peptide
And TcdA _iii , and toxin B is T as the major peptide.
Includes cbA _ii and TcbA _iii .

Example 16 Cleavage and Activation of TcbA Peptides In the toxin B complex, peptides TcbA _ii and TcbA _iii
Originates from the single gene product TcbA (Example 15). Processing of the TcbA peptide to TcbA _ii and TcbA _iii is probably due to the action of one or more Photorhabdus proteases, and probably the metalloprotease described in Example 10. In some cases, when processing Photorhabdus W-14 broth, it was noted that the TcbA peptide was present in the toxin B complex as a major component in addition to peptides TcbA _ii and TcbA _iii . The same procedure as described for purification of toxin B complex (Example 15) was used to enrich peptide TcbA from the toxin complex fraction of W-14 broth. Final purified material in 4-20% gradient
Analyzed in SDS-PAGE and major peptides were quantified by densitometry. TcbA, TcbA _ii and TcbA _iii were determined to make up 58%, 36% and 6% of the total protein, respectively. The identity of these peptides was confirmed by SDS-PAGE and Western blot analysis using a monospecific antibody by their respective molecular sizes. The natural molecular weight of this fraction was measured and found to be 860 kDa.

The purified material was purified to 38 and 58 kDa W-14Ph
Cleavage of TcbA was assessed by treatment with otorhabdus metalloprotease (Example 10) and trypsin as a control enzyme (Sigma, MO). Standard reaction solution is 100 μl
In a total volume of 17.5 μg of the purified fraction, 1.5 units of protease, and 0.1 M Tris buffer, pH 8.0. Protease was omitted for control reactions. The reaction mixture was incubated at 37 ° C for 90 minutes. At the end of the reaction, 20 μl was taken and a 4-20% gradient
Immediately boiled with SDS-PAGE sample buffer for electrophoretic analysis in SDS-PAGE. 38kDa from SDS-PAGE
And protease treatment at 58 kDa both increased the amount of peptides TcbA _ii and TcbA _iii about 3-fold, while TcbA ii
A proportional decrease in the amount of peptide was determined (Table
twenty three). The relative decrease and enhancement of selected peptides was confirmed by Western blot analysis. In addition, gel filtration of the cleaved material revealed that the natural molecular weight of the complex remained the same. Peptides after trypsinization
TcbA and TcbA _ii were non-specifically digested into small peptides. This indicated that the 38 and 58 kDa Photorhabdus proteases could specifically process peptide TcbA into peptides TcbA _ii and TcbA _iii . The remaining 80 μl of the reaction mixture contained 10 protease-treated and 10 untreated controls.
SCR serially diluted with mM sodium phosphate buffer, pH 7.0, SCR
It was analyzed by bioassay. By comparing the activity in several dilutions, the 38 kDa protease treatment was
It was determined to increase the CR insecticidal activity about 3- to 4-fold.
Growth inhibition of residual insects on protease treatment was also more severe than on controls (Table 23).

Example 17 TcdA _ii peptide coding screening sequence number for the library of gene 17 (internal peptide TcdA _ii -PT111N terminal sequence)
And to complete the cloning and characterization of genes encoding TcdA _ii peptides described as SEQ ID NO: 18 (internal peptide TcdA _ii -PT79 N-terminal sequence). SEQ ID NO: 17
Two pools of degenerate oligonucleotides designed to encode the amino acid sequences of Table 24 and SEQ ID NO: 18 (Table 25) and the reverse complement of these sequences were prepared as described in Example 8. Was synthesized. Oligonucleotide
The DNA sequence is shown below.

Use P2.3.6.CB or P2.3.5. As the forward primer and P2.79.R.1 or P2.79 as the reverse primer in all forward / reverse combinations
Photorhabdus W-14 genomic DNA as template using R.CB
Was used to perform the polymerase chain reaction (PCR) substantially as described in Example 8. In another set of reactions, primer P2.79.2 or P2.79.3 was used as the forward primer in all forward / reverse combinations, and P2.3.5R, P2.3.5RI, and P2.
2.3R.CB was used as the reverse primer. Only the reactions containing P2.79.R.1 or P2.79R.CB as the reverse primer and P2.3.6.CB as the forward primer in combination with a non-reduced size of 2500 base pairs (mobility on agarose gel). An artificial amplification product was seen. The order of the primers used to obtain this amplification product indicates that the peptide fragment TcdA _ii -PT111 is the amino proximal to the peptide fragment TcdA _ii -PT79.

The 2500 bp PCR product was ligated into the plasmid vector pCR ^™ II (Invitrogen, San Diego, Calif.) According to the supplier's instructions, and the DNA sequences across the ends of the insert fragments of the two isolates (HS24 and HS27) were supplied with the supplier's instructions. It was measured using the recommended primers and the sequencing method described above. The sequences of both isolates were the same. A new primer was synthesized based on the determined sequence and used to initiate additional sequencing reactions [SEQ ID NO: 36]
A total of 2557 bases were obtained. Translation of the partial peptide encoded by SEQ ID NO: 36 was disclosed as SEQ ID NO: 37 845
Produces an amino acid sequence. Protein homology analysis of this portion of the TcdA _ii peptide fragment reveals substantial amino acid homology (68% similarity; 53% identity) of protein TcbA [SEQ ID NO: 12] to residues 542-1390. . Therefore, it is clear that the gene, represented in part by SEQ ID NO: 36, produces a similar protein but does not produce the same amino acid sequence as TcbA, which is probably Tc.
Similar to bA protein but with non-identical biological activity.

In yet another, SEQ ID NO: 9 (internal peptide TcdA _ii -PK
44 sequence), and SEQ ID NO: 41 (TcdA _iii peptides are described as 58kDaN terminal peptide sequence) TcdA _ii -PK44 and Tc
The gene encoding the dA _iii 58 kDa N-terminal peptide was isolated. Two pools of SEQ ID NO: 39 (Table 27) and SEQ ID NO: 41 (Table 26), and degenerate oligonucleotides designed to encode the reverse complement of these sequences were used in Example 8 and their DNA. Synthesized as described in the sequence.

In all forward / reverse combinations, using A1.44.1 or A1.44.2 as the forward primer, using the reverse primer A2.3R or A2.4R and using Photorhabdus W-14 genomic DNA as the template, Polymerase chain reaction (PCR) was performed as described in Example 8. In another set of reactions, primers in all forward / reverse combinations
Use A2.1 or A2.2 as the forward primer,
Also, A1.44.1R and A1.44.2R were used as reverse primers. A1.44.1 or A1 as a forward primer in combination with A2.3R as a reverse primer.
A non-artificial amplification product with an estimated size of 1400 base pairs (mobility on agarose gel) was found only in the reaction containing 44.2. The order of the primers used to obtain this amplification product peptide fragments TcdA _ii -PK44 is TcdA
It is shown to be amino-proximal to the 58 kDa peptide fragment of _iii .

The 1400 bp PCR product was ligated into the plasmid vector pCR ^™ II according to the supplier's instructions. DNA sequences across the ends of the insert fragments of the four isolates were determined using primers similar in sequence to those recommended by the supplier and using the sequencing method described above. The nucleic acid sequences of all isolates differed as expected in the region corresponding to the degenerate primer sequence, but the amino acid sequence deduced from these data was the actual amino acid sequence for the previously determined peptide (sequence No. 41 and SEQ ID No. 39).

Screening of the W-14 genomic cosmid library described in Example 8 with a radiolabeled probe containing the previously prepared DNA (SEQ ID NO: 36) revealed five hybridizing cosmid isolates, namely 17D9, 20B10, 21D2, 27B
10 and 26D1 were identified. These cosmids are SEQ ID NO:
11 or a probe corresponding to the gene set forth as SEQ ID NO: 25, which was different from that previously identified. Restriction enzyme analysis and DNA blot hybridization show an approximate size of spanning the region containing DNA of SEQ ID NO: 36 3.
Three EcoRI fragments of 7, 3.7, and 1.1 kbp were identified. Radiolabeled 1.4 kbp prepared in this example
Screening a W-14 genomic cosmid library using the DNA fragment of E. coli as a probe identified the same 5 cosmids (17D9, 20B10, 21D2, 27B10, and 26D1). Also, DNA blot hybridization for EcoR I digested cosmid DNA showed hybridization for the same subset of EcoR I fragments found with the 2.5 kbp TcdA _ii gene probe, indicating that both fragments are encoded by genomic DNA. Indicated.

2516 DNA sequencing of cloned EcoR I fragment
An uninterrupted open reading frame of 7551 base pairs (SEQ ID NO: 46) encoding a 282.9 kDa amino acid (SEQ ID NO: 47) was revealed. Analysis of the amino acid sequence of this protein revealed that all predicted internal fragments of the peptide TcdA _ii (SEQ ID NO: 17, 18, 37, 38 and 39) and the TcdA _iii peptide N-terminal (SEQ ID NO: 41) and all TcdA _iii internal peptides. (SEQ ID NOS: 42 and 43) were revealed. TcdA _ii and TcdA _iii
The peptide isolated and identified as is the product of the respective open reading frame designated tcdA disclosed as SEQ ID NO: 46. In addition, SEQ ID NO: 47 is shown to start at position 89, and the sequence disclosed as SEQ ID NO: 13 (which is approximately 201 kDa
Is the N-terminal sequence of a peptide of size
Shows that the initial protein resulting from S. cerevisiae is processed in a similar manner to the protein previously disclosed for SEQ ID NO: 12. In addition, the protein is further cleaved,
A product of size 209.2 kDa encoded by SEQ ID NO: 48 and disclosed as SEQ ID NO: 49 (TcdA _ii peptide), and a product of size 63.6 kDa encoded by SEQ ID NO: 50 and disclosed as SEQ ID NO: 51 (TcdA _iii peptide). Cause Thus, toxin A derived from the product of SEQ ID NO: 46
The insecticidal activity identified as (Example 15) is SEQ ID NO: 47.
As processed by SEQ ID NOs: 49 and 51, as exemplified by the 282.9 kDa full-length protein disclosed as
Is believed to give rise to the peptide disclosed as
The insecticidal activity identified as Toxin B (Example 15) is believed to be derived from the product of SEQ ID NO: 11, as exemplified by the 280.6 kDa protein disclosed as SEQ ID NO: 12. This protein was proteolytically processed to a 207.6 kDa protein disclosed as SEQ ID NO: 53, which is encoded by SEQ ID NO: 52, and SEQ ID NO: 40.
And a 62.9 kDa peptide having the N-terminal sequence disclosed as SEQ ID NO: 55 (which is SEQ ID NO: 54).
Coded by).

Amino acid sequence comparisons of the proteins disclosed as SEQ ID NO: 12 and SEQ ID NO: 47 show that they show 69% similarity and 54% similarity.
Reveal% identity. This high degree of evolutionary relationship is not uniform in the entire amino acid sequence of these peptides, but is higher towards the carboxy terminus of the protein. SEQ ID NO: 51 (derived from SEQ ID NO: 47) and SEQ ID NO: 55 (derived from SEQ ID NO: 12)
This is because the peptides disclosed as have 76% similarity and 64% identity.

Example 18 Control of European Cornbola Induced Leaf Damage on Corn Plants by Spray Application of Photorhabdus (strain W-14) Broth One or more plants that reduce plant damage caused by insect larvae.
The ability of Photorhabdus toxins to develop in European maize plants treated with Photorhabdus broth
Cornboller (Ostrinia nubilaris)
ubilalis)) to measure leaf damage. Fermentation broth from Photorhabdus strain W-14 was produced and subjected to ultrafiltration (1
It was concentrated about 10 times using a (000 MW pore size). The resulting concentrated broth was then filter sterilized using a 0.2 micron nitrocellulose membrane filter.
A similarly prepared sample of uninoculated 2% proteose peptone # 3 was used for control purposes. A soil-free mixture was placed in a corn plant (an inbred line owned by DowElanco) in a greenhouse (27 ° C during the day; 22 ° C at night, about 50% RH, 14 hours day length, watering / fertilization as needed) The seeds were grown to vegetative growth period 7 or 8 in a pot containing them.
Randomized complete block design in a greenhouse (22 ° C during the day; 18 ° C during the night, partially shielded without artificial light, sprinkled / fertilized as needed at about 50% RH in a greenhouse (3) Rep / treatment, 6 plants / treatment). Treatments (uninoculated medium and concentrated Photorhabdus broth) were applied with a syringe spray, 2.0 ml were applied directly (about 6 inches) in a swirl, and an additional 2.0 ml was applied in a circular motion from about 1 foot above the swirl. In addition, one group of plants received no treatment. After the treatment was dry (about 30 minutes), twelve neonatal European corn boller larvae (obtained from commercial sources and hatched in the room) were applied directly to the swirl.
One week later, the improved Guthrie Scale (K
oziel, MG, Beland, GL, Bowman, C., Carozzi, NB, Cren
shaw, R., Crossland, L., Dawson, J., Desai, N., Hill., M., K
adwell, S., Launis, K., Lewis, K., Maddox, D., McPherson,
K., Meghji, MZ, Merlin, E., Rhodes, R., Warren, GW, Wri
ght, M. and Evola, SV1983) Bio / Technology, 11, 194-1
95) were used to score plants for leaf damage and statistically compared the scores [T-test (LSD) p <0.0
5 and Taki Studentized Range (HSD) Test p
<0.1]. The results are shown in Table 28. For reference, a score of 1 represents no damage, a score of 2 represents "window pan" damage to unrolled leaves without pinhole invasion, and a score of 5 is a clear elongated lesion for more than three leaves. And / or medium feeding
g) represents leaf invasion (lesion <1 inch). These data show that when broth or other proteins containing fractions were delivered in a sprayable formulation or when the gene or derivative thereof encoding the protein or part thereof was delivered via transgenic plants or microorganisms. It shows that protection against insect plague can be provided.

Example 19 Summary of genetically engineered construction of genes for expression in E. coli A series of plasmids were constructed in Escherichia coli.
Photorhabdus W-14 tcbA gene was expressed. A list of plasmids is shown in Table 29. Each construction and obtained E.
A brief summary of coli expression data is provided below.

the construction Example 9 PDAB634, described a large EcoR I fragment which hybridized to the TcbA _ii probe. This fragment was subcloned into pBC (Stratagen, La Jolla CA). Sequence analysis shows that this fragment is 8816 base pairs. The fragment encodes the tcbA gene with an initiation ATG at position 571 and a termination TAA at position 8086. Therefore, the fragment is P upstream of ATG.
It has 570 base pairs of hotorhabdus DNA and 730 base pairs downstream of TAA.

Construction of plasmid pAcGP67B / tcbA The tcbA gene was PCR amplified using the following primers. 5'Primer (S1Ac51) 5'TTT AAA CCA TGG GAA AC
T CAT TAT CAA GCA CTA TC 3'and 3'primers (S1Ac3
1) 5'TTT AAA GCG GCC GCT TAA CGG ATG GTA TAA CGA A
TA TG 3 '. Panbella (Madison, Wisconsi
PCR was performed using the Takara LA PCR kit from n). 57.5 ml water, 10 ml 10X LA buffer, 16 ml dNTPs (2.5 mM each stock solution), 20 ml each primer (10 pmol / m
l), a plasmid pDAB6 containing 300 ng of W-14 tcbA gene
34 and 1 ml Takara LA Taq polymerase. The cycling conditions were 98 ° C / 20 seconds, 68 ° C / 5 minutes, 72 ° C / 10 minutes for 30 cycles. The expected PCR product of approximately 7526 bp was converted to TBE (100 mM
Tris, 90 mM boric acid, 1 mM EDTA) in 0.8% agarose gel and isolated in a Qiagen (Chatsworth, Cal
Purified using the Qiaex II kit from ifornia).
The purified tcbA gene was digested with Nco I and Not I and the baculovirus transfer vector pAcGP67B (Pharmingen (San Di
ego, California)) and transformed into DH5α E. coli. The tcbA starch was then cleaved from pAcGP67B and pET2
Transferred to 7b to create plasmid pDAB635. Missense mutations in the tcbA gene were repaired in pDAB635.

The repaired tcbA gene has two changes from the sequence shown in SEQ ID NO: 11; changing asparagine 71 to serine 71
A> G in 212 and G> A in 229 which changes alanine 77 to threonine 77. Both of these changes are upstream of the proposed TcbA _ii N-terminus.

Construction of pET15-tcbA The tcbA coding region of pDAB635 was transferred into vector pET15b. This was done using shotgun ligation and the DNA was cut with the restriction enzymes Nco I and Xho I. The obtained recombinant is
It is called pET15-tcbA.

Expression of TcbA in E. coli from plasmid pET15-tcbA Expression of tcbA in E. coli was determined by Studier et al. (Studier, FW,
Rosenberg, A., Dunn, J., and Duben-dorff, J., (1990)
Use of T7 RNA polymerase to induce expression of cloned genes. Methods Enzymol., 185: 60-89), obtained by modification of the method previously described. Competent E.co
The li cell line BL21 (DE3) was transformed with the plasmid pET15-tcbA and plated on LB agar containing 100 μg / ml ampicillin and 40 mM glucose. Transformed cells were plated to a density of several hundred isolated colonies / plate. After overnight incubation at 37 ° C., cells were scraped from the plates and suspended in LB broth containing 100 μg / ml ampicillin. The typical culture volume was 200-500 ml. 0
At times, the culture density (OD600) was 0.05-0.15 depending on the experiment. The culture was shaken at one of three temperatures (22 ° C, 30 ° C or 37 ° C) until a density of 0.15-0.5 was obtained,
At that time they were induced with 1 mM isopropylthio-β-galactoside (IPTG). 4 ~ at the specified temperature
Incubated for 5 hours and then transferred to 4 ° C until processing (17-72 hours).

TcbA expressed in E. coli from plasmid pET15-tcbA
Purification and characterization of E. coli cultures expressing the TcbA peptide were treated as follows. The cells were harvested by centrifugation at 17,000 x G, the medium decanted and stored in a separate container.

The medium was concentrated approximately 8-fold using an M12 (Amicon, Beverly MA) filtration system and a 100 kD molecular weight cut-off filter. The concentrated medium was loaded onto an anion exchange column and bound proteins were eluted with 1.0 M NaCl. The 1.0 M NaCl elution peak was found to cause mortality against Southern Corn Rootworm (SCR) larvae (Table 30). 1.0M Na
Cl fraction was added to 10 mM sodium phosphate buffer pH 7.0.
Against it was dialyzed, concentrated and subjected to gel filtration on Sepharose CL-4B (Pharmacia, Piscataway, New Jersey). Calculated molecular weight as a natural W-14 toxin complex (about 900k
The area of the CL-4B elution profile corresponding to Da) was collected, concentrated and bioassayed on larvae. The recovered 900 kDa fraction was found to have insecticidal activity (see Table 30), symptomology
Was similar to the symptomatic resolution produced by the native W-14 toxin complex. This fraction was subjected to proteinase K and heat treatment to eliminate or reduce the activity in both cases, providing evidence that the activity is proteinaceous in nature. In addition, the active fractions tested were immunologically positive for TcbA and TcbA _iii peptides in an immunoblot assay when tested with anti-TcbA _ii monoclonal antibody.

Cell pellet is 10 mM sodium phosphate buffer, pH =
Resuspended in 7.0 and lysed by passage through a Bio-Neb ^™ cell nebulizer (Glass-Col, Terra Haute, IN). Treat pellet with DNase to remove DNA and remove 17,0
The cell pellet was separated from the cell supernatant by centrifugation at 00 xg. The supernatant fraction was decanted, filtered through a 0.2 micron filter to remove large particles and subjected to anion exchange chromatography. Bound proteins were eluted with 1.0 M NaCl, dialyzed and concentrated using a Biomax ^™ (Millipore Corporation, Bedford, MA) concentrator with a molecular weight cut-off of 50,000 daltons. The concentrated fractions were subjected to gel filtration chromatography using Sepharose CL-4B bead matrix. The bioassay for the substance thus prepared is shown in Table 30 and is referred to as "TcbA cell Sup".

An alternative method for handling large amounts of material is to use cell pellets
It was resuspended in 10 mM sodium phosphate buffer, pH = 7.0 and homogenized sufficiently using a 40 ml tissue grinder from Contes Glass (Vineland, NJ). Cell debris was pelleted by centrifugation at 25,000 xg, cell supernatant decanted, filtered through a 0.2 micron filter and loaded with Poros HQ50 beads on Pharmacia 10/10.
Anion exchange chromatography was performed using the column. Bound proteins were eluted by running a 0.0-1.0 M NaCl gradient. Fractions containing TcbA protein were combined, concentrated using a 50 kDa concentrator and subjected to gel filtration chromatography using Pharmacia CL-4B bead matrix. TcbA with a molecular weight of approximately 900 kDa
Fractions containing oligomers were collected and subjected to anion exchange chromatography using a Pharmacia Mono Q10 / 10 column equilibrated with 20 mM Tris buffer pH = 7.3. Recombinant TcbA protein was eluted using a gradient of 0.0-1.0 M NaCl. Recombinant TcbA elutes from the column at a salt concentration of about 0.3-0.4 M NaCl and native TcbA oligomers elute from the Mono Q10 / 10 column at the same molarity. Recombinant Tc
The bA oligomers were found to cause SCR mortality in bioassay experiments similar to those in Table 30.

Sequence Listing (1) General Information (i) Applicants: Ensign, Gerald C. Bowen, David J. Peter, James Fattig, Raymond Skoknova, Suffrenk Constant, Richard All, Gregory L. Merlo, Donald J. Roberts, Jane L. Rochereau, Thomas A Blackburn, Michael B Hay, Timothy D Strickland, James A (ii) Title of the invention Insecticidal protein toxin obtained from Hotorhabdus (iii) Number of sequences: 61 (iv) Addressee (A) Addressee: Quorls & Brady (B) Street: 1 South Pinkney Street (C) Town: Madison (D) State: WI (E) Country: United States (F) ZIP Code: 53703 (v) Computer-readable Format: (A) Medium : Floppy Desk (B) Computer: IBM PC Compatible (C) Operation Computing System: PC-DOS / MS-DOS (D) Software: PatentIn Release # 1.0, Vers
ion # 1.30 (vi) Current application data: (A) Application number: (B) Application date: (C) Classification: (vii) Prior application data: (A) Application number: US08 / 063,615 (B) Application date: 1993 May 18, 2014 (vii) Prior application data: (A) Application number: US08 / 395,497 (B) Application date: February 28, 1995 (vii) Prior application data: (A) Application number: US60 / 007,255 ( B) Application date: November 06, 1995 (vii) Prior application data: (A) Application number: US08 / 608,423 (B) Application date: February 28, 1996 (vii) Prior application data: (A) Application No .: US08 / 705,484 (B) Filing date: August 28, 1996 (viii) Agent / agent information: (A) Name: Cai, Nicholson J. (B) Registration number: 27,386 (C) Reference / Litigant Roster number: 960296.93804 (ix) Telecommunication information: (A) Telephone: (608)251-5000 (B) Facsimile: (608)251-9166 (2) Information about SEQ ID NO: 1 (i) Sequence characteristics: (A) Sequence length: 11 amino acids (B) Sequence type: Amino acids (C) Number of chains: (D) Topology: Linear (ii) Molecular type: Protein (V) Fragment type: N-terminal (xi) Sequence description: SEQ ID NO: 1: (2) Information about SEQ ID NO: 2 (i) Sequence characteristics: (A) Sequence length: 12 amino acids (B) Sequence type: Amino acids (C) Number of chains: (D) Topology: Linear ( ii) Molecular type: protein (V) Fragment type: N-terminal (xi) Sequence description: SEQ ID NO: 2: (2) Information on SEQ ID NO: 3 (i) Sequence characteristics: (A) Sequence length: 19 amino acids (B) Sequence type: Amino acids (C) Number of chains: (D) Topology: Linear ( ii) Molecular type: protein (V) Fragment type: N-terminal (xi) Sequence description: SEQ ID NO: 3: (2) Information about SEQ ID NO: 4: (i) Sequence characteristics: (A) Sequence length: 14 amino acids (B) Sequence type: Amino acids (C) Number of chains: (D) Topology: Linear ( ii) Molecular type: protein (V) Fragment type: N-terminal (xi) Sequence description: SEQ ID NO: 4: (2) Information on SEQ ID NO: 5: (i) Sequence characteristics: (A) Sequence length: 9 amino acids (B) Sequence type: Amino acids (C) Number of chains: (D) Topology: Linear ( ii) Molecular type: protein (V) Fragment type: N-terminal (xi) Sequence description: SEQ ID NO: 5: (2) Information on SEQ ID NO: 6: (i) Sequence characteristics: (A) Sequence length: 15 amino acids (B) Sequence type: Amino acid (C) Number of chains: One (D) Topology: Straight chain Form (ii) Molecular type: Protein (V) Fragment type: N-terminal (xi) Sequence description: SEQ ID NO: 6: (2) Information about SEQ ID NO: 7: (i) Sequence characteristics: (A) Sequence length: 11 amino acids (B) Sequence type: Amino acids (C) Number of chains: (D) Topology: Linear ( ii) Molecular type: protein (V) Fragment type: N-terminal (xi) Sequence description: SEQ ID NO: 7: (2) Information about SEQ ID NO: 8: (i) Sequence characteristics: (A) Sequence length: 9 amino acids (B) Sequence type: Amino acids (C) Number of chains: (D) Topology: Linear ( ii) Molecular type: protein (V) Fragment type: N-terminal (xi) Sequence description: SEQ ID NO: 8: (2) Information about SEQ ID NO: 9: (i) Sequence characteristics: (A) Sequence length: 16 amino acids (B) Sequence type: Amino acids (C) Number of chains: (D) Topology: Linear ( ii) Molecular type: protein (V) Fragment type: N-terminal (xi) Sequence description: SEQ ID NO: 9: (2) Information on SEQ ID NO: 10: (i) Sequence characteristics: (A) Sequence length: 20 amino acids (B) Sequence type: Amino acids (C) Number of chains: (D) Topology: Linear ( ii) Molecular type: protein (V) Fragment type: N-terminal (xi) Sequence description: SEQ ID NO: 10: (2) Information on SEQ ID NO: 11: (i) Sequence characteristics: (A) Sequence length: 7515 base pairs (B) Sequence type: Nucleic acid (C) Number of strands: Double-stranded (D) Topology: Linear (ii) Molecular type: DNA (genome) (ix) Characteristics (A) Name / key: CDS (B) Site: 1 ..... 7515 (xi) Sequence description: SEQ ID NO: 11: (2) Information on SEQ ID NO: 12: (i) Sequence characteristics: (A) Sequence length: 2505 amino acids (B) Sequence type: Amino acids (C) Number of chains: (D) Topology: Linear ( ii) Molecular type: protein (xi) Sequence description: SEQ ID NO: 12: (2) Information about SEQ ID NO: 13: (i) Sequence characteristics: (A) Sequence length: 12 amino acids (B) Sequence type: Amino acid (C) Number of chains: Single chain (D) Topology: Direct Chain (ii) Molecular type: Peptide (xi) Sequence description: SEQ ID NO: 13: (2) Information on SEQ ID NO: 14: (i) Sequence characteristics: (A) Sequence length: 12 amino acids (B) Sequence type: Amino acid (C) Number of chains: Single chain (D) Topology: Direct Chain (ii) Molecular type: Peptide (xi) Sequence description: SEQ ID NO: 14: (2) Information on SEQ ID NO: 15: (i) Sequence characteristics: (A) Sequence length: 9 amino acids (B) Sequence type: Amino acid (C) Number of chains: Single chain (D) Topology: Direct Chain (ii) Molecular type: Peptide (xi) Sequence description: SEQ ID NO: 15: (2) Information on SEQ ID NO: 16: (i) Sequence characteristics: (A) Sequence length: 5 amino acids (B) Sequence type: Amino acids (C) Number of chains: Single chain (D) Topology: Direct Chain (ii) Molecular type: Peptide (xi) Sequence description: SEQ ID NO: 16: (2) Information on SEQ ID NO: 17: (i) Sequence characteristics: (A) Sequence length: 10 amino acids (B) Sequence type: Amino acids (C) Number of chains: Single chain (D) Topology: Direct Chain (ii) Molecular type: Peptide (xi) Sequence description: SEQ ID NO: 17: (2) Information about SEQ ID NO: 18: (i) Sequence characteristics: (A) Sequence length: 16 amino acids (B) Sequence type: Amino acids (C) Number of chains: Single chain (D) Topology: Direct Chain (ii) Molecular type: Peptide (xi) Sequence description: SEQ ID NO: 18: (2) Information on SEQ ID NO: 19: (i) Sequence characteristics: (A) Sequence length: 21 amino acids (B) Sequence type: Amino acid (C) Number of chains: Single chain (D) Topology: Direct Chain (ii) Molecular type: Peptide (xi) Sequence description: SEQ ID NO: 19: (2) Information about SEQ ID NO: 20: (i) Sequence characteristics: (A) Sequence length: 12 amino acids (B) Sequence type: Amino acid (C) Number of chains: Single chain (D) Topology: Direct Chain (ii) Molecular type: Peptide (xi) Sequence description: SEQ ID NO: 20: (2) Information on SEQ ID NO: 21: (i) Sequence characteristics: (A) Sequence length: 26 amino acids (B) Sequence type: Amino acid (C) Number of chains: Single chain (D) Topology: Direct Chain (ii) Molecular type: Peptide (xi) Sequence description: SEQ ID NO: 21: (2) Information on SEQ ID NO: 22: (i) Sequence characteristics: (A) Sequence length: 15 amino acids (B) Sequence type: Amino acids (C) Number of chains: Single chain (D) Topology: Direct Chain (ii) Molecular type: Peptide (xi) Sequence description: SEQ ID NO: 22: (2) Information on SEQ ID NO: 23: (i) Sequence characteristics: (A) Sequence length: 13 amino acids (B) Sequence type: Amino acids (C) Number of chains: (D) Topology: Linear ( ii) Molecular type: Peptide (xi) Sequence description: SEQ ID NO: 23: (2) Information on SEQ ID NO: 24: (i) Sequence characteristics: (A) Sequence length: 22 amino acids (B) Sequence type: Amino acid (C) Number of chains: Single chain (D) Topology: Direct Chain (ii) Molecular type: Peptide (xi) Sequence description: SEQ ID NO: 24: (2) Information on SEQ ID NO: 25: (i) Sequence characteristics: (A) Sequence length: 6005 base pairs (B) Sequence type: Nucleic acid (C) Number of strands: Double strand (D) Topology: Linear (ii) Molecular type: DNA (genome) (ix) Characteristics (A) Name / key: RBS (B) Site: 1 ..... 9 (ix) Characteristics (A) Name / key: CDS ( B) Site: 16 ..... 3585 (D) Other information: / Product = "P8" (xi) Sequence description: SEQ ID NO: 25: (2) Information on SEQ ID NO: 26: (i) Sequence characteristics: (A) Sequence length: 1190 amino acids (B) Sequence type: Amino acids (C) Number of chains: (D) Topology: Linear ( ii) Molecular type: Protein (xi) Sequence description: SEQ ID NO: 26: (2) Information about SEQ ID NO: 27: (i) Sequence characteristics: (A) Sequence length: 1881 base pairs (B) Sequence type: Nucleic acid (C) Number of strands: Double-stranded (D) Topology: Linear (ii) Molecular type: DNA (genome) (ix) Characteristics (A) Name / key: CDS (B) Site: 1 ..... 1881 (D) Other information: / Product = "P8 "(Xi) Sequence description: SEQ ID NO: 27: (2) Information on SEQ ID NO: 28: (i) Sequence characteristics: (A) Sequence length: 627 amino acids (B) Sequence type: Amino acid (D) Topology: Linear (ii) Molecular type: Protein ( xi) Sequence description: SEQ ID NO: 28: (2) Information about SEQ ID NO: 29: (i) Sequence characteristics: (A) Sequence length: 1689 base pairs (B) Sequence type: Nucleic acid (C) Number of strands: Double-stranded (D) Topology: Linear (ii) Molecular type: DNA (genome) (ix) Characteristics (A) Name / key: CDS (B) Site: 1 .... 1689 (D) Other information: / Product = "S8" (Xi) Sequence description: SEQ ID NO: 29: (2) Information on SEQ ID NO: 30: (i) Sequence characteristics: (A) Sequence length: 563 amino acids (B) Sequence type: Amino acids (D) Topology: Linear (ii) Molecular type: Protein ( xi) Sequence description: SEQ ID NO: 30: (2) Information on SEQ ID NO: 31: (i) Sequence characteristics: (A) Sequence length: 4458 base pairs (B) Sequence type: Nucleic acid (C) Number of strands: Double-stranded (D) Topology: Linear (ii) Molecular type: DNA (genome) (ix) Characteristics (A) Name / key: CDS (B) Site: 1 ..... 4458 (xi) Sequence description: SEQ ID NO: 31: (2) Information on SEQ ID NO: 32: (i) Sequence characteristics: (A) Sequence length: 1486 amino acids (B) Sequence type: Amino acids (D) Topology: Linear (ii) Molecular type: Protein ( xi) Sequence description: SEQ ID NO: 32: (2) Information on SEQ ID NO: 33: (i) Sequence characteristics: (A) Sequence length: 3288 base pairs (B) Sequence type: Nucleic acid (C) Number of strands: Double-stranded (D) Topology: Linear (ii) Molecular type: DNA (genomic) (xi) Sequence description: SEQ ID NO: 33: (2) Information on SEQ ID NO: 34: (i) Sequence characteristics: (A) Sequence length: 1095 amino acids (B) Sequence type: Amino acids (D) Topology: Linear (ii) Molecular type: Protein ( xi) Sequence description: SEQ ID NO: 34: (2) Information on SEQ ID NO: 35: (i) Sequence characteristics: (A) Sequence length: 603 amino acids (B) Sequence type: Amino acids (D) Topology: Linear (ii) Molecular type: Protein ( xi) Sequence description: SEQ ID NO: 35: (2) Information on SEQ ID NO: 36: (i) Sequence characteristics: (A) Sequence length: 2557 base pairs (B) Sequence type: Nucleic acid (D) Topology: Linear (ii) Molecular type: DNA (Genome) (xi) Sequence description: SEQ ID NO: 36: (2) Information about SEQ ID NO: 37: (i) Sequence characteristics: (A) Sequence length: 845 amino acids (B) Sequence type: Amino acids (D) Topology: Linear (ii) Molecular type: Protein ( (Partial) (xi) Sequence description: SEQ ID NO: 37: (2) Information on SEQ ID NO: 38: (i) Sequence characteristics: (A) Sequence length: 16 amino acids (B) Sequence type: Amino acid (C) Number of chains: Single chain (D) Topology: Direct Chain (ii) Molecular type: Protein (V) Fragment type: N-terminal (xi) Sequence description: SEQ ID NO: 38: (2) Information on SEQ ID NO: 39: (i) Sequence characteristics: (A) Sequence length: 20 amino acids (B) Sequence type: Amino acids (C) Number of chains: Single chain (D) Topology: Direct Chain (ii) Molecular type: Protein (V) Fragment type: N-terminal (xi) Sequence description: SEQ ID NO: 39: (2) Information on SEQ ID NO: 40: (i) Sequence characteristics: (A) Sequence length: 11 amino acids (B) Sequence type: Amino acid (C) Number of chains: Single chain (D) Topology: Direct Chain (ii) Molecular type: Protein (V) Fragment type: N-terminal (xi) Sequence description: SEQ ID NO: 40: (2) Information on SEQ ID NO: 41: (i) Sequence characteristics: (A) Sequence length: 14 amino acids (B) Sequence type: Amino acid (C) Number of chains: Single chain (D) Topology: Direct Chain (ii) Molecular type: Protein (V) Fragment type: N-terminal (xi) Sequence description: SEQ ID NO: 41: (2) Information on SEQ ID NO: 42: (i) Sequence characteristics: (A) Sequence length: 19 amino acids (B) Sequence type: Amino acid (C) Number of chains: Single chain (D) Topology: Direct Chain (ii) Molecular type: Protein (V) Fragment type: N-terminal (xi) Sequence description: SEQ ID NO: 42: (2) Information on SEQ ID NO: 43: (i) Sequence characteristics: (A) Sequence length: 11 amino acids (B) Sequence type: Amino acid (C) Number of chains: Single chain (D) Topology: Direct Chain (ii) Molecular type: Protein (V) Fragment type: N-terminal (xi) Sequence description: SEQ ID NO: 43: (2) Information on SEQ ID NO: 44: (i) Sequence characteristics: (A) Sequence length: 16 amino acids (B) Sequence type: Amino acid (C) Number of chains: Single chain (D) Topology: Direct Chain (ii) Molecular type: Protein (V) Fragment type: N-terminal (xi) Sequence description: SEQ ID NO: 44: (2) Information on SEQ ID NO: 45: (i) Sequence characteristics: (A) Sequence length: 13 amino acids (B) Sequence type: Amino acids (C) Number of chains: Single chain (D) Topology: Direct Chain (ii) Molecular type: Protein (V) Fragment type: N-terminal (xi) Sequence description: SEQ ID NO: 45: (2) Information on SEQ ID NO: 46: (i) Sequence characteristics: (A) Sequence length: 7551 base pairs (B) Sequence type: Nucleic acid (C) Number of strands: Double-stranded (D) Topology: Linear (ii) Molecular type: DNA (genomic) (xi) Sequence description: SEQ ID NO: 46 (tcdA): (2) Information on SEQ ID NO: 47: (i) Sequence characteristics: (A) Sequence length: 2516 amino acids (B) Sequence type: Amino acids (C) Number of chains: Single chain (D) Topology: Direct Chain (ii) Molecular type: Protein (xi) Sequence description: SEQ ID NO: 47 (TcdA): (2) Information about SEQ ID NO: 48: (i) Sequence characteristics: (A) Sequence length: 5547 base pairs (B) Sequence type: Nucleic acid (C) Number of strands: Double-stranded (D) Topology: Linear (ii) Molecular type: DNA (genomic) (xi) Sequence description: SEQ ID NO: 48 (tcdAii coding region): (2) Information on SEQ ID NO: 49: (i) Sequence characteristics: (A) Sequence length: 1849 amino acids (B) Sequence type: Amino acid (C) Number of chains: Single chain (D) Topology: Direct Chain (ii) Molecular type: Protein (xi) Sequence description: SEQ ID NO: 49 (TcdAii): (2) Information on SEQ ID NO: 50: (i) Sequence characteristics: (A) Sequence length: 1740 base pairs (B) Sequence type: Nucleic acid (C) Number of strands: Double-stranded (D) Topology: Linear (ii) Molecular type: DNA (genomic) (xi) Sequence description: SEQ ID NO: 50 (TcdAii coding region): (2) Information on SEQ ID NO: 51: (i) Sequence characteristics: (A) Sequence length: 579 amino acids (B) Sequence type: Amino acids (C) Number of chains: Single chain (D) Topology: Direct Chain (ii) Molecular type: Protein (xi) Sequence description: SEQ ID NO: 51 (TcdAiii): (2) Information on SEQ ID NO: 52: (i) Sequence characteristics: (A) Sequence length: 5532 base pairs (B) Sequence type: Nucleic acid (C) Number of strands: Double-stranded (D) Topology: Linear (ii) Molecular type: DNA (genomic) (xi) Sequence description: SEQ ID NO: 52 (TcdAiii coding region): (2) Information about SEQ ID NO: 53: (i) Sequence characteristics: (A) Sequence length: 1844 amino acids (B) Sequence type: Amino acids (C) Number of chains: Single chain (D) Topology: Direct Chain (ii) Molecular type: Protein (xi) Sequence description: SEQ ID NO: 53 (TcbAii): (2) Information about SEQ ID NO: 54: (i) Sequence characteristics: (A) Sequence length: 1722 base pairs (B) Sequence type: Nucleic acid (C) Number of strands: Double-stranded (D) Topology: Linear (ii) Molecular type: DNA (genomic) (xi) Sequence description: SEQ ID NO: 54 (TcdAiii coding region): (2) Information on SEQ ID NO: 55: (i) Sequence characteristics: (A) Sequence length: 573 amino acids (B) Sequence type: Amino acid (C) Number of chains: Single chain (D) Topology: Direct Chain (ii) Molecular type: Protein (xi) Sequence description: SEQ ID NO: 55 (TcbAiii): (2) Information on SEQ ID NO: 56: (i) Sequence characteristics: (A) Sequence length: 2898 base pairs (B) Sequence type: Nucleic acid (C) Number of strands: Double-stranded (D) Topology: Linear (ii) Molecular type: DNA (genomic) (xi) Sequence description: SEQ ID NO: 56 (tccA): (2) Information about SEQ ID NO: 57: (i) Sequence characteristics: (A) Sequence length: 965 amino acids (B) Sequence type: Amino acids (D) Topology: Linear (ii) Molecular type: Protein ( xi) Sequence description: SEQ ID NO: 57 (TccA peptide): (2) Information about SEQ ID NO: 58: (i) Sequence characteristics: (A) Sequence length: 4698 base pairs (B) Sequence type: Nucleic acid (C) Number of strands: Double-stranded (D) Topology: Linear (ii) Molecular type: DNA (genomic) (xi) Sequence description: SEQ ID NO: 58 (tccB): (2) Information on SEQ ID NO: 59: (i) Sequence characteristics: (A) Sequence length: 1665 amino acids (B) Sequence type: Amino acids (D) Topology: Linear (ii) Molecular type: Protein ( xi) Sequence description: SEQ ID NO: 59 (TccB): (2) Information about SEQ ID NO: 60: (i) Sequence characteristics: (A) Sequence length: 3132 base pairs (B) Sequence type: Nucleic acid (C) Number of strands: Double-stranded (D) Topology: Linear (ii) Molecular type: DNA (genomic) (xi) Sequence description: SEQ ID NO: 60 (tccC): (2) Information on SEQ ID NO: 61: (i) Sequence characteristics: (A) Sequence length: 1043 amino acids (B) Sequence type: Amino acid (D) Topology: Linear (ii) Molecular type: Protein ( xi) Sequence description: SEQ ID NO: 61 (TccC peptide):

Continuation of the front page (31) Priority claim number 08 / 705,484 (32) Priority date August 28, 1996 (August 28, 1996) (33) Country of priority claim United States (US) Preliminary examination ( 72) Inventor Bowen David Jay United States Wisconsin 53575 Oregon Highway A 5668 (72) Inventor Pieter James United States Indiana 46077 Zionsville Hunters Glen 1427 (72) Inventor Fategue Raymond United States Indiana 46077 Zionsville Clay Court 30 (72) Invention Schoenover Sue Indiana, USA 46112 Brownsburg Marstella 7142 (72) Inventor French Constant Richard H. Wisconsin 53705 Madison University Bay Drive 1006 (72) Inventor Rochello Thomas A. USA Wisconsin 53704 Madison Buena Vista Street 3100 (72) Inventor Blackburn Michael Bee Wisconsin 53713 Madison Rouen Lane 2127 (72) Inventor Heitimothy Dee USA Indiana 46077 Zionsville Catalina Way 1653 (72) Inventor Marlo Donald Jay United States Indiana 46032 Carmel Durbin Drive 11845 (72) Inventor Au Gregory El United States Indiana 46280 Indianapolis Saratoga Circle 1028 (72) Inventor Roberts Jean El United States Indiana 46030 Arcadia State Road 19-26035 (72) ) Inventor Strickland James A. United States Indiana 46052 Bannon Mount Geon Road 780 (72) Inventor Goo Leining, Indiana 46112 Brownsburg Nelson Circle 7 (72) Inventor Seache Todd A, Wisconsin 53705 Madison Chadbourne Avenue 1609 (56) References US Patent 5039523 (US, US) A) International publication 95/00647 (WO, A2) J. of Invertrate Pathology, March 1995, Vol. 66,145-155 (58) Fields surveyed (Int.Cl. ⁷ , DB name) C12N 15/00-15/90 A01H 5/00 C07K 7/00-7/66 C07K 14/00-14/825 C12N 5/00-5/28 C12P 21/00-21/08 JISST file (JOIS) SwissProt / PIR / GeneS eq GenBank / EMBL / DDBJ / GeneSeq PudMed

Claims (7)

(57) [Claims] 1. A polynucleotide operably linked to a heterologous promoter, which encodes a protein that is orally toxic to insects and has a sequence selected from the group consisting of SEQ ID NO: 11 and SEQ ID NO: 46. The polynucleotide. 2. A polynucleotide operably linked to a heterologous promoter encoding a protein having oral toxicity to insects, said protein being selected from the group consisting of SEQ ID NO: 12 and SEQ ID NO: 47. The polynucleotide, which is a protein containing an amino acid sequence. 3. A transgenic plant cell containing the polynucleotide according to claim 1. 4. A transgenic plant cell that expresses the polynucleotide of claim 1. 5. An amino acid sequence selected from the group consisting of the amino acid sequences set forth in SEQ ID NO: 12 and SEQ ID NO: 47,
A recombinant protein that is orally toxic to insects. 6. A method for controlling insects, which comprises providing the protein according to claim 5. 7. The method of claim 6, wherein the protein is produced by and is present in an insect accessible transgenic plant.