PL248969B1 - A pair of oligonucleotide primers for detection and a method for detecting the dominant allele of the crown rust resistance gene Pc101 derived from Avena sterilis PI 334961 in the genome of common oat (Avena sativa L.) - Google Patents

Abstract

The subject of the application is a pair of oligonucleotide primers for detecting the dominant allele of the crown rust resistance gene Pc101 from Avena sterilis PI 334961 in oat plants with sequences no. 1 and 2 presented in the sequence listing. The subject of the application is also a method for identifying the dominant allele of the crown rust resistance gene Pc101 from Avena sterilis PI 334961 in oat plants, in which a polymorphic DNA fragment linked to the gene being tested is amplified in a PCR reaction using a pair of primers, followed by detection of the amplification product, and the pair of primers is a pair of oligonucleotides with sequences no. 1 and 2 presented in the sequence listing, wherein the 122_T marker is used.

Description

Description of the invention

The subject of the invention is a pair of oligonucleotide primers for detecting the dominant allele of the crown rust resistance gene Pc101 derived from Avena sterilis PI 334961 in oat plants.

The economic importance of oats (Avena sativa L.), particularly as a grain intended for human consumption rather than for animal feed, has been growing in recent years due to its health benefits appreciated by consumers. Poland, as the world's fourth largest producer, introduces new, increasingly high-yielding varieties to the market each year. Unfortunately, these varieties have low resistance to fungal diseases. Diseases caused by fungal pathogens such as powdery mildew, crown rust, and stem rust appear annually and are one of the main biotic factors limiting yields. Crown rust, caused by the fungus Puccinia coronata Cda. f. sp. avenae P. Syd. & Syd., is a fungal disease that causes significant yield losses due to reduced photosynthesis in infected tissues. As found in the conducted studies, all Polish oat cultivars are highly susceptible to crown rust (Sowa, S., Paczos-Grzęda, E., 2020. A study of crown rust resistance in historical and modern oat cultivars representing 120 years of Polish oat breeding. Euphytica 216, 1-10; Koroluk A. Paczos-Grzęda E., Sowa S., Boczkowska M., Toporowska J. 2022. Diversity of Polish oat cultivars with a glance at breeding history and perspectives. Agronomy-Basel Vol. 12 (10)2423). The best way to improve the health of varieties is to introduce genetically determined resistance, in the form of major R genes. One such resistance gene is Pc101, introduced into common oats from the wild species Avena sterilis (genotype PI 334961) through crossbreeding with the Avena sativa 'Harmon' cultivar. In the progeny of the resulting hybrids, homozygous lines were selected for both the Pc101 gene alleles and most of the other genes in the plant. Due to its high effectiveness, the Pc101 gene can be successfully used in oat resistance breeding, constituting a promising independent resistance gene in terms of effectiveness and durability, as well as a component of gene pyramids in new varieties (Paczos-Grzęda, E., Róg, S., Koroluk, A., Okoń, S., Ostrowska, A., Ociepa, T., Erdzik, P., Chrząstek, M., Kowalczyk, K., 2014. Virulence structure of Puccinia coronata f. sp. avenae in Central and South Eastern Poland 2020; Paczos-Grzęda, E., Sowa, S., 2019. Virulence structure and diversity of Puccinia coronata f. sp. avenae P. syd. & syd. in Poland during 2013 to 2015. Plant Dis. 103, 1559-1564; Sowa, S., Paczos-Grzęda, E.. 2017. Puccinia coronata f. sp. avenae virulence in southeastern Poland in 2014. Folia Pomer. Univ. Technol. Stetin., Agric., Aliment. Pisc., Zootech 336:43, 157-166; Sowa, S., Paczos-Grzęda, E., 2021. Virulence structure of Puccinia coronata f. sp. avenae and effectiveness of Pc resistance genes in Poland during 2017-2019, Phytopathology Vol. 111, No. 7 pp. 1158-4165). To improve, facilitate, and accelerate the process of introducing new main genes into breeding materials, the use of molecular markers is recommended. DNA markers based on the PCR method are used in contemporary marker-assisted breeding. Markers are a particularly useful tool in resistance breeding because they enable the reliable and rapid identification of forms containing specific combinations of gene alleles at early stages of plant development in a very short time. Molecular tests replace labor-intensive physiological tests requiring specialized knowledge.

The aim of the invention was to find a pair of oligonucleotides that would enable the identification of the dominant allele of the Pc101 gene derived from Avena sterilis PI 334961 in oat plants both at the seedling and adult plant stage.

The subject of the invention is a pair of oligonucleotide primers for detecting the dominant allele of the crown rust resistance gene Pc101 derived from Avena sterilis PI 334961 in oat plants with sequence numbers 1 and 2, presented in the sequence listing.

A method for identifying the dominant allele of the crown rust resistance gene Pc101 derived from Avena sterilis PI 334961 in oat plants, in which a polymorphic DNA fragment coupled to the gene under investigation is amplified in a PCR reaction using a pair of primers, followed by detection of the amplification product, is characterized in that the pair of primers is a pair of oligonucleotides with sequences no. 1 and 2, presented in the sequence list, wherein the marker 122_T, presented in Fig. 1-4, of 138 bp in length associated with the presence in oat plants of the dominant allele of the crown rust resistance gene Pc101 derived from Avena sterilis PI 334961 (sequence no. 3), is used.

Figure 1 shows the PCR products obtained by amplification of DNA from F2 generation plants of populations 848 [Avena sativa ‘Chestnut 1’ x (Avena sativa ‘Harmon’ x Avena sterilis PI 334961)] and 851 [Avena sativa ‘Chestnut 2’ x (Avena sativa ‘Harmon’ x Avena sterilis PI 334961)] after incorporating primer pairs no. 1 and 2, presented in the sequence listing, into the reaction.

Numbers 1-24 - plants of population 848 [Avena sativa ‘Chestnut 1’ x (Avena sativa ‘Harmon’ x Avena sterilis PI 334961)] described as to the phenotype: numbers 1-10 - homozygotes resistant; numbers 11-20 - homozygotes susceptible to infection; numbers 21-24 - heterozygotes; numbers 25-46 - plants of population 851 [Avena sativa ‘Chestnut 2’ x (Avena sativa ‘Harmon’ x Avena sterilis PI 334961)] described as to the phenotype: numbers 25-34 - homozygotes resistant; numbers 35-44 - homozygotes susceptible to infection; numbers 45-46 - heterozygotes; P1 - line Pc101 Avena sativa ‘Harmon’ x Avena sterilis PI 334961, P2 - Avena sativa ‘Kasztan’ - parental forms of the tested populations; M - GeneRuler™ 50 bp DNA Ladder size marker.

Figure 2 shows the PCR products obtained by amplification of DNA from F2 generation plants of population 851 [Avena sativa ‘Chestnut 2’ x (Avena sativa ‘Harmon’ x Avena sterilis PI 334961)] after incorporating the primer pair no. 1 and 2 presented in the sequence listing into the reaction.

Numbers 1-48 - plants of population 851 [Avena sativa ‘Chestnut 2’ x (Avena sativa ‘Harmon’ x Avena sterilis PI 334961)] described in terms of phenotype: numbers 1-14 - homozygotes resistant; numbers 15-26 homozygotes susceptible to the infection; numbers 27-48 - heterozygotes; M - GeneRuler™ 50 bp DNA Ladder size marker.

Figure 3 shows the PCR products obtained by amplification of DNA from F2 generation plants of population 851 [Avena sativa ‘Chestnut 2’ x (Avena sativa ‘Harmon’ x Avena sterilis PI 334961)] after incorporating the primer pair no. 1 and 2 shown in the sequence listing into the reaction.

Numbers 1-48 - plants of population 851 - Avena sativa ‘Chestnut 2’ x (Avena sativa ‘Harmon’ x Avena sterilis PI 334961) described in terms of phenotype: numbers 1-14 - homozygotes resistant; numbers 15-26 - homozygotes susceptible to the infection; numbers 27-48 - heterozygotes; M - GeneRuler™ 50 bp DNA Ladder size marker.

Figure 4 shows the PCR products obtained by amplification of DNA from F2 generation plants of population 851 [Avena sativa ‘Chestnut 2’ x (Avena sativa ‘Harmon’ x Avena sterilis PI 334961)] after incorporating the primer pair no. 1 and 2 shown in the sequence listing into the reaction.

Numbers 1-48 - plants of population 851 - Avena sativa 'Chestnut 2' x (Avena sativa 'Harmon' x Avena sterilis PI 334961) described in terms of phenotype: numbers 1-14 - homozygotes resistant; numbers 15-26 - homozygotes susceptible to the infection; numbers 27-48 - heterozygotes; M - GeneRuler™ 50 bp DNA Ladder size marker.

In the first stage, two hybrid populations were created: 848 [Avena sativa Chestnut 1’ x (Avena sativa ‘Harmon’ x Avena sterilis PI 334961)] and 851 [Avena sativa Chestnut 2’ x (Avena sativa ‘Harmon’ x Avena sterilis PI 334961)], in which the donor of the oat crown rust resistance gene is a line containing the Pc101 gene, which is a hybrid form of Avena sativa ‘Harmon’ x Avena sterilis PI 334961. Then, using a physiological test carried out on 300 lines of the F3 generation, homozygous, dominant - resistant plants were identified; Heterozygous plants, segregating for crown rust resistance, and homozygous, recessive plants, susceptible to the disease, were isolated in a 1:2:1 ratio, consistent with monogenic inheritance. After DNA isolation from plants with opposing phenotypes (resistant/affected) and heterozygotes, they were subjected to commercial polymorphism analysis using DArTseq (Diversity Array Technologies Ltd., Canberra, Australia), which involves sequencing a reduced representation of the genome. The results were obtained in the form of binary arrays for 90 plants. After assigning the segregation of phenotypes to the segregation of DArTseq markers, DArTseq sequences were identified, which, after being located on the genome of the common oat cultivar Sang (https://wheat.pw.usda.gov/blast/: Kamal, N., Tsardakas-Renhuldt, N., Bentzer J. et al. 2022. The mosaic oat genome gives insights into a uniquely healthy cereal crop. Nature 606, 113-119), were extended at the 5' and 3' ends and became the basis for designing the appropriate primer pairs no. 1 and 2, presented in the sequence list.

With the use of oligonucleotide primers no. 1 and 2, presented in the sequence list, a dominant marker 122_T was obtained (Fig. 1-4), which in a simple and quick way identifies oat plants with the dominant allele of the crown rust resistance gene Pc101 from Avena sterilis PI 334961. The marker 122_T, based on the results of the segregation analysis of the 138 bp long 122_T product, showed genetic linkage with the locus of the crown rust resistance gene Pc101 from Avena sterilis

PL 248969 Β1

PI 334961 is specific, based on PCR reaction and generates easy-to-interpret and reproducible results, enabling its use in marker-assisted selection.

The conducted tests of the 122_T marker showed that it is a marker of the dominant allele of the crown rust resistance gene Pc101 from Avena sterilis PI 334961 in common oats.

The 122_T marker may be useful for identifying the crown rust resistance gene Pc101 from Avena sterilis PI 334961 present in oat breeding materials. The primary advantage of the developed identification system is the ability to quickly determine the plant genotype at the seedling stage, independent of environmental conditions and the plant's developmental stage, and independent of the presence or absence of infection with a specific isolate of Puccinia coronata f. sp. avenue.

Method of identifying the 122_T marker

Material:

DNA isolated from oat leaves using commercially available kits.

Composition of the mixture in the PCR (Polymerase Chain Reaction) reaction:

DNA 10-50 ng 2x PCR Master Mix (Thermo Fishcr Scientific) 1x Starter 122_F 1T (sequence no. 1) 0.1 -0.5 μM Primer 122 RI (sequence no. 2) 0.1 -0.5 μM H ₂ O Depending on the volume of the final PCR mixture

Primer sequences:

Sequence No. 1: 122_FIT 5' CGGCTCATGCTGCCGCAT 3'

Sequence no. 2: 122_R1 5’ CGACGAAGACGTCCCGGCG 3’

Primers were designed using Primer 3.0.

DNA amplification conditions

The PCR reaction was performed in thermal cyclers: SimpliAmp (Applied Biosystems) or ProFlex (Applied Biosystems)

PCR reaction thermal profile: 94°C - 4 min., 37 cycles (94°C - 30 s., 62°C - 30 s., 72°C - 45 s.), 72°C-7 min.

Marker identification 122_T:

Electrophoresis was carried out on a 1.5% agarose gel containing 0.5 pg/ml ethidium bromide in TBE buffer (pH 8.0) at 100 V for 2 hours. GeneRuler™ 50 bp plus DNA Ladder (ThermoFisher Scientific, USA) was used as a DNA fragment length standard. Marker visualization was performed using the Uvidoc HD6 system (Uvitec, Cambridge, UK).

Results:

Testing of marker 122_T on individuals of populations 848 [Avena sativa ‘Chestnut 1’ x (Avena sativa ‘Harmon’ x Avena sterilis PI 334961)] and 851 [Avena sativa ‘Chestnut 2’ x (Avena sativa ‘Harmon’ x Avena sterilis PI 334961)] showed high concordance of segregation with the dominant allele of oat crown rust resistance. From 300 tested plants representing populations 848 [Avena sativa ‘Chestnut 1’ x (Avena sativa ‘Harmon’ x Avena sterilis PI 334961)) and 851 [Avena sativa ‘Chestnut 2’ x (Avena sativa ‘Harmon’ x Avena sterilis PI 334961)], 188 plants and the parental forms ‘Bingo’, ‘Chestnut’, and Pc101 (Avena sativa ‘Harmon’ x Avena sterilis PI 334961) were randomly selected. Of the 188 tested plants, 95.2% were correctly classified. Of the 188 plants tested, 24 came from population 848 [Avena sativa ‘Chestnut 1’ x (Avena sativa ‘Harmon’ x Avena sterilis PI 334961)] and showed no genotype-phenotype mismatches (Fig. 1). Of the 188 plants tested, 164 came from population 851 [Avena sativa ‘Chestnut 2’ x (Avena sativa ‘Harmon’ x Avena sterilis PI 334961)] and showed 5.49% phenotype-marker mismatches (Figs. 1-4). The dominant allele was detected in line Pc101 (P1 - Avena sativa ‘Harmon’ x Avena sterilis PI 334961), while this amplicon was not detected in the parental form Chestnut (P2). The electrophoregrams (Fig. 1-4) show the amplified DNA fragments after including the primer pair no. 1 and 2 in the analysis, presented in the sequence list, proving the presence of the dominant allele of the crown rust resistance gene Pc101 derived from Avena sterilis PI 334961 in the tested genotypes.

PL 248969 Β1

SEQUENCE LIST

Sequence No. 1 (Starter 122_FlT)

5' CGGCTCATGCTGCCGCAT 3'

Sequence No. 2 (Starter 122RI)

5'CGACGAAGACGTCCCGGCG 3'

Sequence No. 3

5 ^! CGGCTCATGCTGCCGCAGCCTGCATCCGGGACAGCGTCGTCGTCGGCGGCG

GCGTCTCCAGGGGGGCTCGCGTCGACTGAATCTTTCCTG TCGCACCTCATCTCG

CCAGCGGGCGGCGGCGCCGGGACGTCTTCGTCG 3‘

Claims (3)

Patent claims 1. Pair of oligonucleotide primers for detection of alleles in the dominant crown rust resistance gene Pc101 from Avena sterilis PI 334961 in common oat plants with sequence numbers 1 and 2, presented in the sequence listing. 2. A method for identifying the dominant allele of the crown rust resistance gene Pc101 from Avena sterilis PI 334961 in common oat plants, in which a polymorphic DNA fragment coupled to the gene under study is amplified in a PCR reaction using a pair of primers, followed by detection of the amplification product, characterized in that the pair of primers is a pair of oligonucleotide primers with sequences no. 1 and 2, presented in the sequence list, wherein the marker 122_T, presented in Fig. 1-4, is used. 3. The method according to claim 2, characterized in that as a result of the PCR reaction, a DNA fragment of 138 base pairs in length with sequence No. 3 shown in the sequence listing is amplified.