PL248751B1 - A pair of oligonucleotide primers for detection and a method for detecting the recessive allele of the crown rust resistance gene Pc101 derived from Avena sterilis PI 334961 in the genome of common oat (Avena sativa L.) - Google Patents
A pair of oligonucleotide primers for detection and a method for detecting the recessive allele of the crown rust resistance gene Pc101 derived from Avena sterilis PI 334961 in the genome of common oat (Avena sativa L.)Info
- Publication number
- PL248751B1 PL248751B1 PL450067A PL45006724A PL248751B1 PL 248751 B1 PL248751 B1 PL 248751B1 PL 450067 A PL450067 A PL 450067A PL 45006724 A PL45006724 A PL 45006724A PL 248751 B1 PL248751 B1 PL 248751B1
- Authority
- PL
- Poland
- Prior art keywords
- avena
- pair
- resistance gene
- sterilis
- rust resistance
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Przedmiot zgłoszenia stanowi para oligonukleotydowych starterów do wykrywania allelu recesywnego genu odporności na rdzę koronową Pc101 z Avena sterilis PI 334961 w roślinach owsa o sekwencjach nr 1 i 2 przedstawionych na liście sekwencji. Przedmiotem zgłoszenia jest ponadto sposób identyfikacji allelu recesywnego genu odporności na rdzę koronową Pc101 z Avena sterilis PI 334961 w roślinach owsa, w którym polimorficzny fragment DNA sprzężony z badanym genem amplifikowany jest w reakcji PCR z zastosowaniem pary starterów, po czym dokonuje się detekcji produktu amplifikacji, a parę starterów stanowi para oligonukleotydów o sekwencjach nr 1 i 2 przedstawionych na liście sekwencji, przy czym stosuje się marker 496_C.The subject of the application is a pair of oligonucleotide primers for detecting the recessive allele of the crown rust resistance gene Pc101 from Avena sterilis PI 334961 in oat plants with sequences no. 1 and 2 presented in the sequence listing. The subject of the application is also a method for identifying the recessive allele of the crown rust resistance gene Pc101 from Avena sterilis PI 334961 in oat plants, wherein a polymorphic DNA fragment linked to the gene being tested is amplified in a PCR reaction using a pair of primers, followed by detection of the amplification product, and the pair of primers is a pair of oligonucleotides with sequences no. 1 and 2 presented in the sequence listing, wherein the 496_C marker is used.
Description
Opis wynalazkuDescription of the invention
Przedmiot wynalazku stanowi para oligonukleotydowych starterów do wykrywania allelu recesywnego genu odporności na rdzę koronową Pc101 pochodzącego z Avena sterilis PI 334961 w roślinach owsa.The subject of the invention is a pair of oligonucleotide primers for detecting the recessive allele of the crown rust resistance gene Pc101 derived from Avena sterilis PI 334961 in oat plants.
Znaczenie gospodarcze owsa (Avena sativa L.), szczególnie jako zboża przeznaczonego do konsumpcji przez człowieka, a nie na cele paszowe, w ostatnich latach rośnie, z uwagi na doceniane przez konsumentów walory prozdrowotne. Polska jako czwarty z największych światowych producentów każdego roku wprowadza na rynek nowe, coraz lepiej plonujące odmiany. Niestety są to odmiany o niskiej odporności na choroby grzybowe. Choroby wywoływane przez patogeny grzybowe takie jak mączniak prawdziwy, rdza koronowa czy rdza źdźbłowa pojawiają się rokrocznie i są jednym z głównych czynników biotycznych ograniczających plonowanie. Chorobą grzybową będącą przyczyną znaczących strat w plonach, z uwagi na obniżenie intensywności fotosyntezy w zainfekowanych tkankach, jest rdza koronowa powodowana przez grzyb Puccinia coronata Cda. f. sp. avenae P. Syd. & Syd. Jak stwierdzono w przeprowadzonych badaniach wszystkie polskie odmiany owsa są wysoce podatne na rdzę koronową (Sowa, S., Paczos-Grzęda, E., 2020, A study of crown rust resistance in historical and modern oat culitivars representing 120 years of Polish oat breeding. Euphytica 216, 1-10; Koroluk A, Paczos-Grzęda E., Sowa S., Bączkowska M., Toporowska J. 2022, Diversity of Polish oat cultivars with a glance at breeding history and perspectives. Agronomy-Basel Vol 12 (10)2423). Najlepszym sposobem poprawy zdrowotności odmian jest wprowadzanie genetycznie uwarunkowanej odporności, w postaci genów głównych R. Jednym z takich genów odporności jest Pc101 wprowadzony do owsa zwyczajnego z dzikiego gatunku Avena sterilis (genotyp PI 334961) poprzez krzyżowanie z odmianą Avena sativa ‘Harmon’. W potomstwie uzyskanych mieszańców wyselekcjonowano linie homozygotyczne zarówno pod względem alleli genu Pc101, jak i większości pozostałych genów w roślinie. Z uwagi na wysoką skuteczność gen Pc101 może być z powodzeniem wykorzystywany w hodowli odpornościowej owsa, stanowiąc obiecujący pod względem efektywności i trwałości samodzielny gen odporności, jak również komponent piramid genowych w nowych odmianach (Paczos-Grzęda, E., Róg, S., Koroluk, A., Okoń, S., Ostrowska, A., Ociepa, T., Erdzik, R. Chrząstek, M., Kowalczyk, K., 2014. Virulence structure of Puccinia coronata f. sp. avenae in Central and South Eastern Poland 2020; Paczos-Grzęda, E., Sowa, S., 2019. Virulence structure und diversity of Puccinia coronata f. sp. avenae P. syd. & syd in Poland during 2013 to 2015. Plant Dis. 103. 1559-1564; Sowa, S., Paczos-Grzęda, E., 2017. Puccinia coronata f. sp. avenae virulence in south-eastern Poland in 2014. Folia Pomer. Univ. Technol. Stetin., Agric., Aliment. Pisc., Zootech. 336:43, 157-166; Sowa, S., Paczos-Grzęda, E., 2021. Virulence structure of Puccinia coronata f. sp. avenae and effectiveness of Pc resistance genes in Poland during 2017-2019. Phytopathology Vol. 111, No. 7 s. 1158-1165). Aby usprawnić, ułatwić i przyśpieszyć proces wprowadzania nowych genów głównych do materiałów hodowlanych zalecane jest wykorzystywanie markerów molekularnych. Bazujące na metodzie PCR markery DNA wykorzystywane są we współczesnej hodowli wspomaganej markerami. Markery stanowią szczególnie użyteczne narzędzie w hodowli odpornościowej gdyż umożliwiają pewną i szybką identyfikację form zawierających określone kombinacje alleli genów na wczesnych etapach rozwoju rośliny w bardzo krótkim czasie. Testy molekularne zastępują pracochłonne i wymagające specjalistycznej wiedzy testy fizjologiczne.The economic importance of oats (Avena sativa L.), particularly as a grain intended for human consumption rather than for animal feed, has been growing in recent years due to its health benefits appreciated by consumers. Poland, as the world's fourth largest producer, introduces new, increasingly high-yielding varieties to the market each year. Unfortunately, these varieties have low resistance to fungal diseases. Diseases caused by fungal pathogens such as powdery mildew, crown rust, and stem rust appear annually and are one of the main biotic factors limiting yields. Crown rust, caused by the fungus Puccinia coronata Cda. f. sp. avenae P. Syd. & Syd., is a fungal disease that causes significant yield losses due to reduced photosynthesis in infected tissues. As stated in the conducted studies, all Polish oat cultivars are highly susceptible to crown rust (Sowa, S., Paczos-Grzęda, E., 2020, A study of crown rust resistance in historical and modern oat cultivars representing 120 years of Polish oat breeding. Euphytica 216, 1-10; Koroluk A, Paczos-Grzęda E., Sowa S., Bączkowska M., Toporowska J. 2022, Diversity of Polish oat cultivars with a glance at breeding history and perspectives. Agronomy-Basel Vol 12 (10) 2423). The best way to improve the health of varieties is to introduce genetically determined resistance, in the form of major R genes. One such resistance gene is Pc101, introduced into common oats from the wild species Avena sterilis (genotype PI 334961) through crossbreeding with the Avena sativa 'Harmon' cultivar. In the progeny of the resulting hybrids, homozygous lines were selected for both the Pc101 gene alleles and most of the other genes in the plant. Due to its high effectiveness, the Pc101 gene can be successfully used in oat resistance breeding, constituting a promising independent resistance gene in terms of effectiveness and durability, as well as a component of gene pyramids in new varieties (Paczos-Grzęda, E., Róg, S., Koroluk, A., Okoń, S., Ostrowska, A., Ociepa, T., Erdzik, R. Chrząstek, M., Kowalczyk, K., 2014. Virulence structure of Puccinia coronata f. sp. avenae in Central and South Eastern Poland 2020; Paczos-Grzęda, E., Sowa, S., 2019. Virulence structure and diversity of Puccinia coronata f. sp. avenae P. syd. & syd in Poland during 2013 to 2015. Plant Dis. 103. 1559-1564; Sowa, S., Paczos-Grzęda, E., 2017. Puccinia coronata f. sp. avenae virulence in southeastern Poland in 2014. Folia Pomer. Univ. Technol. Stetin., Agric., Aliment. Pisc., Zootech. 336:43, 157-166; Sowa, S., Paczos-Grzęda, E., 2021. Virulence structure of Puccinia coronata f. sp. avenae and effectiveness of Pc resistance genes in Poland during 2017-2019. Phytopathology Vol. 111, No. 7 pp. 1158-1165). To improve, facilitate, and accelerate the process of introducing new main genes into breeding materials, the use of molecular markers is recommended. PCR-based DNA markers are used in contemporary marker-assisted breeding. Markers are a particularly useful tool in resistance breeding because they enable the reliable and rapid identification of forms containing specific combinations of gene alleles at early stages of plant development in a very short time. Molecular tests replace labor-intensive physiological tests requiring specialized knowledge.
Celem wynalazku było znalezienie takiej pary oligonukleotydów, która umożliwiłaby identyfikację allelu dominującego genu Pc101 pochodzącego z Avena sterilis PI 334961 w roślinach owsa zarówno w stadium siewki, jak i rośliny dorosłej.The aim of the invention was to find a pair of oligonucleotides that would enable the identification of the dominant allele of the Pc101 gene derived from Avena sterilis PI 334961 in oat plants both at the seedling and adult plant stage.
Przedmiot wynalazku stanowi para oligonukleotydowych starterów do wykrywania allelu recesywnego genu odporności na rdzę koronową Pc101 pochodzącego z Avena sterilis PI 334961, w roślinach owsa o sekwencjach nr 1 i 2, przedstawionych na liście sekwencji.The subject of the invention is a pair of oligonucleotide primers for detecting the recessive allele of the crown rust resistance gene Pc101 derived from Avena sterilis PI 334961 in oat plants with sequence numbers 1 and 2, presented in the sequence listing.
Sposób identyfikacji allelu dominującego genu odporności na rdzę koronową Pc101 pochodzącego z Avena sterilis PI 334961 w roślinach owsa, w którym to sposobie polimorficzny fragment DNA sprzężony z badanym genem amplifikowany jest w reakcji PCR z zastosowaniem pary starterów, po czym dokonuje się detekcji produktu amplifikacji, charakteryzuje się tym, że parę starterów stanowi para oligonukleotydów o sekwencjach nr 1 i 2, przedstawionych na liście sekwencji, przy czym stosuje się marker 496_C, przedstawiony na Fig. 1-3, o długości 127 pz związany z obecnością w roślinach owsa allelu dominującego genu odporności na rdzę koronową Pc101 pochodzącego z Avena sterilis PI 334961 (sekwencja nr 3).A method for identifying the dominant allele of the crown rust resistance gene Pc101 derived from Avena sterilis PI 334961 in oat plants, in which a polymorphic DNA fragment coupled to the gene under investigation is amplified in a PCR reaction using a pair of primers, followed by detection of the amplification product, is characterized in that the pair of primers is a pair of oligonucleotides with sequences no. 1 and 2, presented in the sequence list, wherein the marker 496_C, presented in Fig. 1-3, of 127 bp in length associated with the presence in oat plants of the dominant allele of the crown rust resistance gene Pc101 derived from Avena sterilis PI 334961 (sequence no. 3), is used.
Fig. 1 przedstawia produkty PCR uzyskane w wyniku amplifikacji DNA roślin pokolenia F2 populacji 848 [Avena sativa ‘Kasztan 1’ x (Avena sativa Harmon’ x Avena sterilis PI 334961)] i 851 [Avena sativa ‘Kasztan 2’ x (Avena sativa ‘Harmon’ x Avena sterilis PI 334961)] po włączeniu do reakcji pary starterów nr 1 i 2, przedstawionych na liście sekwencji.Figure 1 shows the PCR products obtained by amplification of DNA from F2 generation plants of populations 848 [Avena sativa ‘Chestnut 1’ x (Avena sativa Harmon’ x Avena sterilis PI 334961)] and 851 [Avena sativa ‘Chestnut 2’ x (Avena sativa ‘Harmon’ x Avena sterilis PI 334961)] after incorporating primer pairs no. 1 and 2, presented in the sequence listing, into the reaction.
Numery 1-24 - rośliny populacji 848 [Avena sativa ‘Kasztan 1’x (Avena sativa Harmon' x Avena sterilis PI 334961)] opisane pod względem fenotypu: numery 1-10 - homozygoty odporne; numery 11-20 homozygoty wrażliwe na porażenie; numery 21-24 - heterozygoty; numery 25-46 - rośliny populacji 851 [Avena sativa ‘Kasztan 2’ x (Avena sativa ‘Harmon’ x Avena sterilis PI 334961)] opisane pod względem fenotypu: numery 25-34 - homozygoty odporne; numery 35-44 - homozygoty wrażliwe na porażenie: numery 45-46 - heterozygoty; P1 - linia Pc101 Avena sativa ’Harmon’x Avena sterilis PI 334961, P2 - Avena sativa ‘Kasztan’ - formy rodzicielskie badanych populacji; M - marker wielkości GeneRulerTM 50 bp DNA Ladder.Numbers 1-24 - plants of population 848 [Avena sativa ‘Chestnut 1’ x (Avena sativa Harmon’ x Avena sterilis PI 334961)] described as to the phenotype: numbers 1-10 - homozygotes resistant; numbers 11-20 homozygotes susceptible to infection; numbers 21-24 - heterozygotes; numbers 25-46 - plants of population 851 [Avena sativa ‘Chestnut 2’ x (Avena sativa ‘Harmon’ x Avena sterilis PI 334961)] described as to the phenotype: numbers 25-34 - homozygotes resistant; numbers 35-44 - homozygotes susceptible to infection: numbers 45-46 - heterozygotes; P1 - line Pc101 Avena sativa ’Harmon’x Avena sterilis PI 334961, P2 - Avena sativa ‘Kasztan’ - parental forms of the tested populations; M - GeneRulerTM 50 bp DNA Ladder size marker.
Fig. 2 przedstawia produkty PCR uzyskane w wyniku amplifikacji DNA roślin pokolenia F2 populacji 848 [Avena sativa ‘Kasztan 1’ x (Avena sativa ‘Harmon’ x Avena sterilis PI 334961)] po włączeniu do reakcji pary starterów nr 1 i 2, przedstawionych na liście sekwencji.Figure 2 shows the PCR products obtained by amplification of DNA from F2 generation plants of population 848 [Avena sativa ‘Chestnut 1’ x (Avena sativa ‘Harmon’ x Avena sterilis PI 334961)] after incorporating the primer pair no. 1 and 2 shown in the sequence listing into the reaction.
Numery 1-48 - rośliny populacji 848 [Avena sativa ‘Kasztan 1’ x (Avena sativa ‘Harmon’ x Avena sterilis PI 334961)] opisane pod względem fenotypu: numery 1-20 - homozygoty odporne; numery 21-40 homozygoty wrażliwe na porażenie: numery 41-48 - heterozygoty; M - marker wielkości GeneRulerTM 50 bp DNA Ladder.Numbers 1-48 - plants of population 848 [Avena sativa ‘Chestnut 1’ x (Avena sativa ‘Harmon’ x Avena sterilis PI 334961)] described in terms of phenotype: numbers 1-20 - homozygotes resistant; numbers 21-40 homozygotes susceptible to the infection: numbers 41-48 - heterozygotes; M - GeneRulerTM 50 bp DNA Ladder size marker.
Fig. 3 przedstawia produkty PCR uzyskane w wyniku amplifikacji DNA roślin pokolenia F2 populacji 851 [Avena sativa ‘Kasztan 2’ x (Avena sativa ‘Harmon’ x Avena sterilis PI 334961)] po włączeniu do reakcji pary starterów nr 1 i 2, przedstawionych na liście sekwencji.Figure 3 shows the PCR products obtained by amplification of DNA from F2 generation plants of population 851 [Avena sativa ‘Chestnut 2’ x (Avena sativa ‘Harmon’ x Avena sterilis PI 334961)] after incorporating the primer pair no. 1 and 2 shown in the sequence listing into the reaction.
Numery 1-48 - rośliny populacji 851 - Avena sativa ‘Kasztan 2’ x (Avena sativa ‘Harmon’ x Avena sterilis PI 334961) opisane pod względem fenotypu: numery 1-20 - homozygoty odporne; numery 21-40 - homozygoty wrażliwe na porażenie: numery 41-48 - heterozygoty; M - marker wielkości GeneRulerTM 50 bp DNA Ladder.Numbers 1-48 - plants of population 851 - Avena sativa ‘Chestnut 2’ x (Avena sativa ‘Harmon’ x Avena sterilis PI 334961) described in terms of phenotype: numbers 1-20 - homozygotes resistant; numbers 21-40 - homozygotes susceptible to the infection: numbers 41-48 - heterozygotes; M - GeneRulerTM 50 bp DNA Ladder size marker.
W pierwszym etapie wytworzono 2 populacje mieszańcowe 848 [Avena sativa Kasztan 1’ x (Avena sativa ‘Harmon’ x Avena sterilis PI 334961)] i 851 [Avena sativa Kasztan 2’ x (Avena sativa ‘Harmon’ x Avena sterilis PI 334961)], w których dawcą genu odporności na rdzę koronową owsa jest linia zawierająca gen Pc101, będąca formą mieszańcową Avena sativa ‘Harmon’ x Avena sterilis PI 334961. Następnie za pomocą testu fizjologicznego prowadzonego na 300 liniach pokolenia F3 zidentyfikowano rośliny homozygotyczne, dominujące - odporne; rośliny heterozygotyczne - segregujące pod względem odporności na rdzę koronową oraz rośliny homozygotyczne, recesywne - wrażliwe na porażenie w stosunku ilościowym 1:2:1 odpowiadającym dziedziczeniu monogenicznemu. Po wyizolowaniu DNA z roślin o przeciwstawnych fenotypach (odpornych/porażonych) oraz heterozygot poddano je komercyjnej analizie polimorfizmu DArTseq (Diversity Array Technologies Ltd. Canberra, Australia) polegającej na sekwencjonowaniu zredukowanej reprezentacji genomu. Wyniki uzyskano w postaci macierzy binarnych dla 90 roślin. Po przyporządkowaniu segregacji fenotypów do segregacji markerów DArTseq zidentyfikowano sekwencje DArTseq, które po zlokalizowaniu na genomie odmiany owsa zwyczajnego Sang (https://wheat.pw.usda.gov/blast/; Kamal, N., Tsardakas-Renhuldt, N., Bentzer. J. et al. 2022. The mosaic oat genome gives insights into a uniquely healthy cereal crop. Nature 606, 113-119) wydłużono na końcach 5’ oraz 3’ i stały się one podstawą do zaprojektowania odpowiednich par starterów nr 1 i 2, przedstawionych na liście sekwencji.In the first stage, two hybrid populations were created: 848 [Avena sativa Chestnut 1’ x (Avena sativa ‘Harmon’ x Avena sterilis PI 334961)] and 851 [Avena sativa Chestnut 2’ x (Avena sativa ‘Harmon’ x Avena sterilis PI 334961)], in which the donor of the oat crown rust resistance gene is a line containing the Pc101 gene, which is a hybrid form of Avena sativa ‘Harmon’ x Avena sterilis PI 334961. Then, using a physiological test carried out on 300 lines of the F3 generation, homozygous, dominant - resistant plants were identified; Heterozygous plants, segregating for crown rust resistance, and homozygous, recessive plants, susceptible to the disease, were isolated in a 1:2:1 ratio, consistent with monogenic inheritance. After DNA isolation from plants with opposing phenotypes (resistant/affected) and heterozygotes, they were subjected to commercial polymorphism analysis using DArTseq (Diversity Array Technologies Ltd., Canberra, Australia), which involves sequencing a reduced representation of the genome. The results were obtained in the form of binary arrays for 90 plants. After assigning the segregation of phenotypes to the segregation of DArTseq markers, DArTseq sequences were identified, which, after being located on the genome of the common oat cultivar Sang (https://wheat.pw.usda.gov/blast/; Kamal, N., Tsardakas-Renhuldt, N., Bentzer. J. et al. 2022. The mosaic oat genome gives insights into a uniquely healthy cereal crop. Nature 606, 113-119), were extended at the 5' and 3' ends and became the basis for designing the appropriate primer pairs no. 1 and 2, presented in the sequence list.
Z udziałem oligonukleotydowych starterów nr 1 i 2, przedstawionych na liście sekwencji, uzyskano dominujący marker 496_C (Fig. 1-3), który w prosty i szybki sposób identyfikuje rośliny owsa posiadające allel recesywny genu odporności na rdzę koronową Pc101 pochodzący z Avena sterilis PI 334961. Marker 496_C w oparciu o wyniki analizy segregacji produktu 496_C o długości 127 pz, wykazywał sprzężenie genetyczne z locus genu odporności na rdzę koronową Pc101 z Avena sterilis PI 334961, ma charakter specyficzny, bazuje na reakcji PCR oraz generuje łatwe w interpretacji i powtarzalne wyniki umożliwiając jego zastosowanie w selekcji wspomaganej markerami.Using oligonucleotide primers no. 1 and 2, presented in the sequence list, a dominant marker 496_C was obtained (Fig. 1-3), which easily and quickly identifies oat plants possessing a recessive allele of the crown rust resistance gene Pc101 from Avena sterilis PI 334961. Marker 496_C, based on the results of segregation analysis of the 127 bp long 496_C product, showed genetic linkage with the locus of the crown rust resistance gene Pc101 from Avena sterilis PI 334961. It is specific, based on the PCR reaction and generates easy-to-interpret and reproducible results, enabling its use in marker-assisted selection.
Przeprowadzone badania markera 496_C wykazały, że jest on znacznikiem allelu recesywnego genu odporności na rdzę koronową Pc101 z Avena sterilis PI 334961 w owsie zwyczajnym.The conducted tests on the 496_C marker showed that it is a marker of the recessive allele of the crown rust resistance gene Pc101 from Avena sterilis PI 334961 in common oats.
Zastosowanie markera 496_C może być przydatne do identyfikacji genu odporności na rdzę koronową Pc101 z Avena sterilis PI 334961 obecnego w materiałach hodowlanych owsa. Podstawową zaletą opracowanego systemu identyfikacji jest możliwość określenia w bardzo krótkim czasie genotypu rośliny już w stadium kilkudniowej siewki, niezależność od warunków środowiska oraz fazy rozwojowejThe 496_C marker may be useful for identifying the crown rust resistance gene Pc101 from Avena sterilis PI 334961 present in oat breeding materials. The primary advantage of the developed identification system is the ability to quickly determine the plant genotype at the seedling stage, independent of environmental conditions and developmental stage.
PL 248751 Β1 rośliny, a także niezależność od obecności bądź braku porażenia określonym izolatem Puccinia coronata f. sp. avenae.PL 248751 Β1 plants, as well as independence from the presence or absence of infection with a specific isolate of Puccinia coronata f. sp. avenae.
Sposób identyfikacji markera 496_CMethod of identifying the 496_C marker
Materiał:Material:
DNA izolowane z liści owsa przy wykorzystaniu komercyjnie dostępnych zestawów.DNA isolated from oat leaves using commercially available kits.
Skład mieszaniny w reakcji PCR (Polymerase Chain rection):Composition of the mixture in the PCR (Polymerase Chain Reaction) reaction:
Sekwencje starterów:Primer sequences:
Sekwencja nr 1: 496_F7 5’ GACTCGAAGAAGTAAACTGAAGTC 3'Sequence No. 1: 496_F7 5' GACTCGAAGAAGTAAACTGAAGTC 3'
Sekwencja nr 2: 496_R2C 5’ AGGTCGCCGCCTTCATCG 3'Sequence No. 2: 496_R2C 5' AGGTCGCCGCCTTCATCG 3'
Startery projektowano przy użyciu programu Primer 3.0.Primers were designed using Primer 3.0.
Warunki amplifikacji DNADNA amplification conditions
Reakcję PCR przeprowadzono w termocyklerach: SimpliAmp (Applied Biosystems) lub ProFlex (Applied Biosystems)The PCR reaction was performed in thermal cyclers: SimpliAmp (Applied Biosystems) or ProFlex (Applied Biosystems)
Profil termiczny reakcji PCR: 94°C - 4 min., 37 cykli (94°C-30 s., 58°C-30 s., 72°C-45 s), 72°C-7 min.PCR reaction thermal profile: 94°C - 4 min., 37 cycles (94°C-30 s., 58°C-30 s., 72°C-45 s.), 72°C-7 min.
Identyfikacja markera 496_C:Marker identification 496_C:
Elektroforeza w 1,5% żelu agarozowym zawierającym 0,5 pg/ml bromku etydyny w buforze TBE (pH 8,0) przy napięciu 100V przez 2 godziny. Jako wzorzec długości fragmentów DNA użyto GeneRuler™ 50 bp plus DNA Ladder (ThermoFisher Scientific, USA). Wizualizacji markera dokonano wykorzystując system Uvidoc HD6 (Uvitec, Cambridge, UK).Electrophoresis was carried out on a 1.5% agarose gel containing 0.5 pg/ml ethidium bromide in TBE buffer (pH 8.0) at 100V for 2 hours. GeneRuler™ 50 bp plus DNA Ladder (ThermoFisher Scientific, USA) was used as a DNA fragment length standard. Marker visualization was performed using the Uvidoc HD6 system (Uvitec, Cambridge, UK).
Wyniki:Results:
Testowanie markera 496_C na osobnikach populacji 848 [Avena sativa ‘Kasztan 1’ x (Avena sativa 'Harmon’ Avena sterilis PI 334961)] i 851 [Avena sativa ‘Kasztan 2’ x (Avena sativa ‘Harmon’ x Avena sterilis PI 334961)] wykazało wysoką zgodność segregacji z allelem recesywnym odporności na rdzę koronową owsa. Spośród 300 testowanych roślin reprezentujących populacje 848 [Avena sativa ‘Kasztan 1’ x (Avena sativa ‘Harmon’ x Avena sterilis PI 334961)] i 851 [Avena sativa ‘Kasztan 2’ x (Avena sativa ‘Harmon’ x Avena sterilis PI 334961)], wybrano losowo 142 rośliny oraz formy rodzicielskie: ‘Bingo’, ‘Kasztan’ i Pc101 Avena sativa ‘Harmon’ x Avena sterilis PI 334961). Na 142 testowane rośliny 98% zostało właściwie zakwalifikowanych. Spośród 142 testowanych roślin 72 pochodziły z populacji 848 [Avena sativa ‘Kasztan 1’ x (Avena sativa ‘Harmon’ x Avena sterilis PI 334961)] i stwierdzono w nich 2,78% niedopasowań genotypu z fenotypem (Fig. 1, Fig. 2). 70 spośród 142 testowanych roślin pochodziło z populacji 851 [Avena sativa 'Kasztan 2' x (Avena sativa ‘Harmon’ x Avena sterilis PI 334961)] i stwierdzono w nich 1,43% niedopasowań fenotypu z markerem (Fig. 1, Fig. 3). Obecność allelu recesywnego stwierdzono w linii Pc101 (P1 - Avena sativa ‘Harmon’ z Avena sterilis PI 334961), zaś w formie rodzicielskiej Kasztan (P2) nie stwierdzono obecności tego amplikonu. Na elektroforegramach (Fig. 1-3) przedstawiono amplifikowane fragmenty DNA po włączeniu do analizy pary starterów nr 1 i 2, przedstawionych na liście sekwencji, świadczące o obecności w badanych genotypach allelu recesywnego genu odporności na rdzę koronową Pc101 pochodzącego z Avena sterilis PI 334961.Testing of marker 496_C on individuals of populations 848 [Avena sativa ‘Chestnut 1’ x (Avena sativa 'Harmon’ Avena sterilis PI 334961)] and 851 [Avena sativa ‘Chestnut 2’ x (Avena sativa ‘Harmon’ x Avena sterilis PI 334961)] showed high concordance of segregation with the recessive allele for oat crown rust resistance. From 300 tested plants representing populations 848 [Avena sativa ‘Chestnut 1’ x (Avena sativa ‘Harmon’ x Avena sterilis PI 334961)] and 851 [Avena sativa ‘Chestnut 2’ x (Avena sativa ‘Harmon’ x Avena sterilis PI 334961)], 142 plants and the parental forms ‘Bingo’, ‘Chestnut’ and Pc101 Avena sativa ‘Harmon’ x Avena sterilis PI 334961) were randomly selected. Of the 142 tested plants, 98% were correctly classified. Of the 142 plants tested, 72 were from population 848 [Avena sativa ‘Chestnut 1’ x (Avena sativa ‘Harmon’ x Avena sterilis PI 334961)] and showed 2.78% genotype-phenotype mismatches (Fig. 1, Fig. 2). Of the 142 plants tested, 70 were from population 851 [Avena sativa ‘Chestnut 2’ x (Avena sativa ‘Harmon’ x Avena sterilis PI 334961)] and showed 1.43% phenotype-marker mismatches (Fig. 1, Fig. 3). The presence of the recessive allele was detected in the Pc101 line (P1 - Avena sativa ‘Harmon’ from Avena sterilis PI 334961), while in the parental form Kasztan (P2) this amplicon was not detected. The electropherograms (Fig. 1-3) show the amplified DNA fragments after including the primer pair no. 1 and 2 in the analysis, presented in the sequence list, proving the presence of the recessive allele of the Pc101 crown rust resistance gene derived from Avena sterilis PI 334961 in the tested genotypes.
Claims (3)
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| PL450067A PL248751B1 (en) | 2024-10-17 | 2024-10-17 | A pair of oligonucleotide primers for detection and a method for detecting the recessive allele of the crown rust resistance gene Pc101 derived from Avena sterilis PI 334961 in the genome of common oat (Avena sativa L.) |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| PL450067A PL248751B1 (en) | 2024-10-17 | 2024-10-17 | A pair of oligonucleotide primers for detection and a method for detecting the recessive allele of the crown rust resistance gene Pc101 derived from Avena sterilis PI 334961 in the genome of common oat (Avena sativa L.) |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| PL450067A1 PL450067A1 (en) | 2025-08-04 |
| PL248751B1 true PL248751B1 (en) | 2026-01-26 |
Family
ID=96584840
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PL450067A PL248751B1 (en) | 2024-10-17 | 2024-10-17 | A pair of oligonucleotide primers for detection and a method for detecting the recessive allele of the crown rust resistance gene Pc101 derived from Avena sterilis PI 334961 in the genome of common oat (Avena sativa L.) |
Country Status (1)
| Country | Link |
|---|---|
| PL (1) | PL248751B1 (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| PL422536A1 (en) * | 2017-08-11 | 2019-02-25 | Uniwersytet Przyrodniczy W Lublinie | A pair of starter oligonucleotides for detecting, and the method for detecting of the recessive allele of immunity gene Pc39 to crown rust in the plants of common oat (Avena sativa L.) |
| PL438756A1 (en) * | 2021-08-16 | 2023-02-20 | Uniwersytet Przyrodniczy W Lublinie | Pair of oligonucleotide primers for detection and method for detecting the allele of the recessive crown rust resistance gene from the subline of the hybrid form Avena sativa 'Pendek' x Avena sterilis CW-486 in oat plants (Avena sativa L.) |
| PL440934A1 (en) * | 2022-04-13 | 2023-10-16 | Uniwersytet Przyrodniczy W Lublinie | Pair of oligonucleotide primers for the detection and method of detecting the allele of the dominant crown rust resistance gene from the subline of the hybrid form A. sterilis PI 296244 x A. sativa TAM-O-312 in oat plants (Avena sativa L.) |
-
2024
- 2024-10-17 PL PL450067A patent/PL248751B1/en unknown
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| PL422536A1 (en) * | 2017-08-11 | 2019-02-25 | Uniwersytet Przyrodniczy W Lublinie | A pair of starter oligonucleotides for detecting, and the method for detecting of the recessive allele of immunity gene Pc39 to crown rust in the plants of common oat (Avena sativa L.) |
| PL438756A1 (en) * | 2021-08-16 | 2023-02-20 | Uniwersytet Przyrodniczy W Lublinie | Pair of oligonucleotide primers for detection and method for detecting the allele of the recessive crown rust resistance gene from the subline of the hybrid form Avena sativa 'Pendek' x Avena sterilis CW-486 in oat plants (Avena sativa L.) |
| PL440934A1 (en) * | 2022-04-13 | 2023-10-16 | Uniwersytet Przyrodniczy W Lublinie | Pair of oligonucleotide primers for the detection and method of detecting the allele of the dominant crown rust resistance gene from the subline of the hybrid form A. sterilis PI 296244 x A. sativa TAM-O-312 in oat plants (Avena sativa L.) |
Non-Patent Citations (1)
| Title |
|---|
| PARK RF AT AL.: "Theor Appl Genet. 2022 Nov;135(11):3709-3734. doi: 10.1007/s00122-022-04121-z. Epub 2022 Jun 4", BREEDING OAT FOR RESISTANCE TO THE CROWN RUST PATHOGEN PUCCINIA CORONATA F. SP. AVENAE: ACHIEVEMENTS AND PROSPECTS * |
Also Published As
| Publication number | Publication date |
|---|---|
| PL450067A1 (en) | 2025-08-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20230366039A1 (en) | Genetic markers for myb28 | |
| US10337072B2 (en) | Copy number detection and methods | |
| PL233477B1 (en) | A pair of starter oligonucleotides for detecting, and the method for detecting of the recessive allele of immunity gene Pc39 to crown rust in the plants of common oat (Avena sativa L.) | |
| PL245140B1 (en) | A pair of oligonucleotide primers for the detection and method of detecting the allele of the dominant crown rust resistance gene from the subline of the hybrid form A. sterilis PI 296244 x A. sativa TAM-O-312 in oat plants (Avena sativa L.) | |
| PL245142B1 (en) | A pair of oligonucleotide primers for the detection and method of detecting the recessive allele of the crown rust resistance gene from the subline of the hybrid form A. sterilis PI 296244 x A. sativa TAM-O-312 in oat plants (Avena sativa L.) | |
| PL243633B1 (en) | A pair of oligonucleotide primers for the detection and method of detecting the recessive allele of the crown rust resistance gene from the subline of the hybrid form Avena sativa 'Pendek' x Avena sterilis CW-486 in oat plants (Avena sativa L.) | |
| PL233478B1 (en) | A pair of starter oligonucleotides for detecting, and the method for detecting of the dominant allele of immunity gene to crown rust Pc39 in the plants of common oat (Avena sativa L.) | |
| US20160355838A1 (en) | Anaerobic germination-tolerant plants and related materials and methods | |
| RU2717017C2 (en) | Molecular markers for blackleg resistance gene rlm2 in brassica napus and methods of use thereof | |
| PL233476B1 (en) | Two pairs of starter oligonucleotides for detecting the presence of alleles of the dominating or recessive immunity gene to crown rust Pc39 in the genome of common oat (Avena sativa L.), combination of two starter pairs and method for detecting of the of gene Pc39 alleles system | |
| EP1466973A1 (en) | Characteristic base sequences occurring in plant genes and method of utilizing the same | |
| JP4775945B2 (en) | A method for identifying rice blast resistance using as a marker a molecular marker linked to the Pb1 gene | |
| RU2718584C2 (en) | Molecular markers of rlm4 gene of brassica napus black stem resistance and methods of using them | |
| PL244887B1 (en) | A pair of oligonucleotide primers for the detection and method of detecting the allele of the dominant crown rust resistance gene from the subline of the hybrid form A. sterilis PI 296244 x A. sativa TAM-O-312 in oat plants (Avena sativa L.) | |
| PL248753B1 (en) | A pair of oligonucleotide primers for detection and a method for detecting the recessive allele of the crown rust resistance gene Pc101 derived from Avena sterilis PI 334961 in the genome of common oat (Avena sativa L.) | |
| Al-Doss et al. | Impact of'Cre'and peroxidase genes of selected new wheat lines on cereal cyst nematode ('Heterodera Avenae'Woll) resistance | |
| PL248752B1 (en) | A pair of oligonucleotide primers for detection and a method for detecting the dominant allele of the crown rust resistance gene Pc101 derived from Avena sterilis PI 334961 in the genome of common oat (Avena sativa L.) | |
| PL248718B1 (en) | A pair of oligonucleotide primers for detection and a method for detecting the dominant allele of the crown rust resistance gene Pc101 derived from Avena sterilis PI 334961 in the genome of common oat (Avena sativa L.) | |
| PL248969B1 (en) | A pair of oligonucleotide primers for detection and a method for detecting the dominant allele of the crown rust resistance gene Pc101 derived from Avena sterilis PI 334961 in the genome of common oat (Avena sativa L.) | |
| PL249317B1 (en) | A pair of oligonucleotide primers for detection and a method for detecting the recessive allele of the crown rust resistance gene Pc101 derived from Avena sterilis PI 334961 in the genome of common oat (Avena sativa L.) | |
| PL248719B1 (en) | A pair of oligonucleotide primers for detection and a method for detecting the recessive allele of the crown rust resistance gene Pc101 derived from Avena sterilis PI 334961 in the genome of common oat (Avena sativa L.) | |
| PL248720B1 (en) | A pair of oligonucleotide primers for detection and a method for detecting the dominant allele of the crown rust resistance gene Pc101 derived from Avena sterilis PI 334961 in the genome of common oat (Avena sativa L.) | |
| BR112021012597A2 (en) | METHODS AND COMPOSITIONS TO SELECT AND/OR PREDICT COTTON PLANTS RESISTANT TO FUSERIUM RACE-4 RESISTANCE IN COTTON | |
| KR102680459B1 (en) | Tomato plants with improved disease resistance | |
| PL248967B1 (en) | A pair of oligonucleotide primers for detection and a method for detecting the recessive allele of the crown rust resistance gene from the subline isolated from the Iowa X270/X434 line obtained by crossing Avena sterilis Wahl No. 8 x Avena sativa in common oat (Avena sativa L.) plants |