NL9200943A - IMPROVED PROCESS FOR THE PREPARATION OF GLYCOSYL TRANSFERASES. - Google Patents

Description

Improved method for the preparation of glycosyl transferases.

The invention is in the field of recombinant DNA technology and provides an improved method for the preparation of glycosyl transferases by using transformed yeast strains.

Sugar groups from an activated donor substrate, usually a nucleotide sugar, are transferred by glycosyl transferases to a specific acceptor sugar to form a glycoside bond. Based on the type of sugar being transferred, these enzymes are classified in families, for example galactosyl transferases, sialyl transferases and fucosyl transferases. Since they are fixed-stay membrane proteins located primarily in the Golgi apparatus, the glycosyl transferases share a common domain structure consisting of a short tail in the cytoplasm at the amino-out end, a signal anchoring domain and a stretched stem region passing through a large catalytic domain at the carboxyl end is monitored. The signal anchoring domain serves as a non-cleavable signal peptide and as a membrane bridging region and orients the catalytic domain of the glycosyl transferase within the lumen of the Golgi apparatus. The lumen stem or spacer region is believed to function as a flexible line allowing the catalytic domain to glycosylate carbohydrate groups of membrane-bound and soluble proteins of the secretion pathway and pathway through the Golgi apparatus. It has further been discovered that the stem portion functions as a retention signal to keep the enzyme bound to the Golgi membrane (PCT Patent Application No. 9I / O6635). Soluble forms of glycosyl transferases are found in milk, serum and other body fluids. These soluble glycosyl transferases are believed to result from the proteolytic release of the corresponding membrane-bound forms of the enzymes by endogenous proteases, probably by cleavage between the catalytic domain and the transmembrane domain.

Enzymatic synthesis of carbohydrate structures has the advantage of high stereo selectivity and region selectivity, making the glycosyl transferases valuable tools for the modification or synthesis of glycoproteins, glycolipids and oligosaccharides. In contrast to chemical processes, the time-consuming application of protective groups is unnecessary.

Since glycosyl transferases occur in very small amounts in nature, isolation from natural sources and subsequent purification is difficult. Therefore, work has been carried out using recombinant DNA technology. For example, galactosyl transferases have been expressed in E. coli (PCT 90/07000) and in Chinese hamster ovary (CH0) cells (Smith, DF et al. (1990) J. Biol. Chem. 265, 6225-3 ^), sialyl transferases have been expressed in CHO cells (Lee, EU (1990) Diss. Abstr. Int. B. 50, 3453 "4) and in COS-1 cells (Paulsen, JC et al. (1988) J. Cell Biol. 107, 10A) and fucosyltransferases have been produced in COS-1 cells (Goelz, SE, et al. (1990) Cell 63, 1349-1356; Larsen RD et al. (1990) Proc. Natl. Acad Sci. USA 87, 6674-6678) and in CHO cells (Potvin, B. (1990) J. Biol. Chem. 265, 1615-1662). Heterologous expression in prokaryotes has the drawback of providing non-glycosylated products while glycosyl transferases are just glycoproteins. Glycosyl transferase production using mammalian hosts would be very expensive and complicated due to the presence of many endogenous glycosyl transferases which would contaminate the desired product. Therefore, there is a need for improved methods that enable the large-scale economic production of glycosyl transferases.

It is an object of the present invention to provide such methods.

The present invention provides a method for the preparation of biologically active glycosyl transferases by recombinant DNA technology using a yeast vector expression system.

More specifically, the present invention provides a method for the preparation of a membrane-bound glycosyl transferase from the group comprising galactosyl transferases, sialyl transferases and fucosyl transferases and variants thereof, which method comprises culturing a transformed yeast strain and recovering enzymatic activity, which yeast strain is transformed with a hybrid vector comprising an expression cassette, which cassette comprises a promoter and a DNA sequence encoding the glycosyl transferase or a variant, which DNA is regulated by the promoter.

In a first embodiment, the invention relates to a process for the preparation of a membrane-bound glycosyl transferase from the group comprising galactosyl transferases, sialyl transferases and fucosyl transferases and variants thereof, respectively, which method comprises culturing a transformed yeast strain and recovering the enzymatic activity, which yeast strain is transformed with a hybrid vector comprising an expression cassette, which cassette encodes a promoter, a DNA sequence encoding the glycosyl transferase or variant thereof, which DNA sequence is regulated by the promoter, and a DNA sequence containing yeast transcription termination signals includes.

In a second embodiment, the invention relates to a method for the preparation of a membrane-bound glycosyl transferase from the group of galactosyl transferases, sialyl transferases, fucosyl transferases and variants thereof, which method comprises cultivating a transformed yeast strain and recovering the enzymatic activity which yeast strain is transformed with a hybrid vector comprising an expression cassette, said cassette comprising a promoter operably linked to a first DNA sequence encoding a signal peptide and linked in the appropriate reading frame to a second DNA sequence encoding the glycosyl transferase or a variant thereof and comprising a DNA sequence with yeast transcription termination signals.

The term "glycosyl transferase" as used herein refers to the family of galactosyl transferases, the family of sialyl transferases, and the family of fucosyl transferases. The glycosyl transferases are naturally occurring mammalian enzymes, for example, from bovine, mouse, rat - or Human Origin Preferred are naturally occurring human complete glycosyl transferases, including the enzymes identified below by their EC numbers.

The membrane-bound galactosyl transferases and variants thereof, which are obtainable by the inventive method, catalyze the transfer of a galactose group from an activated donor, usually an activated nucleotide such as uridine diphosphate galactose (UDP-Gal) to a carbohydrate group.

Examples of membrane-bound galactosyl transferases are UDP galactose: β-galactoside a (1-3) galactosyl transferase (EC 2.4.I.I5I) which uses galactose as an acceptor substrate to form an α (1-3) bond and UDP galactose: β-N-acetylglucosamine-β (1-4) -galacto-syltransferase (EC 2.4.1.22) which transfers galactose to N-acetylglucosamine (GlcNAc) to form a β (1-4) bond as well variants thereof. In the presence of α-lactalbumin, the β (1-4) -galactosyl transferase also accepts glucose as the acceptor substrate whereby the synthesis of lactose is catalyzed.

The most preferred membrane-bound galactosyl transferase is the enzyme having the amino acid sequence depicted in Figure 1.

The membrane-bound sialyl transferases and the variants thereof available according to the method of the invention catalyze the transfer of sialic acids (e.g. N-acetylneuraminic acid (NeuAc)) from an activated donor, usually a cytidine monophosphate sialic acid (CMP-SA) to a carbohydrate acceptor group. An example of a membrane-bound sialyl transferase available according to the inventive method is the CMP-NeuAc: {$ -galactoside-a (2-6) -sialyl transferase (EC 2.4.99 * 1) containing the NeuAc-a (2 -6) Gal-β (1-4) GlcNAc sequence forms common in N-linked carbohydrate groups.

The most preferred membrane-bound sialyl transferase is the enzyme having the amino acid sequence depicted in Figure 3

The membrane-bound fucosyl transferases and variants thereof available according to the method of the invention catalyze the transfer of a fucose group from an activated donor, usually an activated nucleotide, such as guanosine diphosphate fucose (GDP-Fuc) to a carbohydrate group. Examples of such fucosyl transferases are GDP fucose: β-galactoside-a (1-2) fucosyl transferase (EC 2.4.1.69) and GDP fucose: N-acetylglucosamine-a (1-3 / 4) fucosyl transferase (EC 2.4.1.65).

The most preferred membrane-bound fucosyl transferase is the amino acid sequence enzyme depicted in Figure 5.

The term variants as used herein includes both membrane-bound and soluble variants of the naturally occurring membrane-bound glycosyl transferases derived from a mammal with the proviso that these variants are enzymatically active. Human origin variants are preferred.

For example, the term "variants" includes naturally occurring membrane-bound variants of membrane-bound glycosyl transferases found within a particular species, for example, a variant of a galactosyl transferase different from the enzyme having the amino acid sequence of Figure 1 in that there is a serine is missing at position 11 and the variant comprises the amino acids valine and tyrosine instead of alanine and leucine at positions 31 and 32, respectively. Such a variant can be encoded by a related gene of the same gene family or an allelic variant of a particular gene. The term "variants" also includes glycosyl transferases prepared from a DNA that has been subjected to in vitro mutagenesis, provided that the protein encoded by the DNA has the enzymatic activity of the natural glycosyl transferase. Such modifications may consist of an addition, exchange and / or deletion of amino acids, the latter of which results in shortened variants.

Preferred variants prepared according to the method of the invention are shortened variants, especially soluble variants, i.e. variants not bound to a membrane. Shortened variants include, for example, soluble forms of membrane-bound glycosyl transferases and their membrane-bound variants, for example, those listed above which are used by a transformed yeast strain used in the process of the invention, to divorce them. According to the present invention, these soluble enzymes are the preferred truncated variants.

The invention also relates to a method for the preparation of a soluble variant of a membrane-bound glycosyl transferase from the group comprising galactosyl transferases, sialyl transferases and fucosyl transferases, which method comprises culturing a transformed yeast strain and isolating the variant which yeast strain has been transformed with a hybrid vector comprising an expression cassette, which cassette comprises a promoter operably linked to a first DNA sequence encoding a signal peptide, which DNA sequence in the appropriate reading frame a second DNA sequence encoding the variant is linked and comprises a DNA sequence with yeast transcription termination signals.

By definition, the soluble form of a glycosyl transferase is a truncated variant that differs from the corresponding full form, ie the membrane-bound form naturally located in the endoplasmic reticulum or Golgi complex, by the absence of the cytoplasmic tail, the signal anchor and possibly part of the trunk area. The term "part of the stem region" as used herein is defined as a small portion of the N-terminal side of the stem region of up to 12 amino acids. In other words, the soluble variants prepared by the method of the the present invention encompasses virtually the entire strain region and the catalytic domain.

The soluble variants are enzymatically active enzymes which differ from the corresponding complete forms in the absence of an NH2 terminal peptide which lacks 26 to 671, in particular 26 to 61, amino acid groups with the proviso that the forms in which of the trunk area only missing the above-defined small part thereof. Soluble variants available from membrane-bound glycosyl transferases previously identified by their EC numbers, and additionally, soluble variants available from the membrane-bound fucosyl transferase of Figure 5 are preferred.

Preferred soluble variants of galactosyl transferases are distinguished from the corresponding full forms by the lack of an NH 2 terminal peptide that lacks 37 to 55, especially 4 to 44, amino acids. The most preferred soluble variant prepared by the inventive method of the invention is the enzyme having the amino acid sequence shown in Figure 2.

Preferred soluble variants of sialyl transferases lack an NH2 terminal peptide comprising 26 to 38 amino acids compared to the full form. The most preferred soluble variant prepared according to the inventive method of the invention is the amino acid sequence enzyme of Figure 4. Also, the soluble variant designated ST (Lys27-Cysi, 0g) is preferred, which variant includes amino acids 27 to 406 of the amino acid sequence shown in Figure 3.

The preferred soluble variants of fucosyltransferases differ from the corresponding complete enzymes in that they lack an NH 2 terminal peptide which comprises 56 to 67, in particular 56 to 61, amino acids. In particular, the soluble variant designated FT (Arg62-Arg / .05) is preferred, which variant comprises amino acids 62 to 405 of the amino acid sequence of Figure 5.

The yeast host strains and the components of the hybrid vectors are indicated below.

The transformed yeast strains are grown using methods known to a person skilled in the art.

Therefore, the transformed yeast strains of the invention are grown in a liquid medium comprising assimilable sources of carbon, nitrogen and inorganic salts.

Various carbon sources are usable. Examples of preferred carbon sources are assimilable carbohydrates such as glucose, maltose, mannitol, fructose or lactose or an acetate such as sodium acetate which can be used either individually or in suitable mixtures. Suitable nitrogen sources include, for example, amino acids such as casamino acids, peptides and proteins and degradation products thereof such as tryptone, peptone or meat extracts, further yeast extract, malt extract, liquid corn mixture as well as ammonium salts such as ammonium chloride, sulfate or nitrate which may be either individually or in a suitable mixture are applied. Inorganic salts that can be used include, for example, sulfates, chlorides, phosphates and carbonates of sodium, potassium, magnesium and calcium. In addition, the nutrient medium can also contain growth-promoting substances. For example, substances that promote growth include trace elements such as iron, zinc, manganese and the like or separate amino acids.

Because of the incompatibility of endogenous two-micron DNA and hybrid vectors carrying a replicon, yeast cells transformed with such hybrid vectors generally lose the replicon. Such yeast cells are to be cultured under selective conditions, i.e. conditions that require the expression of a plasmid-encoded gene for growth. Most of the selective markers currently used and present on the hybrid vectors of the invention (infra) are genes encoding enzymes for amino acid or purine biosynthesis. This makes it necessary to use synthetic minimal media deficient in the corresponding amino acid or the corresponding purine base. Genes that provide resistance to a suitable biocide can also be used [for example, a gene that confers resistance to the aminoglycoside G418]. Yeast cells transformed with vectors containing antibiotic resistance genes are grown in complex media containing the corresponding antibiotic, achieving faster growth rates and higher cell densities.

Hybrid vectors comprising the full two-micron DNA (which includes a functional replication origin) are stably maintained in strains of Saccharomyces cerevisiae lacking endogenous two-micron plasmids (so-called cir ° strains), so that the culture is under non-selective growing conditions, ie, can be carried out in a complex medium.

Yeast cells comprising hybrid plasmids with a constitutive promoter express DNA encoding a glycosyl transferase or a variant thereof and regulated by the promoter without induction. However, when the DNA is under the control of a regulated promoter, the composition of the growth medium must be adjusted to obtain maximum amounts of mRNA transcripts. For example, when using the PH05 promoter, the growth medium for derepression of this promoter should contain a low concentration of inorganic phosphate.

The culture is performed using conventional techniques. The culture conditions such as temperature, pH of the medium and fermentation time are chosen to produce maximum amounts of the heterologous protein. Preferably, a selected yeast strain is grown under aerobic conditions in a submerged culture with shaking or stirring and at a temperature of 25 to 35 ° C. preferably around 28 ° C, at a pH value of 4 to 7 », for example at pH 5» and for at least 1 to 3 days, preferably as long as the yield of protein is sufficient.

After expression in yeast, the glycosyl transferase or the variant thereof is either collected within the cells or secreted into the culture medium and isolated in the usual manner.

For example, the first step usually involves separating the cells from the culture broth by centrifugation. When the glycosyl transferase or its variant has accumulated within the cells, the protein must be released from the cell by destruction of the cell. Yeast cells can be destroyed in various well known ways: for example, by exerting mechanical forces such as shaking with glass beads, by ultrasonic vibration, by osmotic shock and / or by enzymatic digestion of the cell wall. When the glycosyl transferase or the variant thereof to be isolated is associated with or bound to a membrane fraction, further enrichment can be obtained, for example, by differential centrifugation of the cell extract and optionally subsequent treatment of the particular fraction with a detergent such as Triton. Methods suitable for the purification of the crude glycosyl transferase or the variant thereof include standard chromatography methods such as affinity chromatography for example with a suitable substrate, antibodies or Concanavalin A, ion exchange chromatography, gel filtration, partition chromatography, HPLC, electrophoresis, precipitation steps such as ammonium sulfate precipitation and other processes, in particular processes known from the literature.

When glycosyl transferase or its variant is secreted by the yeast cell into the periplasmic space, a simplified isolation protocol can be used: the protein is recovered without cell lysis by enzymatic removal of the cell wall or by chemical agents, for example, thiol reagents or EDTA which damage the cell wall that allow the release of the produced glycosyl transferase. When the glycosyl transferase or the variant thereof is secreted into the culture medium, it can be directly recovered and purified using the methods indicated above.

In order to detect glycosyl transferase activity, tests known from the literature can be used. For example, galactosyl transferase activity can be measured by measuring the amount of radioactivity labeled galactose that is incorporated into a suitable acceptor molecule such as a glycoprotein or a free sugar group. Analogously, sialyl transferase activity can be tested, for example, by incorporating sialic acid into suitable substrates, and fucosyl transferase activity, can be examined by transfer of fucose to a suitable acceptor.

The transformed yeast host cells of the invention can be prepared by recombinant DNA techniques comprising the steps of preparing a hybrid vector comprising a yeast promoter and a DNA sequence for a membrane-bound glycosyl transferase or a variant thereof encoding which DNA sequence is regulated by the promoter includes transforming a yeast host strain with the hybrid vector, and selecting transformed yeast cells from non-transformed yeast cells.

Expression vectors

The yeast hybrid vector of the invention comprises an expression cassette which cassette comprises a yeast promoter and a DNA sequence encoding a membrane bound glycosyl transferase or a variant thereof, which DNA sequence is controlled by the promoter.

In a first embodiment, the yeast hybrid vector of the invention comprises an expression cassette comprising a yeast promoter, a DNA sequence encoding a membrane bound glycosyl transferase or a variant thereof, which DNA sequence is regulated by the promoter and a DNA sequence with yeast transcription termination signals.

In a second embodiment, the yeast hybrid vector of the invention comprises an expression cassette, which cassette is a yeast promoter operably linked to a first DNA sequence encoding a signal peptide, which sequence is in the correct reading frame to a second DNA sequence containing a membrane bound glycosyl

vX CUI0I Ci. uOC UI vwil VCll · Ittü L · UCLcLL VCUl LUuCCL U ^ JLO "M cll CgXI X / iin DC

sequence with yeast transcription termination signals.

The yeast promoter is a controlled or constitutive promoter, preferably obtained from a highly expressed yeast gene, in particular a gene from Saccharomyces cerevisiae. Therefore, the promoter of the TRP1 gene, the ADHI or ADHII gene, the acid phosphatase (PHQ5.) Gene, a promoter of the yeast pairing pheromone genes encoding the α or α factor, or a promoter obtained of a gene encoding a glycolytic enzyme such as the enolase promoter, glyceraldehyde-3-phosphate dehydrogenase (GAP), 3-phosphoglycerate kinase (PGK), hexokinase, pyruvate decarboxylase, phosphofructo-kinase, glucose-6-phosphate isomerase, phosphoglycerate mutase, pyruvate kinase, triosephosphate isomerase, phosphoglucose isomerase or glucokinase genes Furthermore, it is possible to use hybrid promoters comprising upstream activation sequences (UAS) of one yeast gene and downstream promoter elements with a functional TATA promoter region of another yeast gene gene comprising the UAS (s) of the yeast PHO 2 gene and downstream promoter elements with a functional TATA region of the yeast GAP gene (PHOS-GAP hybrid promoter) and. A preferred promoter is the promoter of the GAP gene, in particular functional fragments thereof starting at nucleotides between positions -550 and -180, particularly at nucleotide -5 ^ 0, -263 or -198 and ending at nucleotide -5 of the GAP gene. Another regulated type preferred promoter is the PH05 promoter. As a constitutive promoter, a truncated acid phosphatase PH05 promoter, lacking the upstream regulatory elements (UAS), is preferred, as is the ΡΗ05 (-173) promoter element that starts at nucleotide -173 and ends at nucleotide -9 of the PH05 gene.

Preferably, the DNA sequence encoding a signal peptide ("signal sequence") is obtained from a yeast gene encoding a polypeptide which is usually secreted. Other signal sequences of heterologous proteins that are usually secreted can also be selected. For example, yeast signal sequences are the signal and prepro sequences of the yeast invertase, α-factor, pheromone peptidase (KEX1), "killer toxin" and repressible acid phosphatase (PHQ5) genes, and the glucoamylase signal sequence of Aspergillus fused signal sequences. are constructed by ligating part of the signal sequence (if any) of the gene that is naturally linked to the promoter used (eg PH05.) with part of the signal sequence of another heterologous protein The combinations that provide a precise cleavage between the signal sequence and enable the glycosyltransferase amino acid sequence are preferred Additional sequences such as pro or spacer sequences which may or may not carry specific processing signals may also be included in the constructs to facilitate the precise processing of pre-cursor molecules. fusion proteins can be formed internally e contain processing signals that allow proper maturation in vivo or in vitro. The processing signals contain, for example, Lys-Arg, which is recognized by a yeast dopeptidase found in the Golgi membranes. The preferred signal sequence of the present invention is the signal sequence of the yeast invertase gene.

When a complete glycosyl transferase or a membrane-bound variant thereof is expressed in yeast, the preferred yeast hybrid vector comprises an expression cassette encoding a yeast promoter, a DNA sequence encoding the glycosyl transferase or variant thereof, which DNA sequence by the yeast promoter is regulated and includes a DNA sequence with yeast transcription termination signals. When the DNA encodes a membrane-bound enzyme, no additional signal sequence is required.

Preferably, when a soluble variant of a membrane-bound glycosyl transferase is expressed in yeast, the yeast hybrid vector comprises an expression cassette which cassette operably coupled to a first DNA sequence encoding a signal peptide in the correct reading frame. is linked to a second DNA sequence encoding the variant and comprises a DNA sequence with yeast transcription termination signals.

DNA encoding a membrane bound glycosyl transferase or a variant thereof can be prepared according to methods well known and includes genomic DNA, for example from rat, mouse, bovine or human cells. If necessary, the introns contained in genomic DNA encoding the enzyme are removed. Furthermore, DNA encoding a membrane-bound glycosyl transferase or a variant thereof includes cDNA that can be isolated from a mammalian cDNA library or produced from the corresponding mRNA. The cDNA library can be obtained from cells of different tissues, for example, placental cells or liver cells. The preparation of cDNA via the mRNA pathway is accomplished using conventional methods such as the polymerase chain reaction (PCR).

For example, isolation of poly (A) + RNA from mammalian cells, such as HeLa cells, and subsequent first strand cDNA synthesis are performed according to well known standard procedures. From this synthesized DNA template, PCR can be used to amplify the intended sequence, i.e., the glycosyl transferase DNA or a fragment thereof, while minimizing the amplification of other numerically overwhelming undesired sequences. To this end, the sequence of a small series of nucleotides on both sides of the intended sequence must be known. These flanking sequences are used to develop two synthetic single-stranded primer oligonucleotides whose sequence is selected to be complementary in base pair to the respective flanking sequences. PCR begins with denaturation of the mRNA-DNA hybrid strand, followed by fusion of primers and flanking sequences of the intended sequence together. Addition of DNA polymerase and deoxynucleoside triphosphates creates two pieces of double stranded DNA, each piece starting from the primer and extending along the target sequence copying the target sequence. Any of the new synthesized products can serve as a template to which the primer can fuse and extensions can take place (next cycle) leading to an exponential increase in double-stranded fragments of a given length.

Furthermore, DNA encoding a membrane-bound glycosyl transferase or a variant thereof can be synthesized enzymatically or chemically. A variant of a membrane bound glycosyl transferase with enzymatic activity and an amino acid sequence in which one or more amino acids have been removed (DNA fragments) and / or exchanged with one or more other amino acids is encoded by a mutant DNA sequence. Furthermore, a mutant DNA sequence includes a silent mutation in which one or more nucleotides have been replaced by other nucleotides in which the new codon or codons encode or encode the same amino acid or acids. A degenerate DNA sequence also forms such a mutant sequence. Degenerate DNA sequences are genetically degenerated in that an unlimited number of nucleotides can be replaced by other nucleotides without altering the originally encoded amino acid sequence. Such degenerate DNA sequences may be useful due to differences in restriction sites and / or frequency of certain codons that are preferred by the specific host to obtain optimal

The expression of a glycosyl transferase or a variant thereof. Preferably, such DNA sequences have preferred codons that use yeast.

A mutant DNA sequence can also be obtained by in vitro mutation of a naturally occurring genomic DNA or a cDNA according to methods well known in the art. For example, the partial DNA encoding a soluble form of a glycosyl transferase can be obtained from the DNA encoding the corresponding membrane-bound complete glycosyl transferase using restriction enzymes. The availability of a suitable restriction cutting site is advantageous for this.

Preferably, a DNA sequence containing yeast transcription termination signals is the 3 'flanking sequence of a yeast gene that contains suitable signals for transcription termination and polyadenylation. Suitable 3 'flanking sequences are, for example, the yeast gene sequences naturally linked to the promoter used. The preferred flanking sequence is the yeast PH05 gene sequence.

The yeast promoter, optionally the DNA sequence coding for the signal peptide, the DNA sequence encoding a membrane-bound glycosyl transferase or a variant thereof, and the DNA sequence with yeast transcription termination signals are operably linked in a tandem arrangement, ie juxtaposed in such a way that their normal functions are maintained. The arrangement is such that the promoter causes proper expression of the membrane-bound glycosyl transferase or a variant thereof encoding (optionally preceded by a signal sequence), that the transcription termination signals induce proper termination of transcription and polyadenylation and that the signal sequence, if present, is linked in the correct reading frame to the above-mentioned DNA sequence in such a way that the last codon of the signal sequence is directly linked to the first codon of the DNA sequence, so that secretion of the protein takes place. Preferably, if the promoter and signal sequence are obtained from different genes, the promoter is located in a location between the main mRNA start site and the ATG of the gene which is naturally attached to the promoter. linked to the signal sequence linked. The signal sequence should have its own ATG for translation initiation. The coupling of these sequences can be accomplished by synthetic oligodeoxynucleotide linkers carrying the recognition sequence of an endonuclease.

Vectors suitable for yeast replication and expression include a yeast replication origin. Hybrid vectors comprising a yeast replication origin, for example, the chromosomal autonomously replicating fragment (ars), are retained extrachromosomally within the yeast after transformation and are replicated autonomously during mitosis. Hybrid vectors comprising sequences homologous to the yeast 2p plasmid DNA can also be used. Such hybrid vectors are integrated by recombination into 2p plasmids already present within the cell or replicating autonomously.

Preferably, the hybrid vectors of the invention comprise one or more, in particular one or two, selective yeast genetic markers and such marker, and an origin of replication for a bacterial host, in particular Escherichia coli.

With regard to the yeast selective marker genes, any marker gene can be used which facilitates the selection of transformants by phenotypic expression of the marker gene. Suitable markers for yeast are, for example, markers expressing antibiotic resistance or, in the case of auxotrophic yeast mutants, genes that complement host lesions. For example, corresponding genes confer resistance to the antibiotics G * H8, hygromycin or bleomycin or provide prototrophy to an auxotrophic yeast mutant, such as the URAR-. LEU2-. LYS2 or TRP1 genes.

Since amplification of the hybrid vectors is easily performed in E. coli, an E. coli genetic marker and an E. coli origin of replication are advantageously included. These can be obtained from E. coli plasmids such as pBR322 or a pUC plasmid, for example pUC18 or pUC19, both of which include an E. coli replication origin and an E. coli genetic marker conferring resistance to antibiotics such as ampicillin.

The hybrid vectors of the invention are prepared according to methods well known to those skilled in the art, for example, by the expression cassette containing a yeast promoter and a DNA sequence encoding a glycosyl transferase or a variant thereof which is regulated by the promoter or the various components of the expression cassette comprises linking in a predetermined order to the DNA fragments comprising selective genetic markers for yeast and for a bacterial host and origins of replication for yeast and for a bacterial host.

The hybrid vectors of the invention are used for the transformation of the yeast strains described below.

Yeast fermentations and transformation thereof

Suitable yeast host organisms are strains of the genus Saccha romvces. in particular strains of Saccharomvces cerevisiae. These yeast strains include strains which optionally do not include endogenous two-micron plasmids and / or which optionally do not contain yeast peptidase activity or activities, e.g. peptidase ysca, scA, scB, scY and / or scS activity contain.

The invention further relates to a yeast strain transformed with a hybrid vector comprising an expression cassette, said expression cassette comprising a yeast promoter and a membrane-bound glycosyl transferase or variant thereof encoding DNA sequence which is promoted by the promoter. regularly.

In a first embodiment, the yeast strain of the invention is transformed with a hybrid vector comprising an expression cassette, said expression cassette a yeast promoter, a membrane bound glycosyl transferase encoding a variant thereof, which DNA sequence is regulated by the promoter and a DNA sequence with yeast transcription termination signals.

In a second embodiment, the yeast strain of the invention is transformed with a hybrid vector comprising an expression cassette, which expression cassette is a yeast promoter operably linked to a first DNA sequence encoding a signal peptide coupled in the right reading frame to a second DNA sequence encoding a membrane bound glycosyl transferase or a variant thereof and comprising a DNA sequence with yeast transcription termination signals.

The yeast strains according to the invention are used for the preparation of a membrane-bound glycosyl transferase or a variant thereof.

The transformation of yeast with the hybrid vectors of the invention is accomplished by methods well known, for example, by the methods described by Hinnen et al. (Proc. Natl. Acad. Sci. USA (1978) 75 »1929) and Ito et al. (J. Bact. (1983) 153, 163-168).

The membrane bound glycosyl transferases and the variants thereof which are prepared according to the method according to the invention can be used in a manner known per se, for example for the synthesis and / or modification of glyco proteins, oligosaccharides and glyco-lipids (US patent 4,925 .796; EP patent application 414,171).

The invention particularly relates to the process for the preparation of membrane bound glycosyl transferases and variants thereof, the hybrid vectors, the transformed yeast strains and the glycosyl transferases available according to the inventive process as described in the examples.

In the examples, the following abbreviations are used: GT = galactosyl transferase (EC 2.4.1.22), PCR = polymerase chain reaction; ST = sialyl transferase (EC 2.4.99 * 1); FT = fucosyl transferase.

Example 1

Cloning of the galactosyl transferase (GT) cDNA from HeLa cells GT cDNA is isolated from HeLa cells (Watzele, G. and Berger, EG (1990) Nucleic Acids Res. 18, 7174) by the polymerase chain reaction (PCR) : 1.1 Preparation of poly (A) + RNA from HeLa cells

For RNA preparation, HeLA cells are grown in a single layer culture on 5 plates (23x23 cm). The rapid and efficient isolation of RNA from cultured cells is performed by extraction with guanidine HCl as described by MacDonald, R.J. et al. (Meth. Enzymol. (1987) 152, 226-227). Generally, yields are about 0.6-1 mg of total RNA per confluent cell plate. Enrichment of poly (A) + RNA is accomplished by affinity chromatography on oligo (dT) cellulose according to the method described in the Maniatis manual (Sambrook, J., Fritsch, EF and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual (2nd edition), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, USA) using 4 mg of total RNA on a 400 μΐ column. 3% of the applied RNA is recovered as enriched poly (A) + RNA which is stored in equal proportions precipitated with 3 volumes of ethanol at -70 ° C until use.

1.2 First strand cDNA synthesis for PCR

Poly (A) + RNA (mRNA) is reverse transferred to DNA by Moloney Murine Leukemia Virus RNase H 'reverse transcriptase (M-MLV H' RT) (BRL). When setting up the 20 μΐ reaction mixture, the protocol provided by BRL is followed with minor deviations: 1 pg HeLa cell poly (A) + RNA and 500 ng oligo (dT) 12_i8 (Pharmacia) in 11.5 μΐ sterile H2 O are heated to 70 ° C for 10 minutes and then quickly chilled on ice. Then, 4 µl of reaction buffer provided by BRL (250 mM Tris-HCl pH 8.3, 375 mM KCl, 15 mM MgCl2). 2 μΐ 0.1 M dithiothreitol, 1 μΐ mixed dNTP (10 mM each from dATP, dCTP, dGTP, TTP, Pharmacia), 0.5 μΐ (17.5 U) RNA guard (RNase inhibitor from Pharmacia) and 1 μΐ (200 U M-MLVH "RT added. The reaction is run at 42 ° C and stopped after 1 hour by heating the tube at 95 ° C for 10 minutes.

To check the efficiency of the reaction, an equal amount of the mixture (5 μΐ) is incubated in the presence of 2 pCi α-32Ρ dCTP. By measuring the built-in dCTP, the amount of synthesized cDNA can be calculated. The yield of the first strand synthesis is usually between 5 and 13% · 1.3 Polymerase chain reaction

The oligodeoxynucleotide primers used for PCR are synthesized in vitro via the phosphoramidite method (MH Caruthers, in Chemical and Enzymatic Synthesis of Gene Fragments, HG Gassen and A. Lang, ed., Verlag Chemie, Weinheim, Germany) on an Applied Biosystems Model 3Ö0B synthesizer. They are shown in Table A.

Table A: PCR primers primer Sequence (5 'to 3') 1) Corresponding to bp in GT cDNA2)

Plup (KpnI) cgcggtACCCTTCTTAAAGCGGCGGCGGGAAGATG (-26) - 3 PI (EcoRI) gccgaattcATGAGGCTTCGGGAGCCGCTCCTGAGCG 1-28 P3 (Sad) CTGGAGCTCGTGGCAAAGCAGAACCC 448-473 · P2d (EcoRI) gccgaaTTCAGTCTCTTATCCGTGTACCAAAACGCCTA 1222-1192 P4 (HindIII) cccaagctTGGAATGATGATGGCCACCTTGTGAGd 546-520 Couples 15 Uppercase sequences from GT for, lowercase letters are additional sequences, sites for restriction enzymes are underlined. Codons for 'start * and' stop 'of RNA translation are shown in bold letters.

2) Human placenta GT cDNA sequence as published in GenBank (Accession No. M22921).

Standard PCR conditions for a 30 μΐ incubation mix are: 1 μΐ Reverse Transcriptase reaction containing approximately 5 ng of first strand cDNA, 15 pmol of each of the relevant primers, 200 pmol of each of the four deoxynucleoside triphosphates (dATP, dCTP, dGTP and en) in PCR buffer (10 mM Tris-HCl pH 8.3 (at 23eC), 50 mM KCl, 1.5 mM MgCl2, 0.001% gelatin) and 0.5 U AmpliTaq polymerase (Perkin Elmer). Amplification is performed in the Thermocycler 60 (Biomed) under the following conditions: denaturation for 0.5 min at 95 ° C, fusion for 1 min at 56 ° C, and extension for 1 min, 15 sec at 72 ° C for 20-25 cycles. In the last cycle, primer extension is performed at 72eC for 5 min.

For sequencing and subcloning, the HeLa GT cDNA is amplified in two overlapping stretches using different primer combinations: (1) Fragment P1-P4: Primers PI and P4 are used to amplify a 0.55 kb DNA fragment containing nucleotide positions 7 ~ 556 in HeLa GT cDNA (Figure 1) includes (2) Fragment P3_P2d: Primers P3 and P2d are used to amplify a 0.77 kb fragment comprising nucleotide positions 457-1232 (Figure 1).

In order to avoid errors during amplification, four independent PCRs are performed for each fragment. Primer Plup (Kpnl) is also used in combination with primer P4 to determine the DNA sequence followed by the start codon.

After PCR amplification, fragment P1-P4 is digested with the restriction enzymes EcoRI and HindlII, analyzed on a 1.2% agarose gel, eluted from the gel by GENECLEAN (BIO 101) and subcloned into the vector pUCl8 ( Pharmacia), and subjected to digestion with the same enzymes. Fragment P3 ~ P2d is digested with SacI and EcoRI, analyzed on a 1.2% gel, eluted and subcloned in PUC18 and digested with SacI and EcoRI. The resulting subclones are pUCl8 / P1-P4 and pUCl8 / P3-P2d, respectively. Standard protocols are followed as described in Example II for subcloning, ligating and transforming E. coli strain DH5a. Mini-preparations of plasmids pUCl8 / P1-P4 and pUCl8 / P3 “P2d are used for di-deoxy sequencing of denatured double-stranded DNA with the TJ polymerase Sequencing kit (Pharmacia). M13 / pUC sequencing primers and reverse sequencing primers (Pharmacia) are used to sequence overlapping fragments produced by digestion with various restriction enzymes from both strands of DNA. Furthermore, subcloning of restriction fragments of the GT gene is necessary for extensive sequencing of overlapping fragments of both strands. The sequences of fragments amplified by independent PCRs show that the amplification error is less than 1 in 3000 nucleotides. The complete nucleotide sequence of the HeLa cell GT cDNA shown in Figure 1 is SS, 2% homologous to the DNA of a human placenta (Genbank Accession No. M22921). Three differences are found: (a) three additional base pairs at nucleotide positions 37 ~ 39 (Figure 1) resulting in an additional amino acid (Ser) in the N-terminal region of the protein; (b) base pair 98 to 101 are "CTCT" in place of "TCTG" as in the human placenta sequence, resulting in two conservative amino acid substitutions (Ala Leu instead of Val Tyr) at amino acid positions 31 and 32 in the membrane overlapping domain of GT (c) the nucleotide at position 10 ^ 7 has changed from "A" to "G" without resulting in a change in amino acid sequence.

The two overlapping DNA fragments P1-P4 and P3 ~ P2d encoding the HeLa-GT cDNA are linked via nucleotide position 498 contained in both fragments via the Not I restriction site.

The complete HeLa cell GT cDNA (Figure 1) has been cloned as a 1.2 kb EcoRI-EcoRI restriction fragment in plasmid pIC-7, a derivative of pUC8 with additional restriction sites in the multi-cloning site (Marsh, JL, Erfle, M. and Wykes, EJ (1984) Gene 32, 481-485), resulting in vector p4AD113. For the purpose of creating the GT expression cassette, the EcoRI restriction cut site (bp 1227) at the 3 '' end of the cDNA sequence is removed as follows: vector p4AD113 is first linearized by digestion with EcoRV and then treated with alkaline phosphatase. 1 µg of the linearized plasmid DNA is partially digested with 0.25 U EcoRI for 1 hour at 37 ° C. After agarose gel electrophoresis, a fragment corresponding to the size of the linearized plasmid (3.95 kb) is removed from the gel isolated by GENECLEAN (Bio 101). The protruding EcoRI end is supplemented with Klenow polymerase as described in the Maniatis manual (supra). After phenolization and ethanol precipitation, the plasmid is ligated again and used to make E. coli DH5a (Gibco / BRL) Mini-plasmid preparations are prepared from six transformants The resulting plasmids are examined by restriction analysis for the absence of the EcoRI- and EcoRV restriction sites at the 3 '' End of HeLa-GT cDNA. The plasmid designated p4AE113 is selected for the following experiments because its DNA sequence is identical to that of plasmid p4AD113 except that base pairs 1232-1238 with the EcoRI-EcoRV restriction sites have been deleted.

Example 2

Construction of expression cassettes for full GT

For heterologous expression in Saccharomyces cerevisiae, the yeast full HeLa GT cDNA sequence (Figure 1) is fused to transcription regulatory signals for efficient initiation and termination of transcription. The promoter and termination sequences are from the yeast acid phosphatase gene (PHQ5) (EP 100,561). The complete PHOB promoter is controlled by adding inorganic phosphate into the culture medium. High Pj concentrations lead to promoter repression, while low Px works by induction. On the other hand, a short PH05 promoter fragment of 173 bp is used where all the regulatory elements are missing and which fragment therefore behaves as a constitutive promoter.

2.1. Construction of a phosphate-inducible expression cassette

The GT cDNA sequence is combined with the yeast PHOS promoter and transcription termination sequences as follows: (a) Complete HeLa GT cDNA sequence:

Vector p4AE113 with the complete GT cDNA sequence is digested with the restriction enzymes EcoRI and BglII. The DNA fragments are electrophoretically separated on a 1% agarose gel. A 1.2 kb DNA fragment containing the complete HeLa-GT cDNA sequence is isolated from the gel by adsorption to glass milk using the GENECLEAN kit (BIO 101). In this fragment, the "ATG" protein start synthesis codon of GT is located immediately behind the restriction site for EcoRI while the stop codon "TAG" is followed by 32 bp passing through the 3 'untranslated region of HeLa-GT and the multiple clock. The vector will be delivered with the BglII restriction cut site.

(b) Vector for amplification in E. coli:

The amplification vector, plasmid p31R (cf. EP 100,561), a derivative of pBR322, is digested with the restriction enzymes BamHI and Sail. The restriction fragments are separated on a 1% agarose gel and a 3.5 kb vector fragment is isolated from the gel as described above. This DNA fragment contains the large SalI-HindlII vector fragment of the derivative of pBR322 as well as a PH05 transcription termination sequence of 337 bp in place of the HindII-BamHI sequence of pBR322.

(c) Sequence for the inducible PH05 promoter:

The PHOS promoter fragment containing the phosphate induction control elements (UASp) is isolated from plasmid p31R (cf. EP 100,561) by digestion with the restriction enzymes Sail and EcoRI. The 0.8 kb Sall EcoRI DNA fragment includes the 276 bp SalI-BamHI-pBR322 sequence and the 534 bp BamHI-EcoRI-PHOS promoter fragment containing the EcoRI linker (5'-GAATTC-3 ') position -8 of the PHQ5. promoter sequence has been introduced.

(d) Construction of plasmid pGTA 1132:

The three DNA fragments (a) to (c) are ligated in a 12 μΐ ligation mixture: 100 ng of DNA fragment (a) and 30 ng of individual fragments (b) and (c) are ligated using 0.3 U T4 DNA ligase (Boehringer) in the supplied ligase buffer (66 mM Tris-HCl pH 7.5. 1 mM dithioerythritol, 5 mM MgCl2, 1 mM ATP) at 15 ° C for 18 hours. Half of the ligation mixture is used to make competent EL cells.

coli strain DHFja (Gibco / BRL). For the preparation of competent cells and for transformation, the standard protocol as given in the Maniatis manual (supra) is followed. The cells are plated on selective LB medium supplemented with 75 µg / ml ampicillin and incubated at 37 ° C. About 120 transformants are obtained. Plasmid mini-preparations are prepared from six independent transformants using the modified alkaline lysis protocol of Bimboim, H.C. and Doly, J. as described in the Maniatis manual (supra). The isolated plasmids are characterized by restriction analysis with four different enzymes (EcoRI, PstI, HindlII, Sail, also in combination). The six plasmids all show the restriction fragments shown. One of the clones is chosen and is called pGTA 1132. Plasmid pGTA 1132 comprises the expression cassette containing the complete HeLa-GT cDNA under control of the phosphate-regulated PHQS promoter and the PHOS transcription termination sequence. This expression cassette can be extracted as a 2.35 kb SalI-HindII fragment from pGTA 1132, which fragment is called DNA fragment (1A).

2.2 Construction of a constitutive expression cassette:

For the construction of an expression cassette with a constitutive, unregulated promoter, a 5'-truncated ί'ί promoter fragment without phosphate-regulating elements is isolated from plasmid ρ31 / ΕΗΩ5 (-173) ΚΓΓ.

(a) Construction of plasmid p31 / PH05 (-173) RIT

Plasmid p31 RIT12 (EP 288,435) includes the fully regulated PH05. Promoter (with an EcoRI cleavage located at nucleotide position -8 on a 534 bp BamHI EcoRI fragment, followed by the coding sequence for the yeast invertase signal sequence (72 bp EcoRI-XhoI) and the PHOII transcription termination signal (135 bp Xhol-HindII) cloned in a tan-dem arrangement between BamHI and HindII of the pBR322-derived vector.

The constitutive PH05 (-178) promoter element of plasmid pJDB207 / PH05 (-173) -YHIR (EP 340,170) includes the nucleotide sequence of the yeast PHOS promoter from nucleotide position -9 to -173 (BstEII restriction site), but has no upstream regulatory sequences (UASp). The PH05 (-173) promoter therefore behaves as a constitutive promoter. This example describes the replacement of the regulated PH05 pro-motor in plasmid P31RIT12 with the short, constitutive PH05 (-173) promoter element to obtain plasmid p31 / EHQi (-173) RIT.

Plasmids p31RIT 12 (EP 288,435) and pJDB2Q7 / PHQR (-17λ) -YHIR (EP 340.I7O) are digested with restriction endonucleases Sail and EcoRI. The respective 3 * 6 kb and 0.4 kb Sall-EcoRI fragments are isolated on a 0.8 # agarose gel, eluted from the gel, precipitated with ethanol and resuspended in H 2 O at a concentration of 0.1 pmol / μΐ. Both DNA fragments are ligated and equal amounts of 1 μΐ of the ligation mixture are used to transform E. coli HB101 (ATCC) competent cells. Ampicillin resistant colonies are grown separately in LB medium supplemented with ampicillin (100 µg / ml). Plasmid DNA is isolated according to the method of Holmes, D.S. et al. (Anal. Biochem. (1981) 144, 193) and analyzed by restriction digest with Sail and EcoRI. The clone of the clone with the appropriate restriction fragments is designated p31 / PH05 (-173) RIT.

(b) Construction of plasmid pGTB1135

Plasmid p31 / PH05 (-173) RIT is digested with restriction enzymes EcoRI and Sail. After separation on a 1% agarose gel, a 0.45 kb Sal-EcoRI fragment is isolated from the gel by GENECLEAN (BI0 101). This fragment includes the 276 bp SalI-BamHI sequence of pBR322 and the 173 bp BamHI (BstEII) EcoRI fragment from the constitutive PHOS promoter. The 0.45 kb SalI-EcoRI fragment is ligated to the 1.2 kb EcoRI-BglII-GT cDNA (fragment (a)) and to the 3.5 Lb BamHI-SalI vector portion for amplification in E. coli with the PHO5 terminator (fragment (b)) as described in example 2.1. Ligation and transformation of E. coli strain DH5a are performed as described above to yield 58 transformants. Plasmids are isolated from six independent colonies by mini-preparations and characterized by restriction analysis. The six plasmids show the expected fragments. A correct clone is designated pGTB 1135 and further used for cloning experiments to provide the expression cassette for HeLa-GT under control of the constitutive PH05 (-173) promoter fragment. This expression cassette can be obtained from the vector pGTB 1135 as a 2 kb SalI-HindIII fragment called DNA fragment (1B).

Example R

Construction of the pectoral vectors pDPGTA8 and pDPffTB5

The yeast vector used for heterologous expression is the episomal vector pDP34 (11.8 kb) which is a yeast E. coli shuttle vector with ampicillin resistance as a marker for E. coli and with URA8 and dLEU2 as yeast selective markers. Vector pDP34 (cf. EP 340,170) is digested with the restriction enzyme BamHI. The linearized vector is isolated with GENECLEAN and the protruding ends are supplemented with Klenow polymerase treatment as described in the Maniatis manual (supra). The reaction is stopped after 30 minutes by heating at 65 ° C for 20 minutes in the presence of 10 mM EDTA. After ethanol precipitation, the plasmid is digested with Sail and gel electrophoresis on a 0.8 # agarose gel. The straight ended vector pDP34 (BamHI-SalI) cut vector is isolated from the gel as an 11.8 kb DNA fragment using the GENECLEAN kit.

By analogy with the vector preparation, plasmids pGTA 1132 and pGTB 1135 are each digested with HindIII. The protruding ends of the linearized plasmids are supplemented by treatment with Klenow polymerase and then digestion with Sail resulting in (2A) a (HindIII) -Sail cut fragment of straight-ended 2.35 kb fragment with the phosphate-controlled expression cassette, or (2B) a 2.0 kb straight-ended (HindIII-SalI) cut fragment containing the constitutive expression cassette.

Ligation of the straight-ended SalI-pDP34 vector portion with fragment 2A or fragment 2B and transformation of competent cells of E. coli strain DH5a is performed as described in Example 2 using 80 ng of the vector portion and 40 ng of fragment, respectively. 2A or 2B. 58 and 24 transformants are obtained, respectively. Six plasmids are prepared from each transformation and characterized by restriction analysis. For the construction with the controlled expression cassette (fragment 2A), two plasmids show the expected restriction pattern. One of the clones is selected and designated as pDPGTA8. For the construction with the constitutive expression cassette (fragment 2B), one plasmid shows the expected restriction pattern and is designated pDPGTB5.

Example 4

Transformation of S. cerevisiae strain BT1R0

CsCl purified DNA from the expression vectors pDPGTA8 and pDPGTB5 is prepared according to the protocol of R. Treisman in the Maniatis manual (supra). The protease deficient S. cerevisiae strains BTI50 (ΜΑΤα, his4, leu2, ura3. Pral, prbl, leek, cpsl) and H449 (MATa, prbl, cpsl, ura3A5, leu2-3. 2-112, cir °) are each Pg of each of the plasmids pDPGTA8, pDPGTB5 and pDP34 (control without expression cassette) transformed by the method of transformation with lithium acetate (Ito, H. et al., Supra). Ura + transformants are isolated and examined for GT activity (infra). Individual transformed yeast cells are selected and designated as Saccharomvces cerevisiae BT150 / pDPGTA8 Saccharomvces cerevisiae BT150 / pDPGTB5 Saccharomvces cerevisiae BT150 / pDP34 Saccharomvces cerevisiae H449 / pDPGTA8 Saccharomvces cerevisiaevev cerevisiae H449 / pDPGTA8 Saccharomvces cerevisceev444

Example 5

Enzyme activity of complete GT expressed in yeast 5.1 Preparation of cell extracts

Cells of transformed Saccharomyces cerevisiae strains BT150 and H449 are each cultured under selection with uracil in minimal medium (Difco) for yeast supplemented with histidine and leucine. The growth rate of the cells is not affected by the presence of an expression vector. Exponentially growing cells (at 0D57g of 0.5) or stationary cells are collected by centrifugation, washed once with 50 mM Tris-HCl buffer with pH 7.4 (buffer 1) and resuspended in buffer 1 at a concentration corresponding to 0.1- 0.2 0D578. Mechanical breaking of the cells is performed by shaking vigorously on a glass bead vortex mixer (0.45-0.5 mm diameter) for 4 minutes with intermediate cooling. The crude extracts are immediately used for determination of enzyme activity.

Fractionation of cellular components is achieved by differential centrifugation of the extract. First, the extract is centrifuged at 45 g for 5 minutes; then the obtained supernatant is centrifuged at 20,000 g for 45 minutes.

The supernatant is collected and the pellets are resuspended in buffer 1.

For induction of GT expression under regulation of the inducible PH05 promoter by phosphate, cells of transformants BT150 / pDPGTA8 and H449 / pDPGTA8 are mass-shifted to minimal medium with a low phosphate concentration (Meyhack, B. et al. Embo J. (1982) 1,675 "680). The cell extracts are prepared as described above.

5.2 Protein test

Protein concentration is determined using the BCA-Protein Assay Kit (Pierce).

5.3 Test for GT activity GT activity can be measured by radiochemical methods using either ovalbumin, a glycoprotein that only exposes GlcNAc as an acceptor site, or free GlcNAc as acceptor substrates. Cell extracts (containing 1-2 0Ds578 of cells) are examined in 100 μl incubation mixture containing 100 mM Tris-HCl pH 7.4, 50 nCi UDP-14C-Gal (325 mCi / mmol) for 45 or 60 minutes at 37 ° C. 80 nmol UDP-Gal, 1 pmol MnCl2, 1% Triton X-100 and 1 mg ovalbumin or 2 pmol GlcNAc as acceptor. If a glycoprotein is used as the acceptor substrate, the reaction is terminated by precipitation of the protein with acid and the amount of galactose contained in ovalbumin is determined by liquid scintillation counting (Berger, EG et al. (1978) Eur. J. Biochem 90, 213-222). For GlcNAc as an acceptor substrate, the reaction is terminated by adding 0.4 ml of ice cold H 2 O and the unused UDP-C galactose is separated from 1 hC products on an anion exchange column (AG XI-8, BioRad) as described (Masibay, AS and Qasaba, PK (1989) Proc Natl Acad Sci USA 86, 5733-5737) Assays are performed with and without acceptor molecules to determine the degree of hydrolysis of UDP-Gal by nucleotide pyrophosphatases. The results are shown in Table B.

Table B: GT activity in S. cerevisiae strain BT150 transformed with different plasmids

not quite.

GT activity of cultures shifted to inducible conditions (low P 1 minimal medium) is about the same as the activity of cultures in minimal medium expressing GT constitutively (Table B). As expected, no enzyme activity is found in cells transformed only with the vector.

During fractionation, most GT activity (70-90 #, see Table C) and highest specific activity are always found in the pellet at high speed (20,000 g). Enzyme activity can be increased by adding 1-2 # Triton X-100 to the enzyme test. Both findings suggest that recombinant GT is membrane-bound in yeast cells, as well as HeLa cells.

Table C: Distribution of GT activity during fractionation of BT150 / pDPGT5 cells

Example 6

Purification of the recombinant GT

In order to free the membrane-bound enzyme, the 20,000 g pellet fraction of BT150 / pDPGTB5 cells are treated with 1 # (w / v) Triton X-100 at room temperature for 10 minutes and equilibrated with 50 mM Tris HCI with pH 7 A, 25 mM MgCl 2, 0.5 mM UMP and 1% (w / v) Triton X-100. The supernatant obtained after centrifugation is filtered over 0.2 µm and passed over a GlcNAc-β-aminophenyl Sepharose column (Berger, EG et al. (1976) Experientia 32, 69O-69I) with a bed volume of 5 ml at a flow rate of 0.2 ml / min at 4 ° C. The enzyme is eluted with 50 mM Tris-HCl pH 7, k, 5 mM GlcNAc, 25 mM EDTA and 1% Triton X-100. A separate peak of enzyme activity is eluted within five fractions (size: 1 ml). These fractions are pooled and dialyzed against 2x11 50 mM

Tris-HCl pH 7.4, 0.1 # Triton X-100. The purified GT is enzymatically active.

Example 7

Construction of an expression cassette for soluble GT

Galactosyl transferase expressed in yeast can be secreted into the culture medium if a yeast promoter is operably linked to a first DNA sequence that contains the signal sequence of the yeast invertase gene SUC2 in the correct reading frame to a cDNA that encodes soluble GT, is linked, includes.

(a) Partial HeLa GT cDNA sequence GT cDNA is extracted from plasmid p4AD113 (Example 1) by digestion with EcoRI. The 1.2 kb fragment comprising the complete GT cDNA is isolated and partially digested with Mvnl (Boehringer) cutting the GT sequence at positions 43, 55, 140 and 288 of the nucleotide sequence depicted in Figure 1 When 0.2 µg of the EcoRI-EcoRI fragment is digested with 0.75 U Mvnl for 1 hour, the GT cDNA is cut only once at nucleotide position 134 to give a 1.1 kb Mvnl EcoRI fragment .

(b) Vector for amplification in E. coli

Plasmid pUC18 (Pharmacia) is digested in the multiple cloning site with BamHI and EcoRI. The plasmid is then treated with alkaline phosphatase as described in the Maniatis manual (supra), subjected to agarose gel electrophoresis and isolated from the gel as a 2.7 kb DNA fragment.

(c) Constitutive PHOB (-173) promoter and SUC2 signal sequence

The vector p31 / PHOS (-173) RIT (Example 2) is digested with the restriction enzymes BamHI and Xhol. A 0.25 kb BamHI-XhoI fragment with the constitutive PHQ5. (”173) promoter and the adjacent coding sequence for the invertase signal sequence (inv ss) is isolated. The fragment is then cut again with Hgal (BioLabs). The Hgal recognition sequence is on the antisense DNA strand. The restriction enzyme cuts upstream of the recognition sequence in such a way that the 5 'protruding end of the antisense strand matches the end of the coding sequence of the invertase signal sequence. The 0.24 kb DNA fragment digested with BamHI and Hgal contains the constitutive PH05 (-173) promoter sequence linked to the yeast invertase signal sequence.

(d) Adapter

Fragment (a) is linked to fragment (c) by an adapter sequence prepared from equimolar amounts of synthetic oligonucleotides (Microsynth) 5'CT GCA CTG GOT GGC CG 3 'and 5'CG GCC AGO CAG 3' for the complementary strand . The oligonucleotides are fused together by first heating to 95 ° C and then slowly cooling to 20 ° C. The fused adapter is stored frozen.

(e) Construction of plasmid psGT

For ligation, linearized vector (b), the GT cDNA fragment (a), the fragment (c) containing the promoter and the sequence encoding the signal peptide and the adapter (d) are used in a molar ratio of 1: 2: 2: 30-100. Ligation is performed in 12 μl ligase buffer (66 mM Tris-HCl with pH 7 * 5 »1 mM dithioerythritol, 5 mM MgCl2, 1 mM ATP) for 18 h at 16eC. The ligation mixture is used to transform competent cells of E. coli strain DH5a as described above. Mini plasmid preparations are made from 24 independent transformants. The isolated plasmids are characterized by restriction analysis using four different enzymes (BamHI, PstI, EcoRI, Xhol, as well as combinations thereof). A separate clone with the expected restriction pattern is designated psGT.

The appropriate sequence at the fusion site of the invertase signal peptide coding sequence with the soluble GT coding cDNA is confirmed for plasmid psGT using the T7 sequencing kit (Pharmacia) and primer 5'AGTCGAGGTTAGTATGGC 3 'at position -77 in the constitutive PH05 (-173) promoter begins.

Sequence for Mvnl DNA1): 5 'AAA ATA Tct gca ctg get ggc cgC GAC CTG AGC 3' 3 'TTT TAT AGA CGT gac ega ccg gcG CAG GAC TCG 5'

Protein: Lys lie Ser Ala Leu Ala Gly Arg Asp Leu Ser 16 19 42 inv ss GT sequence cleavage site for signal endopeptidase 1} Lowercase letters represent the adapter sequence.

The secreted GT expression cassette comprising the constitutive PHO (f-173) promoter, the invertase signal peptide encoding DNA sequence and the partial GT cDNA of plasmid psGT can be obtained as a Sail (BamHI) EcoRI fragment of 1.35 kb. The expression cassette still lacks the PH05 termination sequences added in the next cloning step.

Example 8

Construction of the exoression vector pDPGTS

For construction of the soluble GT expression vector, the following fragments are combined; (a) Vector portion

Plasmid pDP34 is digested and pretreated as described in Example 3 resulting in a 11.8 kb Sall vector fragment with straight ends.

(b) Expression cassette

Plasmid psGT is first linearized by digestion with Sail (in the multiple cloning site) and then partial digestion with EcoRI. A 1.35 kb DNA fragment is isolated containing the constitutive PH05 (-173) promoter. comprises a DNA sequence encoding the yeast invertase signal peptide and the GT partial cDNA.

(c) PHOS termination sequence

The PH05 termination entity is isolated from plasmid p31 which is constructed from plasmid p30 as described in EP 100,561. After digestion with the restriction enzyme HindII, the protruding ends are supplemented with Klenow polymerase treatment as described above. Then, the plasmid is digested with EcoRI and a 0.39 kb EcoRI straight-ended fragment, which fragment comprises the PH05 termination sequences, is isolated.

Ligation of fragments (a), (b) and (c) and transformation of competent cells of E. coli strain DH5a are performed as described in Example 2. Plasmids are isolated from the transformants obtained and characterized by restriction analysis. The single clone plasmid with appropriate restriction fragments is designated pDPGTS.

Example Q

Expression of soluble GT in yeast

By analogy to example k, CsCl purified DNA from the expression vector pDPGTS is used to transform S. cerevisiae strains BT150 and H449. Ura + transformants are isolated and screened for GT activity. In any case, one transformant is selected and designated with Saccharomvces cerevisiae BT150 / pDPGTS and Saccharomvces cerevisiae Η ^ 9 / pDPGTS, respectively. Using the assay described in Example 5, GT activity is found in the culture media of both transformants.

Example 10

Cloning of the sialvl transferase (ST) cDNA from human HenG2 cells. ST cDNA is isolated from HepG2 cells by PCR by analogy with GT cDNA. Preparation of poly (A) + RNA and first strand cDNA synthesis are performed as described in Example 1. The primers (Microsynth) shown in Table 5 are used for PCR.

Uppercase letters indicate sequences of ST, lowercase letters are additional sequences with restriction enzyme sites (underlined). Codons for 'start' and 'stop' for protein synthesis are shown in bold.

2) ST cDNA sequence from human placenta (27) as published in EMBL Data Bank (Accession No. X17247).

HepG2-ST cDNA can be amplified as a 1.2 kb DNA fragment using primers SIA1 and SIA3. PCR is performed as described for GT cDNA under slightly modified cycle conditions: 0.5 min denaturation at 95 ° C, 1 min 15 sec fusion at 56 ° C and 1 min 30 sec extension at 72 ° C for a total of 25- 35 cycles. In the last cycle, primer extension is performed at 72 ° C for 5 min.

After PCR amplification, the 1.2 kb fragment is digested with the restriction enzymes BamHI and PstI, analyzed on a 1.2 # agarose gel, eluted from the gel and subcloned into the vector pUC18. The resulting subclone is designated pSIA2.

Example 11

Construction of the constitutive ST expression cassette

For constitutive heterologous expression, ST cDNA is ligated with the constitutive PH05 (-173) promoter fragment and PH05 termination sequences.

Plasmid pSIA2 is first linearized by digestion with the restriction enzyme BamHI and then partially digested with EcoRI. Since ST cDNA also contains an internal restriction cut site for the enzyme EcoRI (at base pair 144), a 1.2 kb fragment containing the complete ST cDNA (Figure 3) is created by partial digestion with EcoRI using 1 µg DNA and 0 .25 U EcoRI (1 hour, 37 ° C). After gel electrophoresis, the 1.2 kb EcoRI-BamHI fragment comprising the complete ST cDNA (Figure 3) is isolated. The "ATG" start codon for translation of ST is located on this DNA fragment close to the EcoRI restriction cut site. Three adenosine phosphates (see PCR primer SIA1) provide an "A" at base pair position 12, which is found in the yeast consensus sequence surrounding the "ATG" of high-expressing genes (Hamilton, R. et al, (1987) Nucleic Acids Res.14, 5125-51 * 19) ♦ The stopco-don "TAA" and 5 bp of the 3 'untranslated region of the gene are followed by the BamHI site.

The 1.2 kb EcoRI-BamHI-ST cDNA fragment is ligated with the 0.45 kb SalI-EcoRI fragment containing the constitutive PH03 (-I73) promoter (Example 2.2 (b)) and a 3.5 kb BamHI-Sall vector portion for amplification in E. coli with the PH05 termination sequence (cf. example 2.1, fragment (b)). Ligation and transformation of E. coli strain DH5a is performed as detailed in Example 2.1. A clone showing the expected restriction pattern is designated pST2.

Vector pST2 includes the expression cassette for HepG2-ST under control of the constitutive PH0S (-173) promoter as a 2.0 kb SalI-HindII fragment designated DNA fragment (1C).

Example 12 Expression of ST in yeast

Vector pDP34 (cf. EP 340,170) is digested with the restriction enzyme BamHI. The linearized vector is isolated with GENECLEAN and the protruding ends are supplemented with Klenow polymerase treatment as described in the Maniatis manual (supra). The reaction is stopped after 30 minutes by heating at 65 ° C for 20 minutes in the presence of 10 mM EDTA. After ethanol precipitation, the plasmid is digested with Sail and gel electrophoresis on a 0.8 µg agarose gel. The (BamHI) -SalI cut straight-ended vector pDP3 ^ is isolated with the GENECLEAN kit as an 11.8 kb DNA fragment.

Plasmid pST2 is digested with the restriction enzyme HindlII and analogous to the preparation of the vector portion supplemented at the HindlII site by treatment with Klenow polymerase. The product is digested with Sail to give a 2.0 kb straight-ended (HindIII) -Sail-cut fragment which contains the constitutive ST expression cassette (2C).

Ligation of 80 ng of pDP3 ^ vector with 40 ng fragment 2C and transformation of competent cells of E. coli strain DH5a is performed as described in Example 2. A clone showing the expected restriction pattern is selected and designated pDPST5.

For yeast transformation, CsCl purified DNA from the expression vector pDPST5 is prepared according to the standard protocol given in the Maniatis manual (supra). S. cerevisiae strains BTI50 and H449 are separately transformed with 5 µg of plasmid DNA according to the lithium acetate transformation method (Ito, H. et al., Supra). Ura + transformants are selected and screened for ST activity. In any case, one positive transformant is selected and designated Saccharomvces cerevisiae BT150 / pDPST5 and Saccharomvces cerevisiae H449 / pDPST5.

Example 13

Enzyme activity of complete ST expressed in yeast 13.1 Preparation of cell extracts

Cells of Saccharomyces cerevisiae BT150 / pDPST5 are cultured with uracil in histidine and leucine supplemented minimal yeast medium. Exponentially growing cells (at 0D578 of 0.5) or stationary cells are collected by centrifugation, washed once with 50 mM imidazole buffer, pH 7 * 0 (buffer 1), and resuspended in buffer 1 at a concentration corresponding to 0.1 -0.2 0D5? 8. Mechanical breaking of the cells is accomplished by vigorous shaking with glass beads (0.45-0.5 min diameter) on a vortex mixer for 4 minutes with intermediate cooling.

ST activity can be measured in the crude extracts using the assay described below.

13.2 Test for ST activity ST activity can be determined by measuring the amount of radiolabeled sialic acid transferred from CMP sialic acid to a glycoprotein acceptor. After completion of the reaction by acid precipitation, the precipitate is filtered using glass fiber filters (Whatman GFA), washed extensively with ice-cold ethanol and examined for radioactivity by liquid scintillation counting (Hesford et al. (1984), Glycoconjugate J. 1, 141 -153) · Cell extracts are examined for 45 minutes in an incubation mixture comprising 37 µl of cell extract, which corresponds to about 0.5 mg protein, 3 µl imidazole buffer 50 mmol / 1, with pH 7.0; 50 nmol CMP-N-acetylneuramic acid (Sigma) to which CMP-3H-N-acetylneuramic acid (Amersham) has been added to give a final specific activity of 7 »3 Ci / mol and 75 µg of asialophore garden (prepared by acid hydrolysis using 0.1 M H2S0i, at 80 ° C for 60 minutes followed by neutralization, dialysis and lyophilization).

ST activity is made in the crude extracts prepared from S. cerevisiae BT150 / pDPST5 and H449 / pDPST5 cells.

Example 14

Construction of an expression cassette for soluble ST (Lvs ^ -Cvs;, ^)

The soluble ST designated ST (Lys3g-Cys /, 06) is an N-terminated variant and consists of 368 amino acids (Figure 4).

(a) Partial HepG2-ST cDNA sequence

Plasmid pSIA2 is digested with EcoRI and a 1.1 kb EcoRI-EcoRI fragment is isolated.

(b) Vector for amplification in E. coli

Plasmid pUC18 (Pharmacia) is digested in the multiple cloning site with BamHI and EcoRI. The plasmid is then treated with alkaline phosphatase as described in the Maniatis manual (supra), agarose gel electrophoresis and isolated from the gel as a 2.7 kb DNA fragment.

(c) Constitutive PH05 (-173) promoter and SUC2 signal sequence

The vector p31 / PH05 (-173) RIT (Example 2) is digested with the restriction enzymes BamHI and Xhol. A 0.25 kb BamHI-Xhol fragment with the constitutive ΡΗ05 (-173) promoter and the adjacent coding sequence for the invertase signal sequence (inv ss) is isolated. The fragment is then cut again with Hgal (BioLabs). The Hgal recognition sequence is on the antisense DNA strand. The restriction enzyme cuts upstream of the recognition sequence in such a way that the 5 'protruding end of the antisense strand matches the end of the coding sequence of the invertase signal sequence. The 0.24 kb BamHI and Hgal cut Defragment comprises the constitutive PH05. (-173) promoter sequence linked to the yeast invertase signal sequence.

(d) Adapter

Fragment (a) is linked to fragment (c) by an adapter sequence prepared from equimolar amounts of synthetic oligonucleotides 5'CTGCAAAATTGCAAACCAAGG3 'and 5'AATTCCTTGGTTTGCAATTT3' for the complementary strand. The oligonucleotides are fused together by heating to 95eC first and then slowly cooling to 20eC. The fused adapter is stored frozen.

(e) Construction of plasmid psST

For ligation, linearized vector (b), the ST cDNA fragment (a), fragment (c) containing the promoter and the sequence encoding the signal peptide and the adapter (d) are used in a molar ratio from 1: 2: 2: 30-100. Ligation is performed in 12 μl ligase buffer (66 mM Tris-HCl with pH 7.5, 1 mM dithioerythritol, 5 μMgCl2, 1 mM ATP) for 18 at 16 ° C. The ligation mixture is used to transform competent cells of E. coli strain DH5a as described above. Mini plasmid preparations are prepared from 24 separate transformants. A separate clone showing the expected restriction pattern after characterization by restriction analysis using four different enzymes (BamHI, PstI, EcoRI, Xhol, and combinations thereof) is referred to as psST.

The correct sequence at the fusion site of the invertase signal peptide coding sequence with the soluble ST (Lys39-Cysj, 06) coding cDNA is confirmed for plasmid psST using the T7 Sequencing kit (Pharmacia) and primer 5 ' ACGAGGTTAATGGC3 'starting at position -77 in the constitutive PH05 (-173) promoter.

Sequence for DNA15: 5 'AAA ATA Tct gca aaa ttg caa acc aag gAA 3 * 3' TTT TAT AGA GTG ttt aac gtt tgg ttc ctt 5 '

Protein: Lys lie Ser Ala Lys Leu Gin Thr Lys Glu 16 19 39 inv ss ST sequence cleavage site for signal endopeptidase

Lowercase letters represent the adapter sequence.

The secreted ST expression cassette comprising the constitutive PHQEj (-173) promoter, the DNA sequence encoding invertase signal peptide and the partial ST cDNA from plasmid psST can be obtained as a Sail (BamHI) EcoRI fragment of 1 , 35 kb. The expression cassette still lacks the PH05 termination sequences to be added in the next cloning step.

Example IR

Construction of the expression vector pDPSTS

For construction of the expression vector for soluble ST (Lys3g-CySi, o6) the following fragments are combined: (a) Vector portion

Plasmid pDP34 is digested and pretreated as described in Example 3 to give a 11.8 kb Sall vector fragment with straight ends.

(b) Expression cassette

Plasmid psST is first linearized by digestion with Sail (in the multiple cloning site) and then partially digested with EcoRI. A 1.35 kb DNA fragment is isolated containing the constitutive ΡΗ05 (-173) promoter, a DNA sequence encoding the yeast invertase signal peptide and comprising the partial ST cDNA.

(c) PHOS termination sequence

The PHO5 termination sequence is isolated from plasmid p31 which is constructed from plasmid p30 as described in EP 100,561. After digestion with the HindTII restriction enzyme, the protruding ends are supplemented by treatment with Klenow polymerase as described above. The plasmid is then digested with EcoRI and a straight-ended EcoRI fragment with the PH05 termination units isolated.

Ligation of fragments (a), (b) and (c) and transformation of competent cells of E. coli strain DH5a is performed as described in Example 2. From the obtained transformants, plasmids are isolated and characterized by restriction analysis. The clone plasmid with appropriate restriction fragments is designated pDPSTS.

Example 16

Expression of soluble ST in yeast

By analogy with Example 4, CsCl purified DNA from the expression vector pDPSTS is used to transform S. cerevisiae strains BTI50 and h449. Ura + transformants are isolated and screened for ST activity. In any case, a transformant is selected and designated with Saccharomvces cerevisiae BT150 / pDPSTS and Saccharomvces cerevisiae H449 / pDPSTS, respectively. Using the assay described in Example 13, ST activity is found in the culture media of both transformants.

Example 17

Construction of an expression cassette for soluble ST (Lvs2y-CvS) IQ6)

The soluble ST designated as ST (Lys27-Cys /, o6) is an N-terminal truncated variant comprising the catalytic domain and the entire stem region and consisting of 380 amino acids, i.e. amino acids 27 to 406 of the amino acid sequence of Figure 3.

(a) Partial HepG2-ST cDNA sequence

Plasmid pSIA2 is digested with EcoRI and a 1.1 kb EcoRI-EcoRI fragment is isolated.

(b) Vector for amplification in E. coli

Plasmid pUC18 (Pharmacia) is digested in the multiple cloning site with BamHI and EcoRI. The plasmid is then treated with alkaline phosphatase as described in the Maniatis manual (supra), subjected to agarose gel electrophoresis and isolated from the gel as a 2.7 kb DNA fragment.

(c) Constitutive PH05 (-173) promoter and SUC2 signal sequence

The vector p31 / PH05 (-173) RIT (Example 2) is digested with the restriction enzymes BamHI and Xhol. A 0.25 kb BamHI-Xhol fragment with the constitutive PH05 (-173) promoter and the adjacent coding sequence for the invertase signal sequence (inv ss) is isolated. The fragment is then cut again with Hgal (BioLabs). The Hgal recognition sequence is on the antisense DNA strand. The restriction enzyme cuts upstream of the recognition sequence in such a way that the 5 'protruding end of the antisense strand matches the end of the coding sequence of the invertase signal sequence. The 0.24 kb DNA fragment cut with BamHI and Hgal contains the constitutive PH05 (-173) promoter sequence linked to the yeast invertase signal sequence.

(d) Adapter

Fragment (a) is linked to fragment (c) by means of an adapter sequence which is prepared from equimolar amounts of the synthetic oligonucleotides 5'CTGCAAAGGAAAAGAAGAAAGGGAGTTACTATGATTCCTTTAAATTGCAAACCAAGG3 'and 5 * AATTCCTTGTTGCAATTTAAAGGAATCATAGTAACTCCCTTTCTTCTTTTCCTT3' for the complementary strand. The oligonucleotides are fused together by first heating to 95 ° C and then slowly cooling to 20 ° C. The fused adapter is stored frozen.

(e) Construction of plasmid psST1

For ligation, linearized vector (b), the ST cDNA fragment (a), fragment (c) containing the promoter and the sequence encoding the signal peptide and the adapter (d) are used in a molar ratio of 1: 2: 2: 30-100. Ligation is performed in 12 μl ligase buffer (66 mM Tris-HCl with pH 7.5. 1 mM dithioerythritol, 5 mM MgCl2, 1 mM ATP) for 18 hours at 16 ° C. The ligation mixture is used to transform competent cells of E. coli strain DH5a as described above. Mini plasmid preparations are prepared from 24 independent transformants. A single clone showing the expected restriction pattern after characterization by restriction analysis using four different enzymes (BamHI, PstI, EcoRI, Xhol, also in combination) is designated psST1.

The appropriate sequence at the fusion site of the sequence encoding invertase signal peptide with the cDNA encoding soluble ST (Lys27-CySi, o6) is confirmed for plasmid psSTl using T7_Sequencing kit (Pharmacia) and primer 5'AGTCGAGTAGTATGGC3 'starting at position - 77 in the constitutive ΡΗ05 (-173) promoter.

Sequence for DNA1J: 5 * AAA ATA Tct gca aag gaa aag aag aaa ggg 3 '3' TTT TAT AGA GTG ttc ctt ttc ttc ttt ccc 5 '

Protein: Lys lie Ser Ala Lys Glu Lys Lys Lys Gly 16 19 27 inv ss ST sequence cleavage site for signal endopeptidase 1} Lowercase letters represent the adapter sequence.

The expression cassette for secreted ST (Lys ^ -Cys ^ g) containing the constitutive PHO ^ i (-173) promoter. the DNA sequence encoding invertase signal peptide and comprising the partial ST cDNA of plasmid psST1 can be obtained as a 1.35 kb Sail (BamHI) EcoRI fragment. The expression cassette lacks the PH05 termination entities added in the next cloning step.

Example 18

Construction of the pDPSTSI exoression vector

For construction of the expression vector for soluble ST (Lys27-Cys / jo ^), the following fragments are combined: (a) Vector portion

Plasmid pDP3 ^ is digested and pretreated as described in Example 3 to give a 11.8 kb Sall vector fragment with straight ends.

(b) Expression cassette

Plasmid psST1 is first linearized by digestion with Sail (in the multiple cloning site) and then partial digestion with EcoRI. A 1.35 kb DNA fragment is isolated containing the constitutive PH05 (-173) promoter. a DNA sequence encoding the yeast invertase signal peptide and comprising the partial ST cDNA.

(c) PHO5 termination sequence

The PHQ5 termination sequence is isolated from plasmid p31, which plasmid is constructed from plasmid p30 as described in EP 100,561. After digestion with the restriction enzyme HindIII, the protruding ends are filled by treatment with Klenow polymerase as described above. The plasmid is then digested with EcoRI and a 0.39 kb EcoRI fragment with straight ends and with the PHOS termination units isolated.

Ligation of fragments (a), (b) and (c) and transformation of competent cells of E. coli strain DH5a is performed as described in Example 2. From the obtained transformants, plasmids are isolated and characterized by restriction analysis. The clone plasmid with appropriate restriction fragments is designated pDPSTS1.

Example 10

Expression of soluble ST (Lvs27-Cys>, 0ft) in yeast

By analogy with Example 4, CsCl purified DNA from the expression vector pDPSTS1 is used to transform S. cerevisiae strains BT150 and H449. Ura + transformants are isolated and screened for ST activity. In any case, a transformant is selected and designated as Saccharomvces cerevisiae BT150 / pDPSTSl and Saccharomvces cerevisiae H449 / pDPSTSl. Using the assay described in Example 13, ST activity is found in the culture media of both transformants.

Example 20

Cloning of the FT cDNA from the human HL60 cell line

Based on the published cDNA sequence (Goelz, SE et al. (I99O) Cell 63, 13 ^ 9-1356) for ELFT (ELAM-1 ligand fucosyl transferase) encoding a (1-3) fucosyl transferase, the following oligo nucleotide primers designed to amplify a DNA fragment that includes the open reading frame of the ELFT cDNA amplified by PCR technology: 5'-CAGCGCTGCCTGTTCGCGCCAT-3 * (ELFT-1B) and 5'-GGAGATGCACAGTAGAGGATCA-3 (ELFT-2B). ELFT-1B starts at base pairs 38-59 of the published sequence and ELFT-2B starts at base pairs 1347-1326 in the antisense direction. The primers are used to amplify a 1.3 kb fragment using the Perkin-Elmer Cetus Taq polymerase kit. The fragment is amplified from fresh HLéO cDNA in the presence of 5 # DMSO and 2 µ MgCl2 with the following cycle: 95 ° C 5 min, 25x (1 min 95 ° C, 1 min 60 ° C, 1.5 min 72 ° C), ΙΟχ (1 min 95 ° C, 1 min 60eC, 1.5 min + 15 sec / cycle 'J2 ° C). Agarose gel electrophoresis reveals a prominent 1.3 kb band that gives the pattern predicted by the published sequence upon digestion with Narrow or Apal. The 1.3 kb band is purified using a Gene-Clean kit (Bio 101) and subcloned into the pCRIOOO vector (Invitrogen). A separate clone with the correct 1.3 kb insert is chosen and designated BRB.ELFT / pCR1000-13. The FT cDNA is inserted into the vector in an inverted orientation with respect to the T7 promoter. The open reading frame of the FT cDNA is fully sequenced and identical to the published sequence (Figure 5)

Example 21

Construction of plasmids for inducible and constitutive expression of soluble FTfArg ^ -Arg;, ^) in yeast

Soluble FT (Arg62-Arg / .05) is generated by expression of the FT cDNA starting at nucleotide position 241 (Nrul restriction cut site) omitting the N-terminal region encoding the cytoplasmic tail and membrane bridging domain (see sequence of figure 5)

Plasmid BRB.ELFT / pCR1000-13 is digested with HindII, which cuts into the multi-cloning region 3 'of the FT cDNA insert. The protruding ends are converted to straight ends in a reaction with Klenow DNA polymerase. Xhol linker (5'CCTCGAGG3 ', Biolabs), is kinase treated, fused and ligated to the straight ends of the plasmid using a 100-fold molar excess of linkers. Unreacted linkers are removed by precipitation of the DNA with isopropanol which is further digested with Xhol and Nrul (cleavage at nucleotide position 240 of the FT cDNA of Figure 5). The Nrul-Xhol fragment (a) of 1.1 kb contains the FT cDNA sequence lacking the region encoding the cytoplasmic tail and membrane bridging domain to amino acid 61.

Plasmids p31 RIT12 and p31 / PH04 (-173) RIT (see example 2) are each digested with Sail and Xhol. The respective 0.9 kb and 0.5 kb fragments are isolated and cut with Hgal. The resulting protruding ends are supplemented with Klenow DNA polymerase. The straight ends created correspond to the 3 'end of the coding sequence for the yeast invertase signal sequence. Subsequently, cleavage with BamHI releases a 596 bp straight-ended BamHI fragment (b) that the inducible PHOS promoter and the invertase signal sequence with native ATG or a straight-ended bp BamHI fragment (c) with the short constitutive ΡΗ05 (-173) promoter and the inverse signal sequence.

Plasmid p31 RIT12 is linearized with restriction endonuclease Sail. Partial digestion with HindII in the presence of ethidium bromide gives a 1 kb SalI-HindII fragment containing the 276 bp SalI-BamHI-pBR322 sequence, the 53 ^ bp promoter of the yeast acid phosphatase PHQü, the yeast invertase signal sequence (encoding 19 amino acids) and the PH05 transcription termination. The 1 kb SalI-HindIII fragment of p31 RIT12 is cloned into yeast E. coli shuttle vector pJDB207 (Beggs, J.D. in: Molecular Genetics in yeast, Alfred Benzon Symposium 16, Copenhagen, 1981, biz. 383 “389) which shuttle vector is cut with Sail and HindIII. The resulting plasmid containing the 1kb insert is designated pJDB207 / PH05-RIT12.

Plasmid pJDB207 / PH-5 ~ RIT12 is digested with BamHI and Xhol and the large 6.8 kb BamHI-XhoI fragment (d) is isolated. This fragment contains all pJDB207 vector sequences and the PH05 transcription termination.

The 596 bp straight-ended BamHI fragment (b), the 1.1 kb Nrul-Xhol fragment (a), and the 6.8 kb XhoI-BamHI vector fragment (d) are ligated under standard ligation conditions with straight ends. Equal amounts of the ligation mixture are used to transform competent E. coli HB10 cells. Plasmid DNA from ampicillin resistant colonies is analyzed by restriction digits. A separate clone with the appropriate expression plasmid is designated pJDB207 / PH05 ”I-FT. Ligation of DNA fragments (c), (a) and (d) leads to expression plasmid pJDB207 / PHO5 - (- 173) -I-FT. The expression cassettes of these plasmids comprise the coding sequence of the invertase signal sequence which sequence is fused in the reading frame to the sequence of the soluble α (1-3) fucosyl transferase expressed under regulation of the inducible PH05 or the constitutive PHOS (-178) promoter ♦ The expression cassettes are placed in the yeast E. coli shuttle vector pJDB207 cloned between the BamHI and HindII restriction cleavage sites. The nucleotide sequence at the fusion between the invertase signal sequence and the cDNA encoding soluble FT is confirmed by DNA sequencing on double-stranded plasmid DNA using the primer 5, AGTCGAGGTTAGTATGGC3 'which contains the nucleotide sequence at position -77 to -60 of the ΡΗ05 as well as the PH05 (-17R) promoter. The correct link is: 5 'AAA ATA TCT GCA CGA CCG GTG 3' 3 'TTT TAT AGA CGT GCT GGC CAC 5'

Lys lie Ser Ala Arg Pro Val 19 62

inv ss FT

cleavage site for signal peptidase

Example 22

Construction of plasmids for inducible and constitutive expression of membrane bound FT in yeast

In these constructs, the coding sequence of the FT cDNA with its own ATG is used. However, the nucleotide sequence located immediately upstream of ATG is unfavorable for expression in yeast due to a high G-C content. This region has been replaced with an A-T rich sequence using PCR. At the same time, a restriction snap site for EcoRI has been introduced at the new nucleotide positions -4 to -9

Uppercase letters represent nucleotides of FT, lowercase letters are additional new sequences, restriction cut sites are underlined, 'start' and 'stop' codons are in bold.

Standard PCR conditions are used to amplify the FT cDNA with primers FT1 and FT2 (see Table F) in 30 DNA synthesis cycles (Taq DNA polymerase, Perkin-Elmer, 5 U / μΙ, 1 min at 72 ° C) , denaturation (10 sec at 93 ° C) and fusion (40 sec at 60 ° C). The resulting 1.25 kb DNA fragment is purified by phenol extraction and ethanol precipitation, then digested with EcoRI, Xhol and Nrul. The 191 bp EcoRI-Nrul fragment (e) is isolated on a preparative 4 # 's Nusive 3: 1 agarose (FMC BioProducts, Rockland, ME, USA) gel in tris borate buffer of pH 8.3, from the gel eluted and precipitated with ethanol. Fragment (e) includes the 5 * portion of the FT gene encoding amino acids 1 to 6l. The DNA has a 5 'extension with the EcoRI cleavage site as in PCR primer FT1.

Plasmids p31 RIT12 and p31 / PH05 (“173) RIT are each digested with EcoRI and Xhol. The large vector fragments (f and g, respectively) are isolated, eluted and purified on a preparative 0.8 # agarose gel. The 4.1 kb XhoI-EcoRI fragment (f) includes the pBR322-derived vector, the 534 bp PHOS promoter (3'EcoRI site), and the 131 bp PH05 transcription termination (5'XhoI site) . The 3.7 kb Xho I-EcoRI fragment (g) differs only by the 172 bp short constitutive PH05 (-173) promoter (3'EcoRI cleavage site) rather than the full PH05 promoter.

The 191 bp EcoRI-NruI fragment (e), the 1.1 kb NruI-XhoI fragment (a) and the 4.1 kb XhoI-EcoRI fragment (f) are ligated. An equal amount of 1 μΐ of the ligation mixture is used to transform competent E. coli HB10 cells. Plasmid DNA from ampicillin resistant colonies is analyzed. Plasmid DNA from a single clone is designated p31R / PH05 ~ ssFT.

Ligation of DNA fragments (e), (a) and (g) leads to plasmid P31R / PH05 (-173) -ssFT. These plasmids comprise the coding sequence of the membrane-bound FT under regulation of the inducible PH05 or the constitutive PHO (f-173) promoter, respectively.

Example 23

Cloning of the FT expression cassettes into pDP ^ 4

Plasmids p31R / PH05-ssFT and p31R / PH05 (-173) -ssFT are digested with HindIII cutting 3 * of the PH05 transcription termination. After reaction with Klenow DNA polymerase, the DNA is digested with Sail. The 2.3 kb and 1.9 kb straight-ended Sall fragments are isolated.

Plasmids pJDB207 / PH05-I-FT and pJDB207 / PH05 (-173) -I-FT are partially digested with HindlII in the presence of 0.1 mg / ml ethidium bromide (to cleave at an additional HindlII site in the invertase signal sequence). and then treated with Klenow DNA polymerase and Sail as described above. The respective 2.1 kb and 1.8 kb fragments are isolated.

The four DNA fragments are each ligated to the 11.8 kb Sall vector fragment of straight-ended pDP34 (see Example 3). In transformation of competent E. coli HB10 cells and analysis of plasmid DNA from individual transformants, four correct expression plasmids are designated pDP34 / PH05-I-FT; pDP34 / PH05 (-173) -I-FT; pDP34R / PH05-ssFT and pDP34R / PH05 (-173) -ssFT.

S. cerevisiae strains BT150 and H449 are transformed with 5 Pg separately from the four expression plasmids (above) according to Example 4. Individual transformed yeast colonies are selected and indicated by

Saccharomvces cerevisiae BT150 / pDP34 / PH05'I'FT> "" BT150 / pDP34 / PH05 (-173) "I-FT;" "BT150 / pDP3WPH05-ssFT;" "BT150 / PDP34R / PH05 (-173) 'SsFT; "" H4ii9 / pDP3it / PH05-I-FT; "" H ^ 9 / pDP3 ^ / PH05 ('i73) -i-FT; "" H449 / pDP34R / PH05-ssFT; "" h449 / pDP34r / ph05 (- 173) -ssFT.

Fermentation and preparation of the cell extracts is carried out according to Example 5. Using an assay analogous to the assay described by Goelz et al. (Supra), FT activity is found in the crude extracts from strains BT150 / pDP34R / PH05 ' SsFT, BT150 / pDP34R / PH05 (-173) -ssFT, H449 / pDP34r / PH05-ssFT and H449 / pDP34R / PH05 (-173) -ssFT have been prepared and in the culture media of strains H449 / pDP34 / PH05-I-FT , H449 / pDP34 / PH05 (-173) -I-FT, BT150 / pDP34 / PH05-I-FT

and BT150 / pDP34 / PH05 (-173) -1-FT.

Deposit of micro-organisms

The following strains of microorganisms were deposited with Deutsche Sammlung von Mikroorganismen (DSM), Mascheroder Weg 16, D-33OO Braunschweig (deposit data and accession numbers are given): Escherichia coli JM109 / pDP34: March 14, 1988; DSM 4473 Escherichia coli HB101 / p30: October 23, 1987; DSM 4297 Escherichia coli HB101 / p31R: December 19, 1988; DSM 5H6 Saccharomyces cerevisiae H449: February 18, 1988; DSM 4413 Saccharomyces cerevisiae BT150: May 23, 1991; DSM 6530

Claims (19)

A method for the preparation of membrane-bound mammalian glycosyl transferase which transferase is selected from galactosyl transferases, sialyl transferases, fucosyl transferases and variants thereof, by cultivating a yeast strain transformed with a hybrid vector, which vector is a expression cassette comprising a promoter and a DNA sequence encoded by the promoter encoding the glycosyl transferase or a variant thereof, recovering the enzymatic activity. The method of claim 1, wherein the glycosyl transferase is of human origin. The method of preparing a variant according to claim 1, wherein the variant differs from the corresponding complete glycosyl transferase in the absence of the cytoplasmic tail, the signal anchor and optionally a small portion of the stem region. Method for the preparation of a variant according to claim 3 »by cultivating a yeast strain comprising an expression cassette, said expression cassette having a promoter operably linked to a first DNA sequence encoding a signal peptide and in the correct reading frame is linked to a second DNA sequence for the variant encoding and is regulated by the promoter. A method according to any one of claims 1-4, wherein the glycosyl transferase is a galactosyl transferase. The method of claim 5, wherein the galactosyl transferase is selected from UDP galactose: β-galactoside α (1-3) galactosyl transferase (EC 2.4.I.I5I) and UDP galactose: β-Ν-acetylglucosamine β (1- 4) -galactosyl transferase (EC 2.4.1.22). The method of claim 5, wherein the galactosyl transferase has the amino acid sequence shown in Figure 1. The method of claim 5, wherein the galactosyl transferase has the amino acid sequence shown in Figure 2. The method of any one of claims 1-4, wherein the glycosyl transferase is a sialyl transferase. The method of claim 9. wherein the sialyl transferase is CMP-NeuAc β-galactoside α (2-6) sialyl transferase (EC 2.4.99 * 1). The method of claim 9 wherein the sialyl transferase has the amino acid sequence shown in Figure 3 * The method of claim 9, wherein the sialyl transferase is designated ST (Lys27-Cys /, o6) and comprises amino acids 27 to 406 of the amino acid sequence shown in Figure 3. The method of claim 9. wherein the sialyl transferase has the amino acid sequence shown in Figure 4. A method according to any one of claims 1-4, wherein the glycosyl transferase is a fucosyl transferase. The method of claim 14, wherein the fucosyl transferase is selected from GDP fucose: β-galactoside a (1-2) fucosyl transferase (EC 2.4.I.69) and GDP fucose: N-acetylglucosamine a (1-3 / 4) -fucosyl transferase (EC 2.4.1.65). The method of claim 14, wherein the fucosyl transferase has the amino acid sequence shown in Figure 5 The method of claim 14, wherein the fucosyl transferase is designated FT (Arg62-Arg / .05) and comprises amino acids 62 to 405 of the amino acid sequence shown in Figure 5. A hybrid yeast vector comprising an expression cassette comprising an expression cassette comprising a yeast promoter and a DNA sequence encoding a membrane bound mammalian glycosyl transferase and controlled by the promoter, the glycosyl transferase from galactosyl transferases, sialyl transferases, fucosyl transferases and variants thereof has been chosen. A yeast strain transformed with a hybrid vector according to claim 18.