NL2032310A - Kit and method for identifying eospalax fontanieri - Google Patents

Kit and method for identifying eospalax fontanieri Download PDF

Info

Publication number
NL2032310A
NL2032310A NL2032310A NL2032310A NL2032310A NL 2032310 A NL2032310 A NL 2032310A NL 2032310 A NL2032310 A NL 2032310A NL 2032310 A NL2032310 A NL 2032310A NL 2032310 A NL2032310 A NL 2032310A
Authority
NL
Netherlands
Prior art keywords
seq
rrna gene
conserved motif
motif sequence
sequence shown
Prior art date
Application number
NL2032310A
Other languages
Dutch (nl)
Other versions
NL2032310B1 (en
Inventor
Han Xiaoling
Li Bin
Zhou Bai'an
Song Pengfei
Zhang Jingjie
Hou Luyi
Jiang Feng
Zhang Tongzuo
Cai Zhenyuan
Original Assignee
Northwest Inst Plateau Bio Cas
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Northwest Inst Plateau Bio Cas filed Critical Northwest Inst Plateau Bio Cas
Publication of NL2032310A publication Critical patent/NL2032310A/en
Application granted granted Critical
Publication of NL2032310B1 publication Critical patent/NL2032310B1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6858—Allele-specific amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present disclosure provides a kit for identifying Eospalax fontanieri, including a reagent for detecting any one or more of the following three single—nucleotide polymorphism (SNP) sites of a species to be identified: a 37th position of a conserved motif sequence shown in SEQ ID NO: 5 and a 23rd position of a conserved motif sequence shown in SEQ ID NO: 6, in a 12S rRNA gene; and an 18th position of a conserved motif sequence shown in SEQ ID NO: 7 in a l6S rRNA gene. The present disclosure provides a simple and accurate kit for identifying E. fontanieri and a method for identifying the E. fontanieri. The present disclosure solves the problem. of identifying a zokor species by morphology, with an excellent prospect for use.

Description

P1434 /NL
KIT AND METHOD FOR IDENTIFYING ZOSPALAX FONTANIERI
TECHNICAL FIELD
The present disclosure belongs to the technical field of identification, and in particular relates to a kit and a method for identifying Eospalax fontanieri.
BACKGROUND ART
Zokor, as a collective name for animals of the subfamily Myo- spalacinae, is a rodent adapted to underground life. The zokor is stout and cylindrical in shape, with a broad and flat head and tentacles on the head, and has a flat and blunt nose with a bare nose pad, and a short tail and limbs. The zokor has extremely small eyes with poor vision, and is almost covered by hair, with its auricle degenerated and hidden under the hair. The zokor is mainly distributed in China, but also found in Mongolia and Sibe- ria, and inhabits forest edges, grasslands and farmland. The zokor lives in burrows during the day and occasionally goes to the ground at night, feeding on the roots, stems and seeds of plants, and storing a lot of food in the burrows. The zokor can dig bur- rows in an extremely high rate. The burrow has a complex system with many branches. Generally, there is no obvious exit of the burrow on the ground, but there are irregular mounds nearby.
The extant zokor includes Eospalax and Myospalax. There are few species in the genus Myospalax, and it is generally believed that there are three species at current, namely M. aspalax, M. myospalax and M. psilurus. The Eospalax includes 6 species of E. fontanieri, E. smithi, E. rothschildi, E. baileyi, E. cansus, and
E. rufescens. The zokor lives in a closed underground tunnel sys- tem almost all its life. A unique underground lifestyle makes the zokor special in many aspects such as foraging, mating, and repro- duction, which have aroused the wide interest of scientists.
It is the basis for understanding and protecting biodiversity by identifying and identifying biological species. Only after each species is accurately identified to conduct more fields of re-
search. However, since different zokor species have similar mor- phologies due to similar living environments, it is extremely dif- ficult to accurately identify species through morphology without professional training.
Therefore, it is extremely is to research a method and re- agent capable of quickly and accurately identifying the E. fonta- nieri.
SUMMARY
A purpose of the present disclosure is to provide a kit and a method capable of easily and accurately identifying E. fontanieri, which can solve the problem of identifying zokor species by mor- phology.
The present disclosure provides a kit for identifying E. fon- tanieri, including a reagent for detecting any one or more of the following three single-nucleotide polymorphism (SNP) sites of a species to be identified: a 37th position of a conserved motif sequence shown in SEQ ID
NO: 5 and a 23rd position of a conserved motif sequence shown in
SEQ ID NO: 6, in a 12S rRNA gene; and an 18th position of a conserved motif sequence shown in SEQ
ID NO: 7 in a 16S rRNA gene.
Further, the reagent may be capable of simultaneously detec- ting the three SNP sites; or the SNP sites may have bases as follows: the 37th position of the conserved motif sequence shown in
SEQ ID NO: 5 is A and the 23rd position of the conserved motif se- quence shown in SEQ ID NO: 6 is T, in the 1235 rRNA gene; and the 18th position of the conserved motif sequence shown in
SEQ ID NO: 7 is T in the 16S rRNA gene.
After research, it is found that the three SNP sites ge- nerally exist at the same time, that is, when a 37th base of the conserved motif sequence shown in SEQ ID NO: 5 is A, a 23rd base of the conserved motif sequence shown in SEQ ID NO: 6 is T, and an 18th base of the conserved motif sequence shown in SEQ ID NO: 7 is
T. Further experiments have also found that only a genome of the
E. fontanieri has the three SNP sites. Therefore, by detecting any one or more of the three SNP sites, it is possible to identify whether a species to be identified is the E. fontanieri.
Further, the reagent may be used for sequencing, a kompetiti- ve allele-specific PCR (KASP) method, or a restriction fragment length polymorphism (RFLP) method.
Furthermore, the kit may further include a reagent for ampli- fying a conserved motif sequence of the 123 rRNA gene and/or the 16S rRNA gene; where the conserved motif sequence is any one or more sequences shown in SEQ ID NO: 5 to SEQ ID NO: 7.
Further, the reagent for amplifying the conserved motif se- quence of the 12S rRNA gene may include a primer pair shown in SEQ
ID NO: 1 and SEQ ID NO: 2; and the reagent for amplifying the con- served motif sequence of the 16S rRNA gene may include a primer pair shown in SEQ ID NO: 3 and SEQ ID NO: 4.
The present disclosure further provides use of a reagent for amplifying a conserved motif sequence of a 12S rRNA gene and/or a 16S rRNA gene in a kit for identifying E. fontanieri, where the conserved motif sequence is any one or more sequences shown in SEQ
ID NO: 5 to SEQ ID NO: 7; and preferably, the reagent includes a primer pair shown in SEQ
ID NO: 1 to SEQ ID NO: 2 and/or a primer pair shown in SEQ ID NO: 3 to SEQ ID NO: 4.
The present disclosure further provides a method for identi- fying E. fontanieri, including the following steps: (1) extracting a total genomic DNA of a sample of a zokor to be identified; and (2) detecting any one or more of the following three SNP si- tes, and conducting analysis: a 37th position of a conserved motif sequence shown in SEQ ID
NO: 5 and a 23rd position of a conserved motif sequence shown in
SEQ ID NO: 6, in a 128 rRNA gene; and an 18th position of a conserved motif sequence shown in SEQ
ID NO: 7 in a 16S rRNA gene.
Preferably, in step {1}, the sample may be a tissue sample or a blood sample.
Further, in step (2), the detecting may specifically include: 1) conducting PCR amplification with an amplification reagent using the DNA extracted in step (1) as a template, to obtain an amplification product; 2) conducting agarose gel electrophoresis detection on the
PCR amplification product obtained in step 1); 3) sequencing a PCR amplification product of the 12S rRNA ge- ne with a bright band at 490 bp and/or a PCR amplification product of the 16S rRNA gene with a bright band at 1,450 bp in a detection result obtained in step 2), to obtain a sequence of the 12S rRNA gene and/or the 163 rRNA gene; and 4) conducting analysis on one or more of the following three
SNP sites in the sequence of the 12S rRNA gene and/or the 16S rRNA gene obtained in step 3): the 37th position of the conserved motif sequence shown in SEQ ID NO: 5 and the 23rd position of the con- served motif sequence shown in SEQ ID NO: 6, in the 123 rRNA gene; and the 18th position of the conserved motif sequence shown in SEQ
ID NO: 7 in the 163 rRNA gene; and preferably, in step 1), the amplification reagent may include a primer pair shown in SEQ ID NO: 1 and SEQ ID NO: 2 and/or a pri- mer pair shown in SEQ ID NO: 3 and SEQ ID NO: 4; the PCR amplifi- cation may have a annealing temperature of 52°C to 56°C; and in step 3), the sequencing may be bidirecticnal Sanger sequencing.
Furthermore, in step (2), the detecting may be to detect the three SNP sites simultaneously; or
Furthermore, if bases of the SNP sites are as follows, the zokor to be identified may be FE. fontanieri: the 37th position of the conserved motif sequence shown in
SEQ ID NO: 5 is A and the 23rd position of the conserved motif se- quence shown in SEQ ID NO: 6 is T, in the 1235 rRNA gene; and the 18th position of the conserved motif sequence shown in
SEQ ID NO: 7 is T in the 16S rRNA gene.
Beneficial effects of the present disclosure are:
In the present disclosure, the three specific SNP genotypes of the E. fontanieri appear simultaneously in a fragment (DNA bar- code) of the 125 rRNA gene and the 16S rRNA gene, and if one or more of the three SNP sites are detected, it can be determined that a to-be-identified zokor is the E. fontanieri, such that the- re is a low requirement for a sequencing length. The three SNP si-
tes with specific genotypes of the E. fontanieri are used to iden- tify zokor species, and the SNP sites can be mutually confirmed, such that obtained results are more accurate and reliable.
In the present disclosure, a key point is to discover a rela- 5 tionship between the three SNP sites in the conserved motif se- quence of the 12S rRNA gene fragment and the 163 rRNA gene frag- ment of zokor and the E. fontanieri. On this basis, any reagent or equipment capable of detecting any one or more bases of the SNP sites can be used for species identification of the E. fontanieri.
Specifically, in examples of the present disclosure, the SNP sites are detected by sequencing. The primer pair has desirable specificity, and has no non-specific amplification with DNA frag- ments other than the target when conducting PCR; an amplified tar- get gene is a mitochondrial single-copy gene that can be directly used for sequencing through a simple method without cloning. Three conserved motif sequences of E. fontanieri are further provided to assist in determining a position of the specific SNP sites of FE. fontanieri in the fragment (DNA barcode) of the 12s rRNA gene and the 1635 rRNA gene, which is convenient for determination of a ge- notype of the SNP site.
Obviously, according to the above-mentioned content of the present disclosure and on the basis of common technical knowledge and common methods in the field, various other modifications, sub- stitutions or alterations can be made without departing from the above-mentioned basic technical idea of the present disclosure.
The above-mentioned content of the present disclosure will be further described in detail below through specific implementations in the form of examples. However, it should not be construed that the subject of the present disclosure is limited to the following examples. Instead, technologies implemented based on the content of the present disclosure should fall within the scope of the pre- sent disclosure.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 shows a sequence peak diagram (a first motif sequence) of a PCR product of a 12S rRNA gene of a zokor numbered ZYX-4 in
Example 5;
FIG. 2 shows a sequence peak diagram (a second motif sequen- ce) of the PCR product of the 125 rRNA gene of the zokor numbered
ZYX-4 in Example 5;
FIG. 3 shows a sequence peak diagram (a reverse complement of a third motif sequence) of a PCR product of a 16S rRNA gene of the zokor numbered ZYX-4 in Example 5;
FIG. 4 shows a sequence peak diagram (a sequence at the first motif) of a PCR product of a 12S rRNA gene of a zokor numbered
DLL-5 in Example 5;
FIG. 5 shows a sequence peak diagram (a sequence at the se- cond motif) of the PCR product of the 125 rRNA gene of the zokor numbered DLL-5 in Example 5; and
FIG. 6 shows a sequence peak diagram (a reverse complement sequence at the third motif) of a PCR product of a 16S rRNA gene in a primer pair of a zokor numbered DLL-5 in Example 5.
DETAILED DESCRIPTION OF THE EMBODIMENTS
For a clearer understanding, the present disclosure is fur- ther described with reference to the following examples and accom- panying drawings. The examples are for illustration only and do not limit the present disclosure in any way.
The experimental methods that do not indicate specific condi- tions in the examples are conventional methods and conventional conditions well known in the art, or according to the conditions suggested by the manufacturer; various chemical reagents used in the examples are comercially available, and the primers are en- trusted to be synthesized.
Example 1 Kit for identifying E. fontanieri
Components of the kit included: {1) a PCR amplification reagent: including a primer pair shown in SEQ ID NO: 1 to SEQ ID NO: 2; (2) a reagent for sequen- cing.
Example 2 Kit for identifying E. fontanieri
Components of the kit included: (1) a PCR amplification reagent: including a primer pair shown in SEQ ID NO: 3 to SEQ ID NO: 4; (2) a reagent for sequen- cing.
Example 3 Kit for identifying E. fontanieri
Components of the kit included: (1) a PCR amplification reagent: including primer pairs shown in SEQ ID NO: 1 to SEQ ID NO: 2 and SEQ ID NO: 3 to SEQ ID NO: 4; (2) a reagent for sequencing.
Example 4 Design of PCR primers and verification of SNP sites
The mitochondrial genome sequences of 121 zokor individuals from 8 zokor species were compared, and it was found that there were 2 E. fontanieri-specific SNP genotypes in the 1235 rRNA gene, and 1 E. fontanieri-specific SNP genotype in the 163 rRNA gene; there were conserved sequences at both ends of these three SNP si- tes, such that the 12S rRNA gene fragment and the 16S rRNA gene fragment were determined as a DNA barcode for the identification of E. fontanieri.
The 121 zokor individuals from 8 zokor species specifically included: 12 M. aspalax, 10 M. psilurus, 15 E. fontanieri, 18 E. smithi, 16 E. rothschildi, 14 FE. baileyi, 24 E. cansus, and 12 E. rufescens.
The primers were designed for the 12S rRNA, the 16S rRNA and nearby gene sequences in a conserved region as follows:
ME12S-1L: AGCACTGAAAATGCTTAGATGG (SEQ ID NO: 1};
ME12S-1R: CGGCTAAGCATAGTGGGGGTA (SEQ ID NO: 2).
ME16S-1L: AGAGGAGATAAGTCGTAACAAGGT (SEQ ID NO: 3);
ME16S-1R: TCCTGATCCAACATCGAGGT (SEQ ID NO: 4).
DNA samples of different zokor species were amplified using the primer pairs to confirm 3 SNP sites in the 125 rRNA gene and the 16S rRNA gene for the identification of E. fontanieri, as fol- lows: 1) a genotype of a 307th base (a 37th base of the conserved motif sequence shown in SEQ ID NO: 5) of an amplification product of the 123 rRNA gene of E. fontanieri is A, while a genotype of the site in other zokor species is G; 2) a genotype of a 347th base (a 23rd base of the conserved motif sequence shown in SEQ ID NO: 6) of an amplification product of the 123 rRNA gene of E. fontanieri is T, while a genotype of the site in other zokor species is A or G; and 3) a genotype of a 1304th base (an 18th base of the conserved motif sequence shown in SEQ ID NO: 7) of an amplification product of the 163 rRNA gene of E. fontanieri is T, while a genotype of the site in other zokor species is C.
Example 5 Species identification of E. fontanieri
A primer pair (SEQ ID NO: 1 and SEQ ID NO: 2) was synthesized for a 123 rRNA gene fragment, and a primer pair (SEQ ID NO: 3 and
SEQ ID NO: 4) was synthesized for a 163 rRNA gene fragment.
Identification was conducted by the following method: a) a Qiagen's DNeasy Blood & Tissue Kit was used to extract a total genomic DNA of a muscle tissue of a zokor numbered JX-5, a total genomic DNA of a muscle tissue of a zokor numbered ZYX-4, and a total genomic DNA of a liver tissue of a zokor numbered DLL- 57 b) a PCR reaction was conducted with the primer pair of 128 rRNA and the primer pair of 16S rRNA using the total genomic DNAs of the zokors numbered ZYX-4 and DLL-5 obtained in step a) as tem- plates, where a ZYX-4 reaction system was 25 uL at an annealing temperature of 56°C; a DLL-5 reaction system was 25 pL at an anne- aling temperature of 55°C; while a PCR reaction was conducted with the primer pair of 12S rRNA using the total genomic DNA of the zokor numbered JX-5 obtained in step a) as a template, where a J¥- 5 reaction system was 25 uL at an annealing temperature of 52°C; c) a PCR product obtained in step b) was detected by 1% aga- rose gel electrophoresis, and bright bands of about 490 bp and about 1,450 bp were observed; d) bidirectional Sanger sequencing was conducted on the PCR product obtained in step c) to obtain sequencing peak diagrams of the 12S rRNA gene and the 165 rRNA gene; and e) conserved motif sequences shown in SEQ ID NO: 5 to SEQ ID
NO: 7 were found in the sequencing peak diagrams, and bases of the
SNP sites were analyzed.
The results were as follows: (1) ZYX-4 zokor: in the sequence of SEQ ID NO: 5, a 37th base is A (FIG. 1); in the sequence of SEQ ID NO: 6, a 23rd base is T (FIG. 2); and in the sequence of SEQ ID NO: 7, an 18th base is T (FIG. 3).
Therefore, it is determined that the sample numbered ZYX-4 is
E. fontanieri. (2) JX-5 zokor: in the sequence of SEQ ID NO: 5, a 37th base is A.
Therefore, it is determined that the sample numbered JX-5 is
E. fontanieri. {3) DLL-5 zokor: in the sequence of SEQ ID NO: 5, a 37th base is not A (FIG. 4); in the sequence of SEQ ID NO: 6, a 23rd base is not T (FIG. 5); and in the sequence of SEQ ID NO: 7, an 18th base is not T (FIG. 6).
Therefore, it is determined that the sample numbered DLL-5 is not EZ. fontanieri.
In addition, the zokors numbered JX-5, ZYX-4 and DLL-5 were identified by a traditional morphological identification method.
In the JX-5 and ZYX-4 zokors, the body is large with white spots on the forehead, the nose pad is oval, the tail is relative- ly long with no hair; the cranial occipital part of the skull is raised, the nose pad is oval and the zygomatic arch is slightly extended, a widest point of the zygomatic arch is at the rear; the ridge crest is parallel, and the supraorbital ridge and middle oc- cipital ridge are underdeveloped; the incisor foramen is sur- rounded by the premaxilla and maxilla, and the third upper molar (M?) has a posterior extension lobe. These characteristics are con- sistent with the E. fontanieri, indicating that the two zokors are
E. fontanieri.
In DLL-5, the body is small, the front claws are obviously slender, the nose pad is mitral, and the tail is densely haired; the cranial occipital part of the skull is raised, the zygomatic arch is extended, and the ridge crest is parallel, not close to the raphe, but folded and close to the frontal part, and then com- bined with the developed supraorbital ridge forward; the incisor foramen is surrounded by the premaxilla and maxilla. These charac- teristics are in line with the morphological identification cha- racteristics of E. rothschildi, confirming that the DLL-5 zokor is
E. rothschildi, not E. fontanieri.
The experimental results show that the method for identifying
E. fontanieri of the present disclosure is accurate, and can be actually used for the identification and detection of the E. fon-
tanieri.
The present disclosure provides a simple and accurate kit for identifying E. fontanieri and a method for identifying the E. fon- tanieri. The present disclosure solves the problem of identifying a zokor species by morphology, with an excellent prospect for use.
SEQUENCE LISTING
<110> Northwest Institute of Plateau Biology, Chinese Acade- my of Sciences <120> KIT AND METHOD FOR IDENTIFYING EOSPALAX FONTANIERI <130> HKJP20220400652 <160> 7 <170> PatentIn version 3.5 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer for amplifying conserved motif sequence of 125 rRNA gene <400> 1 agcactgaaa atgcttagat gg 22 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for amplifying conserved motif sequence of 125 rRNA gene
<400> 2 cggctaagca tagtggggta 20
<210> 3 <211> 24 <212> DNA <213> Artificial Sequence
<220> <223> primer for amplifying conserved motif sequence of 1685 rRNA gene <400> 3 agaggagata agtcgtaaca aggt 24 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for amplifying conserved motif sequence of 1685 rRNA gene <400> 4 tcctgatcca acatcgaggt 20
<210> 5 <211> 44 <212> DNA
<213> Eospalax fontanieri
<400> 5 ggtaaatttc gtgccagcca ccgcggtcat acgattaacc caaa 44
<210> 6
<211> 24
<212> DNA <213> Eospalax fontanieri i
<400> 6 catcggcgta aagcgtacaa catg 24
<210> 7
<211> 37
<212> DNA
<213> Eospalax fontanieri
<400> 7 cctccgaata acaaaactaa gacctacaag tcaaagt 37
SEQUENCE LISTING
<110> Northwest Institute of Plateau Biology, Chinese Academy of
Sciences <120> KIT AND METHOD FOR IDENTIFYING EOSPALAX FONTANIERI <130> HKJIP20220400652 <160> 7 <170> PatentIn version 3.5 <21e> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer for amplifying conserved motif sequence of 12S rRNA gene <400> 1 agcactgaaa atgcttagat gg 22 <2105 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for amplifying conserved motif sequence of 12S rRNA gene <400> 2 cggctaagca tagtggggta 20 <2105 3 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer for amplifying conserved motif sequence of 16S rRNA gene <400> 3 agaggagata agtcgtaaca aggt 24 <2105 4 <211> 20 <212> DNA <213> Artificial Sequence
<220>
<223> primer for amplifying conserved motif sequence of 16S rRNA gene <400> 4 tcctgatcca acatcgaggt 20 <210> 5
<211> 44
<212> DNA
<213> Eospalax fontanieri
<400> 5 ggtaaatttc gtgccagcca ccgcggtcat acgattaacc caaa 44 <210> 6
<211> 24
<212> DNA
<213> Eospalax fontanieri
<400> 6 catcggcgta aagcgtacaa catg 24 <210> 7
<211> 37
<212> DNA
<213> Eospalax fontanieri
<400> 7 cctccgaata acaaaactaa gacctacaag tcaaagt 37

Claims (10)

CONCLUSIESCONCLUSIONS 1. Kit voor het identificeren van Eospalax fontanieri, omvattende een reagens voor het detecteren van een of meer van de volgende drie single-nucleotide polymorfisme (SNP)-plaatsen van een te identificeren soort: een 37e positie van een geconserveerde motiefsequentie getoond in SEQ ID NO: 5 en een 23e positie van een geconserveerde motiefse- quentie getoond in SEQ ID NO: 6 in een 12S rRNA-gen; en een 18e positie van een geconserveerde motiefsequentie getoond in SEQ ID NO: 7 in een 16S rRNA-gen.A kit for identifying Eospalax fontanieri comprising a reagent for detecting one or more of the following three single nucleotide polymorphism (SNP) sites from a species to be identified: a 37th position of a conserved motif sequence shown in SEQ ID NO: 5 and a 23rd position of a conserved motif sequence shown in SEQ ID NO: 6 in a 12S rRNA gene; and an 18th position of a conserved motif sequence shown in SEQ ID NO: 7 in a 16S rRNA gene. 2. Kit volgens conclusie 1, waarbij het reagens in staat is om ge- lijktijdig de drie SNP-plaatsen te detecteren; of de SNP-plaatsen de volgende basen hebben: de 37e positie van de geconserveerde motiefsequentie getoond in SEQ ID NO: 5 is A en de 23e positie van de geconserveerde motief- sequentie getoond in SEQ ID NO: 6 is T, in het 12S rRNA-gen; en de 18e positie van de geconserveerde motiefsequentie die wordt ge- toond in SEQ ID NO: 7 is T in het 16S rRNA-gen.The kit according to claim 1, wherein the reagent is capable of simultaneously detecting the three SNP sites; whether the SNP sites have the following bases: the 37th position of the conserved motif sequence shown in SEQ ID NO: 5 is A and the 23rd position of the conserved motif sequence shown in SEQ ID NO: 6 is T, in the 12S rRNA -gene; and the 18th position of the conserved motif sequence shown in SEQ ID NO: 7 is T in the 16S rRNA gene. 3. Kit volgens conclusie 1 of 2, waarbij het reagens wordt ge- bruikt voor sequencing, een competitieve allel-specifieke PCR (KASP)-methode of een restrictiefragmentlengte polymorfisme (RFLP) -methode.A kit according to claim 1 or 2, wherein the reagent is used for sequencing, a competitive allele-specific PCR (KASP) method or a restriction fragment length polymorphism (RFLP) method. 4. Kit volgens conclusie 1 of 2, verder omvattende een reagens voor het amplificeren van een geconserveerde motiefsequentie van het 12S rRNA-gen en/of het 16S rRNA-gen; waarbij de geconserveerde motiefsequentie één of meer sequenties is die worden getoond in SEQ ID NO: 5 tot SEQ ID NO: 7.The kit according to claim 1 or 2, further comprising a reagent for amplifying a conserved motif sequence of the 12S rRNA gene and/or the 16S rRNA gene; wherein the conserved motif sequence is one or more sequences shown in SEQ ID NO: 5 to SEQ ID NO: 7. 5. Kit volgens conclusie 4, waarbij het reagens voor het amplifi- ceren van de geconserveerde motiefseguentie van het 123 rRNA-gen een primerpaar omvat dat wordt getoond in SEQ ID NO: 1 en SEQ ID NO: 2; en het reagens voor het amplificeren van de geconserveerde motiefsequentie van het 16S rRNA-gen een primerpaar omvat dat wordt getoond in SEQ ID NO: 3 en SEQ ID NO: 4.The kit of claim 4, wherein the reagent for amplifying the conserved motif sequence of the 123 rRNA gene comprises a pair of primers shown in SEQ ID NO: 1 and SEQ ID NO: 2; and the reagent for amplifying the conserved motif sequence of the 16S rRNA gene comprises a pair of primers shown in SEQ ID NO: 3 and SEQ ID NO: 4. 6. Gebruik van een reagens voor het amplificeren van een geconser- veerde motiefsequentie van een 12S rRNA-gen en/of een 16S rRNA-gen in een kit voor het identificeren van E. fontanieri, waarbij de geconserveerde motiefsequentie een of meer sequenties is die wor- den getoond in SEQ ID NO: 5 tot SEQ ID NR: 7; bij voorkeur omvat het reagens een primerpaar dat wordt getoond in SEQ ID NO: 1 tot SEQ ID NO: 2 en/of een primerpaar dat wordt ge- toond in SEQ ID NO: 3 tot SEQ ID NO: 4.6. Use of a reagent for amplifying a conserved motif sequence of a 12S rRNA gene and/or a 16S rRNA gene in a kit for identifying E. fontanieri, wherein the conserved motif sequence is one or more sequences are shown in SEQ ID NO: 5 to SEQ ID NO: 7; preferably the reagent comprises a primer pair shown in SEQ ID NO: 1 to SEQ ID NO: 2 and/or a primer pair shown in SEQ ID NO: 3 to SEQ ID NO: 4. 7. Werkwijze voor het identificeren van E. fontanieri, omvattende de volgende stappen: (1) het extraheren van een totaal genomisch DNA van een monster van een te identificeren zokor; en (2) het detecteren van een of meer van de volgende drie SNP- plaatsen en het uitvoeren van analyses: een 37e positie van een geconserveerde motiefsequentie die wordt getoond in SEQ ID NO: 5 en een 23e positie van een geconserveerde motiefsequentie die wordt getoond in SEQ ID NO: 6 in een 12S rRNA- gen; en een 18e positie van een geconserveerde motiefsequentie die wordt getoond in SEQ ID NO: 7 in een 16S rRNA-gen; waarbij in stap (1) het monster bij voorkeur een weefselmonster of een bloedmonster is.A method of identifying E. fontanieri, comprising the steps of: (1) extracting a total genomic DNA from a sample of a zokor to be identified; and (2) detecting one or more of the following three SNP sites and performing analyses: a 37th position of a conserved motif sequence shown in SEQ ID NO: 5 and a 23rd position of a conserved motif sequence shown in SEQ ID NO: 6 in a 12S rRNA gene; and an 18th position of a conserved motif sequence shown in SEQ ID NO: 7 in a 16S rRNA gene; wherein in step (1) the sample is preferably a tissue sample or a blood sample. 8. Werkwijze volgens conclusie 7, waarbij in stap (2) het detecte- ren specifiek omvat: 1) het uitvoeren van PCR-amplificatie met een amplificatiereagens met gebruikmaking van het in stap (1) geëxtraheerde DNA als een matrijs, om een amplificatieproduct te verkrijgen; 2) het uitvoeren van agarosegelelektroforese detectie op het PCR- amplificatieproduct verkregen in stap 1}; 3) het sequencen van een PCR-amplificatieproduct van het 12S rRNA- gen met een heldere band bij 490 bp en/of een PCR- amplificatieproduct van het 16S rRNA-gen met een heldere band bijThe method of claim 7, wherein in step (2) detecting specifically comprises: 1) performing PCR amplification with an amplification reagent using the DNA extracted in step (1) as a template, to obtain an amplification product. to acquire; 2) performing agarose gel electrophoresis detection on the PCR amplification product obtained in step 1}; 3) sequencing a PCR amplification product of the 12S rRNA gene with a clear band at 490 bp and/or a PCR amplification product of the 16S rRNA gene with a clear band at 1.450 bp in een detectieresultaat dat is verkregen in stap 2), om een sequentie van het 12S rRNA-gen en/of het 16S rRNA-gen te ver- krijgen; en 4) het uitvoeren van analyse op een of meer van de volgende drie SNP-plaatsen in de sequentie van het 125 rRNA-gen en/of het 163 rRNA-gen dat is verkregen in stap 3): de 37e positie van de gecon- serveerde motiefsequentie die is getoond in SEQ ID NR: 5 en de 23e positie van de geconserveerde motiefsequentie die is getoond in SEQ ID NO: 6, in het 125 rRNA-gen; en de 18e positie van de gecon- serveerde motiefsequentie die is getoond in SEQ ID NO: 7 in het 16S rRNA-gen; en bij voorkeur omvat in stap 1) het amplificatiereagens een primer- paar dat is getoond in SEQ ID NO: 1 en SEQ ID NO: 2 en/of een pri- merpaar dat is getoond in SEQ ID NO: 3 en SEQ ID NO: 4; waarbij de PCR-amplificatie een annealingstemperatuur heeft van 52 °C tot 56 °C; en in stap 3) de sequencing bidirectionele Sanger-sequencing is.1,450 bp in a detection result obtained in step 2), to obtain a sequence of the 12S rRNA gene and/or the 16S rRNA gene; and 4) performing analysis at one or more of the following three SNP sites in the sequence of the 125 rRNA gene and/or the 163 rRNA gene obtained in step 3): the 37th position of the con- served motif sequence shown in SEQ ID NO: 5 and the 23rd position of the conserved motif sequence shown in SEQ ID NO: 6 in the 125 rRNA gene; and the 18th position of the conserved motif sequence shown in SEQ ID NO: 7 in the 16S rRNA gene; and preferably in step 1) the amplification reagent comprises a primer pair shown in SEQ ID NO: 1 and SEQ ID NO: 2 and/or a primer pair shown in SEQ ID NO: 3 and SEQ ID NO: 4; wherein the PCR amplification has an annealing temperature of 52°C to 56°C; and in step 3) the sequencing is bidirectional Sanger sequencing. 9. Werkwijze volgens conclusie 7 of 8, waarbij in stap (2) de de- tectie het gelijktijdig detecteren van de drie SNP-plaatsen is.The method of claim 7 or 8, wherein in step (2) the detection is simultaneously detecting the three SNP sites. 10. Werkwijze volgens conclusie 7 of 8, waarbij als de basen van de SNP-plaatsen als volgt zijn, de te identificeren zokor E. fon- tanieri is: de 37e positie van de geconserveerde motiefsequentie die is ge- toond in SEQ ID NO: 5 is A en de 23e positie van de geconserveerde motiefsequentie die is getoond in SEQ ID NO: 6 is T, in het 123 rRNA-gen; en de 18e positie van de geconserveerde motiefsequentie die is ge- toond in SEQ ID NR: 7 is T in het 16S rRNA-gen.The method of claim 7 or 8, wherein when the bases of the SNP sites are as follows, the zokor to be identified is E. fontanieri: the 37th position of the conserved motif sequence shown in SEQ ID NO: 5 is A and the 23rd position of the conserved motif sequence shown in SEQ ID NO: 6 is T, in the 123 rRNA gene; and the 18th position of the conserved motif sequence shown in SEQ ID NO: 7 is T in the 16S rRNA gene.
NL2032310A 2021-08-17 2022-06-28 Kit and method for identifying eospalax fontanieri NL2032310B1 (en)

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110945436.8A CN113444814B (en) 2021-08-17 2021-08-17 Kit and method for identifying Chinese zokor

Publications (2)

Publication Number Publication Date
NL2032310A true NL2032310A (en) 2023-02-24
NL2032310B1 NL2032310B1 (en) 2023-03-03

Family

ID=77818652

Family Applications (1)

Application Number Title Priority Date Filing Date
NL2032310A NL2032310B1 (en) 2021-08-17 2022-06-28 Kit and method for identifying eospalax fontanieri

Country Status (2)

Country Link
CN (1) CN113444814B (en)
NL (1) NL2032310B1 (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113430281A (en) * 2021-08-17 2021-09-24 中国科学院西北高原生物研究所 Kit and method for identifying zokor species

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
PT103599B (en) * 2006-11-06 2009-08-06 Univ Do Porto PROCESS OF IDENTIFICATION OF ANIMAL SPECIES IN SAMPLES CONTAINING GENETIC MATERIAL, BASED ON DETERMINATION OF THE SIZE OF MITOCHONDRIAL DNA SEQUENCES
CN107058492A (en) * 2017-01-12 2017-08-18 中国人民解放军第二军医大学 The method and kit of a kind of pvuii restriction fragment for identifying naked mole mitochondrial cytochrome b genes

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113430281A (en) * 2021-08-17 2021-09-24 中国科学院西北高原生物研究所 Kit and method for identifying zokor species

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
CAI ZHENYUAN ET AL: "The complete mitochondrial genome of Chinese zokor ( Eospalax fontanierii )", MITOCHONDRIAL DNA PART B, vol. 4, no. 1, 8 January 2019 (2019-01-08), pages 153 - 154, XP093001904, Retrieved from the Internet <URL:https://www.tandfonline.com/doi/pdf/10.1080/23802359.2018.1544859?needAccess=true> DOI: 10.1080/23802359.2018.1544859 *
YANG LI ET AL: "Species identification through mitochondrial rRNA genetic analysis", SCIENTIFIC REPORTS, vol. 4, no. 1, 13 February 2014 (2014-02-13), pages 1 - 11, XP055793519, Retrieved from the Internet <URL:http://www.nature.com/articles/srep04089> DOI: 10.1038/srep04089 *
ZHOU CAIQUAN ET AL: "Molecular authentication of the animal crude drug Sailonggu (bone of Myospalax baileyi)", BIOL. PHARM. BULL., vol. 27, no. 11, 1 November 2004 (2004-11-01), pages 1850 - 1858, XP055980949, Retrieved from the Internet <URL:https://www.jstage.jst.go.jp/article/bpb/27/11/27_11_1850/_pdf/-char/en> *
ZHOU CAIQUAN ET AL: "The validity of different zokor species and the genus Eospalax inferred from mitochondrial gene sequences", INTEGRATIVE ZOOLOGY, vol. 3, no. 4, 1 December 2008 (2008-12-01), pages 290 - 298, XP055979067, ISSN: 1749-4869, DOI: 10.1111/j.1749-4877.2008.00108.x *

Also Published As

Publication number Publication date
CN113444814B (en) 2023-10-27
CN113444814A (en) 2021-09-28
NL2032310B1 (en) 2023-03-03

Similar Documents

Publication Publication Date Title
CN105483228B (en) A kind of quasi- Nian Triplophysa DNA bar code standard detection gene and its application
KR101912196B1 (en) Molecular marker and primer set for discriminating Paeonia suffruticosa and Paeonia lactiflora and uses thereof
CN105821054B (en) sinkiang bream DNA bar code standard detection sequence and application thereof
CN112126692B (en) Molecular marker for identifying sika deer long island subspecies, identification method and application
NL2032209B1 (en) Kit and method for identifying eospalax smithi
CN113430281B (en) Kit and method for identifying species of zokor with raised cranium
NL2032311B1 (en) Kit and method for identifying eospalax rothschildi
CN107475414B (en) Method for screening parent oysters with high glycogen content
NL2032310B1 (en) Kit and method for identifying eospalax fontanieri
Abu-Almaaty et al. Genetic characterization of four fish species of Genus Synodontis using RAPD marker
NL2032208B1 (en) Kit and method for identifying myospalax aspalax
NL2032253B1 (en) Kit and method for identifying eospalax baileyi
CN113637769B (en) Kit and method for identifying northeast zokor
KR101736670B1 (en) Primer sets for identification of Phalaenopsis and composition of marker comprising the same
KR101137799B1 (en) Specific primers for discriminating Suhan strains in Pleurotus ostreatus, and uses thereof
CN108251542B (en) Method for identifying Scylla paramamosain and Scylla serrata
CN113444812B (en) Kit and method for identifying zokor in Qinling mountain
KR101795937B1 (en) Primer set KSLG-CP001 for identification of Phalaenopsis and composition of marker comprising the same
CN113444813B (en) Kit and method for identifying Gansu zokor
KR102592643B1 (en) Primer set for species discrimination of Japanese seabass and Spotted seabass and method of determining species of Japanese seabass and Spotted seabass using the same
KR101636110B1 (en) Universal primer set COS0420 for discrimination of Brassicaceae sp. and molecular marker comprising the same
JP6415663B1 (en) Individual identification method of Amami rabbit and PCR primer set
KR101137803B1 (en) Specific primers for discriminating Wonhyeong strains in Pleurotus ostreatus, and uses thereof
KR20070083260A (en) Specific primer for detection of soybean mosaic virus
CN117363753A (en) SNP molecular marker related to growth traits and related method and application thereof