NL2029091B1 - Scar molecular marker for specificity identification of tremella fuciformis strain and identification method and application thereof - Google Patents

Scar molecular marker for specificity identification of tremella fuciformis strain and identification method and application thereof Download PDF

Info

Publication number
NL2029091B1
NL2029091B1 NL2029091A NL2029091A NL2029091B1 NL 2029091 B1 NL2029091 B1 NL 2029091B1 NL 2029091 A NL2029091 A NL 2029091A NL 2029091 A NL2029091 A NL 2029091A NL 2029091 B1 NL2029091 B1 NL 2029091B1
Authority
NL
Netherlands
Prior art keywords
scar
strain
tremella fuciformis
sequence
molecular marker
Prior art date
Application number
NL2029091A
Other languages
Dutch (nl)
Inventor
Liu Yunchao
Sun Shujing
Kong Xuqiang
Original Assignee
Univ Fujian Agriculture & Forestry
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Univ Fujian Agriculture & Forestry filed Critical Univ Fujian Agriculture & Forestry
Priority to NL2029091A priority Critical patent/NL2029091B1/en
Application granted granted Critical
Publication of NL2029091B1 publication Critical patent/NL2029091B1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Botany (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Described is a provides a SCAR molecular marker for specificity identification of a Tremel/a 5 fuciformis strain and an identification method and application thereof. A nucleotide sequence of the SCAR molecular marker is shown by SEQ ID NO: 1, or is consistent with a middle sequence in 30bp of a front end and a rear end in the sequence shown by SEQ ID NO: 1, or has a similarity of over 99% with the middle sequence in 30bp of the front end and the rear end in the sequence shown by SEQ ID NO: 1. The present invention also provides primers designed based on the 10 SCAR molecular marker. Vlfith the SCAR molecular marker and the primer, different Treme/la fuciformis varieties can be identified; and a Tremel/a fuciformis TVWV01-AX strain can be rapidly and effectively identified. The present invention has the advantages of simple operation, short time consumption and strong specificity.

Description

SCAR MOLECULAR MARKER FOR SPECIFICITY IDENTIFICATION OF TREMELLA
FUCIFORMIS STRAIN AND IDENTIFICATION METHOD AND APPLICATION THEREOF Technical Field The present invention belongs to the technical field of biology, and in particular relates to a SCAR molecular marker for specificity identification of a Tremella fuciformis strain and an identification method and application thereof. Background Tremella fuciformis, which belongs to Tremella, Tremellaceae, Tremellales, is an edible- medicinal fungus having good reputation in China. Tremella fuciformis contains a lot of bioactive substances, enhances organism immunity, relieves impairment of a nervous system and has effects of antitumour, anti-radiation, anti-oxidation, anti-aging, antidiabetics and anti- hyperlipidemia as well as broad development prospects.
As an edible fungus variety with outstanding features and advantages in China, Tremella fuciformis has the yield accounting for over 90% of the worldwide yield. At present, main cultivars of Tremella fuciformis are singular in China. With the increase of passage number, the main cultivars have become degraded to different degrees, bringing certain risks to seed production. It is urgent to supplement high-quality new varieties. Compared with other edible fungi, folk seed production of Tremella fuciformis is chaotic, great disputes exist over culture sources and obvious problems are caused such as different species sharing the same name and the same species having different names. In addition, as the cultivation scale is further expended, more and more high-quality cultures of Tremella fuciformis adapted to different altitudes and different climate conditions are needed. Therefore, it is necessary to establish a simple and rapid strain identification technology with accurate results so as to ensure accurate and correct use of cultures, protect interests of breeders and producers and avoid waste of scientific research resources.
Summary Aiming at the above problems in the prior art, the present invention aims to provide a SCAR molecular marker for specificity identification of a Tremella fuciformis strain TWWO01-AX. A nucleotide sequence of the SCAR molecular marker is shown by SEQ ID NO: 1, or is consistent with a middle sequence in 30bp of a front end and a rear end in the sequence shown by SEQ ID NO:1, or has a similarity of over 99% with the middle sequence in 30bp of the front end and the rear end in the sequence shown by SEQ ID NO: 1.
In a sequence synthesis process, due to changes in a synthesis system or a procedure, a synthesized sequence may be different. However, aiming at the present invention, main manifestations include substitution, insertion or deletion of a part of bases in the sequence of about 30bp between the front end and the rear end. However, for the middle sequence in about 30bp of the front end and the rear end, namely based on the sequence shown by SEQ ID NO: 1, if the sequence of about 30bp of the front end or the sequence of about 30bp of the rear end can be changed, but the sequence of a middle fragment between the two ends does not change, or the similarity of the middle sequence reaches over 98%, above contents fall into the protection scope of the present invention.
The Tremella fuciformis strain TWWO01-AX was deposited on November 18, 2019 in General Microbiological Center of China Committee for Culture Collection of Microorganisms (CCCCM) with collection number of CGMCC NO.18809.
Another purpose of the present invention is to provide primers designed based on the SCAR molecular marker. Preferably, sequences of the primers are: 2047-S-1F:5,-GGCGGAGGATACAGATTG-3' 2047-S-1R:5’-CCAGTAGGTAGCGGAAGA-3’.
A third purpose of the present invention is to apply the SCAR molecular marker or the primers to identification of the Tremella fuciformis strain TWWO01-AX.
A method for identifying the Tremella fuciformis strain TWW01-AX with the SCAR molecular marker or the primers comprises the following steps: extracting a DNA of a sample, and conducting SCAR-PCR amplification on the DNA, wherein the sample strain is the Tremella fuciformis strain TWWO01-AX if a 308bp band is amplified.
A SCAR-PCR reaction system is as follows: 1pl of an upstream primer, 1 pl of a downstream primer, 1 pl of a DNA template, 12.5 pl of 2 x Easy Taq PCR SuperMix and 9.5 pl of ddH20O. A SCAR-PCR reaction procedure comprises: 94°C pre-denaturation of 5min, 94°C denaturation of 1min, 55°C annealing of 1min, 72°C extension of 1min, 30 cycles, and 72°C extension of 10 min.
The SCAR molecular marker for specificity identification of the Tremella fuciformis strain and the identification method and application thereof provided by the present invention have the following beneficial effects: With the SCAR molecular marker and the primers, the Tremella fuciformis TWWO01-AX strain can be rapidly and effectively identified. The present invention has the advantages of simple operation, short time consumption and strong specificity.
Description of Drawings Fig. 1 shows amplification results of random polymorphic amplification of different Tremelia fuciformis strains with use of a primer $2047; and Fig. 2 shows amplification results of PCR amplification of different Tremella fuciformis strains with a specific SCAR primer.
Detailed Description
The technical solutions in the present invention, unless otherwise specified in particular, are conventional solutions in the field. Unless otherwise specified in particular, reagents or materials are sourced from commercial channels. The present invention will be further described below in conjunction with embodiments. Embodiment 1 Acquisition of a SCAR Molecular Marker Primer for Specificity Identification of Tremella Fuciformis Strains (1) Culture of Yeast-like Spores of Tremella Fuciformis Strains and DNA Extraction Names and sources of Tremella fuciformis strains are shown in Table 1. Yeast-like spores of the different Tremella fuciformis strains deposited at low temperatures are transferred to tubes for activation, put into a PDA fluid medium after activation culture of a week at 25°C, and then cultured for 7 days in a constant-temperature shaking incubator of 150 r/min. After culture, strain body precipitates are collected centrifugally under a sterile condition. Genome DNA of each Tremella fuciformis strain is extracted using an Ezup column fungal genome DNA extraction kit of Sangon Biotech (Shanghai) Co., Ltd.
Table 1 Names and Sources of Different Tremella Fuciformis Strains 23 T23-CAS Spore 23, Institute of Microbiology ee vem 26 T26-CAS Spore 26, Institute of Microbiology I A eo T30-CAS Spore 30, Institute of Microbiology TT ee ete 33 T33-CAS Spore 33, Institute of Microbiology LTT ee ceri 56 T56-CAS Spore 56, Institute of Microbiology LTT ee ceri 74 T74-CAS Spore 74, Institute of Microbiology CTT om vena 8225 T8225-CAS Spore 8225, Institute of Microbiology ee W TROM In-planting white Tremella fuciformis spore ee TT ee Y TR21 In-planting yellow Tremelia fuciformis
CT Chuan TY01-SC Yellow Tremella fuciformis spore in
CT TTT Anxi
(2) Acquisition of Specific DNA Fragment of Tremella Fuciformis TWWO01-AX Strain By the PCR technology, primers of random amplified polymorphic DNA (RAPD) are screened. Finally, a primer S2047 (5-TGTGCCTGAC-3’, SEQ ID NO: 4) is used for random polymorphic amplification of each Tremella fuciformis strain. An RAPD reaction system is as follows: 1 yl of a primer, 1 pl of a DNA template, 12.5 pl of 2xEasyTaq PCR SuperMix (Beijing TransGen Biotech Co., Ltd.) and 10.5 ul of ddH>O. An RAPD amplification reaction procedure comprises: 94°C pre-denaturation of 5 min, 94°C denaturation of 1 min, 35°C annealing of 1.5 min, 72°C extension of 1.5 min, 30 cycles, 72°C extension of 10 min and preservation at 4°C. Amplification products are treated by gel electrophoresis with 1% agarose under a voltage of 120 Vand observed and photographed under a gel imaging analysis meter. Results are shown in the accompanying diagram Fig. 1 (with lanes 1-11 of T23-CAS, T26-CAS, T30-CAS, T33-CAS, T56- CAS, T74-CAS, T8225-CAS, TWWO1-AX, TY01-SC, TRO1 and TR21). As shown by the RAPD amplification results, obvious polymorphism exists among the tested strains; and an obvious specific fragment (shown by the arrow in the diagram) can be amplified by the primer S2047 in the TWWO1-AX strain. (3) Recycling, Cloning and Sequencing of Specific Fragment A Gel Extraction Kit D2500 of OMEGA is used for recycling and purification of the specific fragment obtained in step (2). A target DNA obtained by recycling is connected to a pMD18-T Vector carrier (Takara Biomedical Technology (Beijing) Co., Ltd.), transformed in a Trans1-T1 competent cell (Beijing TransGen Biotech Co., Ltd.) and coated on an LB solid medium containing IPTG, X-gal and AMP for overnight culture at 37°C. A white single colony is picked and put into an LB fluid medium for culture of 12-16 h, followed by plasmid extraction. EcoR 1 and Hind Ill are used for double enzyme digestion verification. A transformed transformant is sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. (4) Design of Specific SCAR-PCR Amplification Primer Pair According to a sequence of the specific fragment obtained in step (3), a pair of specific primers are designed by Primer Premier 6 software for application in a SCAR reaction. Sequences of the primers are as follows: 2047-S-1F: 5-GGCGGAGGATACAGATTG-3 (SEQ ID NO: 2}, 2047-S-1R: 5’-CCAGTAGGTAGCGGAAGA-3 (SEQ ID NO: 3), sent to Sangon Biotech (Shanghai) Co., Ltd. for synthesis. (5) SCAR-PCR Amplification The specific amplification primer pair obtained in step (4) is used for SCAR-PCR amplification verification of the genome DNA of each Tremella fuciformis strain. A SCAR-PCR reaction system is as follows: 1 ul of an upstream primer, 1 yl of a downstream primer, 1 ul of a DNA template,
12.5 pl of 2xEasyTaq PCR SuperMix (Beijing TransGen Biotech Co., Ltd.) and 9.5pL of ddH:0. A SCAR-PCR reaction procedure comprises: 94°C pre-denaturation of 5 min, 94°C denaturation of 1min, 55°C annealing of 1 min, 72°C extension of 1min, 30 cycles, 72°C extension of 10 min, and preservation at 4°C. (6) Electrophoresis Detection SCAR-PCR amplification products in step (5) are treated by gel electrophoresis with 1% 5 agarose under a voltage of 120V and observed and photographed under a gel imaging analysis meter after electrophoresis. Results are shown in Fig. 2. A specific band of 308 bp can be detected in the lane of the Tremella fuciformis strain TWWO01-AX; and no specific fragment of other Tremella fuciformis strains is found at the same position. (7) The specific DNA fragment of the Tremella fuciformis strain TWWO01-AX obtained by amplification in step (6) is sequenced. Sequence information of the amplified specific fragment is as follows: 5-TCCAGTAGGTTGGGAAGACGGCGTCAGTGCTTGTCGTTAGACTGATCTTTCAACA
TGGAGACAGCTTACAAAGGCCCCGGGCCCGTCAAATCGATCTATCTGTCAGCTACCATCC CGAGTATCATCGCTGAGCGCTCACTGCTCCAAGCGATCCTACGCCTCCGTTTTCGACTAGC TCAACGATGGTGGCGATGGTGTCCAGCAGGATCGGGTGGAACGGTTTGGACTGGATGTCA
GCGCTCGATCCCATTCGCAGCCAGCCATAGCGCACCACCATGGTATACTGCCCAATCTCA TCCTCCGCCCAC-3' (SEQ ID NO:1).
SEQUENCE LISTING <110> Fujian Agriculture and Forestry University <120> SCAR MOLECULAR MARKER FOR SPECIFICITY IDENTIFICATION OF TREMELLA
FUCIFORMIS STRAIN AND IDENTIFICATION METHOD AND APPLICATION
THEREOF <130> BJS-SCAR Marker NL <160> 4 <170> PatentIn version 3.5 <210> 1 <211> 308 <212> DNA <213> Tremella fuciformis <400> 1 tccagtaggt tgggaagacg gcgtcagtgc ttgtcgttag actgatcttt caacatggag 60 acagcttaca aaggccccgg gcccgtcaaa tcgatctatc tgtcagctac catcccgagt 120 atcatcgctg agcgctcact gctccaagcg atcctacgcc tccgttttcg actagctcaa 180 cgatggtggc gatggtgtcc agcaggatcg ggtggaacgg tttggactgg atgtcagcgc 240 tcgatcccat tcgcagccag ccatagcgca ccaccatggt atactgccca atctcatcct 300 ccgcccac 308 <210> 2 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Amplification primer <400> 2 ggcggaggat acagattg 18 <210> 3 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> amplification primer <400> 3 ccagtaggta gcggaaga 18 <210> 4 <211> 10 <212> DNA <213> Artificial Sequence
<220>
<223> amplification primer
<400> 4 tgtgcctgac 10

Claims (7)

CONCLUSIESCONCLUSIONS 1. Een moleculaire SCAR merker voor de specificiteitsidentificatie van een Tremella fuciformis-stam TWWO01-AX, waarbij de nucleotidesequentie van de SCAR-moleculaire merker wordt weergegeven door SEQ ID NO:1, of overeenkomt met een middelste sequentie in 30 bp van een voor- en een achteruiteinde in de sequentie die wordt weergegeven door SEQ ID NO:1, of een overeenkomst van meer dan 99% heeft met de middelste sequentie in 30 bp van een voor- en een achteruiteinde in de sequentie die wordt weergegeven door SEQ ID NO:1.A molecular SCAR marker for the specificity identification of a Tremella fuciformis strain TWWO01-AX, wherein the nucleotide sequence of the SCAR molecular marker is represented by SEQ ID NO:1, or corresponds to a middle sequence in 30 bp of a precursor and a rear end in the sequence represented by SEQ ID NO:1, or greater than 99% identity with the middle sequence in 30 bp of a front and a rear end in the sequence represented by SEQ ID NO: 1. 2. Primers ontworpen op basis van de moleculaire SCAR merker volgens conclusie 1.Primers designed on the basis of the molecular SCAR marker according to claim 1. 3. De primers volgens conclusie 2, waarin de primers zijn 2047-S-1F: 5'-GGCGGAGGATACAGATTG-3"; 2047-S-1R: 5’-CCAGTAGGTAGCGGAAGA-3.The primers of claim 2, wherein the primers are 2047-S-1F: 5'-GGCGGAGGATACAGATTG-3"; 2047-S-1R: 5'-CCAGTAGGTAGCGGAAGA-3. 4. Toepassing van de SCAR-moleculaire SCAR merker volgens conclusie 1 of de primers volgens conclusie 2 of 3 bij de identificatie van de Tremella fuciformis-stam TWWO01-AX.Use of the SCAR molecular SCAR marker according to claim 1 or the primers according to claim 2 or 3 in the identification of the Tremella fuciformis strain TWWO01-AX. 5. Een werkwijze voor het identificeren van de Tremella fuciformis-stam TWW01-AX met de moleculaire SCAR merker volgens conclusie 1 of de primers volgens conclusie 2 of 3, welke werkwijze de volgende stappen omvat: het extraheren van DNA van een monster, en het uitvoeren van SCAR-PCR amplificatie op het DNA, waarbij de stam in het monster de Tremella fuciformis stam TWWO01-AX is indien een 308bp band wordt vermeerderd.A method for identifying the Tremella fuciformis strain TWW01-AX with the molecular SCAR marker of claim 1 or the primers of claim 2 or 3, the method comprising the steps of: extracting DNA from a sample, and performing SCAR-PCR amplification on the DNA, wherein the strain in the sample is the Tremella fuciformis strain TWWO01-AX when a 308bp band is amplified. 6. De werkwijze voor het identificeren van de Tremella fuciformis-stam TWWO1-AX, waarbij het SCAR-PCR-reactiesysteem als volgt is: 1 ul van een upstream primer, 1 pl van een downstream primer, 1 pl van een DNA-matrijs, 12,5 ul van 2 x EasyTaq PCR SuperMix en 9,5 pl ddH20.6. The method for identifying Tremella fuciformis strain TWWO1-AX, wherein the SCAR-PCR reaction system is as follows: 1 µl of an upstream primer, 1 µl of a downstream primer, 1 µl of a DNA template, 12.5 µl of 2x EasyTaq PCR SuperMix and 9.5 µl ddH20. 7. De werkwijze voor het identificeren van de Tremella fuciformis-stam TWAN01-AX, waarbij de SCAR-PCR-reactieprocedure omvat: 94°C voordenaturatie gedurende 5 min, 94°C denaturatie gedurende 1 min, 55°C aaneenhechten gedurende 1 min, 72°C verlenging gedurende 1 min, 30 cycli, en een uitloop van 72°C gedurende 10 min.The method for identifying the Tremella fuciformis strain TWAN01-AX, wherein the SCAR-PCR reaction procedure comprises: 94°C predenaturation for 5 min, 94°C denaturation for 1 min, 55°C annealing for 1 min, 72°C elongation for 1 min, 30 cycles, and a 72°C elongation for 10 min.
NL2029091A 2021-09-01 2021-09-01 Scar molecular marker for specificity identification of tremella fuciformis strain and identification method and application thereof NL2029091B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
NL2029091A NL2029091B1 (en) 2021-09-01 2021-09-01 Scar molecular marker for specificity identification of tremella fuciformis strain and identification method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
NL2029091A NL2029091B1 (en) 2021-09-01 2021-09-01 Scar molecular marker for specificity identification of tremella fuciformis strain and identification method and application thereof

Publications (1)

Publication Number Publication Date
NL2029091B1 true NL2029091B1 (en) 2021-12-14

Family

ID=79237719

Family Applications (1)

Application Number Title Priority Date Filing Date
NL2029091A NL2029091B1 (en) 2021-09-01 2021-09-01 Scar molecular marker for specificity identification of tremella fuciformis strain and identification method and application thereof

Country Status (1)

Country Link
NL (1) NL2029091B1 (en)

Similar Documents

Publication Publication Date Title
CN109913572B (en) Molecular marker tightly linked with spike length major QTL (quantitative trait locus) and application thereof
Xue et al. Pathotype identification of Leptosphaeria maculans with PCR and oligonucleotide primers from ribosomal internal transcribed spacer sequences
CN106701984A (en) Electrochemical luminescence nucleic acid detection method and kit based on branched DNA (Deoxyribonucleic Acid) amplification signal
CN109504799A (en) A kind of the primer combination and method of Rapid identification sickle-like bacteria strain
CN113151567B (en) SSR molecular marker and method for identifying Lepista sordida N006# strain
NL2029091B1 (en) Scar molecular marker for specificity identification of tremella fuciformis strain and identification method and application thereof
CN106566875A (en) Primers, kit and method for detecting myelodysplastic syndromes (MDS) gene mutation
CN114015799B (en) LAMP (loop-mediated isothermal amplification) detection primer group, kit and LAMP detection method for Helminthosporium putrescens
CN110714094B (en) SCAR molecular marker for specifically identifying tremella strain and identification method and application thereof
CN113073144B (en) Molecular marker CAPS-799 for screening wheat with high phosphorus utilization efficiency, primer group and application
CN116004863A (en) Primer pair for detecting and identifying rice bacterial leaf blight bacteria and application thereof
CN108330206A (en) Cultivation of Dictyophora, short-skirted veiled lady, the complete ITS sequence of stick dictyophora phalloidea and the method with its identification dictyophora phalloidea kind
CN114958835A (en) Combination product and kit for detecting bacterial rice blight bacteria
CN114807411A (en) Method for detecting sex of kiwi fruits
Prabina et al. DNA amplification fingerprinting as a tool for checking genetic purity of strains in the cyanobacterial inoculum
CN111607657A (en) Primer, probe, kit and method for RT-QPCR (reverse transcription-quantitative polymerase chain reaction) detection of fusarium oxysporum
KR101149437B1 (en) Genetic markers for Xanthomonas oryzae pv.oryzae, primers for the markers, and method for detecting and discriminating Xanthomonas oryzae pv.oryzae
CN111471793A (en) Primer, probe, kit and method for RT-QPCR (reverse transcription-quantitative polymerase chain reaction) detection of fusarium sporotrichioides
CN110724757A (en) Primer for mulberry fertilize large sclerotinia sclerotiorum detection and application thereof
CN113897456B (en) Real-time fluorescence PCR detection primer probe combination and detection kit for four fir anthracnose pathogens and application of kit
CN113913556B (en) Kit for rapidly detecting bat adenovirus and detection method thereof
CN113444823B (en) Primer group and method for identifying streptomyces albidoflavus W68 by using primer group
CN109628625A (en) Identify specific primer, the kit, method and its application of six younger sister hickory chicks
CN111304353B (en) Method for breeding rice east field type three-line maintainer line by using outcross gene linkage markers
CN113151530B (en) Diagnostic molecular marker of wheat powdery mildew resistance gene Pm13 and application thereof