NL2024335B1 - Protein for improving ability of plants and microorganisms to resist low nitrogen stress and gene thereof - Google Patents

Abstract

The present invention relates to a protein and a gene thereof for improving the ability of plants 5 and microorganisms to resist low nitrogen stress, and belongs to the technical field of biological genetic engineering. The amino acid sequence of the protein is: an amino acid sequence represented by SEQ ID No. 2; or an equivalent amino acid sequence formed by the amino acid sequence represented by SEQ ID No. 2 through substituting, missing and/or adding one or a plurality of amino acid residues. The nucleotide sequence of the gene encoding the protein is: a 10 nucleotide represented by SEQ ID No. l; or a nucleotide sequence encoding CsNRT2.4 obtained by substituting one or a plurality of nucleotides of the nucleotide sequence represented by SEQ ID No. l. The present invention newly discovered a Camellia sinensis L high-affinity nitrate transport protein CsNRT2.4. Over-expression of a gene corresponding to the protein in plants or microorganisms may enhance the ability of plants and microorganisms to absorb nitrate from 15 external soil or culture substrate for strengthening the ability of plants or microorganisms to resist low nitrogen stress.

Description

PROTEIN FOR IMPROVING ABILITY OF PLANTS AND MICROORGANISMS TO RESIST LOW NITROGEN STRESS AND GENE THEREOF

FIELD OF TECHNOLOGY |0001] The present invention belongs to the technical field of biological genetic engineering, more particular, relates to a protein and a gene thereof for improving the ability of plants and microorganisms to resist low nitrogen stress.

BACKGROUND

[0002] Nitrate (NOs) is an important nutrient, also a signal molecule, and has an important impact on the metabolism and development of plants and microorganisms. In plants, the uptake of nitrate from soil is a key process regulated by complex networks, the core of which is the nitrate transporter in the roots. For the uptake and transport of nitrate, plants have evolved a large family of transporters, and at different tissue sites there will be corresponding transporters to function.

[0003] It is found that NRT2 transporter is considered to be a family of high-affinity nitrate transporters that can absorb and transport NO: at low nitrate concentrations outside to ensure growth and development of the plants. The tea tree is a perennial woody leaf plant that has affinity to ammonium and resistance to ammonium. However, recent studies have shown that mixed supply of NO: and NHy" is more conducive to tea tree growth, indicating that NOs” in soil is also an important nitrogen source for the growth of tea tree.

[0004] At present, there are no reports on the genes and proteins involved in the uptake and transport of nitrate in tea plants. In view of the fact that the fertilization of tea tree is characterized by small amount but several times, high-affinity nitrate transport proteins play an important role in the uptake and utilization of nitrate in tea plants. Therefore, the discovery of the high-affinity nitrate transport protein CsNRT2.4 gene of tea tree has important practical significance for improving efficiency in the nitrate uptake of plants and microorganisms and increasing the ability of plants and microorganisms to resist low nitrogen stress.

SUMMARY

[0005] In view of the problems existing in the prior art, the object of the present invention is to design a technical solution in which a protein and an encoding gene thereof for improving the ability of plants and microorganisms to resist low nitrogen stress, and belongs to the technical field of biological genetic engineering, and an application thereof are provided.

[0006] The protein for transporting nitrate is characterized in that an amino acid sequence of the protein is:

[0007] 1) an amino acid sequence represented by SEQ ID No. 2; or

[0008] 2) an equivalent amino acid sequence formed by the amino acid sequence represented by SEQ ID No. 2 through substituting, missing and/or adding one or a plurality of amino acid residues.

[0009] The gene encoding the protein 1s characterized in that the nucleotide sequence of the gene is:

[0010] 1)a nucleotide represented by SEQ ID No. 1; or

[0011] 2) a nucleotide sequence encoding CsNRT2.4 obtained by substituting one or a plurality of nucleotides of the nucleotide sequence represented by SEQ ID No. 1.

[0012] The recombinant vector comprising the encoding gene.

[0013] An application of the encoding gene for transporting nitrate from a nutrient medium to a biological body.

[0014] An application of the encoding gene for enhancing the ability of plants and microorganisms to absorb nitrate from external soil or culture substrate for strengthening the ability of plants or microorganisms to resist low nitrogen stress.

[0015] An application of the encoding gene for enhancing the efficiency of nitrate uptake by plants and microorganisms.

[0016] The method for improving ability of plants and microorganisms to resist low nitrogen stress is characterized by comprising steps of: introducing an encoding gene into plants and microorganisms to over-express the gene to increase the efficiency of nitrate uptake by plants and microorganisms for strengthening the ability of plants or microorganisms to resist low nitrogen stress, a nucleotide sequence of the encoding gene being:

[0017] 1)a nucleotide represented by SEQ ID No. 1; or

[0018] 2) a nucleotide sequence encoding CsNRT2.4 obtained by substituting one or a plurality of nucleotides of the nucleotide sequence represented by SEQ ID No. 1.

[0019] The experiment of the present invention proves: the present invention newly discovered a high-affinity nitrate transport protein CsNRT2.4 of tea tree, and over-expression of a gene corresponding to the protein in plants or microorganisms may enhance the ability of plants and microorganisms to absorb nitrate from external soil or culture substrate for strengthening the ability of plants or microorganisms to resist low nitrogen stress.

BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Fig. 1 shows the gene and amino acid sequence of tea tree CsNRT2.4;

[0021] Fig. 2 shows the relative quantitative results of qPCR of CsNRT2.4 gene in different tea tree tissues;

[0022] Fig. 3 shows the comparison in phenotype between CsNRT2.4 over-expressed line (OE) and wild type (WT) after 3 weeks of substrate culture, wherein the asterisk (*) represents a significant difference in the independent sample T test at the P0.05 level, WT is wild type Col-0 Arabidopsis thaliana, and OE is an Arabidopsis over-expressed line transformed into tea tree CsNRT2.4 gene;

[0023] Fig. 4 shows the comparison in phenotype between CsNRT2.4 over-expressed line (OE) and wild type (WT) under nitrogen treatment conditions, wherein A and B are phenotypic observations of wild-type Arabidopsis thaliana (WT) and CsNRT2.4-0E over-expressed line under conditions of nitrogen deficiency (0 mM N) and low nitrogen (0.2 mM N), respectively; C and D are the differences in root length and fresh weight of WT and OE strains under different nitrogen treatment conditions, respectively; the asterisk (*) represents a significant difference in the independent sample T test at the P0.05 level, WT is wild type Col-0 Arabidopsis thaliana, and OE is an Arabidopsis over-expressed line transformed into tea tree CsNRT2.4 gene;

[0024] Fig. 5 shows the NO3-uptake rate of Arabidopsis roots determined by NMT, wherein A is the dynamic change of the uptake rate of 0.1 mM NO3- in the over-expressed line (OE) of wild-type Arabidopsis thaliana (WT) and transgenic tea tree CsNRT2.4 gene during the 5 min test period, B is the average value of the uptake rate at different time points and repetitions and the results of the variance analysis; the asterisk (*) represents a significant difference in the independent sample T test at the P0.05 level, WT is wild type Col-0 Arabidopsis thaliana, and OE is an Arabidopsis over-expressed line transformed into tea tree CsNRT2 4 gene.

DESCRIPTION OF THE EMBODIMENTS

[0025] The present invention is further illustrated by the following description in conjunction with the embodiments.

[0026] Embodiments

[0027] (1) Gene cloning: the radicle of Longjing 43 is used as a material to extract total RNA by kit method; primers are designed based on the mRNA sequence of CsNRT2.4, the full length of the gene is obtained by reverse transcription PCR, and verified by sequencing to finally obtain a gene sequence of the tea tree CsNRT2.4 represented by SEQ ID No. 1 and an amino acid sequence of the encoded protein represented by SEQ ID No. 2, as shown in Fig. 1.

[0028] The primer used for the above reverse transcription gene cloning is: CsNRT2.4-F: 5'- AGACACCTTCAAAAGTTACA-3 (represented by SEQ ID No.3); CsNRT24-R: 5'- GATACAAATCCGTCACCT-3(represented by SEQ ID No.4).

[0029] (2) Real-time fluorescence quantitative analysis: Fluorescence quantitative PCR is performed using the ABI 7500 Real-Time PCR System (Applied Biosystems), with labeling by SYBR Green dye. An internal reference gene selects the tea tree GAPDH gene (GE651107).

[0030] The primer used is: CsNRT2.4-Q-F: 5'- CCGACTACTCCGCCAGATTC -3' (represented by SEQ ID No.5); CsNRT2.4-Q-R: 5'- GGAGGAAGCAGAAGAGTCCG -3' (represented bySEQ ID No.6); GAPDH-F: 5'-TTGGCATCGTTGAGGGTCT-3' (represented by SEQ ID No.7) and GAPDH-R: 5'-CAGTGGGAACACGGAAAGC-3' (represented by SEQ ID No.8).

[0031] The reaction system is 25ul, and contains 0.5uL LATaq, Sul. PCR buffer, 2 uL dNTP (2.5 mM), 0.5uL primer (10 M), luL cDNA (40 ng) and 15.5uL ddH20.

[0032] The reaction conditions are: 94 °C, 3 minutes; 95 °C, 30 seconds; 59 °C, 30 seconds; 72 °C, 1 minute; 30 cycles. 72 °C, 10 minutes; preserved at 4 °C. Three replicates per sample.

[0033] As shown in Fig. 2, the relative quantitative results of CsNRT2.4 gene qPCR in different tissue parts of three tea tree varieties, such as middle root, mature leaf and one bud and two leaves, indicate that the tea tree CsNRT2.4 gene is specifically expressed in tea roots.

[0034] (3) Purification for recombinant expression of transgenic proteins: the encoding cassette of the full-length cDNA of the tea tree CsAlaDC is cloned into the prokaryotic expression vector pET28b containing the T7 promoter.

[0033] Specifically, the steps include: designing specific primers: forward primer 5’-CGCGAGCTC(SachHATGGCCAACATTGAAGCAC (represented by SEQ ID No. 9) and backward primer 5’- GTCGAC(Sal) AAGATGGTTTGGACTCGAATCC (represented by SEQ ID No. 10); amplifying the coding region sequence of the target gene CsNRT2.4 by PCR; construction of expression vector: PCR-amplified Cs NRT2.4 gene is recovered and purified by gel, and then after recovery by cutting the gel, the target fragment and the pCAMBIA1300-35S-GFP over-expressed vector plasmid are digested with Sacl and Sall, respectively; the target fragment recovered by double enzyme digestion is ligated to the vector by T4 DNA ligase, transformed into E. coli Trans5a competent cells, and verified by bacterial PCR and sequencing to extract a recombinant plasmid; the correct recombinant plasmid is transformed into Agrobacterium GV3101, and cultured in a 200 mL LB (Kana resistance) shaker at 28 °C, 200 rpm after PCR identification until the OD600 is about 1.0; the bacterial solution (centrifugation at 8000 rpm for 6 min at room temperature) is centrifuged, and the obtained bacterial solution is re-suspended with the same volume (200 mL) of MS solution (with 5% sucrose, KOH adjusted to pH 5.7). 0.02% Silwet 1-77 Arabidopsis thaliana conversion auxiliary reagent is added to the above suspension; the wild-type Arabidopsis inflorescence is immersed in the above suspension, extracted under vacuum at 0.5 Kpa for 5 min, and then sucked away the surface bacterial liquid to be placed in the culture chamber to wait for the seed (TO generation). The test is completed with the assistance of Hangzhou Runlangsai Biotechnology Co., Ltd. The received seeds are screened for positive seedlings on a 1/5 hoagland plate containing 50 ug/mL 5 kanamycin and 25 pg/mL concentration.

[0036] T2, T3 homozygous screening: after the positive T1 generation is planted, part of the harvested seeds (T2) are screened for hygromycin at a concentration of 25-30 pg/mL, and then all of the surviving AA (T3) homozygous strains are screened to obtain a pure line plant of CsNRT2.4 transgenic Arabidopsis thaliana.

[0037] (4) Verification of the resistance ability of CsNRT2.4 transgenic Arabidopsis to low nitrogen stress

[0038] The wild type (Col-0, WT) and CsNRT2.4 gene over-expressed line (OE) are used as materials, and then differences in growth of over-expressed lines are observed using a medium of grass charcoal and different nitrogen-treated medium (1/2 MS without nitrogen + 0, 0.2 mM N). At the same time, different nitrogen concentrations, i.e, 0, 0.2 mM N (with KNO: and (NH4):SO4 as nitrogen sources, of which NOs; NHy*=1: 1), are set to affect the growth of Arabidopsis thaliana. The root length, leat size and biomass of the lines are counted, and the growth phenotype differences of the over-expressed lines are examined. Phenotypic difference statistics are performed after the seedling grows for 3 weeks to form 6-7 leaves.

[0039] As shown in Figs. 3 and 4, OE strains grow significantly better than WT. The results obtained from the detection of leaf characteristics show that the leat width, leaf length and petiole length of OE strains are significantly higher than those of wild type (WT). This indicates that CsNRT2.4 may promote the nitrate uptake and nitrogen use efficiency of Arabidopsis thaliana and improve the ability of plants to resist low nitrogen stress.

[0040] The NMT non-injury assay is used to determine the difference in NOs ion uptake between the transgenic CsNRT2 4 gene (OE) and wild-type Arabidopsis (WT) roots. After 7 days of nitrogen starvation in a medium containing no 1/2 MS of nitrogen, a mature area located 3-4 mm from the root tip is selected to determine the uptake rate of 0.1 mM NOs" in different strains of Arabidopsis thaliana roots, and the results are shown in Fig. 5, indicating that the uptake rate of NO: of CsNRT2.4 over-expressed lines is significantly higher than that of wild type. This indicates that the CsNRT2.4 gene of tea tree may improve the uptake rate of NO: in the roots of Arabidopsis thaliana under low nitrogen conditions.

Sequence Listing <110> TEA RESEARCH INSTITUTE, CHINESE ACADEMY OF AGRICULTRUAL SCIENCE <120> PROTEIN FOR IMPROVING ABILITY OF PLANTS AND MICROORGANISMS TO RESIST LOW

NITROGEN STRESS AND GENE THEREOF <160> 10 <170> SIPOSequenceListing 1.0 <210> 1 <211> 1515 <212> DNA <213> TEA <400> 1 atggccaaca ttgaagcaca actctccaca tcaaaatttt cattaccagt agattccgaa 60 aacaaatcca aatcactcaa aatcttctcc ttcgccaacc cacacatgag aaccttccac 120 ctctcctggt tttcattctt cacttgtttc gtctccacct tcgecgecgce tcctctcgtc 180 ccaatcatcc gcgacaacct caacctcacc aaatccgaca taggaaacgc cggggtagcc 240 tcggtttccg gaagcatctt ttccaggctc gtcatgggcc cagtatgtga tctactgggc 300 ccacggtacg gttgtgcttt tttaatcatg ttgtcggccc cgacagtgtt ctcgatgtcg 360 ttcgtgtcgt cggcatcggg atacattact gtccgattca tgattgggtt ttgtttggca 420 acgttcgtgt cgtgtcagta ttggatgagt aggatgttta atggggagat tattgggctt 480 gtgaatggga cggccgctgg gtgggggaat atgggtggag gagctactca gcttataatg 540 ccgttgctgt atgagttgat tttacggtgc gggtcgagtc cgtttaccgc gtggcggatt 600 gcttttttta tacccggttg gtttcatgtc attatgggga ttttggtttt gactcttggt 660 caggatttgc ctgaagggaa ccttggggct ttgcagaaga agggtgatgt tgccagagat 720 aaattctcta aggtgttatg gtatgctatc acaaactaca ggacatggat ctttgtcctc 780 ctctacggct attccatggg tgtcgagtta tccacagaca atgtcatcgc agagtacttt 840 tacgacaggt tcaatctcaa gctccacact gccggcacca tcgcagccac cttcggcatg 900 gccaacctca tcgcccgccc cttcggcggc ttcgcttccg actactccgc cagattcttc 960 ggcatgagag gccgcctgtg gaccctctgg atcctccaaa cactcggcgg actcttctgc 1020 ttcctcctcg gccacgccaa ctccctcccc atcgccatct ccatgatgat cctcttctcc 1080 gccggcgctc aggccgcctg cggagccacc ttcggcatca tccccttcat ttctcgccga 1140 tctctcggag tcatttctgg catggtcgga gccggtggga attttgggtc tggtttgaca 1200 cagttgatat ttttcacaag ctccaagtac tcaactcaaa tgggtttatc ttatatgggt 1260 gttatgatta tgtgttgtac tttgccggtg atgtttgtga attttccgca gtggggtggg 1320 atgtttgttg gggccgcgaa agagggtgtg aaagggagtg aagagtacta ttatgggtcg 1380 gagtggagcg agcaggagaa ggagaagggg atgcatcagg gaagtttgaa gtttgcggag 1440 aacagccggt cggagagggg gaggagggtt gettetgtgg catcgccgct ggattcgagt 1500 ccaaaccatc tttaa 1515 <210> 2 <211> 504 <212> PRT <213> TEA <400> 2 Met Ala Asn lle Glu Ala Gin Leu Ser Thr Ser Lys Phe Ser Leu Pro 1 5 10 15 Val Asp Ser Glu Asn Lys Ser Lys Ser Leu Lys Ile Phe Ser Phe Ala Asn Pro His Met Arg Thr Phe His Leu Ser Trp Phe Ser Phe Phe Thr 40 45 Cys Phe Val Ser Thr Phe Ala Ala Ala Pro Leu Val Pro lle lle Arg 50 55 60 Asp Asn Leu Asn Leu Thr Lys Ser Asp lle Gly Asn Ala Gly Val Ala 65 70 75 80 file:///LNV .INTERN/Home/S/Sahadat A/2024335%20SEQLTXT.txt[10-12-2019 16:17:24]

Ser Val Ser Gly Ser lle Phe Ser Arg Leu Val Met Gly Pro Val Cys 85 90 95 Asp Leu Leu Gly Pro Arg Tyr Gly Cys Ala Phe Leu lle Met Leu Ser 100 105 110 Ala Pro Thr Val Phe Ser Met Ser Phe Val Ser Ser Ala Ser Gly Tyr 115 120 125 lle Thr Val Arg Phe Met lle Gly Phe Cys Leu Ala Thr Phe Val Ser 130 135 140 Cys GIn Tyr Trp Met Ser Arg Met Phe Asn Gly Glu lle lle Gly Leu 145 150 155 160 Val Asn Gly Thr Ala Ala Gly Trp Gly Asn Met Gly Gly Gly Ala Thr 165 170 175 Gin Leu lle Met Pro Leu Leu Tyr Glu Leu lle Leu Arg Cys Gly Ser 180 185 190 Ser Pro Phe Thr Ala Trp Arg lle Ala Phe Phe Ile Pro Gly Trp Phe 195 200 205 His Val lle Met Gly lle Leu Val Leu Thr Leu Gly Gin Asp Leu Pro 210 215 220 Glu Gly Asn Leu Gly Ala Leu Gin Lys Lys Gly Asp Val Ala Arg Asp 225 230 235 240 Lys Phe Ser Lys Val Leu Trp Tyr Ala lle Thr Asn Tyr Arg Thr Trp 245 250 255 lle Phe Val Leu Leu Tyr Gly Tyr Ser Met Gly Val Glu Leu Ser Thr 260 265 270 Asp Asn Val lle Ala Glu Tyr Phe Tyr Asp Arg Phe Asn Leu Lys Leu 275 280 285 His Thr Ala Gly Thr Ile Ala Ala Thr Phe Gly Met Ala Asn Leu lle 290 295 300 Ala Arg Pro Phe Gly Gly Phe Ala Ser Asp Tyr Ser Ala Arg Phe Phe 305 310 315 320 Gly Met Arg Gly Arg Leu Trp Thr Leu Trp lle Leu Gin Thr Leu Gly 325 330 335 Gly Leu Phe Cys Phe Leu Leu Gly His Ala Asn Ser Leu Pro Ile Ala 340 345 350 lle Ser Met Met Ile Leu Phe Ser Ala Gly Ala Gin Ala Ala Cys Gly 355 360 365 Ala Thr Phe Gly lle lle Pro Phe lle Ser Arg Arg Ser Leu Gly Val 370 375 380 lle Ser Gly Met Val Gly Ala Gly Gly Asn Phe Gly Ser Gly Leu Thr 385 390 395 400 Gin Leu lle Phe Phe Thr Ser Ser Lys Tyr Ser Thr Gin Met Gly Leu 405 410 415 Ser Tyr Met Gly Val Met Ile Met Cys Cys Thr Leu Pro Val Met Phe 420 425 430 Val Asn Phe Pro Gin Trp Gly Gly Met Phe Val Gly Ala Ala Lys Glu 435 440 445 Gly Val Lys Gly Ser Glu Glu Tyr Tyr Tyr Gly Ser Glu Trp Ser Glu 450 455 460 Gin Glu Lys Glu Lys Gly Met His Gin Gly Ser Leu Lys Phe Ala Glu 465 470 475 480 Asn Ser Arg Ser Glu Arg Gly Arg Arg Val Ala Ser Val Ala Ser Pro 485 490 495 Leu Asp Ser Ser Pro Asn His Leu 500 <210> 3 <211> 20 <212> DNA <213> PRIMER <400> 3 file:///LNV INTERN/Home/S/Sahadat A/2024335%20SEQLTXT.txt[ 10-12-2019 16:17:24]

agacaccttc aaaagttaca 20

<210> 4

<211> 18

<212> DNA

<213> PRIMER

<400> 4 gatacaaatc cgtcacct 18

<210> 5

<211> 20

<212> DNA

<213> PRIMER

<400> 5 ccgactactc cgccagattc 20

<210> 6

<211> 20

<212> DNA

<213> PRIMER

<400> 6 ggaggaagca gaagagtccg 20

<210> 7

<211> 19

<212> DNA

<213> PRIMER

<400> 7 ttggcatcgt tgagggtct 19

<210> 8

<211> 19

<212> DNA

<213> PRIMER

<400> 8 cagtgggaac acggaaagc 19

<210> 9

<211> 28

<212> DNA

<213> PRIMER

<400> 9 cgcgagctca tggccaacat tgaagcac 28

<210> 10

<211> 28

<212> DNA

<213> PRIMER

<400> 10 gtcgacaaga tggtttggac tcgaatcc 28 file:///LNV .INTERN/Home/S/SahadatA/2024335%20SEQLTXT txt[10-12-2019 16:17:24]

Claims (7)

Conclusions II. A protein for transporting nitrate, characterized in that an amino acid sequence of the protein: 1) is an amino acid sequence represented by SEQ ID NO: 2; or 2) is an equivalent amino acid sequence formed from the amino acid sequence represented by SEQ ID NO:2 by substituting, missing and/or adding one or a variety of amino acid residues. A gene encoding the protein according to claim 1, characterized in that the nucleotide sequence of the gene: 1) is a nucleotide represented by SEQ ID NO: 1; or 2) is a nucleotide sequence encoding CsNRT2.4 and obtained by the substitution of one or several nucleotides of the nucleotide sequence represented by SEQ ID NO: 1. 3. A recombinant vector making up the coding gene in accordance with claim 2. 4. A use of the coding gene according to claim 2 for the transport of nitrate from a nutrient medium to a biological body. An use of the coding gene according to claim 2 to improve the ability of plants and microorganisms to absorb nitrate from an external soil or nutrient substrate so as to improve the resistance of plants and microorganisms to stress from low nitrogen levels. A use of the coding gene according to claim 2 to increase the efficiency of the nitrate uptake of plants and microorganisms. 7. A method of improving the resistance of plants and microorganisms to stress from low nitrogen levels, characterized by comprising steps to: introduce a coding gene into plants and microorganisms to make the gene more expressed to to increase the efficiency of nitrate uptake by plants and microorganisms so as to improve the resistance of plants and microorganisms to stress from low nitrogen levels, wherein a nucleotide sequence of the coding gene: 1) is a nucleotide represented by SEQ ID NO 1; or 2) is a nucleotide sequence encoding CsNRT2.4 and obtained by the substitution of one or several nucleotides of the nucleotide sequence represented by SEQ ID NO: 1.