CN111454340A

CN111454340A - Elytrigia elongata external rectification potassium channel protein and coding gene and application thereof

Info

Publication number: CN111454340A
Application number: CN202010255733.5A
Authority: CN
Inventors: 郭强; 孟林; 周妍彤; 毛培春; 田小霞; 郑明利
Original assignee: Beijing Academy of Agriculture and Forestry Sciences
Current assignee: Beijing Academy of Agriculture and Forestry Sciences
Priority date: 2020-04-02
Filing date: 2020-04-02
Publication date: 2020-07-28
Anticipated expiration: 2040-04-02
Also published as: CN111454340B

Abstract

The invention relates to the technical field of biology, in particular to an elytrigia elongata externally-rectified potassium channel protein, and a coding gene and application thereof. The invention clones the elytrigia elongata outer rectification potassium channel protein EeSKOR, and the amino acid sequence of the EeSKOR is shown in SEQ ID NO. 1. The invention discovers that the EeSKOR can improve the biomass and the plant height of the plant in a high-salt environment, and the overexpression of the EeSKOR gene under salt treatment obviously reduces the H of the transgenic tobacco plant₂O₂And the content of MDA, the SOD activity and the chlorophyll content are improved, and the Na of transgenic plants is obviously reduced⁺Concentration, increase of K in vivo⁺And (4) concentration. The EeSKORs can be used for improving the growth performance of plants under high salt stress and improving the salt resistance tolerance of the plants, and have important significance for cultivating new salt-resistant plant varieties.

Description

Elytrigia elongata external rectification potassium channel protein and coding gene and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to an elytrigia elongata externally-rectified potassium channel protein, and a coding gene and application thereof.

Background

When plants are exposed to abiotic stress, such as salt stress, the response involves an auto-hypersensitivity reaction that ultimately leads to apoptosis. K in gramineous plants⁺/Na⁺Too low, the plant degrades its content by autophagy, or autophagy in aleurone cells, or degradation-affecting hydrolases released during the formation of tubular molecules of cellular protoplasts. Thus, high K in plants⁺/Na⁺The plant salt tolerance is related to the plant growth and development. K⁺Channel and K⁺The transporter is a plant body to K⁺Are important components of absorption, transport and distribution. Gaymard et al found that the expression level of SKOR could be decreased by ABA treatment and acidic conditions, and that AtSKOR isolated from Arabidopsis was confirmed to load K into xylem from xylem parenchyma cells⁺. Hu et al (2016) study showed that the Zygophylum xanthoxylum ZxSKOR-encoded outer rectification K⁺Channel-mediated root K⁺Transporting to the ground over a long distance by maintaining the ground K⁺To enhance its salt resistance.

The perennial rhizome sparse type herbaceous plant Elytrigia elongata (Elytrigia) of the family Triticulate Dumont (Graminae) of the family Triticulate (Elytrigia) is a kindred species of wheat (Triticum aestivum), is an indispensable wild gene bank for improving wheat, plays an important role in improving soil salinization, can be used as an ideal plant for improving saline-alkali soil, is originally produced in southeast Europe and Asia, grows in seashore and saline-alkali meadow for a long time, has strong stress resistance in a long-term natural selection process, and can possibly store rich stress resistance gene resources. However, the research on the SKOR of the elytrigia elongata in the prior art is not reported, and the existence of the SKOR in the elytrigia elongata and the biological functions of the SKOR are unknown. The research and development of effective gene resources of the elytrigia elongata can provide more means and scientific theoretical basis for the improvement of germplasm resources of plants.

Disclosure of Invention

The application aims to develop gene resources of elytrigia elongata, and provides an eSKORR (exo-rectified potassium channel protein) and a coding gene and application thereof.

The invention takes the elytrigia elongata as a research material, and adopts an RT-PCR combined RACE method to clone and obtain the full-length sequence of the elytrigia elongata SKOR gene, thereby laying a scientific foundation for the functional verification of the elytrigia elongata SKOR salt-tolerant gene and the research of the salt-tolerant molecular mechanism thereof.

In the first aspect, the EeSKORR gene of the elytrigia elongata is obtained by cloning through RT-PCR combined RACE method, and the ORF sequence is as follows:

(1) a nucleotide sequence shown as SEQ ID NO. 2;

(2) a nucleotide sequence having at least 90% homology with the nucleotide sequence shown as SEQ ID NO. 2; preferably, the homology is at least 95%; more preferably 98%.

Further, the invention provides an EeSKORR protein of the elytrigia elongata, which has any one of the following amino acid sequences:

(1) an amino acid sequence shown as SEQ ID NO. 1;

(2) the amino acid sequence of the protein with the same function is obtained by replacing, inserting or deleting one or more amino acids in the amino acid sequence shown as SEQ ID NO. 1;

(3) an amino acid sequence having at least 90% homology with the amino acid sequence shown as SEQ ID No. 1; preferably, the homology is at least 95%; more preferably 98%.

In a second aspect, the invention provides a biological material containing the EeSKOR gene, wherein the biological material is an expression cassette, a vector, a host cell, a recombinant bacterium or a transgenic plant cell.

In a third aspect, the invention provides the following applications of the elytrigia elongata EeSKORR protein, the coding gene thereof or the biological material containing the coding gene thereof:

(1) the application of the plant salt tolerance improving agent in plant salt tolerance improvement.

(2) The application of increasing plant biomass or increasing plant height under high salt stress.

(3) Reduction of plant H under high salt stress₂O₂And/or MDA content.

(4) The application of the plant SOD activity and/or the chlorophyll content of plants under the high salt stress.

(5) Reduction of plant Na under high salt stress⁺Concentration, or increase of K in plants⁺Use in concentration.

(6) The application of the transgenic plant in preparing the transgenic plant has the growth capacity of resisting high salt stress.

Any of the above uses, wherein the salt tolerance of the plant is increased by increasing the expression level and/or activity of the EeSKOR protein in the plant.

The salt stress of the invention means that the concentration of NaCl in the growth substrate is less than or equal to 200 mM.

The invention has the beneficial effects that:

(1) the invention discovers that the EeSKORR expression of the elytrigia elongata is induced and regulated by salt stress, the expression quantity of the EeSKORR expression in the tissue is root > leaf blade > leaf sheath, and the trend of the expression quantity in the tissue is unchanged along with the increase of the NaCl treatment concentration;

(2) the EeSKOR can improve the biomass and the plant height of the plant in a high-salt environment, the dry weight of the transgenic plant is increased by 35-46% compared with the control under the treatment of 200mM NaCl, and the plant height of the transgenic plant is increased by 38-47% compared with the control;

(3) overexpression of the EeSKOR gene under salt treatment significantly reduces H in transgenic tobacco plants₂O₂And the MDA content, the SOD activity and the chlorophyll content are improved: h of transgenic plants in comparison with wild type and empty vector plants under 200mM NaCl treatment₂O₂The content is reduced by 36 to 41 percent; the MDA content of the transgenic plant is reduced by 16 to 22 percent; the SOD activity of the transgenic plant is increased by 47 to 50 percent; the chlorophyll content of the transgenic plant is increased by 97-118 percent;

(4) overexpression of EeSKO under salt treatmentR gene obviously reduces Na of transgenic plant⁺Concentration, increase of K in vivo⁺Concentration: na on the overground part of the transgenic plant under the treatment of 200mM NaCl⁺The concentration is respectively reduced by 58 to 65 percent compared with that of wild type and empty carrier plants, and the K on the overground part⁺The concentration is 1.8-2.1 times of wild type and empty carrier plants; transgenic plant root Na⁺The concentration is reduced by 28 to 34 percent compared with the wild type and the empty vector plants, and the root part K⁺The concentration is 1.5-2 times of wild type and empty carrier plants.

In conclusion, the invention discovers that the overexpression of EeSKOR of thinopyrum elongatum in plants such as tobacco improves the biomass of transgenic plants, the chlorophyll content and increases K⁺Besides the concentration, the H of the transgenic plant is also obviously reduced₂O₂Content and its SOD activity. Indicating that the EeSKOR can not maintain the K in the plant body⁺The steady state balance can also reduce the serious damage of active oxygen to cell structures. Undoubtedly, the EeSKKOR obtained by cloning in the application is obviously different from the functions of other plants SKOR, has excellent performance of improving the salt stress resistance of the plants, can be used for improving the growth performance of the plants under the high salt stress, improving the salt stress resistance of the plants and protecting the structural integrity of plant cells, and has important significance for cultivating new salt-resistant plant varieties.

Drawings

FIG. 1 shows PCR amplification products of EeSKOR gene, wherein a: EeSKORR core fragment b EeSKORR 3 'RACE fragment c EeSKORR 5' RACE fragment.

FIG. 2 shows multiple comparisons of EeSKKOR of Elytrigia elongata with TaSKOR, TuSKOR and AetSKOR amino acids of Triticum aestivum.

FIG. 3 is K⁺HbAKT1 (rubber Tree, Hevea brasiliensis (Willd. ex. A. juss.) Muell. Arg., XM-021790545), MeAKT1 (cassava, Manihot esculenta Crantz, XM-021736424, QsAKT1 (Quercus suber, Quercus suber L., XM-024069160), JrAKT1 (walnut, Juglans regia L., XM-018985513), TcAKT1 (cocoa tree, Theobroma cacao L, XM-007013273), AtGORK (Arabidopsis thaliana, NM-123109.5), AtSKOR (Arabidopsis thaliana, NM-111153), VvSKOR (grape, Vitis vini. ferna L, XM _002282362), EeSKKOR (thinopyrum elongatum), TaSKOR (wheat, AK331457), ZmSKKOR (maize, NM _ 001357855).

FIG. 4 is a graph showing the effect of salt treatment at various concentrations for 24h on the expression level of EeSKOR in the root, leaf sheath and leaf of elytrigia elongata. The histogram at each concentration in the figure is, from left to right, the root, leaf sheath, leaf blade, respectively.

FIG. 5 shows the product of PCR amplification of EeSKOR gene ORF (left) and pCAMBIA1301 vector Hind III/Bgl II (right) in a double digestion assay, wherein 1 and 2 are the product of PCR amplification of EeSKOR gene ORF and pCAMBIA1301-35S-EeSKOR-Nos identification by digestion.

FIG. 6 is a schematic diagram of the construction of pCAMBIA1301-35S-EeSKOR-Nos vector.

FIG. 7 shows the positive identification of Agrobacterium, 1,2-Kan PCR product identification; 3,4-ORF PCR product identification.

FIG. 8 shows PCR detection of transgenic positive plants, WT-wild type tobacco, vector (V) -empty vector tobacco, L1-L45-transgenic tobacco plants.

FIG. 9 shows the qRT-PCR detection of expression level of transgenic tobacco plants, WT-wild tobacco, vector (V) -empty vector tobacco, L1-L45-transgenic tobacco plants.

FIG. 10 shows the effect of different concentrations of NaCl (0, 50, 100, 150, 200mM) on the phenotype of Wild Type (WT), the trans-empty Vector (Vector) and the transgenic lines (L12 and L36) treated with 21 d.

FIG. 11 shows the effect of different concentrations of NaCl (0, 50, 100, 150, 200mM) treatment 21d on the dry weight and plant height of Wild Type (WT), empty Vector (Vector) and transgenic plants (L12 and L36). The histograms for each concentration are WT, Vector, L12 and L36 from left to right.

FIG. 12 shows different NaCl concentrations (0, 50, 100, 150, 200mM) of treatment 21d for Wild Type (WT), transgenic empty Vector (Vector) and transgenic plants (L12 and L36) H₂O₂Content, MDA content, chlorophyll content and SOD activity.

FIG. 13 shows Na in aerial parts and roots of different NaCl concentrations (0, 50, 100, 150, 200mM) treated 21d wild type plants (WT), transgenic empty Vector plants (Vector) and transgenic plants (L12 and L36)⁺And K⁺The effect of concentration.

Detailed Description

Preferred embodiments of the present invention will be described in detail with reference to the following examples. It is to be understood that the following examples are given for illustrative purposes only and are not intended to limit the scope of the present invention. Various modifications and alterations of this invention will become apparent to those skilled in the art without departing from the spirit and scope of this invention.

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

The quantitative tests in the following examples, all set up three replicates and the results averaged. In the following examples, unless otherwise specified, the 1 st position of each nucleotide sequence is the 5 'terminal nucleotide of the corresponding DNA, and the last position is the 3' terminal nucleotide of the corresponding DNA.

Example 1 cloning and sequence analysis of EeSKORR Gene

Degenerate primers (P1, P2) are designed, cDNA synthesized by reverse transcription of total RNA of the radicle of the elytrigia elongata is taken as a template, an EeSKOR conserved core cDNA fragment of the elytrigia elongata is amplified by PCR, and the core fragment is found to be 555bp by sequencing (a in figure 1).

5 '-cDNA and 3' -cDNA were synthesized according to the method of 5 '-RACE and 3' -RACE of Clontech SMARTer RACE kit instructions, respectively; based on an EeSKORR gene core sequence of Elytrigia elongata, DNAMAN 8.0 and Primer5.0 software are utilized to respectively design a 5 '-RACE outer side primer P3, a nested primer P4, a 3' -RACE outer side primer P5 and a nested primer P6; the 3 '-RACE amplification product was sequenced to 1033bp (b of FIG. 1) and the 5' -RACE amplification product was sequenced to 1136bp (c of FIG. 1).

The full-length cDNA sequence of the EeSKORR of the elytrigia elongata is obtained by the sequence splicing of DNAMAN software, the length is 2402bp, the length of ORF frame is 2154bp, as shown in SEQ ID NO.2, 717 amino acids can be coded, as shown in SEQ ID NO.1, the presumed isoelectric point is 8.29, the molecular weight is 8.29It was 81.15kD and was named EeSKOR. The amino acid homology of EeSKOR with wheat TaSKOR, wula-profile wheat (Triticum urartu. ex Gandil) TuSKOR and jiegypt (aegylops tauschii Coss.) AetSKOR was 87.67%, 87.14% and 86.09%, respectively (fig. 2). Phylogenetic tree analysis shows that the relationship between EeSKKOR and SKOR is relatively close (FIG. 3). The above results indicate that the EeSKOR gene encodes the exocrine K⁺A channel protein.

The primer sequences used in this example are as follows:

P1:5’-TACCTGRTCGGSAACATGACGGCG-3’

P2:5’-GATGCTRGTCARGGAYTGCTTGTC-3’

P3:5’-ACAATCTGGCTCAGGAAGTCCTCT-3’

P4:5’-CTCTTGTAGCTGCTCTCGTACTGC-3’

P5:5’-ACATGGATGTCTGGAAGAGATTGT-3’

P6:5’-ATGTGGATCAGAAAAGGTCATCTCAGA-3’

UPM:

Long(0.4μM):

5’-CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT-3’

Short(2μM):5’-CTAATACGACTCACTATAGGGC-3’

NUP:5’-AAGCAGTGGTATCAACGCAGAGT-3’

EXAMPLE 2 Effect of salt treatment at different concentrations on EeSKOR expression levels

In order to prove the expression level and the change rule of EeSKOR genes in the root, leaf sheath and leaf of elytrigia elongata under salt stress, the length of a PCR product is 189bp by a forward primer P7 (5'-TACGGAGGCTGCTCAGGTTT-3') and a reverse primer P8 (5'-CGCATCTCCTCGCTTCATC-3') of qRT-PCR; the real-time fluorescence quantitative PCR of the reference gene Actin is carried out by a forward primer P9 (5'-CTTGACTATGAACAAGAGCTGGAAA-3') and a reverse primer P10 (5'-TGAAAGATGGCTGGAAAAGGA-3'), the length of a PCR product is 139bp, 4-week-old elytrigia elongata is treated for 24h in NaCl (0, 25, 50, 100, 150 and 200mM) with different concentrations, and the expression level of EeSKOR genes in roots, leaf sheaths and leaves of the elytrigia elongata is analyzed.

The results show that the EeSKOR gene expression level in roots tends to increase with the increase of NaCl treatment concentration (25-100 mM), while the EeSKOR gene expression level in roots slightly decreases with 150-200 mM NaCl; as the NaCl treatment concentration increased, the expression level of the EeSKOR gene in the leaf sheath and leaf showed a decrease compared to the control, but showed a tendency of root > leaf sheath overall (fig. 4). Indicating that the EeSKOR expression of the elytrigia elongata is induced and regulated by salt stress.

Example 3 construction of EeSKORR Gene plant expression vector for Elytrigia elongata

According to the requirement of the Clontech Infusion seamless connection technology, Nco I enzyme cutting sites and Bgl II enzyme cutting sites are respectively introduced at the two ends of an upstream (P11: 5'-ACTCTTGACCATGGTATGGAGAGGGAGATTGTAGCAGAG-3') primer and a downstream (P12: 5'-TTTACCCTCAGATCTCTACTGATCGGCTGCAACAGCAG-3') primer of an EeSKORR gene ORF frame of the elytrigia elongata, amplified by RT-PCR, and a target fragment PCR product is detected by 1.2% gel electrophoresis (figure 5). Carrying out double enzyme digestion on the restriction enzyme digestion sites on the pCAMBIA1301 vector through Nco I and Bgl II, and recovering a large fragment, which is named as pCAMBIA 1301-A; according to a corresponding program of a Clontech Infusion seamless linking technology, a target gene EeSKOR is inserted into a linearized plant table vector (pCAMBIA1301-A) to obtain a recombinant plasmid pCAMBIA1301-35S-EeSKOR-Nos, and then a specific band with the size of about 2900bp is obtained by Hind III/Bgl II double enzyme digestion (figure 5), so that a plant expression vector of the Elytrigia elongata EsSKOR gene is successfully constructed (figure 6).

Example 4 Agrobacterium Positive identification

The pCAMBIA1301-35S-EeSKOR-Nos vector was introduced into Agrobacterium GV3101 by freeze-thawing method using Kan (kanamycin) containing 50 mg. L-1 and 50mg L^-1Rif (Rifampicin) L B solid medium, screening and culturing at 28 deg.C in dark for 2-3 days, inoculating milky single colony growing on the plate to a medium containing 50 mg. L^-1Kan and 50 mg-L^-1Culturing in L B liquid culture medium of Rif antibiotic at 28 deg.C and 150rpm overnight in dark, extracting plasmid DNA of bacterial liquid, detecting by PCR Agrobacterium for positive detection, using plasmid DNA as template, using ORF frame PCR primers (P13: 5'-ATGGAGAGGGAGATTGTAGCAGAG-3' and P14: 5'-CTACTGATCGGCTGCAACAGCAGC-3') and Kan primers (P15: 5'-CTAAAACAATTCATCCAGTAAAA-3' and P16:5 ' -ATGGCTAAAATGAGAATATCACC-3'), and the 2154bp and 795bp target fragments were detected by gel electrophoresis (FIG. 7), confirming that the strain was positive.

Example 5 tobacco genetic transformation and molecular detection

Genetic transformation methods according to tobacco leaf disc infestation, and corresponding resistance (50mg L)^-1Kan) the transgenic tobacco plants of T0 generation obtained by screening are transplanted into a flowerpot containing nutrient soil and vermiculite (2:1), and the flowerpot is placed in a greenhouse to harvest the transgenic tobacco plant seeds of T0 generation, the harvested transgenic tobacco seeds of T0 generation are firstly disinfected by 5 percent sodium hypochlorite and then placed in a greenhouse containing 50mg L^-1In 1/2MS culture medium of Kan, transgenic tobacco with consistent germination was harvested after about 7d according to the above method to obtain T1 generation transgenic tobacco plant seeds. DNA of leaves of WT and T1 transgenic plants was extracted according to TaKaRaMiniBEST Universal Genomic DNAextraction Kit instructions, and DNA concentration was measured using a Quawell5000 nucleic acid protein analyzer, and using this as a template, 45 plants with 615bp fragment size were obtained by PCR amplification using primers P17 (5'-AGGGAGATTGTAGCAGAGTAT-3') and P18 (5'-CCTCCCGATCCATGTGCCCCCCTCAA-3') (FIG. 8).

Subsequently, the obtained T1 generation transgenic plants are propagated, the total RNA of the leaves of the transgenic plants is extracted and is reversely transcribed to synthesize cDNA according to the method in the example 1, the transcription abundance of the transgenic tobacco plants (target gene primers P7 and P8; tobacco internal reference Actin gene qRT-PCR upstream primer P19: 5'-GTGGTCGTACAACTGGTATTGTGTT-3' and downstream primer P20: 5'-GCAAGGTCCAAACGAAGAATG-3', the length is 109bp) is detected by a qRT-PCR method, as shown in figure 9, wild type and empty vector-transferred tobacco are used as a control, the expression levels of different transgenic tobacco strains are detected by utilizing the qRT-PCR technology, and the results show that the expression levels of No. 12 (L12) and No. 36 (L36) transgenic tobacco strains are the highest compared with those of other transgenic tobacco strains, so L12 and L36 are selected for subsequent salt tolerance physiological and biochemical analysis.

Example 6 transgenic tobacco plants salt tolerance analysis

(1) Under normal conditions (0mM NaCl), the wild type plants, the empty vector transgenic plants and the transgenic plants grow well, but with the increase of NaCl salt concentration, the transgenic plants show stronger salt tolerance characteristics (figure 10) compared with the wild type plants and the empty vector transgenic plants, as can be seen from figure 11, compared with normal growth conditions, the plant height and the dry weight of each plant are reduced remarkably with the increase of salt treatment concentration, but the dry weight and the plant height of the transgenic tobacco plants under salt treatment are remarkably higher than those of the wild type plants and the empty vector transgenic plants, for example, under 200mM NaCl treatment, compared with the wild type plants and the empty vector transgenic plants, the dry weight of L12 of the transgenic tobacco plants is increased by 35% and 42% respectively, and the dry weight of L36 is increased by 39% and 46% respectively, the plant height of L12 of the transgenic tobacco plants is increased by 39% and 47% respectively, and the plant height of L36 is increased by 38% and 45%, indicating that the overexpression of EeSKOR under salt treatment significantly increases the biomass and the plant height of the transgenic tobacco plants.

(2) Plant H₂O₂MDA and chlorophyll content and SOD activity analysis: as can be seen in FIG. 12, under normal conditions, H for wild type, empty vector and transgenic tobacco plants₂O₂MDA, chlorophyll content and SOD activity have no significant difference. Although the individual plants H increased with the external salt concentration compared with the normal conditioned treatment₂O₂The content, MDA content and SOD activity are gradually increased, but the chlorophyll content is greatly reduced, particularly under the treatment of 200mM NaCl, compared with wild type and empty vector plants, the H content of the transgenic tobacco L12₂O₂H with contents reduced by 36 percent and 39 percent and L36 percent respectively₂O₂The contents of the transgenic tobacco plant are respectively reduced by 38 percent and 41 percent, the MDA content of a transgenic tobacco plant L12 is respectively reduced by 18 percent and 22 percent, the MDA content of L36 is respectively reduced by 16 percent and 20 percent, the SOD activity of the transgenic tobacco plant L12 is respectively increased by 47 percent and 49 percent, the SOD activity of L36 is respectively increased by 48 percent and 50 percent, the chlorophyll content of the transgenic tobacco plant L12 is respectively increased by 118 percent and 114 percent, and the chlorophyll content of L36 is respectively increased by 101 percent and 97 percent, which fully shows that the H of the transgenic tobacco plant is obviously reduced by over-expressing the EeeeSKOR gene under salt treatment₂O₂And MDA content, and SOD activity and chlorophyll content are improved.

(3) Plant Na⁺And K⁺And (3) concentration analysis: to studyExpression of EeSKOR gene on Na in transgenic tobacco plant body⁺、K⁺The accumulated influence is respectively measured on Na in the overground part and the roots of the wild type, the empty vector and the transgenic tobacco plant under different NaCl concentration treatments⁺And K⁺The concentration of (c). As shown in FIG. 13, under normal conditions, Na was found in the aerial parts and roots of each plant⁺And K⁺No significant change in concentration; with increasing salt treatment concentration (50-200 mM NaCl), Na in aerial parts and roots of transgenic tobacco plants is increased compared with wild type plants and transgenic empty vector plants⁺The concentration is obviously reduced, K⁺The concentrations are all obviously increased, for example, the Na on the upper part of a transgenic tobacco plant L12 is treated by 200mM NaCl⁺The concentration is reduced by 59% and 58% compared with wild type and empty carrier plant, and the Na content of the aerial part of L36⁺The concentration is respectively reduced by 65 percent and 64 percent, L12 Na is on roots⁺The concentration is respectively reduced by 28% and 30% compared with wild type and empty carrier plant, L36 root Na⁺The concentrations were reduced by 32% and 34%, respectively, while the upper K of L12 was reduced by 32% and 34%, respectively⁺The concentration is 2.1 times and 2 times of wild type and empty carrier plant respectively, L36 overground part K⁺The concentration is 1.9 times and 1.8 times of wild plants and empty carrier plants respectively, L12 root K⁺The concentration of K is 2 times of that of wild type and empty carrier plants, L36 root⁺The concentrations were 1.6 and 1.5 times higher than those of wild type and empty vector plants, respectively. Therefore, the overexpression of the EeSKOR gene under the salt treatment obviously reduces Na of transgenic plants⁺Concentration and increase of K in vivo⁺And (4) concentration.

Although the invention has been described in detail hereinabove by way of general description, specific embodiments and experiments, it will be apparent to those skilled in the art that many modifications and improvements can be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

Sequence listing

<110> agriculture and forestry academy of sciences of Beijing City

<120> elytrigia elongata external rectification potassium channel protein, and coding gene and application thereof

<130>KHP201111312.2

<160>25

<170>SIPOSequenceListing 1.0

<210>1

<211>717

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>1

Met Glu Arg Glu Ile Val Ala Glu Tyr Glu Leu Asn Glu Ile Val Asp

1 5 10 15

Thr Leu His Gly Ser Val Gly Ser Arg Leu Ser Leu Phe Ser Arg Glu

20 25 30

Leu Asn Trp Arg Gly Ser Ser Ser Ala Leu Ser His Ala Thr Asn Cys

35 40 45

Tyr Gly Gly Ser Phe Val Met Asp Pro Asn Gly Arg Leu Tyr Arg Met

50 55 60

Trp Ser Asn Met Met Phe Leu Trp Ser Ile Tyr Ser Val Phe Tyr Thr

65 70 75 80

Pro Phe Ala Phe Cys Phe Phe Arg Gly Ile Pro Glu His Leu Met Asp

85 90 95

Leu Glu Cys Ala Gln Leu Ile Phe Leu Ala Asp Val Ala Val His Phe

100 105 110

Phe Leu Ala Tyr Arg Asp Ser His Thr His Arg Val Val Tyr Asp Lys

115 120 125

Gln Arg Ile Ala Leu Arg Tyr Ile Lys Gly Ser Phe Ala Leu Asp Met

130 135 140

Leu Gly Cys Phe Pro Trp Asp Ala Ile Tyr Lys Phe Thr Gly Arg Lys

145 150 155 160

Glu Met Val Arg Tyr Leu Val Trp Leu Arg Leu Tyr Arg Ala Arg Lys

165 170 175

Ile Gln Gly Phe Phe Lys Lys Met Glu Lys Asp Ile Arg Ile Ser Tyr

180 185 190

Leu Phe Thr Arg Ile Val Lys Leu Val Thr Val Glu Leu Tyr Cys Thr

195 200 205

His Thr Ala Ala Cys Val Phe Tyr Tyr Leu Ala Thr Thr Leu Pro Pro

210 215 220

Ala Leu Glu Gly Gly Thr Trp Ile Gly Arg Leu Thr Met Gly Asp His

225 230 235 240

Ser Tyr Ile Asn Phe Arg Glu Val Asp Leu Leu Thr Arg Tyr Val Thr

245 250 255

Ser Leu Tyr Leu Ala Ile Val Thr Met Ala Thr Val Gly Tyr Gly Asp

260 265 270

Ile His Ala Ala Asn Thr Arg Glu Met Val Phe Ile Met Val Tyr Val

275 280 285

Ser Phe Asp Met Leu Leu Gly Ala Tyr Leu Ile Gly Asn Met Thr Ala

290295 300

Leu Ile Val Lys Gly Ser Arg Thr Glu Arg Phe Arg Asp Lys Met Thr

305 310 315 320

Glu Leu Thr Arg Tyr Met Asn Arg Asn Arg Leu Gly Ser Asp Ile Arg

325 330 335

Ser Gln Val Lys Ala His Leu Leu Leu Gln Tyr Glu Ser Ser Tyr Lys

340 345 350

Arg Asp Arg Ile Val Asp Asp Ile Pro Val Ala Val Arg Ser Lys Thr

355 360 365

Leu Tyr Leu Asp Met Val Ser Lys Val His Leu Phe Lys Gly Cys Ser

370 375 380

Glu Asp Phe Leu Ser Gln Ile Val Val Lys Leu His Glu Glu Phe Phe

385 390 395 400

Leu Pro Gly Glu Val Ile Leu Glu Gln Gly Thr Val Val Asp Gln Ile

405 410 415

Tyr Ile Leu Gly His Gly Cys Leu Glu Glu Ile Val Ala Gly Glu Cys

420 425 430

Gly Ser Glu Lys Val Ile Ser Glu Leu Leu Pro His Asp Val Val Gly

435 440 445

Asp Val Ala Val Ile Cys Asn Thr Pro Gln Pro Tyr Thr Ile Arg Val

450455 460

Ser Glu Leu Cys Arg Leu Leu Arg Ile Asp Lys Gln Ser Leu Thr Ser

465 470 475 480

Ile Leu Gln Met Tyr Phe Lys Asp Ser Arg Gln Ile Met Ser Asn Leu

485 490 495

Leu Lys Gly Lys Thr Thr Glu Ser Lys Gly Lys Gln Leu Glu Ser Asn

500 505 510

Ile Thr Tyr Leu Ile Ala Lys Gln Glu Ala Asp Leu Val Leu Gly Val

515 520 525

Asn Asn Ala Ala Tyr Asp Gly Asp Leu Phe Arg Leu Lys Gly Leu Ile

530 535 540

Ser Ala Gly Ala Asp Pro Ser Lys Pro Asp Tyr Asp Gly Arg Thr Ala

545 550 555 560

Leu His Val Ala Ala Leu Arg Gly Tyr Glu Asp Ile Ile Arg Phe Leu

565 570 575

Ile Gln Arg Gly Ala Asn Val Asn Ser Ile Asp Lys Phe Gly Asn Ser

580 585 590

Pro Leu Leu Gln Ala Val Lys Ser Gly His Asp Arg Ile Ile Ser Val

595 600 605

Leu Val Ala Arg Gly Ala Ala Leu Asn Leu Glu Asp Ala Gly Gly Tyr

610 615620

Leu Cys Arg Val Val Ala Glu Gly Lys Ile Asp Leu Leu Arg Arg Leu

625 630 635 640

Leu Arg Phe Gly Ile Asp Pro Asn Cys Arg Asn Tyr Asp Arg Arg Thr

645 650 655

Pro Leu His Val Ala Ala Gly Glu Gly Leu Pro Leu Val Ala Gly Met

660 665 670

Leu Val Glu Leu Gly Ala Asp Val Met Ala Arg Asp Arg Trp Gly Ser

675 680 685

Thr Pro Leu Asp Glu Ala Arg Arg Cys Gly Ser Lys Pro Val Val Arg

690 695 700

Ile Leu Glu Gln Thr Thr Ala Ala Val Ala Ala Asp Gln

705 710 715

<210>2

<211>2154

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

atggagaggg agattgtagc agagtatgag ctgaatgaga tagttgacac attgcatggc 60

tctgttggga gcaggctctc cctgttttca agggagctca actggagagg cagcagcagt 120

gccttgagcc acgcaacgaa ttgctatggc ggcagctttg tcatggaccc taatggaaga 180

ttgtacagga tgtggtcgaa catgatgttc ctgtggtcca tctactccgt cttctacacc 240

cctttcgcct tctgcttcttccggggtatc cccgagcatc tcatggacct cgagtgcgcg 300

cagcttatct tccttgccga cgtcgccgtc cacttcttcc tcgcctaccg ggattctcac 360

actcacaggg tggtctacga caagcagagg attgccctgc gttacatcaa aggcagcttc 420

gctctcgata tgctgggatg cttcccttgg gacgccatct acaagtttac agggaggaag 480

gagatggtga ggtacctggt gtggctccgg ctgtacaggg caaggaagat tcagggtttc 540

ttcaagaaga tggagaagga catccgcatc agctacctct tcacgcggat cgtgaagctg 600

gtcaccgtcg agctctactg cacccacacc gccgcctgcg tcttctacta cctcgccacc 660

acgctgccgc cggcgcttga ggggggcaca tggatcggga ggctcaccat gggagaccac 720

agctacatca atttcaggga ggtcgacctg ctcacccgct acgtcacctc cctctacctc 780

gccatcgtca ccatggcaac agtcggttac ggagatatcc atgcagcgaa cacgagggag 840

atggtgttca tcatggtgta cgtctccttt gacatgctgc tcggtgcgta cctgatcggg 900

aacatgacag cgctcatcgt caagggctcc aggactgaga ggttccggga caagatgacg 960

gagctcacca ggtacatgaa taggaacagg ctgggcagcg acatcaggtc ccaggtgaag 1020

gcacatctat tgctgcagta cgagagcagc tacaagagag acaggattgt cgacgacata 1080

ccggtcgcgg tccggtccaa gacactgtac ttggacatgg tttcaaaagt gcacctattc 1140

aaaggatgct cagaggactt cctgagccag attgtggtga aattacatga agaattcttc 1200

ctccccgggg aagttatttt agagcaaggc actgtggtgg atcagatata cattctggga 1260

catggatgtc tggaagagat tgtggctgga gaatgtggat cagaaaaggt catctcagaa 1320

ctgcttccgc acgacgtagt cggtgatgtc gccgtaatct gcaacactcc gcagccatat 1380

acaattagag tctctgaact ctgccgcctc ttgagaattg acaagcagtc cctgactagc 1440

atcttgcaaa tgtacttcaa ggatagccga cagataatga gcaacctact caaggggaaa 1500

acaactgagt caaaggggaa gcaactggaa tcaaatatca catacctaat agcaaagcaa 1560

gaagcagacc tggtcctcgg agtcaacaat gctgcctacg atggagactt gttccggtta 1620

aaaggcttga tcagcgcagg agcagatccg agtaaaccgg attacgatgg aaggaccgca 1680

ttacatgttg ctgcattgag agggtacgaa gatatcatca ggttccttat ccagcgagga 1740

gcaaacgtca acagcataga taagtttggg aattcgcctc tgctgcaagc ggtgaaatca 1800

gggcacgaca ggatcatctc ggtcctggtc gctcgtggcg cagccctgaa ccttgaggac 1860

gcaggaggct acctgtgcag ggtggtcgct gaaggcaaga tcgacctact acggaggctg 1920

ctcaggtttg ggatcgaccc caactgcagg aactacgacc ggaggacgcc gctccatgtc 1980

gctgccggag agggcctgcc gctcgtcgcc ggcatgctgg tggagctcgg ggccgacgtc 2040

atggccaggg accggtgggg gagcacgccg ctcgatgaag cgaggagatg cggcagtaag 2100

ccggtggtga ggatcctgga gcagactaca gctgctgttg cagccgatca gtag 2154

<210>3

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

tacctgrtcg gsaacatgac ggcg 24

<210>4

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

gatgctrgtc arggaytgct tgtc 24

<210>5

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

acaatctggc tcaggaagtc ctct 24

<210>6

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

ctcttgtagc tgctctcgta ctgc 24

<210>7

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

acatggatgt ctggaagaga ttgt 24

<210>8

<211>27

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

atgtggatca gaaaaggtca tctcaga 27

<210>9

<211>45

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

ctaatacgac tcactatagg gcaagcagtg gtatcaacgc agagt 45

<210>10

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>10

ctaatacgac tcactatagg gc 22

<210>11

<211>23

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>11

aagcagtggt atcaacgcag agt 23

<210>12

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>12

tacggaggct gctcaggttt 20

<210>13

<211>19

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>13

cgcatctcct cgcttcatc 19

<210>14

<211>25

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>14

cttgactatg aacaagagctggaaa 25

<210>15

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>15

tgaaagatgg ctggaaaagg a 21

<210>16

<211>39

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>16

actcttgacc atggtatgga gagggagatt gtagcagag 39

<210>17

<211>38

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>17

tttaccctca gatctctact gatcggctgc aacagcag 38

<210>18

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>18

atggagaggg agattgtagc agag 24

<210>19

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>19

ctactgatcg gctgcaacag cagc 24

<210>20

<211>23

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>20

ctaaaacaat tcatccagta aaa 23

<210>21

<211>23

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>21

atggctaaaa tgagaatatc acc 23

<210>22

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>22

agggagattg tagcagagta t 21

<210>23

<211>26

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>23

cctcccgatc catgtgcccc cctcaa 26

<210>24

<211>25

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>24

gtggtcgtac aactggtatt gtgtt 25

<210>25

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>25

gcaaggtcca aacgaagaat g 21

Claims

1. The EeSKORR protein of the elytrigia elongata is characterized by having any one of the following amino acid sequences:

(1) an amino acid sequence shown as SEQ ID NO. 1;

2. A gene encoding an eeskorr protein of elytrigia elongata according to claim 1, characterized in that its ORF sequence is:

(1) a nucleotide sequence shown as SEQ ID NO. 2;

3. Biological material comprising the gene of claim 2, wherein the biological material is an expression cassette, a vector, a host cell, a recombinant bacterium or a transgenic plant cell.

4. The use of the EeSKORR protein of Elytrigia elongata, its encoding gene or the biological material containing the encoding gene of claim 1 for improving the salt tolerance of plant.

5. The use of the EeSKORR protein of Elytrigia elongata, the coding gene thereof or the biological material containing the coding gene thereof according to claim 1 for increasing the biomass of plants or increasing the plant height under high salt stress.

6. The EeSKORR protein of Elytrigia elongata of claim 1, and the gene encoding the sameOr the biological material containing the coding gene thereof reduces the plant H under the high salt stress₂O₂And/or MDA content.

7. The use of the EeSKORR protein of Elytrigia elongata, the gene encoding the same, or the biological material containing the gene encoding the same according to claim 1, for increasing the SOD activity of plants and/or increasing the chlorophyll content of plants under high salt stress.

8. The EeSKORR protein of Elytrigia elongata, the encoding gene thereof or the biological material containing the encoding gene of the EeSKORR protein of claim 1, which can reduce plant Na under high salt stress⁺Concentration, or increase of K in plants⁺Use in concentration.

9. Use of the elytrigia elongata EeSKOR protein, its encoding gene or the biological material containing the encoding gene according to claim 1 for the preparation of transgenic plants having the ability to grow with high salt stress tolerance.

10. The use according to any one of claims 4 to 9, wherein the salt tolerance of the plant is increased by increasing the expression level and/or activity of the EeSKOR protein in the plant.