LU502146B1 - PECTATE LYASE (Pel) MUTANT deltaPelG403, AND ENCODING GENE, PREPARATION METHOD AND USE - Google Patents

Abstract

The present disclosure provides a pectate lyase (Pel) mutant ΔPelG403, and an encoding gene, a preparation method and use. In the Pel mutant ΔPelG403, an amino acid at position 129 of a flexible region of a wild-type PelG403 is mutated from alanine with a small molecular weight to valine with a large molecular weight; and the ΔPelG403 has an amino acid sequence and a nucleotide sequence shown in SEQ ID NO: 1 and SEQ ID NO: 2, respectively. The Pel mutant has significantly-improved enzyme activity and thermal resistance under alkaline conditions, which avoids low catalytic activity and insufficient thermal stability of the wild-type Pel under the alkaline conditions. Therefore, the Pel mutant has desirable conditions for use in the fields of cotton and linen processing, pulping and papermaking, and industrial wastewater treatment.

Description

PECTATE LYASE (Pel) MUTANT APelG403, AND ENCODING GENE, HUS02140

PREPARATION METHOD AND USE TECHNICAL FIELD

[0001] The present disclosure belongs to the technical field of molecular biology, and more particularly, relates to a pectate lyase (Pel) mutant APelG403, and an encoding gene, a preparation method and use.

BACKGROUND ART

[0002] Pectate lyase (Pel, EC 4.2.2.2) cleaves an a-1,4-glycosidic bond of pectic acid or pectin in a random manner through trans-elimination to generate C4-Cs unsaturated oligogalacturonic acid; the Pel functions generally under alkaline conditions, with catalysis depending on Ca?*. Starr and Moran first discovered the Pel in cultures of Erwinia carotovora and Bacillus polymyxa in 1962; subsequently, the Pel was found in microbial resources such as Penicillium sp., Paenibacillus sp. and Psedomonas sp.

[0003] Pel is widely used in many fields, such as papermaking, coffee and tea fermentation, textile and vegetable fiber processing, oil extraction and industrial wastewater treatment.

[0004] As an important enzyme for cleaner production, the Pel has attracted much attention, and is mainly used in pulp bleaching and textile biorefining industries. Enzymatic hydrolysis refining can fundamentally solve environmental and energy problems existing in the traditional process, and has the incomparable advantages of traditional process in terms of quality and environmental protection. The industrial use of Pel mainly depends on enzymatic properties such as the optimum temperature, optimum pH, stable temperature and stable pH of enzyme activity. Therefore, it is one of the focuses to discover excellent Pel from microbial strain resources, and select the Pel suitable for industrial production uses.

[0005] Pel often encounters a high temperature environment during industrial use. Excessive temperature may destroy non-covalent bonds such as salt bridges, hydrogen bonds, van der Waals forces, and hydrophobic interactions in Pel molecule, thereby disrupting the spatial structure of Pel and changing the Pel from a folded state to a relatively unfolded state. As a result, the activity of Pel decreases and even enzyme inactivation occurs. According to reports, most of Pel at present are derived from normal-temperature microorganisms, and are basically inactivated at 50°C for 1 h.

[0006] With the development of molecular biology technology, molecular modification on existing Pel is one of the effective means to obtain excellent enzyme species with a high enzyme activity and high-temperature resistance. Site-directed mutagenesis, according to known or 1 predicted structural information and catalytic mechanism of the Pel, analyzes a relationship 46 between the structure and function of Pel. Based on this, the site-directed mutagenesis infers main sites that affect enzyme stability and catalytic activity, and modifies or replaces key sites. The site-directed mutagenesis has been widely used for the improvement of enzyme performances due to a high mutation rate and desirable repeatability.

[0007] Up to now, there are no reports on transformation of Pel by point mutation.

SUMMARY

[0008] In view of this, the present disclosure provides a Pel mutant APelG403, and an encoding gene, a preparation method and use.

[0009] In order to achieve the aforementioned objective, the technical solution of the present disclosure is as follows.

[0010] The present disclosure provides a Pel mutant APelG403, where an amino acid at position 129 of a flexible region of a wild-type PelG403 is mutated from alanine with a small molecular weight to valine with a large molecular weight.

[0011] Specifically, the amino acid at position 129 in the flexible region (random coil and turn region) at positions 128 to 137 is point-mutated. More specifically, on the basis of a pelG403 gene sequence (GenBank accession number: JX964998) published in the GenBank database, an amino acid encoded by the gene is substituted, where an amino acid substitution point is the alanine at position 129. Therefore, intermolecular forces (such as van der Waals forces) are increased in the flexible region, thereby improving a heat resistance of the enzyme.

[0012] Further, the mutant APelG403 may have an amino acid sequence shown in SEQ ID NO:

1.

[0013] The present disclosure further provides a gene Ape/G403 encoding the Pel mutant.

[0014] Further, the gene Ape/G403 may have a nucleotide sequence shown in SEQ ID NO: 2.

[0015] The present disclosure further provides a vector including the gene Ape/G403.

[0016] The present disclosure further provides a host cell including the gene Ape/G403 or the vector.

[0017] The present disclosure further provides an engineering bacterium including the gene ApelG403 or the vector.

[0018] The present disclosure further provides use of the gene Ape/G403 and an enzyme encoded by the gene in degradation of colloid in cotton and linen, colloid in papermaking raw materials and pectin in industrial wastewater.

[0019] The present disclosure further provides a method for producing the Pel mutant APelG403, including: 2

[0020] Achieving high-efficiency expression of a nucleotide sequence shown in SEQ ID NO: 2002146 with a gene encoding the mutant shown in SEQ ID NO: 2 using a plasmid capable of expressing the Pel as an expression vector and a strain capable of expressing the Pel as an expression host.

[0021] Specifically, high-efficiency expression of a nucleotide sequence shown in SEQ ID NO: 2 is achieved with a gene pe/G403“?W encoding the mutant using pET28a or a plasmid capable of expressing the Pel as an expression vector and Escherichia coli BL21 (DE3) or a strain capable of expressing the Pel as an expression host.

[0022] More specifically, the Pel gene pe/G403 is derived from Dickeya dadantii DCE-01 (deposit number: CGMCC 5522, and patent number: ZL201110410078.7), a high-efficiency degumming strain of bast fiber plants. A promoter of the pET28a expression unit is a commonly used T7 promoter; under an action of the T7 promoter, the mutant enzyme can be directly and intracellularly expressed in the host cell Æ.coli BL21(DE3) in a soluble manner.

[0023] Compared with the prior art, the present disclosure has the following advantages:

[0024] The Pel mutant has significantly-improved enzyme activity and thermal resistance under alkaline conditions, which avoids low catalytic activity and insufficient thermal stability of the wild-type Pel under the alkaline conditions. Therefore, the Pel mutant has desirable conditions for use in the fields of cotton and linen processing, pulping and papermaking, and industrial wastewater treatment.

[0025] In the present disclosure, the degradation ability is compared between the wild-type PelG403 and the mutant PelG403 to sodium polygalacturonate under alkaline conditions. The results show that the mutant PelG403412°V has a specific enzyme activity of 9820.5 U/mg at a pH value of 9.0, which is 1.2 times that of the wild-type PelG403; after heat preservation at 50°C for 2 h, the mutant PelG403412°Y has a residual enzyme activity of 1,689.8 U/mg, which is 4.7 times that of the wild-type PelG403. In summary, the mutant enzyme has heat resistance and high enzyme activity under alkaline conditions, indicating that the mutant enzyme has important prospects for use in industrial production under high-temperature and alkaline conditions.

BRIEF DESCRIPTION OF THE DRAWINGS

[0026] FIG. 1 shows a construction flow chart of a mutant Pel engineering strain in the example of the present disclosure;

[0027] FIG. 2 shows a construction map of a recombinant plasmid pET28a(+)-pelG403 in the example of the present disclosure;

[0028] FIG. 3 shows a schematic diagram of a principle of site-directed mutagenesis in the example of the present disclosure;

[0029] FIG. 4 shows sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) 3 profiles of induced expression of wild-type and mutant enzymes in the example of the present 202140 disclosure; and

[0030] FIG. 5 shows a stability temperature comparison of wild-type and mutant enzymes in the example of the present disclosure.

DETAILED DESCRIPTION OF THE EMBODIMENTS

[0031] To make the objective, technical solutions and advantages of the present disclosure clearer and more comprehensible, the present disclosure will be further described below in detail in conjunction with embodiments.

[0032] It should be understood that the specific examples described herein are merely intended to explain the present disclosure, rather than to limit the present disclosure.

[0033] Methods used in the following examples are conventional methods unless otherwise specified.

[0034] The terms "include", "comprise", "have", "including", or any other variations thereof used in the present disclosure refer to non-exclusive inclusion. For example, a composition, step, method, article, or device including listed elements is not necessarily limited to those elements, but may include other elements not explicitly listed or inherent elements in such a composition, step, method, article, or device.

[0035] Further, the technical features involved in the various embodiments of the present disclosure described below may be combined with each other as long as they do not constitute a conflict with each other.

[0036] Materials and reagents:

[0037] An expression vector pET28a, a prokaryotic clone competent E.coli TOP10 and a prokaryotic expression competent Æ.coli BL21(DE3) each were purchased from Novagen.

[0038] An Ultra HiFidelity PCR Kit, a Spin Column Type Bacterial Genome Extraction Kit, a Rapid Site-Directed Mutagenesis Kit, a DNA Marker III, a 2xTaq PCR Mix Reagent, a Common Agarose Gel NDA Recovery Kit, a Plasmid Mini Kit, IPTG, and kanamycin (Kan) each were purchased from TIANGEN Biotech.

[0039] Sodium polygalacturonate, tryptone, a yeast extract and an agar powder each were purchased from Sigma-Aldrich.

[0040] Primer synthesis and nucleic acid sequencing were completed by Tsingke Biotechnology Co., Ltd.

[0041] The rest of chemical reagents were commercial products of analytical grade, purchased from Sinopharm Group.

[0042] FIG. 1 shows a construction flow chart of a mutant Pel engineering strain in the example 4 shown in of the present disclosure. 17502746

[0043] Example 1 Construction of recombinant plasmid

[0044] D. dadantii DCE-01 was cultured to a logarithmic growth phase, and 1.5 mL of a bacterial solution was centrifuged at 12,000 rpm for 1 min to collect a bacterial pellet; a genomic DNA was extracted according to kit instructions.

[0045] According to an MCS segment of a Pel gene pe/G403 and a vector pET28a, restriction sites Nde I and Xho I were selected in sequence, and the following primers were designed with bioinformatics software SnapGene:

[0046] F: S'CGCATATGATGAAATCACTCATTACCCC 3' (Nde I) (SEQ ID NO: 3)

[0047] R: S'CCTCGAGTTATTTACAGGCTGCGCTGGT 3' (Xho I) (SEQ ID NO: 4).

[0048] PCR reaction system included: genomic DNA, 1 uL; Primer F (10 uM), 0.75 uL; Primer R (10 uM), 0.75 pL; 2xUltraHiFi Mix (with dye) 12.5 pL; the system was supplemented to 25 uL with ddH>O; PCR reaction was conducted after mixing well.

[0049] Parameter settings:

[0050] (1) initial denaturation at 94°C for 2 min; (2) denaturation at 98°C for 10 sec; (3) renaturation at 60°C for 30 sec; (4) extension at 68°C for 15 sec; repeating steps (2) to (4) for 35 cycles; (5) heat preservation at 68°C for 5 min.

[0051] A purified PCR product and a pET28a(+) vector were subjected to double enzyme digestion with corresponding restriction enzymes, respectively, and a pET28a (+) linear vector and a target gene were recovered by gel cutting, and the vector and target gene were ligated overnight at 16°C with a T4 DNA ligase; a ligation product was transformed into a prokaryotic clone competent E.coli TOP10, and a transformed bacterial solution was evenly spread on an LB screening plate (Kan 50 pg/mL), and incubated at 37°C overnight; transformants were selected for liquid culture, a plasmid was extracted, and a recombinant plasmid pET28a-pelG403 (FIG. 2) was obtained by enzyme digestion and PCR verification, and the recombinant plasmid was transferred to Æ.coli BL21 (DE3) to obtain a pET28a-pelG403/BL21 engineering bacterium.

[0052] Example 2 Site-directed mutagenesis

[0053] Principle of site-directed mutagenesis: a point mutation plasmid was constructed by a Dpn I method (FIG. 3).

[0054] PCR point mutation primers were designed according to amino acid sites to be mutated as follows:

[0055] FA!?*V: 5" CACCATCATCGGCGTGAACGGTTCTTCCGC 3' (SEQ ID NO: 5)

[0056] RAV: 5' GCGGAAGAACCGTTCACGCCGATGATGGTG 3' (SEQ ID NO: 6); where

[0057] An underlined part represented a codon corresponding to valine at position 129 encoded by the mutant gene.

[0058] The mutation site was introduced by whole plasmid PCR using a rapid site-directed 202140 mutagenesis kit with the recombinant plasmid pET28a-pelG403 as a template.

[0059] A PCR reaction system included: 1 uL of the Primer F (10 uM), 1 uL of the Primer R (10 uM), 5 uL of a SxFastAlteration Buffer, 1 uL of a plasmid DNA, 0.5 pL of a Fast Alteration DNA Polymerase, supplemented with ddH>O to 25 pL.

[0060] Parameter settings:

[0061] (1) initial denaturation at 95°C for 2 min; (2) denaturation at 94°C for 20 sec; (3) renaturation at 60°C for 10 sec; (4) extension at 68°C for 2.5 min; repeating steps (2) to (4) for 18 cycles; (5) heat preservation at 68°C for 5 min; and the product was stored at 4°C.

[0062] 0.5 uL of a restriction endonuclease Dpn I was added to 25 pL of a mutated PCR product, mixed well, and digested at 37°C for 1 h; 5 uL of a Dpn I-digested product was transformed into DHSa, a transformed bacterial solution was spread evenly on an LB screening plate (Kan 50 ug/mL), and incubated at 37°C overnight to obtain transformants of relevant mutants; a plasmid was extracted, and a correct mutant was obtained through ÆcoR I single restriction digestion, and PCR amplification and sequencing of the mutant gene; a successfully constructed recombinant plasmid was transformed into Æ. coli BL21 (DE3) to obtain a genetically engineered mutant strain pET28a-pel G403A12°V/BL21.

[0063] Example 3 Induced expression and SDS-PAGE analysis of wild-type and mutant enzymes

[0064] Single colonies of genetically engineered bacteria pET28a-pelG403/BL21 and pET28a- pelG403A!°V/BL21 were inoculated into an LB liquid medium containing 50 mg/L Kan, and incubated at 37°C and 220 r/min to OD60 = 0.6, 0.5 mmol/L IPTG was added, and induce expression was conducted at 28°C and 120 r/min for 12 h to 15 h.

[0065] 1 mL of an induced mature fermented bacterial solution was added into a 1.5 mL centrifuge tube, centrifuged at 10,000 r/min for 5 min, a supernatant was discarded, 500 pL of a normal saline was added for vortex, followed by conducting centrifugation and washing twice. A bacterial pellet was suspended by 40 uL of sterilized ddH:O, 10 uL of a 5x protein loading buffer was added, boiled for 5 min, cooled naturally, and stored at -20°C for later use (Note: before loading, boiling was conducted in a water bath for 3 min).

[0066] The prepared samples were analyzed by discontinuous SDS-PAGE (5% stacking gel and 12% separating gel) (FIG. 4), and a same treatment was conducted on the pET28a/BL21 strain without the target gene inserted as a blank control. The results show that the wild-type Pel engineering strain pET28a-pelG403/BL21 and the mutant engineering strain pET28a- pelG403412°V/BL21 each can successfully express specific protein bands.

[0067] Example 4 Preparation of enzyme solutions of wild-type and mutant enzymes 6

[0068] (1) A fermentation broth induced to mature was centrifuged at 3,000 r/min and 4°C for 202140 min, and bacterial cells were collected.

[0069] (2) 1 pL of DNase I, 2 pL. of lysozyme and 10 pL of a protease inhibitor mixture were added to each 1 mL of a bacterial protein extraction reagent, and mixed well by vortexing.

[0070] (3) According to a ratio of adding 20 mL of the bacterial protein extraction reagent to each gram of a bacterial cell pellet, an extracting solution was added to the bacterial cell pellet, and pipetted up and down with a pipette until the bacterial cells were completely resuspended.

[0071] (4) After resuspension, incubation was conducted at room temperature for 10 min to 15 min.

[0072] (5) Centrifugation was conducted at 15,000 r/min for 5 min.

[0073] (6) A supernatant was transferred to a new centrifuge tube (the supernatant was an intracellular soluble protein) for protein quantification and enzyme activity assays.

[0074] Example S Comparison of catalytic ability between wild-type and mutant enzymes in vitro

[0075] To compare catalytic abilities of wild-type and mutant enzymes under alkaline conditions, enzyme activity assays were conducted under the same conditions.

[0076] Enzyme activity assay method: a 5 mg/mL sodium polygalacturonate solution was prepared with a 0.05 mol/L glycine-sodium hydroxide buffer (pH 9.0). 1 mL of a substrate was preheated to 50°C, 10 uL of an appropriately diluted enzyme solution was added, reaction was conducted accurately at 50°C for 10 min, and 2 mL of DNS was immediately added. Color development was conducted in a boiling water bath for 5 min, followed by rapid cooling in an ice water bath. A same enzyme solution inactivated by boiling was subjected to a same reaction as a negative control, and ODs20 of the sample was measured.

[0077] The definition of Pel activity is: an amount of enzyme required for the substrate to release 1 pmol of reducing sugar of unsaturated galacturonic acid per minute is 1 unit of enzyme activity, expressed in U.

[0078] The results show that the mutant PelG403412°V has a specific enzyme activity of 9820.5 U/mg at pH 9.0, which is 1.2 times that of the wild-type PelG403, such that the mutant has a greatly improved ability to catalyze degradation of the sodium polygalacturonate.

[0079] Example 6 Comparison of heat resistance between wild-type and mutant enzymes

[0080] A crude enzyme solution was incubated at 50°C for 2 h, and a remaining enzyme activity was measured (FIG. 5) to characterize a thermal stability of the enzyme. The results show that the mutant PelG4034!2°Y has a residual enzyme activity of 3636.3 U/mg after heat preservation at 50°C for 2 h, which is 4.7 times that of the wild-type PelG403. This indicates that the mutation of A129 site improves the heat stability of the Pel.

7

[0081] The above-mentioned examples only express several implementations of the present. 502146 disclosure, and the descriptions thereof are relatively specific and detailed, but they should not be thereby interpreted as limiting the scope of the present disclosure.

[0082] It should be noted that those of ordinary skill in the art can further make several variations and improvements without departing from the idea of the present disclosure, but such variations and improvements shall all fall within the protection scope of the present disclosure. Therefore, the protection scope of the present disclosure shall be subject to the appended claims.

8

SEQUENCE LISTING <110> INSTITUTE OF BAST FIBER CROPS, CHINESE ACADEMY OF

AGRICULTURAL SCIENCES <120> PECTATE LYASE (Pel) MUTANT A PelG403, AND ENCODING GENE,

PREPARATION METHOD AND USE <130> HKJU20220302244 <150> 202110563930 .8 <151> 2021-05-24 <160> 6 <170> PatentIn version 3.5 <210> 1 <211> 387 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence of mutant À PelG403 <400> 1 Met Pro Ile Ser His Phe Ser Lys Thr Gly Ile Leu Leu Met Lys Ser 1 5 10 15 Phe Ile Ala Pro Ile Ala Ala Gly Leu Leu Leu Ala Phe Ser Gln Ser 9

Ser Leu Ala Ala Thr Gly Gly Tyr Ala Thr Thr Ser Gly Gly Asn Val 35 40 45 Thr Gly Thr Val Ser Lys Thr Ala Ala Ser Met Gln Asp Ile Ile Asp 50 55 60 Ile lle Asp Ala Ala Lys Leu Asp Ala Lys Gly Lys Lys Val Lys Gly 65 70 75 80 Gly Ala Tyr Pro Leu Val Ile Thr Tyr Thr Gly Asn Glu Asp Ser Leu 85 90 95 Ile Asn Ala Ala Ala Ala Asn Ile Cys Gly Gln Trp Ser Lys Asp Ala 100 105 110 Arg Gly Val Glu Ile Lys Asp Phe Thr Lys Gly Ile Thr Ile Ile Gly 115 120 125 Ala Asn Gly Ser Ser Ala Asn Phe Gly Ile Trp Ile Val Asn Ser Ser 130 135 140 Asp Val Val Val Arg Asn Met Arg Ile Gly Tyr Leu Pro Gly Gly Ala 145 150 155 160 Gln Asp Gly Asp Met Phe Arg Ile Asp Asn Ser Pro Asn Ile Trp Leu 165 170 175

Asp His Asn Glu Leu Phe Ala Ala Asn His Glu Cys Asp Gly Thr Lys 180 185 190 Asp Gly Asp Thr Thr Phe Glu Ser Ala Phe Asp Ile Lys Lys Gly Ala 195 200 205 Thr Tyr Val Thr Ile Ser Tyr Asn Tyr Ile His Gly Val Lys Lys Val 210 215 220 Gly Leu Ala Gly Phe Ser Ala Ser Asp Ser Ala Glu Arg Asn Ile Thr 225 230 235 240 Tyr His His Asn Ile Tyr Asn Asp Val Asn Ala Arg Leu Pro Leu Gln 245 250 255 Arg Gly Gly Asn Val His Ala Tyr Asn Asn Leu Tyr Thr Asn Ile Thr 260 265 270 Ser Ser Gly Leu Asn Val Arg Gln Asn Gly Lys Ala Leu Val Glu Ser 275 280 285 Asn Trp Phe Glu Asn Ala Val Asn Pro Val Thr Ser Arg Tyr Asp Gly 290 295 300 Ser Asn Phe Gly Thr Trp Val Leu Lys Asn Asn Asn Ile Thr Lys Pro 305 310 315 320 11

Ala Asp Phe Ala Thr Tyr Asn Ile Thr Trp Thr Ala Asp Thr Lys Ala 325 330 335 Tyr Val Asn Ala Asp Ser Trp Thr Ser Thr Gly Thr Tyr Pro Thr Val 340 345 350 Thr Tyr Ser Tyr Ser Pro Val Ser Ala Gln Cys Val Lys Asp Lys Leu 355 360 365 Ala Asn Tyr Ala Gly Val Gly Lys Asn Leu Ala Glu Leu Thr Ser Ser 370 375 380 Ala Cys Lys 385 <210> 2 <211> 1164 <212> DNA <213> Artificial Sequence <220> <223> Nucleotide sequence of gene A pelG403 <400> 2 atgcccatct cacatttttc aaaaacagga atactactca tgaaatcatt cattgeccceg 60 attgccgccg gtetgetget ggectttagt caatccagte tggetgegac gggeggttat 120 12 gccaccactt ccgggggcaa cgtgacagga accgtcagca aaaccgcagc atccatgcag 180 HUS02140 gacatcatcg atatcatcga tgccgccaaa ctcgacgeca aaggcaaaaa ggtgaaagge 240 ggcgcgtacc cgetggteat cacctatacc ggtaacgaag attcgetgat caacgecget 300 gccgccaata tctgcggcca gtggageaaa gacgeccgeg gegtggaaat caaagactte 360 accaaaggca tcaccatcat cggcgccaac gattettecg ccaacttcgg catctggatc 420 gtgaactcct ccgacgtagt agtacgcaac atgcgtatcg getacctgee gggeggeget 1480 caggatggcg atatgttccg tatcgacaac tcgecgaaca tetggetgga ccacaacgaa 540 ctetttgccg ccaaccacga gtgtgatgge accaaagacg gegacaccac gttcgaatce 600 gcctttgaca tcaagaaagg cgccacttac gtcaccattt cctacaacta catccacgge 660 gtgaagaaag tcggtetggc agggttcage gectctgaca gegecgaacg caacatcact 720 taccaccaca atatctacaa tgacgtcaac gcccgtctec cgttgecageg cggeggtaac 780 gtacacgcct acaacaacct gtacaccaac atcaccagct ctggtctgaa cgtgegtcag 840 aacggcaagg cgttggtcga aagcaactgg ttcgaaaacg cggtgaacce ggtgacgtce 900 cectacgacg gcagcaattt cggcacctgg gtgctgaaaa acaacaacat caccaaaccg 960 gctgatttcg ctacctacaa catcacctgg acggcggata ccaaagctta cgtcaacgec 1020 gatagctgga cttccaccgg cacttacccg actetgacct acagctacag cccggtcage 1080 gcacagtgcg tgaaggacaa actggctaac tacgctgetg tcggtaaaaa cctggecgag 1140 ctgaccagct cagcttgtaa ataa 1164

13

<210> 3 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Primer Nde I <400> 3 cgcatatgat gaaatcactc attaccec 28 <210> 4 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Primer Xho I <400> 4 cctcgagtta tttacagect gegetggt 28 <210> 5 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer FA129V <400> 5

14 caccatcatc ggecgtgaacg gttettecgc 30 <210> 6 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer RA129V <400> 6 gcggaagaac cgttcacgec gatgatggtg 30

Claims (9)

WHAT IS CLAIMED IS:

1. À pectate lyase (Pel) mutant APelG403, wherein an amino acid at position 129 of a flexible region of a wild-type PelG403 is mutated from alanine with a small molecular weight to valine with a large molecular weight.

2. The Pel mutant APelG403 according to claim 1, wherein the APelG403 has an amino acid sequence shown in SEQ ID NO: 1.

3. A gene ApelG403 encoding the Pel mutant according to claim 2.

4. The gene Ape/G403 according to claim 3, wherein the gene has a nucleotide sequence shown in SEQ ID NO: 2.

5. A vector comprising the gene Ape/G403 according to claim 3 or 4.

6. A host cell comprising the gene Ape/G403 according to claim 3 or 4 or the vector according to claim 5.

7. An engineering bacterium comprising the gene Ape/G403 according to claim 3 or 4 or the vector according to claim 5.

8. Use of the gene Ape/G403 according to claim 3 or 4 and an enzyme encoded by the gene in degradation of colloid in cotton and linen, colloid in papermaking raw materials and pectin in industrial wastewater.

9. À method for producing the Pel mutant APelG403 according to claim 2, comprising: achieving high-efficiency expression of a nucleotide sequence shown in SEQ ID NO: 2 with a gene encoding the mutant shown in SEQ ID NO: 1 using a plasmid capable of expressing the Pel as an expression vector and a strain capable of expressing the Pel as an expression host.

16