CN114645038B - Alkali-resistant pectin lyase and application thereof - Google Patents

Abstract

The invention provides an alkali-resistant pectin lyase and application thereof, in particular to a mutant pectin lyase PGLA4-C209-289 coding gene with a nucleotide sequence shown in SEQ ID NO. 1; the amino acid sequence is shown as SEQ ID NO. 2; the nucleotide sequence of the coding gene of the mutant pectin lyase PGLA4-C10-182 is shown in SEQ ID NO. 9; the amino acid sequence is shown in SEQ ID NO. 10; the mutant pectin lyase provided by the invention has alkali resistance and wide application prospect in the fields of pulping, papermaking, spinning, feed and the like.

Description

Alkali-resistant pectin lyase and application thereof

Technical Field

The invention belongs to the field of bioengineering, and particularly relates to alkali-resistant pectin lyase and application thereof.

Background

Pectin is a polymer formed by connecting galacturonic acid through alpha-1, 4 glycosidic bonds, is a heteropolysaccharide, is weak acid and has strong heat resistance. Currently, pectin molecules are widely considered to include rhamnogalacturonan-I (RGI), rhamnogalacturonan-II (RGI), and polygalacturonan (HG) 3 types. Pectase is a group of enzymes which can synergistically decompose pectin, and can be classified into protopectase (protopectase), pectase (pectnester) and depolymerase (Depolymerizing enzymes) according to the action mode of the enzymes, and the depolymerase comprises hydrolase and lyase, and is widely existing in animals, plants and microorganisms.

Pectin lyase is a pectic enzyme that cleaves pectin polymers by trans-elimination. Pectin lyase cleaves pectin by cleaving the C-4 position of pectin and eliminating an H atom from C-5, producing an unsaturated product. Pectin lyase is classified into alkaline, neutral and acidic according to its tolerance to acid-base environments.

Chinese patent document CN113549608A (application number: 202110563930.8) discloses a pectin lyase mutant DeltaPelG 403, and a coding gene, a preparation method and application thereof. The 129 th amino acid of the flexible region of the delta PelG403 of the pectin lyase mutant is mutated from small molecular weight alanine to large molecular weight valine; the mutant enzyme provided by the invention has obviously improved enzyme activity and heat resistance under alkaline conditions, and solves the problems of low catalytic activity and insufficient thermal stability of wild pectin lyase under alkaline conditions. The site-directed mutagenesis referred to in this invention is different from the pectin lyase mutagenesis referred to in this invention.

In the prior art, in order to improve the heat resistance of a certain protein, researchers often add disulfide bonds to the gene structure of the protein, thereby improving the heat resistance. The introduction of disulfide bonds (Cys 108-Cys 152) at the corresponding positions of AoXyn11A by site-directed mutagenesis techniques is described in the chinese literature (Liu Xiaotong, minchen, et al, journal of food and biotechnology 2014, volume 33, 10) on the effect of disulfide bonds on improving the heat stability of xylan AoXyn11A, which study shows that disulfide bonds have an important effect on improving the heat stability of AoXyn 11A.

Disclosure of Invention

Aiming at the defects of the prior art, the invention provides a method for constructing alkali-resistant pectin lyase.

The inventor finds that the amino acid of the pectin lyase gene PGLA4 is mutated into cysteine respectively, so that disulfide bonds are formed, the thermal stability of the pectin lyase is not improved, and the stability of the modified pectin lyase PGLA4-C209-289 and the alkali resistance of the pectin lyase PGLA4-C10-182 is improved.

The technical scheme of the invention is as follows:

the nucleotide sequence of the mutant pectin lyase PGLA4-C209-289 coding gene is shown in SEQ ID NO. 1.

The amino acid sequence of the mutant pectin lyase PGLA4-C209-289 is shown in SEQ ID NO. 2.

A recombinant vector comprises the nucleotide sequence of the mutant pectin lyase PGLA4-C209-289 coding gene, and is shown in SEQ ID NO. 1.

A recombinant bacterium comprises the nucleotide sequence of the mutant pectin lyase PGLA4-C209-289 coding gene, and is shown in SEQ ID NO. 1.

A construction method of escherichia coli engineering bacteria containing mutant pectin lyase PGLA4-C209-289 genes comprises the following steps:

(1) Amplifying the synthesized pET-28a (+) -PGLA4 plasmid into a C209-289 gene fragment containing two mutation points by inverse PCR, wherein the nucleotide sequence of the gene fragment is shown as SEQ ID NO. 3;

(2) Amplifying pET-28a (+) -PGLA4 gene fragment by inverse PCR, the nucleotide sequence of which is shown as SEQ ID NO. 4;

(3) Carrying out seamless cloning connection on the C209-289 gene fragment prepared in the step (1) and the pET-28a (+) -PGLA4 gene fragment prepared in the step (2) to obtain a recombinant plasmid pET-28a (+) -PGLA4-C209-289;

(4) Preparing competent cells of the escherichia coli BL21 (DE 3), transforming the recombinant plasmid pET-28a (+) -PGLA4-C209-289 prepared in the step (3) into competent cells of the escherichia coli BL21 (DE 3), and screening positive clones to obtain the escherichia coli engineering bacteria containing the mutant pectin lyase PGLA 4-C209-289.

According to a preferred embodiment of the present invention, in the step (1), the inverse PCR amplification uses pET-28a (+) -PGLA4 plasmid as a template, and the nucleotide sequence of the amplification primer is as follows:

F1:CGCTTTGGTGAGGCACATATTTTCTGCAATTATTACGCA SEQ ID NO.5；

R1:GCATTAGCACGCACAACGTCCTTGCACTGATTGAC SEQ ID NO.6；

according to the present invention, in the step (1), the reaction system for PCR amplification is as follows, and the total system is 50. Mu.l:

the PCR amplification procedure was as follows:

pre-denaturation at 95℃for 3min; denaturation at 95℃for 15sec, annealing at 60℃for 15sec, elongation at 72℃for 15sec,30 cycles; extending at 72 ℃ for 5min, and preserving at 4 ℃.

Preferably, in the step (2), the inverse PCR amplification template is pET-28a (+) -PGLA4 plasmid; the nucleotide sequence of the amplification primer is as follows:

F2:GACGTTGTGCGTGCTAATGCAGGTGTAGGCGTCAT SEQ ID NO.7；

R2:ATATGTGCCTCACCAAAGCGAACAGACGGAACACGG SEQ ID NO.8；

according to the present invention, in the step (2), the reaction system for PCR amplification is as follows, and the total system is 50. Mu.l:

the PCR amplification procedure was as follows:

pre-denaturation at 95℃for 3min; denaturation at 95℃for 15sec, annealing at 60℃for 15sec, extension at 72℃for 3min,30 cycles; extending at 72 ℃ for 5min, and preserving at 4 ℃.

According to the invention, in the step (3), the seamless cloning PCR amplification system is preferably as follows, and the total system is 20. Mu.l:

the seamless cloning procedure was as follows:

reacting at 37deg.C for 30min, and preserving at 4deg.C;

according to a preferred embodiment of the present invention, in the step (4), the method for screening positive clones comprises: the transformed cells are coated on LB solid medium containing 50 mug/mL of kanamycin, cultured overnight at 37 ℃, single colony is selected and inoculated on LB liquid medium containing 50 mug/mL of kanamycin, cultured overnight at 37 ℃, positive clones of target gene bands are obtained through PCR verification, then sequencing is carried out, and the strain with correct sequencing result is reserved as target expression strain.

The nucleotide sequence of the coding gene of the mutant pectin lyase PGLA4-C10-182 is shown in SEQ ID NO. 9.

The amino acid sequence of the mutant pectin lyase PGLA4-C10-182 is shown in SEQ ID NO. 10.

A recombinant vector comprises the nucleotide sequence of the mutant pectin lyase PGLA4-C10-182 encoding gene shown in SEQ ID NO. 9.

A recombinant bacterium comprises the nucleotide sequence of the mutant pectin lyase PGLA4-C10-182 encoding gene, and is shown in SEQ ID NO. 9.

A construction method of escherichia coli engineering bacteria containing mutant pectin lyase PGLA4-C10-182 genes comprises the following steps:

(1) amplifying the synthesized pET-28a (+) -PGLA4 plasmid by inverse PCR to obtain C10-182 gene fragment containing two mutation points, wherein the nucleotide sequence of the fragment is shown as SEQ ID NO.11;

(2) amplifying pET-28a (+) -PGLA4 gene fragment by inverse PCR, the nucleotide sequence of which is shown as SEQ ID NO. 12;

(3) carrying out seamless cloning connection on the C10-182 gene fragment prepared in the step (1) and the pET-28a (+) -PGLA4 gene fragment prepared in the step (2) to obtain a recombinant plasmid pET-28a (+) -PGLA4-C10-182;

(4) preparing competent cells of escherichia coli BL21 (DE 3), converting the recombinant plasmid pET-28a (+) -PGLA4-C10-182 prepared in the step (3) into competent cells of escherichia coli BL21 (DE 3), and screening positive clones to obtain escherichia coli engineering bacteria containing mutant pectin lyase PGLA 4-C10-182.

According to a preferred embodiment of the present invention, in the step (1), the inverse PCR amplification uses pET-28a (+) -PGLA4 plasmid as a template, and the nucleotide sequence of the amplification primer is as follows:

F1-1:AACGTGAACTTTTCCATGCAAGGTUGCGCCACT SEQ ID NO.13；

R1-1:TCAGGTTCTCGAAATAGTTATTGTGGAAAGTGATGCAACGACCATA SEQ ID NO.14；

according to the present invention, in the step (1), the reaction system for PCR amplification is as follows, and the total system is 50. Mu.l:

the PCR amplification procedure was as follows:

pre-denaturation at 95℃for 3min; denaturation at 95℃for 15sec, annealing at 60℃for 15sec, elongation at 72℃for 20sec,30 cycles; extending at 72 ℃ for 5min, and preserving at 4 ℃.

Preferably, in the step (2), the inverse PCR amplification template is pET-28a (+) -PGLA4 plasmid; the nucleotide sequence of the amplification primer is as follows:

F1-2:ACTTTCCACAATAACTATTTCGAGAACCTGAACAGCCG SEQ ID NO.15；

R1-2:TTGCATGGAAAAGTTCACGTTCGCCATGGTATATCTC SEQ ID NO.16；

according to the present invention, in the step (2), the reaction system for PCR amplification is as follows, and the total system is 50. Mu.l:

the PCR amplification procedure was as follows:

pre-denaturation at 95℃for 3min; denaturation at 95℃for 15sec, annealing at 60℃for 15sec, extension at 72℃for 3min,30 cycles; extending at 72 ℃ for 5min, and preserving at 4 ℃.

According to the invention, in the step (3), the seamless clone PCR amplification system is as follows, and the total system is 20. Mu.l:

the seamless cloning procedure was as follows:

reacting at 37deg.C for 30min, and preserving at 4deg.C;

according to a preferred embodiment of the present invention, in the step (4), the method for screening positive clones comprises: the transformed cells are coated on LB solid medium containing 50 mug/mL of kanamycin, cultured overnight at 37 ℃, single colony is selected and inoculated on LB liquid medium containing 50 mug/mL of kanamycin, cultured overnight at 37 ℃, positive clones of target gene bands are obtained through PCR verification, then sequencing is carried out, and the strain with correct sequencing result is reserved as target expression strain.

The recombinant bacterium or the escherichia coli engineering bacterium prepared by the construction method is applied to the production of pectin lyase.

Advantageous effects

The mutant pectin lyase PGLA4-C209-289 and the mutant pectin lyase PGLA4-C10-182 provided by the invention have the advantages that the alkali resistance of the modified pectin lyase is improved, and the modified pectin lyase has wide application prospects in the fields of pulping, papermaking, spinning, feed and the like.

Drawings

FIG. 1 is a graph showing the results of enzyme activity detection under different pH values in example 4.

FIG. 2 is a graph showing the results of enzyme activity detection under different temperature conditions in example 4.

FIG. 3 is a graph showing the results of enzyme activity detection under different pH values in example 5.

FIG. 4 is a graph showing the results of enzyme activity detection under different temperature conditions in example 5.

FIG. 5 is a graph showing the results of enzyme activity detection under different pH values in comparative example 1.

FIG. 6 is a graph showing the results of enzyme activity detection under different temperature conditions in comparative example 1.

Detailed Description

The technical scheme of the present invention is further described below with reference to examples, but the scope of the present invention is not limited thereto.

All not described in detail in the examples are prior art.

Example 1

Construction of mutant pectin lyase PGLA4-C209-289 gene

(i) PCR amplification is carried out by taking DNA of pET-28a (+) -PGLA4 as a template to obtain a mutant gene fragment, and the nucleotide sequence of the mutant gene fragment is shown as SEQ ID NO. 3;

the PCR primer sequence is as follows:

F1:CGCTTTGGTGAGGCACATATTTTCTGCAATTATTACGCA SEQ ID NO.5；

R1:GCATTAGCACGCACAACGTCCTTGCACTGATTGAC SEQ ID NO.6；

the PCR amplification system is shown in Table 1:

TABLE 1

The PCR amplification procedure was as follows:

pre-denaturation at 95℃for 3min; denaturation at 95℃for 15sec, annealing at 60℃for 15sec, elongation at 72℃for 15sec,30 cycles; extending at 72 ℃ for 5min, and preserving at 4 ℃;

the PCR products were checked by agarose gel electrophoresis and were about 250bp in length, and gel recovery was performed using a SanPrep column type DNA gel recovery kit (Shanghai Biotechnology), and the recovered products were stored at-20℃for use.

(ii) PCR amplification is carried out by taking DNA of pET-28a (+) -PGLA4 as a template to obtain the rest unmutated fragments on the plasmid, and the nucleotide sequence of the rest unmutated fragments is shown as SEQ ID NO. 4;

the PCR primer sequence is as follows:

F2:GACGTTGTGCGTGCTAATGCAGGTGTAGGCGTCAT SEQ ID NO.7；

R2:ATATGTGCCTCACCAAAGCGAACAGACGGAACACGG SEQ ID NO.8；

the PCR amplification system is shown in Table 2:

TABLE 2

The PCR amplification procedure was as follows:

pre-denaturation at 95℃for 3min; denaturation at 95℃for 15sec, annealing at 60℃for 15sec, extension at 72℃for 3min,30 cycles; extending at 72 ℃ for 5min, and preserving at 4 ℃;

the PCR product was checked by agarose gel electrophoresis and had a length of about 5900bp, and was recovered using a SanPrep column type DNA gel recovery kit (Shanghai Biotechnology), and the recovered product was stored at-20℃for use.

(iii) Performing seamless cloning on the C209-289 fragment obtained in the step (i) and the pET-28a (+) -PGLA4 fragment obtained in the step (ii) to obtain pET-28a (+) -PGLA4-C209-289, wherein the gene sequence of pectin lyase PGLA4-C209-289 is shown as SEQ ID NO.1, and the amino acid sequence of the pectin lyase PGLA4-C209-289 is shown as SEQ ID NO. 2;

the amplification system of the seamless clone is shown in Table 3:

TABLE 3 Table 3

The seamless cloning procedure was as follows:

reacting at 37deg.C for 30min, and preserving at 4deg.C;

the PCR product was checked by agarose gel electrophoresis and was 6148bp in length, and gel recovery was performed using a SanPrep column type DNA gel recovery kit (Shanghai Biotechnology), and the recovered product was stored at-20℃for use.

Example 2

Preparation of E.coli competence

(i) E.coli (Escherichia coli) BL21 (DE 3) single colony is selected and inoculated into LB culture medium, and cultured overnight at 220r/min and 37 ℃;

(ii) Sucking 0.1mL of bacterial liquid into 10mL of LB culture medium, culturing at 300r/min and 37 ℃ until OD ₆₀₀ Reaching 0.6 to 0.8;

(iii) Aspiration of 1mLOD ₆₀₀ The bacterial liquid reaching 0.6 to 0.8 is added into a 1.5mL sterile centrifuge tube, and the solution is centrifuged for 2min at 12000r/min, and the supernatant is thoroughly removed;

(iv) 100 mu L of ice-precooled SSCS (a competent cell kit prepared rapidly by a one-step method and manufactured by Shanghai Bioengineering Co., ltd.) is added, and the cells are resuspended to prepare competent cells.

(v) The prepared competent cells were packed in 100. Mu.L each tube and stored at-80℃for further use.

Example 3

PGLA4-C209-289 Gene chemical conversion E.coli (Escherichia coli) BL21 (DE 3)

Firstly, measuring the concentration of PGLA4-C209-289 fragment by using a nucleic acid ultramicro spectrophotometer, carrying out chemical conversion after reaching the concentration of 300 mug/mL, resuscitating and culturing the obtained cells for 1h at 37 ℃ by using a resuscitating culture medium, taking 100 mug of the resuscitating and culturing on LB solid culture medium containing 50 mug/mL of kanamycin, culturing overnight at 37 ℃, and screening positive recombinant colonies with kanamycin resistance.

The liquid recovery medium comprises the following components per liter:

10g of peptone, 5g of yeast powder, 10g of sodium chloride, 91g of sorbitol, 69.4g of mannitol and the balance of water.

Cultivation and identification of positive recombinant bacteria

Picking the positive recombinant colony, inoculating into liquid LB culture medium containing 50 μg/mL of kanamycin resistance, culturing overnight at 37deg.C, extracting recombinant bacterial DNA using kit provided by Shanghai biological engineering Co., ltd, and using the obtained genome as template, F ₁ And R is ₂ Performing PCR amplification on the primers, and verifying amplification products by agarose gel electrophoresis;

the PCR primer sequence is as follows:

F1:CGCTTTGGTGAGGCACATATTTTCTGCAATTATTACGCA SEQ ID NO.5；

R2:ATATGTGCCTCACCAAAGCGAACAGACGGAACACGG SEQ ID NO.8；

the PCR amplification system was 20. Mu.l, see Table 4:

TABLE 4 Table 4

The PCR amplification procedure was as follows:

pre-denaturation at 95℃for 3min; denaturation at 95℃for 15sec, annealing at 60℃for 15sec, elongation at 72℃for 3.5min,30 cycles; extending at 72 ℃ for 5min, and preserving at 4 ℃;

PCR products were checked by agarose gel electrophoresis and the results showed that primer F was used ₁ And R is ₂ Can amplify a specific gene band with the size of about 6100bp and close to the theoretical value of 6148bp, which indicates that the carrier containing the target gene is successfully transferred into the cell of the escherichia coli to prepare the escherichia coli engineering bacteria of the mutant pectin lyase PGLA4-C209-289 gene.

Example 4

Example 3 preparation of E.coli engineering bacteria fermentation test containing pectin lyase PGLA4-C209-289 Gene

Inoculating the prepared Escherichia coli engineering bacteria containing pectin lyase PGLA4-C209-289 gene into 100mL LB culture medium (peptone 10g/L, yeast extract 5g/L, naCl 10g/L, balance water) and culturing at 37deg.C at 220rpm until fermentation broth OD ₆₀₀ 0.8, adding IPTG to induce for 12h, and sampling. Referring to the method for measuring the enzymatic activity of QB/T4482-2013 alkaline pectin lyase, after sample treatment, the optimal pH value of the pectin lyase in the fermentation broth is measured by an ultraviolet spectrophotometry (A235), after the sample is treated for 10min under the conditions of 55 ℃ and pH value of 8.5-12.0, 3ml of 0.03M phosphoric acid is added to terminate the reaction, and the absorbance value is measured at 235nm of the ultraviolet spectrophotometry, wherein the detection result is shown in figure 1. Determining the optimal temperature of pectin lyase in fermentation broth by ultraviolet spectrophotometry (A235 method), and measuring the optimal pH at 11.5 and 55-85deg.C (gradient of 5 deg.C)After 10min of treatment under the piece, 3ml of 0.03M phosphoric acid is added to stop the reaction, and the absorbance value is measured at 235nm of an ultraviolet spectrophotometer, and the detection result is shown in figure 2.

Compared with the original enzyme PGLA4 (with the optimal temperature of 70 ℃ and the optimal pH of 11), the recombinant PGLA4-C209-289 gene-containing escherichia coli engineering bacteria fermentation broth has the optimal pH of 11.5. And the alkali resistance of the recombined pectate lyase PGLA4-C209-289 is much better than that of the original enzyme PGLA4, the residual rate of the enzyme activity of the original enzyme PGLA4 is 80.63 percent after the recombined pectate lyase PGLA4-C209-289 is treated for 10min under the high alkaline condition of the pH value of 12 at the temperature of 55 ℃, and the residual rate of the enzyme activity of the recombined pectate lyase PGLA4-C209-289 is 93.26 percent. Although the optimum temperature is reduced to 65 ℃ (5 ℃ is reduced), the alkali resistance of the recombinant pectin lyase PGLA4-C209-289 is better than that of the pectin lyase reported before, and the heat resistance of the pectin lyase with the same alkali resistance is better.

Example 5

Construction of pectin lyase PGLA4-C10-182 gene and fermentation test

(i) Extracting pET-28a (+) -PGLA4 plasmid DNA of Escherichia coli BL21 (DE 3), taking the genome DNA as a template, and carrying out PCR amplification to obtain a mutant gene fragment, wherein the nucleotide sequence of the mutant gene fragment is shown as SEQ ID NO.11;

the PCR primer sequence is as follows:

F1-1:AACGTGAACTTTTCCATGCAAGGTTGCGCCACT SEQ ID NO.13；

R1-1:TCAGGTTCTCGAAATAGTTATTGTGGAAAGTGATGCAACGACCATASEQ ID NO.14；

the PCR amplification system is shown in Table 5:

TABLE 5

The PCR amplification procedure was as follows:

pre-denaturation at 95℃for 3min; denaturation at 95℃for 15sec, annealing at 60℃for 15sec, elongation at 72℃for 20sec,30 cycles; extending at 72deg.C for 10min, and preserving at 4deg.C;

the PCR products were checked by agarose gel electrophoresis and were about 500bp in length, and were recovered using a SanPrep column type DNA gel recovery kit (Shanghai Biotechnology), and the recovered products were stored at-20℃for further use.

(ii) Extracting pET-28a (+) -PGLA4 plasmid DNA of Escherichia coli BL21 (DE 3), taking the genome DNA as a template, and carrying out PCR amplification to obtain a vector gene fragment, wherein the nucleotide sequence of the vector gene fragment is shown as SEQ ID NO. 12;

the PCR primer sequence is as follows:

F2-1:ACTTTCCACAATAACTATTTCGAGAACCTGAACAGCCG SEQ ID NO.15；

R2-1:TTGCATGGAAAAGTTCACGTTCGCCATGGTATATCTC SEQ ID NO.16；

the PCR amplification system is shown in Table 6:

TABLE 6

The PCR amplification procedure was as follows:

pre-denaturation at 95℃for 3min; denaturation at 95℃for 15sec, annealing at 60℃for 15sec, extension at 72℃for 3min,30 cycles; extending at 72 ℃ for 5min, and preserving at 4 ℃;

the PCR product was checked by agarose gel electrophoresis and the length was about 6000bp, and gel recovery was performed using a SanPrep column type DNA gel recovery kit (Shanghai Biotechnology), and the recovered product was stored at-20℃for use.

(iii) Performing seamless cloning on the C10-182 fragment prepared in the step (i) and the pET-28a (+) -PGLA4-1 fragment prepared in the step (ii) to prepare a pET-28a (+) -PGLA4-C10-182 gene sequence; the nucleotide sequence of the pectin lyase PGLA4-C10-182 is shown as SEQ ID NO.9, and the amino acid sequence of the pectin lyase PGLA4-C10-182 is shown as SEQ ID NO. 10.

The amplification system of the seamless clone is shown in Table 7:

TABLE 7

The seamless cloning procedure was as follows:

reacting at 37deg.C for 30min, and preserving at 4deg.C;

the PCR product was checked by agarose gel electrophoresis and was 6148bp in length, and gel recovery was performed using a SanPrep column type DNA gel recovery kit (Shanghai Biotechnology), and the recovered product was stored at-20℃for use.

Referring to the method of example 3, an E.coli engineering bacterium containing the alkali-resistant pectin lyase PGLA4-C10-182 gene was prepared, and the prepared E.coli engineering bacterium containing the alkali-resistant pectin lyase PGLA4-C10-182 gene was inoculated into 100mL of LB medium (peptone 10g/L, yeast extract 5g/L, naCl 10 g/L) and cultured at 220rpm at 37℃to give a fermentation broth OD ₆₀₀ 0.8, adding IPTG to induce for 12h, and sampling. Referring to the method for measuring the enzymatic activity of the alkaline pectin lyase by QB/T4482-2013, after sample treatment, the optimal pH value of the pectin lyase in the fermentation broth is measured by an ultraviolet spectrophotometry (A235), after the sample is treated for 10min under the conditions of 55 ℃ and pH value of 8.0-12.0, 3ml of 0.03M phosphoric acid is added to terminate the reaction, and the absorbance value is measured at 235nm of the ultraviolet spectrophotometry, and the detection result is shown in figure 3. The optimal temperature of pectin lyase in the fermentation broth is determined by ultraviolet spectrophotometry (A235 method), after the fermentation broth is treated for 10min under the conditions of pH11.5 and temperature of 55-85 ℃ (gradient is 5 ℃), 3ml of 0.03M phosphoric acid is added to terminate the reaction, and the absorbance value is determined at 235nm of the ultraviolet spectrophotometer, and the detection result is shown in figure 4.

Compared with the original enzyme PGLA4 (with the optimal temperature of 70 ℃ and the optimal pH of 11), the recombinant PGLA4-C10-182 gene-containing escherichia coli engineering bacteria fermentation broth has the optimal pH of 11.5, the optimal temperature of 60 ℃ and the heat resistance of 10 ℃ lower than that of the original enzyme PGLA 4. After 10min of treatment at 55deg.C under high alkaline condition with pH12, the enzyme activity residual rate of the original pectin lyase PGLA4 is 80.63%, and the enzyme activity residual rate of the recombined pectin lyase PGLA4-C10-182 is 85.62%.

Comparative example 1

Construction of recombinant PGLA4-C259-286 gene and fermentation test

(i) Extracting pET-28a (+) -PGLA4 plasmid DNA of Escherichia coli BL21 (DE 3), and carrying out PCR amplification by taking the genome DNA as a template to obtain a mutant gene fragment;

the PCR primer sequence is as follows:

F1-2:TTACTGGCACCTGGTTAATAACTGCTACGTTTCCT SEQ ID NO.17；

R1-2:CGCACAACGTCCTTAACCTGATTGCACGGG SEQ ID NO.18；

the PCR amplification system is shown in Table 8:

TABLE 8

The PCR amplification procedure was as follows:

pre-denaturation at 95℃for 3min; denaturation at 95℃for 15sec, annealing at 60℃for 15sec, elongation at 72℃for 10sec,30 cycles; extending at 72 ℃ for 5min, and preserving at 4 ℃;

the PCR products were checked by agarose gel electrophoresis and were about 100bp in length, and gel recovery was performed using a SanPrep column type DNA gel recovery kit (Shanghai Biotechnology), and the recovered products were stored at-20℃for use.

(ii) Extracting pET-28a (+) -PGLA4 plasmid DNA of Escherichia coli BL21 (DE 3), and carrying out PCR amplification by taking the genome DNA as a template to obtain a vector gene fragment;

the PCR primer sequence is as follows:

F2-2:AATCAGGTTAAGGACGTTGTGCGTGCTAATGCAGGTGT SEQ ID NO.19；

R2-2:TATTAACCAGGTGCCAGTAACCAATTTCTTTTGAATCGCGG SEQ ID NO.20；

the PCR amplification system is shown in Table 9:

TABLE 9

The PCR amplification procedure was as follows:

pre-denaturation at 95℃for 3min; denaturation at 95℃for 15sec, annealing at 60℃for 15sec, elongation at 72℃for 3.3min,30 cycles; extending at 72 ℃ for 5min, and preserving at 4 ℃;

the PCR product was checked by agarose gel electrophoresis and the length was about 6000bp, and gel recovery was performed using a SanPrep column type DNA gel recovery kit (Shanghai Biotechnology), and the recovered product was stored at-20℃for use.

(iii) Performing seamless cloning on the C259-286 fragment prepared in the step (i) and the pET-28a (+) -PGLA4-2 fragment prepared in the step (ii) to prepare a pET-28a (+) -PGLA4-C259-286 gene sequence, wherein the nucleotide sequence of the pET-28a (+) -PGLA4-C259-286 gene sequence is shown as SEQ ID NO. 21;

the amplification system of the seamless clone is shown in Table 10:

table 10

The seamless cloning procedure was as follows:

reacting at 37deg.C for 30min, and preserving at 4deg.C;

the PCR product was checked by agarose gel electrophoresis and was 6148bp in length, and gel recovery was performed using a SanPrep column type DNA gel recovery kit (Shanghai Biotechnology), and the recovered product was stored at-20℃for use.

Referring to the method of example 3, an E.coli engineering bacterium containing the alkali-resistant pectin lyase PGLA4-C259-286 gene was prepared, and the prepared E.coli engineering bacterium containing the alkali-resistant pectin lyase PGLA4-C259-286 gene was inoculated into 100mL of LB medium (peptone 10g/L, yeast extract 5g/L, naCl 10 g/L) and cultured at 220rpm 37℃to give a fermentation broth OD ₆₀₀ 0.8, adding IPTG to induce for 12h, sampling, referring to the method for measuring the enzyme activity of QB/T4482-2013 alkaline pectin lyase, measuring the optimal pH value of pectin lyase in fermentation liquor by an ultraviolet spectrophotometry (A235) method after sample treatment, respectively treating for 10min at 55 ℃ and pH value of 8.0-12.0, adding 3ml of 0.03M phosphoric acid to terminate the reaction, and measuring the absorbance value at 235nm of an ultraviolet spectrophotometer, wherein the detection result is shown in figure 5. Determination of fermentation by UV spectrophotometry (A235 method)After the pectin lyase in the solution is treated for 10min under the conditions of pH11.5 and temperature of 55-85 ℃ (gradient of 5 ℃), 3ml of 0.03M phosphoric acid is added to terminate the reaction, and the absorbance value is measured at 235nm of an ultraviolet spectrophotometer, and the detection result is shown in figure 6.

Compared with the original enzyme PGLA4 (with the optimal temperature of 70 ℃ and the optimal pH of 11), the recombinant PGLA4-C10-182 gene-containing escherichia coli engineering bacteria fermentation broth has the optimal pH of 11.0, the optimal temperature of 65 ℃ and the heat resistance of 5 ℃ lower than that of the original enzyme PGLA 4. And after 10min of treatment at 55 ℃ and pH12 under high alkaline conditions, the residual rate of the enzyme activity of the original pectin lyase PGLA4 is 80.63%, and the residual rate of the enzyme activity of the recombined pectin lyase PGLA4-C259-286 is 84.81%.

In summary, PGLA4-C209-289 of example 4 was obtained by mutating serine and valine at positions 209 and 286 of pectin lyase PGLA4 to cysteine, thereby forming disulfide bonds.

In example 5 PGLA4-C10-182, phenylalanine and lysine at positions 10 and 182 of pectin lyase PGLA4 were mutated to cysteine to form disulfide bonds.

In comparative example 1 PGLA4-C259-286 were selected from pectin lyase PGLA4 with mutations of arginine and valine at positions 259 and 286 to cysteine; thereby forming disulfide bonds.

The enzymatic properties corresponding to the original enzyme and the three mutant enzymes are shown in Table 11:

TABLE 11

Comparison of the mutant enzyme of the present invention with the mutant enzyme of comparative example 1 shows that the improvement of heat resistance and alkali resistance has no direct relation with the position of disulfide bond substitution. The modified pectin lyase PGLA4-C209-289 and pectin lyase PGLA4-C10-182 have improved alkali resistance stability, and have wide application prospects in the fields of pulping, papermaking, spinning, feed and the like.

SEQUENCE LISTING

<110> Qilu university of industry

<120> alkali-resistant pectin lyase and application thereof

<160> 21

<170> PatentIn version 3.5

<210> 1

<211> 912

<212> DNA

<213> artificial sequence

<400> 1

gcgaacgtga acttttccat gcaaggtttt gccactctca atggcggtac cacaggcggt 60

gcggggggtc agacggtaac cgtaacaacg ggagatcagc tgattgcggc attaaaaaat 120

aagaatgcaa atacgccttt aaaaatctat atcgatggta ccatcacccc agctaatacc 180

agcgcgtcga agatcgatat caaagatgtc aatgatgtta gcttgctggg cgttggtacg 240

aacggtgagt tgaacggtat tggcattaag gtgtggcgtg cgaacaacgt tatcatccgt 300

aatctgaaga ttcatcatgt aaacacgggt gataaagacg cgatctccat tgaaggtccg 360

tcgaagaaca tctgggttga tcacaacgag ctgtataatt cgctggacgt gcacaaagac 420

tactatgatg gcctgttcga cgtgaaaaga gatgcagact acatcacgtt cagctggaat 480

tacgtgcacg attcttggaa aagcatgctg atgggtagtt ccgacagcga tagctatggt 540

cgtaaaatca ctttccacaa taactatttc gagaacctga acagccgtgt tccgtctgtt 600

cgctttggtg aggcacatat tttctgcaat tattacgcag acatccgcga aaccggcatc 660

aactctcgta tgggtgcaca ggttcgcatt gaggagaact acttcgaacg cgcgaacaac 720

ccgattgtta gccgcgattc aaaagaaatt ggttactggc acctggttaa taaccgttac 780

gtttcctcca ccggtgagca accgaccgtt tccaccacca cgtataatcc gccgtacagc 840

taccaagcga ccccggtcaa tcagtgcaag gacgttgtgc gtgctaatgc aggtgtaggc 900

gtcatctcgc cg 912

<210> 2

<211> 304

<212> PRT

<213> artificial sequence

<400> 2

Ala Asn Val Asn Phe Ser Met Gln Gly Phe Ala Thr Leu Asn Gly Gly

1 5 10 15

Thr Thr Gly Gly Ala Gly Gly Gln Thr Val Thr Val Thr Thr Gly Asp

20 25 30

Gln Leu Ile Ala Ala Leu Lys Asn Lys Asn Ala Asn Thr Pro Leu Lys

35 40 45

Ile Tyr Ile Asp Gly Thr Ile Thr Pro Ala Asn Thr Ser Ala Ser Lys

50 55 60

Ile Asp Ile Lys Asp Val Asn Asp Val Ser Leu Leu Gly Val Gly Thr

65 70 75 80

Asn Gly Glu Leu Asn Gly Ile Gly Ile Lys Val Trp Arg Ala Asn Asn

85 90 95

Val Ile Ile Arg Asn Leu Lys Ile His His Val Asn Thr Gly Asp Lys

100 105 110

Asp Ala Ile Ser Ile Glu Gly Pro Ser Lys Asn Ile Trp Val Asp His

115 120 125

Asn Glu Leu Tyr Asn Ser Leu Asp Val His Lys Asp Tyr Tyr Asp Gly

130 135 140

Leu Phe Asp Val Lys Arg Asp Ala Asp Tyr Ile Thr Phe Ser Trp Asn

145 150 155 160

Tyr Val His Asp Ser Trp Lys Ser Met Leu Met Gly Ser Ser Asp Ser

165 170 175

Asp Ser Tyr Gly Arg Lys Ile Thr Phe His Asn Asn Tyr Phe Glu Asn

180 185 190

Leu Asn Ser Arg Val Pro Ser Val Arg Phe Gly Glu Ala His Ile Phe

195 200 205

Cys Asn Tyr Tyr Ala Asp Ile Arg Glu Thr Gly Ile Asn Ser Arg Met

210 215 220

Gly Ala Gln Val Arg Ile Glu Glu Asn Tyr Phe Glu Arg Ala Asn Asn

225 230 235 240

Pro Ile Val Ser Arg Asp Ser Lys Glu Ile Gly Tyr Trp His Leu Val

245 250 255

Asn Asn Arg Tyr Val Ser Ser Thr Gly Glu Gln Pro Thr Val Ser Thr

260 265 270

Thr Thr Tyr Asn Pro Pro Tyr Ser Tyr Gln Ala Thr Pro Val Asn Gln

275 280 285

Cys Lys Asp Val Val Arg Ala Asn Ala Gly Val Gly Val Ile Ser Pro

290 295 300

<210> 3

<211> 252

<212> DNA

<213> artificial sequence

<400> 3

attttctgca attattacgc agacatccgc gaaaccggca tcaactctcg tatgggtgca 60

caggttcgca ttgaggagaa ctacttcgaa cgcgcgaaca acccgattgt tagccgcgat 120

tcaaaagaaa ttggttactg gcacctggtt aataaccgtt acgtttcctc caccggtgag 180

caaccgaccg tttccaccac cacgtataat ccgccgtaca gctaccaagc gaccccggtc 240

aatcagtgca ag 252

<210> 4

<211> 5896

<212> DNA

<213> artificial sequence

<400> 4

gacgttgtgc gtgctaatgc aggtgtaggc gtcatctcgc cgctcgagca ccaccaccac 60

caccactgag atccggctgc taacaaagcc cgaaaggaag ctgagttggc tgctgccacc 120

gctgagcaat aactagcata accccttggg gcctctaaac gggtcttgag gggttttttg 180

ctgaaaggag gaactatatc cggattggcg aatgggacgc gccctgtagc ggcgcattaa 240

gcgcggcggg tgtggtggtt acgcgcagcg tgaccgctac acttgccagc gccctagcgc 300

ccgctccttt cgctttcttc ccttcctttc tcgccacgtt cgccggcttt ccccgtcaag 360

ctctaaatcg ggggctccct ttagggttcc gatttagtgc tttacggcac ctcgacccca 420

aaaaacttga ttagggtgat ggttcacgta gtgggccatc gccctgatag acggtttttc 480

gccctttgac gttggagtcc acgttcttta atagtggact cttgttccaa actggaacaa 540

cactcaaccc tatctcggtc tattcttttg atttataagg gattttgccg atttcggcct 600

attggttaaa aaatgagctg atttaacaaa aatttaacgc gaattttaac aaaatattaa 660

cgtttacaat ttcaggtggc acttttcggg gaaatgtgcg cggaacccct atttgtttat 720

ttttctaaat acattcaaat atgtatccgc tcatgaatta attcttagaa aaactcatcg 780

agcatcaaat gaaactgcaa tttattcata tcaggattat caataccata tttttgaaaa 840

agccgtttct gtaatgaagg agaaaactca ccgaggcagt tccataggat ggcaagatcc 900

tggtatcggt ctgcgattcc gactcgtcca acatcaatac aacctattaa tttcccctcg 960

tcaaaaataa ggttatcaag tgagaaatca ccatgagtga cgactgaatc cggtgagaat 1020

ggcaaaagtt tatgcatttc tttccagact tgttcaacag gccagccatt acgctcgtca 1080

tcaaaatcac tcgcatcaac caaaccgtta ttcattcgtg attgcgcctg agcgagacga 1140

aatacgcgat cgctgttaaa aggacaatta caaacaggaa tcgaatgcaa ccggcgcagg 1200

aacactgcca gcgcatcaac aatattttca cctgaatcag gatattcttc taatacctgg 1260

aatgctgttt tcccggggat cgcagtggtg agtaaccatg catcatcagg agtacggata 1320

aaatgcttga tggtcggaag aggcataaat tccgtcagcc agtttagtct gaccatctca 1380

tctgtaacat cattggcaac gctacctttg ccatgtttca gaaacaactc tggcgcatcg 1440

ggcttcccat acaatcgata gattgtcgca cctgattgcc cgacattatc gcgagcccat 1500

ttatacccat ataaatcagc atccatgttg gaatttaatc gcggcctaga gcaagacgtt 1560

tcccgttgaa tatggctcat aacacccctt gtattactgt ttatgtaagc agacagtttt 1620

attgttcatg accaaaatcc cttaacgtga gttttcgttc cactgagcgt cagaccccgt 1680

agaaaagatc aaaggatctt cttgagatcc tttttttctg cgcgtaatct gctgcttgca 1740

aacaaaaaaa ccaccgctac cagcggtggt ttgtttgccg gatcaagagc taccaactct 1800

ttttccgaag gtaactggct tcagcagagc gcagatacca aatactgtcc ttctagtgta 1860

gccgtagtta ggccaccact tcaagaactc tgtagcaccg cctacatacc tcgctctgct 1920

aatcctgtta ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg ggttggactc 1980

aagacgatag ttaccggata aggcgcagcg gtcgggctga acggggggtt cgtgcacaca 2040

gcccagcttg gagcgaacga cctacaccga actgagatac ctacagcgtg agctatgaga 2100

aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg gcagggtcgg 2160

aacaggagag cgcacgaggg agcttccagg gggaaacgcc tggtatcttt atagtcctgt 2220

cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag gggggcggag 2280

cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt gctggccttt 2340

tgctcacatg ttctttcctg cgttatcccc tgattctgtg gataaccgta ttaccgcctt 2400

tgagtgagct gataccgctc gccgcagccg aacgaccgag cgcagcgagt cagtgagcga 2460

ggaagcggaa gagcgcctga tgcggtattt tctccttacg catctgtgcg gtatttcaca 2520

ccgcatatat ggtgcactct cagtacaatc tgctctgatg ccgcatagtt aagccagtat 2580

acactccgct atcgctacgt gactgggtca tggctgcgcc ccgacacccg ccaacacccg 2640

ctgacgcgcc ctgacgggct tgtctgctcc cggcatccgc ttacagacaa gctgtgaccg 2700

tctccgggag ctgcatgtgt cagaggtttt caccgtcatc accgaaacgc gcgaggcagc 2760

tgcggtaaag ctcatcagcg tggtcgtgaa gcgattcaca gatgtctgcc tgttcatccg 2820

cgtccagctc gttgagtttc tccagaagcg ttaatgtctg gcttctgata aagcgggcca 2880

tgttaagggc ggttttttcc tgtttggtca ctgatgcctc cgtgtaaggg ggatttctgt 2940

tcatgggggt aatgataccg atgaaacgag agaggatgct cacgatacgg gttactgatg 3000

atgaacatgc ccggttactg gaacgttgtg agggtaaaca actggcggta tggatgcggc 3060

gggaccagag aaaaatcact cagggtcaat gccagcgctt cgttaataca gatgtaggtg 3120

ttccacaggg tagccagcag catcctgcga tgcagatccg gaacataatg gtgcagggcg 3180

ctgacttccg cgtttccaga ctttacgaaa cacggaaacc gaagaccatt catgttgttg 3240

ctcaggtcgc agacgttttg cagcagcagt cgcttcacgt tcgctcgcgt atcggtgatt 3300

cattctgcta accagtaagg caaccccgcc agcctagccg ggtcctcaac gacaggagca 3360

cgatcatgcg cacccgtggg gccgccatgc cggcgataat ggcctgcttc tcgccgaaac 3420

gtttggtggc gggaccagtg acgaaggctt gagcgagggc gtgcaagatt ccgaataccg 3480

caagcgacag gccgatcatc gtcgcgctcc agcgaaagcg gtcctcgccg aaaatgaccc 3540

agagcgctgc cggcacctgt cctacgagtt gcatgataaa gaagacagtc ataagtgcgg 3600

cgacgatagt catgccccgc gcccaccgga aggagctgac tgggttgaag gctctcaagg 3660

gcatcggtcg agatcccggt gcctaatgag tgagctaact tacattaatt gcgttgcgct 3720

cactgcccgc tttccagtcg ggaaacctgt cgtgccagct gcattaatga atcggccaac 3780

gcgcggggag aggcggtttg cgtattgggc gccagggtgg tttttctttt caccagtgag 3840

acgggcaaca gctgattgcc cttcaccgcc tggccctgag agagttgcag caagcggtcc 3900

acgctggttt gccccagcag gcgaaaatcc tgtttgatgg tggttaacgg cgggatataa 3960

catgagctgt cttcggtatc gtcgtatccc actaccgaga tatccgcacc aacgcgcagc 4020

ccggactcgg taatggcgcg cattgcgccc agcgccatct gatcgttggc aaccagcatc 4080

gcagtgggaa cgatgccctc attcagcatt tgcatggttt gttgaaaacc ggacatggca 4140

ctccagtcgc cttcccgttc cgctatcggc tgaatttgat tgcgagtgag atatttatgc 4200

cagccagcca gacgcagacg cgccgagaca gaacttaatg ggcccgctaa cagcgcgatt 4260

tgctggtgac ccaatgcgac cagatgctcc acgcccagtc gcgtaccgtc ttcatgggag 4320

aaaataatac tgttgatggg tgtctggtca gagacatcaa gaaataacgc cggaacatta 4380

gtgcaggcag cttccacagc aatggcatcc tggtcatcca gcggatagtt aatgatcagc 4440

ccactgacgc gttgcgcgag aagattgtgc accgccgctt tacaggcttc gacgccgctt 4500

cgttctacca tcgacaccac cacgctggca cccagttgat cggcgcgaga tttaatcgcc 4560

gcgacaattt gcgacggcgc gtgcagggcc agactggagg tggcaacgcc aatcagcaac 4620

gactgtttgc ccgccagttg ttgtgccacg cggttgggaa tgtaattcag ctccgccatc 4680

gccgcttcca ctttttcccg cgttttcgca gaaacgtggc tggcctggtt caccacgcgg 4740

gaaacggtct gataagagac accggcatac tctgcgacat cgtataacgt tactggtttc 4800

acattcacca ccctgaattg actctcttcc gggcgctatc atgccatacc gcgaaaggtt 4860

ttgcgccatt cgatggtgtc cgggatctcg acgctctccc ttatgcgact cctgcattag 4920

gaagcagccc agtagtaggt tgaggccgtt gagcaccgcc gccgcaagga atggtgcatg 4980

caaggagatg gcgcccaaca gtcccccggc cacggggcct gccaccatac ccacgccgaa 5040

acaagcgctc atgagcccga agtggcgagc ccgatcttcc ccatcggtga tgtcggcgat 5100

ataggcgcca gcaaccgcac ctgtggcgcc ggtgatgccg gccacgatgc gtccggcgta 5160

gaggatcgag atctcgatcc cgcgaaatta atacgactca ctatagggga attgtgagcg 5220

gataacaatt cccctctaga aataattttg tttaacttta agaaggagat ataccatggc 5280

gaacgtgaac ttttccatgc aaggttttgc cactctcaat ggcggtacca caggcggtgc 5340

ggggggtcag acggtaaccg taacaacggg agatcagctg attgcggcat taaaaaataa 5400

gaatgcaaat acgcctttaa aaatctatat cgatggtacc atcaccccag ctaataccag 5460

cgcgtcgaag atcgatatca aagatgtcaa tgatgttagc ttgctgggcg ttggtacgaa 5520

cggtgagttg aacggtattg gcattaaggt gtggcgtgcg aacaacgtta tcatccgtaa 5580

tctgaagatt catcatgtaa acacgggtga taaagacgcg atctccattg aaggtccgtc 5640

gaagaacatc tgggttgatc acaacgagct gtataattcg ctggacgtgc acaaagacta 5700

ctatgatggc ctgttcgacg tgaaaagaga tgcagactac atcacgttca gctggaatta 5760

cgtgcacgat tcttggaaaa gcatgctgat gggtagttcc gacagcgata gctatggtcg 5820

taaaatcact ttccacaata actatttcga gaacctgaac agccgtgttc cgtctgttcg 5880

ctttggtgag gcacat 5896

<210> 5

<211> 39

<212> DNA

<213> artificial sequence

<400> 5

cgctttggtg aggcacatat tttctgcaat tattacgca 39

<210> 6

<211> 35

<212> DNA

<213> artificial sequence

<400> 6

gcattagcac gcacaacgtc cttgcactga ttgac 35

<210> 7

<211> 35

<212> DNA

<213> artificial sequence

<400> 7

gacgttgtgc gtgctaatgc aggtgtaggc gtcat 35

<210> 8

<211> 36

<212> DNA

<213> artificial sequence

<400> 8

atatgtgcct caccaaagcg aacagacgga acacgg 36

<210> 9

<211> 912

<212> DNA

<213> artificial sequence

<400> 9

gcgaacgtga acttttccat gcaaggttgc gccactctca atggcggtac cacaggcggt 60

gcggggggtc agacggtaac cgtaacaacg ggagatcagc tgattgcggc attaaaaaat 120

aagaatgcaa atacgccttt aaaaatctat atcgatggta ccatcacccc agctaatacc 180

agcgcgtcga agatcgatat caaagatgtc aatgatgtta gcttgctggg cgttggtacg 240

aacggtgagt tgaacggtat tggcattaag gtgtggcgtg cgaacaacgt tatcatccgt 300

aatctgaaga ttcatcatgt aaacacgggt gataaagacg cgatctccat tgaaggtccg 360

tcgaagaaca tctgggttga tcacaacgag ctgtataatt cgctggacgt gcacaaagac 420

tactatgatg gcctgttcga cgtgaaaaga gatgcagact acatcacgtt cagctggaat 480

tacgtgcacg attcttggaa aagcatgctg atgggtagtt ccgacagcga tagctatggt 540

cgttgcatca ctttccacaa taactatttc gagaacctga acagccgtgt tccgtctgtt 600

cgctttggtg aggcacatat tttcagcaat tattacgcag acatccgcga aaccggcatc 660

aactctcgta tgggtgcaca ggttcgcatt gaggagaact acttcgaacg cgcgaacaac 720

ccgattgtta gccgcgattc aaaagaaatt ggttactggc acctggttaa taaccgttac 780

gtttcctcca ccggtgagca accgaccgtt tccaccacca cgtataatcc gccgtacagc 840

taccaagcga ccccggtcaa tcaggttaag gacgttgtgc gtgctaatgc aggtgtaggc 900

gtcatctcgc cg 912

<210> 10

<211> 304

<212> PRT

<213> artificial sequence

<400> 10

Ala Asn Val Asn Phe Ser Met Gln Gly Cys Ala Thr Leu Asn Gly Gly

1 5 10 15

Thr Thr Gly Gly Ala Gly Gly Gln Thr Val Thr Val Thr Thr Gly Asp

20 25 30

Gln Leu Ile Ala Ala Leu Lys Asn Lys Asn Ala Asn Thr Pro Leu Lys

35 40 45

Ile Tyr Ile Asp Gly Thr Ile Thr Pro Ala Asn Thr Ser Ala Ser Lys

50 55 60

Ile Asp Ile Lys Asp Val Asn Asp Val Ser Leu Leu Gly Val Gly Thr

65 70 75 80

Asn Gly Glu Leu Asn Gly Ile Gly Ile Lys Val Trp Arg Ala Asn Asn

85 90 95

Val Ile Ile Arg Asn Leu Lys Ile His His Val Asn Thr Gly Asp Lys

100 105 110

Asp Ala Ile Ser Ile Glu Gly Pro Ser Lys Asn Ile Trp Val Asp His

115 120 125

Asn Glu Leu Tyr Asn Ser Leu Asp Val His Lys Asp Tyr Tyr Asp Gly

130 135 140

Leu Phe Asp Val Lys Arg Asp Ala Asp Tyr Ile Thr Phe Ser Trp Asn

145 150 155 160

Tyr Val His Asp Ser Trp Lys Ser Met Leu Met Gly Ser Ser Asp Ser

165 170 175

Asp Ser Tyr Gly Arg Cys Ile Thr Phe His Asn Asn Tyr Phe Glu Asn

180 185 190

Leu Asn Ser Arg Val Pro Ser Val Arg Phe Gly Glu Ala His Ile Phe

195 200 205

Ser Asn Tyr Tyr Ala Asp Ile Arg Glu Thr Gly Ile Asn Ser Arg Met

210 215 220

Gly Ala Gln Val Arg Ile Glu Glu Asn Tyr Phe Glu Arg Ala Asn Asn

225 230 235 240

Pro Ile Val Ser Arg Asp Ser Lys Glu Ile Gly Tyr Trp His Leu Val

245 250 255

Asn Asn Arg Tyr Val Ser Ser Thr Gly Glu Gln Pro Thr Val Ser Thr

260 265 270

Thr Thr Tyr Asn Pro Pro Tyr Ser Tyr Gln Ala Thr Pro Val Asn Gln

275 280 285

Val Lys Asp Val Val Arg Ala Asn Ala Gly Val Gly Val Ile Ser Pro

290 295 300

<210> 11

<211> 546

<212> DNA

<213> artificial sequence

<400> 11

atgcaaggtt gcgccactct caatggcggt accacaggcg gtgcgggggg tcagacggta 60

accgtaacaa cgggagatca gctgattgcg gcattaaaaa ataagaatgc aaatacgcct 120

ttaaaaatct atatcgatgg taccatcacc ccagctaata ccagcgcgtc gaagatcgat 180

atcaaagatg tcaatgatgt tagcttgctg ggcgttggta cgaacggtga gttgaacggt 240

attggcatta aggtgtggcg tgcgaacaac gttatcatcc gtaatctgaa gattcatcat 300

gtaaacacgg gtgataaaga cgcgatctcc attgaaggtc cgtcgaagaa catctgggtt 360

gatcacaacg agctgtataa ttcgctggac gtgcacaaag actactatga tggcctgttc 420

gacgtgaaaa gagatgcaga ctacatcacg ttcagctgga attacgtgca cgattcttgg 480

aaaagcatgc tgatgggtag ttccgacagc gatagctatg gtcgttgcat cactttccac 540

aataac 546

<210> 12

<211> 5602

<212> DNA

<213> artificial sequence

<400> 12

tatttcgaga acctgaacag ccgtgttccg tctgttcgct ttggtgaggc acatattttc 60

agcaattatt acgcagacat ccgcgaaacc ggcatcaact ctcgtatggg tgcacaggtt 120

cgcattgagg agaactactt cgaacgcgcg aacaacccga ttgttagccg cgattcaaaa 180

gaaattggtt actggcacct ggttaataac cgttacgttt cctccaccgg tgagcaaccg 240

accgtttcca ccaccacgta taatccgccg tacagctacc aagcgacccc ggtcaatcag 300

gttaaggacg ttgtgcgtgc taatgcaggt gtaggcgtca tctcgccgct cgagcaccac 360

caccaccacc actgagatcc ggctgctaac aaagcccgaa aggaagctga gttggctgct 420

gccaccgctg agcaataact agcataaccc cttggggcct ctaaacgggt cttgaggggt 480

tttttgctga aaggaggaac tatatccgga ttggcgaatg ggacgcgccc tgtagcggcg 540

cattaagcgc ggcgggtgtg gtggttacgc gcagcgtgac cgctacactt gccagcgccc 600

tagcgcccgc tcctttcgct ttcttccctt cctttctcgc cacgttcgcc ggctttcccc 660

gtcaagctct aaatcggggg ctccctttag ggttccgatt tagtgcttta cggcacctcg 720

accccaaaaa acttgattag ggtgatggtt cacgtagtgg gccatcgccc tgatagacgg 780

tttttcgccc tttgacgttg gagtccacgt tctttaatag tggactcttg ttccaaactg 840

gaacaacact caaccctatc tcggtctatt cttttgattt ataagggatt ttgccgattt 900

cggcctattg gttaaaaaat gagctgattt aacaaaaatt taacgcgaat tttaacaaaa 960

tattaacgtt tacaatttca ggtggcactt ttcggggaaa tgtgcgcgga acccctattt 1020

gtttattttt ctaaatacat tcaaatatgt atccgctcat gaattaattc ttagaaaaac 1080

tcatcgagca tcaaatgaaa ctgcaattta ttcatatcag gattatcaat accatatttt 1140

tgaaaaagcc gtttctgtaa tgaaggagaa aactcaccga ggcagttcca taggatggca 1200

agatcctggt atcggtctgc gattccgact cgtccaacat caatacaacc tattaatttc 1260

ccctcgtcaa aaataaggtt atcaagtgag aaatcaccat gagtgacgac tgaatccggt 1320

gagaatggca aaagtttatg catttctttc cagacttgtt caacaggcca gccattacgc 1380

tcgtcatcaa aatcactcgc atcaaccaaa ccgttattca ttcgtgattg cgcctgagcg 1440

agacgaaata cgcgatcgct gttaaaagga caattacaaa caggaatcga atgcaaccgg 1500

cgcaggaaca ctgccagcgc atcaacaata ttttcacctg aatcaggata ttcttctaat 1560

acctggaatg ctgttttccc ggggatcgca gtggtgagta accatgcatc atcaggagta 1620

cggataaaat gcttgatggt cggaagaggc ataaattccg tcagccagtt tagtctgacc 1680

atctcatctg taacatcatt ggcaacgcta cctttgccat gtttcagaaa caactctggc 1740

gcatcgggct tcccatacaa tcgatagatt gtcgcacctg attgcccgac attatcgcga 1800

gcccatttat acccatataa atcagcatcc atgttggaat ttaatcgcgg cctagagcaa 1860

gacgtttccc gttgaatatg gctcataaca ccccttgtat tactgtttat gtaagcagac 1920

agttttattg ttcatgacca aaatccctta acgtgagttt tcgttccact gagcgtcaga 1980

ccccgtagaa aagatcaaag gatcttcttg agatcctttt tttctgcgcg taatctgctg 2040

cttgcaaaca aaaaaaccac cgctaccagc ggtggtttgt ttgccggatc aagagctacc 2100

aactcttttt ccgaaggtaa ctggcttcag cagagcgcag ataccaaata ctgtccttct 2160

agtgtagccg tagttaggcc accacttcaa gaactctgta gcaccgccta catacctcgc 2220

tctgctaatc ctgttaccag tggctgctgc cagtggcgat aagtcgtgtc ttaccgggtt 2280

ggactcaaga cgatagttac cggataaggc gcagcggtcg ggctgaacgg ggggttcgtg 2340

cacacagccc agcttggagc gaacgaccta caccgaactg agatacctac agcgtgagct 2400

atgagaaagc gccacgcttc ccgaagggag aaaggcggac aggtatccgg taagcggcag 2460

ggtcggaaca ggagagcgca cgagggagct tccaggggga aacgcctggt atctttatag 2520

tcctgtcggg tttcgccacc tctgacttga gcgtcgattt ttgtgatgct cgtcaggggg 2580

gcggagccta tggaaaaacg ccagcaacgc ggccttttta cggttcctgg ccttttgctg 2640

gccttttgct cacatgttct ttcctgcgtt atcccctgat tctgtggata accgtattac 2700

cgcctttgag tgagctgata ccgctcgccg cagccgaacg accgagcgca gcgagtcagt 2760

gagcgaggaa gcggaagagc gcctgatgcg gtattttctc cttacgcatc tgtgcggtat 2820

ttcacaccgc atatatggtg cactctcagt acaatctgct ctgatgccgc atagttaagc 2880

cagtatacac tccgctatcg ctacgtgact gggtcatggc tgcgccccga cacccgccaa 2940

cacccgctga cgcgccctga cgggcttgtc tgctcccggc atccgcttac agacaagctg 3000

tgaccgtctc cgggagctgc atgtgtcaga ggttttcacc gtcatcaccg aaacgcgcga 3060

ggcagctgcg gtaaagctca tcagcgtggt cgtgaagcga ttcacagatg tctgcctgtt 3120

catccgcgtc cagctcgttg agtttctcca gaagcgttaa tgtctggctt ctgataaagc 3180

gggccatgtt aagggcggtt ttttcctgtt tggtcactga tgcctccgtg taagggggat 3240

ttctgttcat gggggtaatg ataccgatga aacgagagag gatgctcacg atacgggtta 3300

ctgatgatga acatgcccgg ttactggaac gttgtgaggg taaacaactg gcggtatgga 3360

tgcggcggga ccagagaaaa atcactcagg gtcaatgcca gcgcttcgtt aatacagatg 3420

taggtgttcc acagggtagc cagcagcatc ctgcgatgca gatccggaac ataatggtgc 3480

agggcgctga cttccgcgtt tccagacttt acgaaacacg gaaaccgaag accattcatg 3540

ttgttgctca ggtcgcagac gttttgcagc agcagtcgct tcacgttcgc tcgcgtatcg 3600

gtgattcatt ctgctaacca gtaaggcaac cccgccagcc tagccgggtc ctcaacgaca 3660

ggagcacgat catgcgcacc cgtggggccg ccatgccggc gataatggcc tgcttctcgc 3720

cgaaacgttt ggtggcggga ccagtgacga aggcttgagc gagggcgtgc aagattccga 3780

ataccgcaag cgacaggccg atcatcgtcg cgctccagcg aaagcggtcc tcgccgaaaa 3840

tgacccagag cgctgccggc acctgtccta cgagttgcat gataaagaag acagtcataa 3900

gtgcggcgac gatagtcatg ccccgcgccc accggaagga gctgactggg ttgaaggctc 3960

tcaagggcat cggtcgagat cccggtgcct aatgagtgag ctaacttaca ttaattgcgt 4020

tgcgctcact gcccgctttc cagtcgggaa acctgtcgtg ccagctgcat taatgaatcg 4080

gccaacgcgc ggggagaggc ggtttgcgta ttgggcgcca gggtggtttt tcttttcacc 4140

agtgagacgg gcaacagctg attgcccttc accgcctggc cctgagagag ttgcagcaag 4200

cggtccacgc tggtttgccc cagcaggcga aaatcctgtt tgatggtggt taacggcggg 4260

atataacatg agctgtcttc ggtatcgtcg tatcccacta ccgagatatc cgcaccaacg 4320

cgcagcccgg actcggtaat ggcgcgcatt gcgcccagcg ccatctgatc gttggcaacc 4380

agcatcgcag tgggaacgat gccctcattc agcatttgca tggtttgttg aaaaccggac 4440

atggcactcc agtcgccttc ccgttccgct atcggctgaa tttgattgcg agtgagatat 4500

ttatgccagc cagccagacg cagacgcgcc gagacagaac ttaatgggcc cgctaacagc 4560

gcgatttgct ggtgacccaa tgcgaccaga tgctccacgc ccagtcgcgt accgtcttca 4620

tgggagaaaa taatactgtt gatgggtgtc tggtcagaga catcaagaaa taacgccgga 4680

acattagtgc aggcagcttc cacagcaatg gcatcctggt catccagcgg atagttaatg 4740

atcagcccac tgacgcgttg cgcgagaaga ttgtgcaccg ccgctttaca ggcttcgacg 4800

ccgcttcgtt ctaccatcga caccaccacg ctggcaccca gttgatcggc gcgagattta 4860

atcgccgcga caatttgcga cggcgcgtgc agggccagac tggaggtggc aacgccaatc 4920

agcaacgact gtttgcccgc cagttgttgt gccacgcggt tgggaatgta attcagctcc 4980

gccatcgccg cttccacttt ttcccgcgtt ttcgcagaaa cgtggctggc ctggttcacc 5040

acgcgggaaa cggtctgata agagacaccg gcatactctg cgacatcgta taacgttact 5100

ggtttcacat tcaccaccct gaattgactc tcttccgggc gctatcatgc cataccgcga 5160

aaggttttgc gccattcgat ggtgtccggg atctcgacgc tctcccttat gcgactcctg 5220

cattaggaag cagcccagta gtaggttgag gccgttgagc accgccgccg caaggaatgg 5280

tgcatgcaag gagatggcgc ccaacagtcc cccggccacg gggcctgcca ccatacccac 5340

gccgaaacaa gcgctcatga gcccgaagtg gcgagcccga tcttccccat cggtgatgtc 5400

ggcgatatag gcgccagcaa ccgcacctgt ggcgccggtg atgccggcca cgatgcgtcc 5460

ggcgtagagg atcgagatct cgatcccgcg aaattaatac gactcactat aggggaattg 5520

tgagcggata acaattcccc tctagaaata attttgttta actttaagaa ggagatatac 5580

catggcgaac gtgaactttt cc 5602

<210> 13

<211> 33

<212> DNA

<213> artificial sequence

<400> 13

aacgtgaact tttccatgca aggttgcgcc act 33

<210> 14

<211> 46

<212> DNA

<213> artificial sequence

<400> 14

tcaggttctc gaaatagtta ttgtggaaag tgatgcaacg accata 46

<210> 15

<211> 38

<212> DNA

<213> artificial sequence

<400> 15

actttccaca ataactattt cgagaacctg aacagccg 38

<210> 16

<211> 37

<212> DNA

<213> artificial sequence

<400> 16

ttgcatggaa aagttcacgt tcgccatggt atatctc 37

<210> 17

<211> 35

<212> DNA

<213> artificial sequence

<400> 17

ttactggcac ctggttaata actgctacgt ttcct 35

<210> 18

<211> 30

<212> DNA

<213> artificial sequence

<400> 18

cgcacaacgt ccttaacctg attgcacggg 30

<210> 19

<211> 38

<212> DNA

<213> artificial sequence

<400> 19

aatcaggtta aggacgttgt gcgtgctaat gcaggtgt 38

<210> 20

<211> 41

<212> DNA

<213> artificial sequence

<400> 20

tattaaccag gtgccagtaa ccaatttctt ttgaatcgcg g 41

<210> 21

<211> 6148

<212> DNA

<213> artificial sequence

<400> 21

tggcgaatgg gacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg 60

cagcgtgacc gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc 120

ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg 180

gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgattagg gtgatggttc 240

acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt 300

ctttaatagt ggactcttgt tccaaactgg aacaacactc aaccctatct cggtctattc 360

ttttgattta taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta 420

acaaaaattt aacgcgaatt ttaacaaaat attaacgttt acaatttcag gtggcacttt 480

tcggggaaat gtgcgcggaa cccctatttg tttatttttc taaatacatt caaatatgta 540

tccgctcatg aattaattct tagaaaaact catcgagcat caaatgaaac tgcaatttat 600

tcatatcagg attatcaata ccatattttt gaaaaagccg tttctgtaat gaaggagaaa 660

actcaccgag gcagttccat aggatggcaa gatcctggta tcggtctgcg attccgactc 720

gtccaacatc aatacaacct attaatttcc cctcgtcaaa aataaggtta tcaagtgaga 780

aatcaccatg agtgacgact gaatccggtg agaatggcaa aagtttatgc atttctttcc 840

agacttgttc aacaggccag ccattacgct cgtcatcaaa atcactcgca tcaaccaaac 900

cgttattcat tcgtgattgc gcctgagcga gacgaaatac gcgatcgctg ttaaaaggac 960

aattacaaac aggaatcgaa tgcaaccggc gcaggaacac tgccagcgca tcaacaatat 1020

tttcacctga atcaggatat tcttctaata cctggaatgc tgttttcccg gggatcgcag 1080

tggtgagtaa ccatgcatca tcaggagtac ggataaaatg cttgatggtc ggaagaggca 1140

taaattccgt cagccagttt agtctgacca tctcatctgt aacatcattg gcaacgctac 1200

ctttgccatg tttcagaaac aactctggcg catcgggctt cccatacaat cgatagattg 1260

tcgcacctga ttgcccgaca ttatcgcgag cccatttata cccatataaa tcagcatcca 1320

tgttggaatt taatcgcggc ctagagcaag acgtttcccg ttgaatatgg ctcataacac 1380

cccttgtatt actgtttatg taagcagaca gttttattgt tcatgaccaa aatcccttaa 1440

cgtgagtttt cgttccactg agcgtcagac cccgtagaaa agatcaaagg atcttcttga 1500

gatccttttt ttctgcgcgt aatctgctgc ttgcaaacaa aaaaaccacc gctaccagcg 1560

gtggtttgtt tgccggatca agagctacca actctttttc cgaaggtaac tggcttcagc 1620

agagcgcaga taccaaatac tgtccttcta gtgtagccgt agttaggcca ccacttcaag 1680

aactctgtag caccgcctac atacctcgct ctgctaatcc tgttaccagt ggctgctgcc 1740

agtggcgata agtcgtgtct taccgggttg gactcaagac gatagttacc ggataaggcg 1800

cagcggtcgg gctgaacggg gggttcgtgc acacagccca gcttggagcg aacgacctac 1860

accgaactga gatacctaca gcgtgagcta tgagaaagcg ccacgcttcc cgaagggaga 1920

aaggcggaca ggtatccggt aagcggcagg gtcggaacag gagagcgcac gagggagctt 1980

ccagggggaa acgcctggta tctttatagt cctgtcgggt ttcgccacct ctgacttgag 2040

cgtcgatttt tgtgatgctc gtcagggggg cggagcctat ggaaaaacgc cagcaacgcg 2100

gcctttttac ggttcctggc cttttgctgg ccttttgctc acatgttctt tcctgcgtta 2160

tcccctgatt ctgtggataa ccgtattacc gcctttgagt gagctgatac cgctcgccgc 2220

agccgaacga ccgagcgcag cgagtcagtg agcgaggaag cggaagagcg cctgatgcgg 2280

tattttctcc ttacgcatct gtgcggtatt tcacaccgca tatatggtgc actctcagta 2340

caatctgctc tgatgccgca tagttaagcc agtatacact ccgctatcgc tacgtgactg 2400

ggtcatggct gcgccccgac acccgccaac acccgctgac gcgccctgac gggcttgtct 2460

gctcccggca tccgcttaca gacaagctgt gaccgtctcc gggagctgca tgtgtcagag 2520

gttttcaccg tcatcaccga aacgcgcgag gcagctgcgg taaagctcat cagcgtggtc 2580

gtgaagcgat tcacagatgt ctgcctgttc atccgcgtcc agctcgttga gtttctccag 2640

aagcgttaat gtctggcttc tgataaagcg ggccatgtta agggcggttt tttcctgttt 2700

ggtcactgat gcctccgtgt aagggggatt tctgttcatg ggggtaatga taccgatgaa 2760

acgagagagg atgctcacga tacgggttac tgatgatgaa catgcccggt tactggaacg 2820

ttgtgagggt aaacaactgg cggtatggat gcggcgggac cagagaaaaa tcactcaggg 2880

tcaatgccag cgcttcgtta atacagatgt aggtgttcca cagggtagcc agcagcatcc 2940

tgcgatgcag atccggaaca taatggtgca gggcgctgac ttccgcgttt ccagacttta 3000

cgaaacacgg aaaccgaaga ccattcatgt tgttgctcag gtcgcagacg ttttgcagca 3060

gcagtcgctt cacgttcgct cgcgtatcgg tgattcattc tgctaaccag taaggcaacc 3120

ccgccagcct agccgggtcc tcaacgacag gagcacgatc atgcgcaccc gtggggccgc 3180

catgccggcg ataatggcct gcttctcgcc gaaacgtttg gtggcgggac cagtgacgaa 3240

ggcttgagcg agggcgtgca agattccgaa taccgcaagc gacaggccga tcatcgtcgc 3300

gctccagcga aagcggtcct cgccgaaaat gacccagagc gctgccggca cctgtcctac 3360

gagttgcatg ataaagaaga cagtcataag tgcggcgacg atagtcatgc cccgcgccca 3420

ccggaaggag ctgactgggt tgaaggctct caagggcatc ggtcgagatc ccggtgccta 3480

atgagtgagc taacttacat taattgcgtt gcgctcactg cccgctttcc agtcgggaaa 3540

cctgtcgtgc cagctgcatt aatgaatcgg ccaacgcgcg gggagaggcg gtttgcgtat 3600

tgggcgccag ggtggttttt cttttcacca gtgagacggg caacagctga ttgcccttca 3660

ccgcctggcc ctgagagagt tgcagcaagc ggtccacgct ggtttgcccc agcaggcgaa 3720

aatcctgttt gatggtggtt aacggcggga tataacatga gctgtcttcg gtatcgtcgt 3780

atcccactac cgagatatcc gcaccaacgc gcagcccgga ctcggtaatg gcgcgcattg 3840

cgcccagcgc catctgatcg ttggcaacca gcatcgcagt gggaacgatg ccctcattca 3900

gcatttgcat ggtttgttga aaaccggaca tggcactcca gtcgccttcc cgttccgcta 3960

tcggctgaat ttgattgcga gtgagatatt tatgccagcc agccagacgc agacgcgccg 4020

agacagaact taatgggccc gctaacagcg cgatttgctg gtgacccaat gcgaccagat 4080

gctccacgcc cagtcgcgta ccgtcttcat gggagaaaat aatactgttg atgggtgtct 4140

ggtcagagac atcaagaaat aacgccggaa cattagtgca ggcagcttcc acagcaatgg 4200

catcctggtc atccagcgga tagttaatga tcagcccact gacgcgttgc gcgagaagat 4260

tgtgcaccgc cgctttacag gcttcgacgc cgcttcgttc taccatcgac accaccacgc 4320

tggcacccag ttgatcggcg cgagatttaa tcgccgcgac aatttgcgac ggcgcgtgca 4380

gggccagact ggaggtggca acgccaatca gcaacgactg tttgcccgcc agttgttgtg 4440

ccacgcggtt gggaatgtaa ttcagctccg ccatcgccgc ttccactttt tcccgcgttt 4500

tcgcagaaac gtggctggcc tggttcacca cgcgggaaac ggtctgataa gagacaccgg 4560

catactctgc gacatcgtat aacgttactg gtttcacatt caccaccctg aattgactct 4620

cttccgggcg ctatcatgcc ataccgcgaa aggttttgcg ccattcgatg gtgtccggga 4680

tctcgacgct ctcccttatg cgactcctgc attaggaagc agcccagtag taggttgagg 4740

ccgttgagca ccgccgccgc aaggaatggt gcatgcaagg agatggcgcc caacagtccc 4800

ccggccacgg ggcctgccac catacccacg ccgaaacaag cgctcatgag cccgaagtgg 4860

cgagcccgat cttccccatc ggtgatgtcg gcgatatagg cgccagcaac cgcacctgtg 4920

gcgccggtga tgccggccac gatgcgtccg gcgtagagga tcgagatctc gatcccgcga 4980

aattaatacg actcactata ggggaattgt gagcggataa caattcccct ctagaaataa 5040

ttttgtttaa ctttaagaag gagatatacc atggcgaacg tgaacttttc catgcaaggt 5100

tttgccactc tcaatggcgg taccacaggc ggtgcggggg gtcagacggt aaccgtaaca 5160

acgggagatc agctgattgc ggcattaaaa aataagaatg caaatacgcc tttaaaaatc 5220

tatatcgatg gtaccatcac cccagctaat accagcgcgt cgaagatcga tatcaaagat 5280

gtcaatgatg ttagcttgct gggcgttggt acgaacggtg agttgaacgg tattggcatt 5340

aaggtgtggc gtgcgaacaa cgttatcatc cgtaatctga agattcatca tgtaaacacg 5400

ggtgataaag acgcgatctc cattgaaggt ccgtcgaaga acatctgggt tgatcacaac 5460

gagctgtata attcgctgga cgtgcacaaa gactactatg atggcctgtt cgacgtgaaa 5520

agagatgcag actacatcac gttcagctgg aattacgtgc acgattcttg gaaaagcatg 5580

ctgatgggta gttccgacag cgatagctat ggtcgtaaaa tcactttcca caataactat 5640

ttcgagaacc tgaacagccg tgttccgtct gttcgctttg gtgaggcaca tattttcagc 5700

aattattacg cagacatccg cgaaaccggc atcaactctc gtatgggtgc acaggttcgc 5760

attgaggaga actacttcga acgcgcgaac aacccgattg ttagccgcga ttcaaaagaa 5820

attggttact ggcacctggt taataactgc tacgtttcct ccaccggtga gcaaccgacc 5880

gtttccacca ccacgtataa tccgccgtac agctaccaag cgaccccgtg caatcaggtt 5940

aaggacgttg tgcgtgctaa tgcaggtgta ggcgtcatct cgccgctcga gcaccaccac 6000

caccaccact gagatccggc tgctaacaaa gcccgaaagg aagctgagtt ggctgctgcc 6060

accgctgagc aataactagc ataacccctt ggggcctcta aacgggtctt gaggggtttt 6120

ttgctgaaag gaggaactat atccggat 6148

Claims (23)

1. Mutant pectin lyasePGLA4-C209-289The nucleotide sequence of the coding gene is shown as SEQ ID NO. 1.

2. Mutant pectin lyasePGLA4-C209-289The amino acid sequence is shown as SEQ ID NO. 2.

3. A recombinant vector comprising the mutant pectin lyase according to claim 1PGLA4-C209-289A coding gene.

4. A recombinant bacterium comprising the mutant pectin lyase according to claim 1PGLA4-C209-289A coding gene.

5. Mutant pectin lyasePGLA4-C10-182The nucleotide sequence of the coding gene is shown as SEQ ID NO. 9.

6. Mutant pectin lyasePGLA4-C10-182The amino acid sequence is shown as SEQ ID NO. 10.

7. A recombinant vector comprising the mutant pectin lyase according to claim 5PGLA4-C10-182A coding gene.

8. A recombinant bacterium comprising the mutant pectin lyase according to claim 5PGLA4-C10-182A coding gene.

9. A mutant pectin lyase comprising the mutant pectin lyase of claim 1PGLA4-C209-289The construction method of the escherichia coli engineering bacteria of the coding genes comprises the following steps:

(1) Synthetic pET-28a (+)PGLA4Plasmid amplification by inverse PCR containing two mutation pointsC209-289The nucleotide sequence of the gene fragment is shown as SEQ ID NO. 3;

(2) pET-28a (+)'s amplification by inverse PCRPGLA4The nucleotide sequence of the gene fragment is shown as SEQ ID NO. 4;

(3) The step (1) of preparingC209-289Gene fragment and pET-28a (+)'s prepared in step (2)PGLA4The gene fragment is subjected to seamless cloning connection to obtain recombinant plasmid pET-28a (+)PGLA4-C209-289；

(4) Preparing competent cells of escherichia coli BL21 (DE 3), and preparing recombinant plasmid pET-28a (+) (prepared in the step (3))PGLA4-C209-289Competent cells transformed into E.coli BL21 (DE 3) and positive clones were selected.

10. The method of claim 9, wherein in step (1), the inverse PCR is performed with pET-28a (+)PGLA4The plasmid is used as a template, the amplification primers are F1 and R1 respectively, and the nucleotide sequences of the amplification primers are SEQ ID NO. 5 and SEQ ID NO. 6 respectively.

11. The construction method according to claim 10, wherein in the step (1), the reaction system for PCR amplification is as follows, and the total system is 50. Mu.l:

2×Phanta Max Master Mix25μl

F110μmol/L2μl

R110μmol/L2μl

template 2 μl

dd H ₂ O19μl；

The PCR amplification procedure was as follows:

pre-denaturation at 95℃for 3min; denaturation at 95℃for 15sec, annealing at 60℃for 15sec, elongation at 72℃for 15sec,30 cycles; extending at 72 ℃ for 5min, and preserving at 4 ℃.

12. The method of claim 9, wherein in step (2), the inverse PCR amplification template is pET-28a (+)PGLA4A plasmid; the amplification primers are F2 and R2 respectively, and the nucleotide sequences of the amplification primers are SEQ ID NO. 7 and SEQ ID NO. 8 respectively.

13. The construction method according to claim 12, wherein in the step (2), the reaction system for PCR amplification is as follows, and the total system is 50. Mu.l:

2×Phanta Max Master Mix25μl

F210μmol/L2μl

R210μmol/L2μl

template 2 μl

dd H ₂ O19μl；

The PCR amplification procedure was as follows:

pre-denaturation at 95℃for 3min; denaturation at 95℃for 15sec, annealing at 60℃for 15sec, extension at 72℃for 3min,30 cycles; extending at 72 ℃ for 5min, and preserving at 4 ℃.

14. The construction method according to claim 9, wherein in the step (3), the seamless cloning PCR amplification system is as follows, and the total system is 20. Mu.l:

pET-28a(+)-PGLA41μl

C209-2891μl

5 × CE II Buffer4μl

Exnase II2μl

dd H ₂ O12μl

the seamless cloning procedure was as follows:

the reaction was carried out at 37℃for 30min and stored at 4 ℃.

15. The method of claim 9, wherein in step (4), the method of screening positive clones comprises: the transformed cells are coated on LB solid medium containing 50 mug/mL of kanamycin, cultured overnight at 37 ℃, single colony is selected and inoculated on LB liquid medium containing 50 mug/mL of kanamycin, cultured overnight at 37 ℃, then positive clones of target gene strips are obtained through PCR verification, then sequencing is carried out, and the strain with correct sequencing result is reserved as target expression strain.

16. A mutant pectin lyase comprising the mutant pectin lyase of claim 5PGLA4-C10-182The construction method of the escherichia coli engineering bacteria of the coding genes is characterized by comprising the following steps:

(1) synthetic pET-28a (+)PGLA4Plasmid amplification by inverse PCR containing two mutation pointsC10-182The nucleotide sequence of the gene fragment is shown as SEQ ID NO.11;

(2) pET-28a (+)'s amplification by inverse PCRPGLA4The nucleotide sequence of the gene fragment is shown as SEQ ID NO. 12;

(3) the step (1) of preparingC10-182Gene fragment and pET-28a (+)'s prepared in step (2)PGLA4The gene fragment is subjected to seamless cloning connection to obtain recombinant plasmid pET-28a (+)PGLA4-C10-182；

(4) Preparing competent cells of escherichia coli BL21 (DE 3), and preparing recombinant plasmid pET-28a (+) (prepared in the step (3))PGLA4- C10-182Transforming into competent cells of Escherichia coli BL21 (DE 3), and screening positive clones to obtain pectin lyase containing mutationPGLA4-C10-182E.coli engineering bacteria.

17. The method of claim 16, wherein in step (1), the inverse PCR is performed with pET-28a (+)PGLA4The plasmid is used as a template, the amplification primers are F1-1 and R1-1 respectively, and the nucleotide sequences of the amplification primers are SEQ ID NO. 13 and SEQ ID NO. 14 respectively.

18. The construction method according to claim 17, wherein in the step (1), the reaction system for PCR amplification is as follows, and the total system is 50. Mu.l:

2×Phanta Max Master Mix25μl

F1-110μmol/L2μl

R1-110μmol/L2μl

template 2 μl

dd H ₂ O19μl；

The PCR amplification procedure was as follows:

pre-denaturation at 95℃for 3min; denaturation at 95℃for 15sec, annealing at 60℃for 15sec, elongation at 72℃for 20sec,30 cycles; extending at 72 ℃ for 5min, and preserving at 4 ℃.

19. The method of claim 16, wherein in step (2), the inverse PCR amplification template is pET-28a (+)PGLA4A plasmid; the amplification primers are F1-2 and R1-2 respectively, and the nucleotide sequences of the amplification primers are SEQ ID NO. 15 and SEQ ID NO. 16 respectively.

20. The construction method according to claim 19, wherein in the step (2), the reaction system for PCR amplification is as follows, and the total system is 50. Mu.l:

2×Phanta Max Master Mix25μl

F1-210μmol/L2μl

R1-210μmol/L2μl

template 2 μl

dd H ₂ O19μl；

The PCR amplification procedure was as follows:

pre-denaturation at 95℃for 3min; denaturation at 95℃for 15sec, annealing at 60℃for 15sec, extension at 72℃for 3min,30 cycles; extending at 72 ℃ for 5min, and preserving at 4 ℃.

21. The method of claim 16, wherein in step (3), the seamless clonal PCR amplification system is 20. Mu.l:

pET-28a(+)-PGLA41μl

C10-1821μl

5 × CE II Buffer4μl

Exnase II2μl

dd H ₂ O12μl

the seamless cloning procedure was as follows:

the reaction was carried out at 37℃for 30min and stored at 4 ℃.

22. The method of claim 16, wherein in step (4), the method of screening positive clones comprises: the transformed cells are coated on LB solid medium containing 50 mug/mL of kanamycin, cultured overnight at 37 ℃, single colony is selected and inoculated on LB liquid medium containing 50 mug/mL of kanamycin, cultured overnight at 37 ℃, then positive clones of target gene strips are obtained through PCR verification, then sequencing is carried out, and the strain with correct sequencing result is reserved as target expression strain.

23. Use of the recombinant bacterium of claim 4, the recombinant bacterium of claim 8, the escherichia coli engineering bacterium prepared by the construction method of claim 9 or the escherichia coli engineering bacterium prepared by the construction method of claim 16 in the production of pectin lyase.

Images